Molecular Endocrinology, doi:10.1210/me.2003-0117
Molecular Endocrinology 18 (2): 350-358
Copyright © 2004 by The Endocrine Society
Negative Regulation of Insulin-Stimulated Mitogen-Activated Protein Kinase Signaling By Grb10
Paul Langlais,
Lily Q. Dong,
Fresnida J. Ramos,
Derong Hu,
Yunhua Li,
Michael J. Quon and
Feng Liu
Department of Biochemistry (P.L., F.L.), Department of Cellular & Structural Biology (L.Q.D.), and Department of Pharmacology (F.J.R., D.H., F.L.), The University of Texas Health Science Center, San Antonio, Texas 78229; and Diabetes Unit, National Center for Complementary and Alternative Medicine (M.J.Q., Y.L.), National Institutes of Health, Bethesda, Maryland 20892-1755
Address all correspondence and requests for reprints to: Feng Liu, Department of Pharmacology, University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, Texas 78229. E-mail: liuf{at}uthscsa.edu.
 |
ABSTRACT
|
|---|
Grb10 is a Pleckstrin homology and Src homology 2 (SH2) domain-containing protein that binds to the tyrosine-phosphorylated insulin receptor in response to insulin stimulation. Loss of Grb10 function in mice results in fetal and placental overgrowth; however, the molecular mechanism remains unknown. In the present study, we show that overexpression of Grb10 in Chinese hamster ovary cells expressing the insulin receptor or in 3T3-L1 adipocytes reduced insulin-stimulated phosphorylation of MAPK. Overexpression of Grb10 in rat primary adipocytes also inhibited insulin-stimulated phosphorylation of the MAPK downstream substrate Elk1. To determine the mechanism by which Grb10 inhibited insulin-stimulated MAPK signaling, we examined whether Grb10 affects the phosphorylation of MAPK upstream signaling components. We found that overexpression of Grb10 inhibited the insulin-stimulated phosphorylation of Shc, a positive regulator of the MAPK signaling pathway. The inhibitory effect was diminished when the SH2 domain of Grb10 was deleted. The negative role of Grb10 in insulin signaling was established by suppression of endogenous Grb10 by RNA interference in HeLa cells overexpressing the insulin receptor, which enhanced insulin-stimulated phosphorylation of MAPK, Shc, and Akt. Taken together, our findings suggest that Grb10 functions as a negative regulator in the insulin-stimulated MAPK signaling pathway. In addition, the inhibitory effect of Grb10 on the MAPK pathway is most likely due to a direct block of insulin-stimulated Shc tyrosine phosphorylation.
 |
INTRODUCTION
|
|---|
THE BINDING OF insulin to its receptor on the cell membrane results in receptor tyrosine kinase activation, leading to receptor trans-autophosphorylation at several crucial sites required to initiate further downstream signaling events such as activation of the phosphatidylinositol 3'-kinase (PI 3-kinase) pathway, the Cbl-CAP pathway, and the MAPK pathway (1, 2). Autophosphorylation of Tyr960 in the juxtamembrane region of the insulin receptor (IR) creates an NPXpY recognition sequence that functions to recruit phosphotyrosine binding (PTB) domain-containing proteins such as Shc (3). In addition to Tyr960, autophosphorylation also occurs at Tyr1322, creating a pYXXM motif, which has been shown to bind to the Src homology 2 (SH2) domain of Shc (3, 4). Once Shc associates with the IR, it is phosphorylated on tyrosine residues, thus creating a docking site for the SH2 domain of Grb2. Grb2 recruits the guanine nucleotide exchange factor protein, Sos, resulting in a Sos-mediated conversion of the membrane-bound protein Ras from the inactive GDP bound form to the active GTP bound form. Activated Ras then associates with and activates Raf-1, leading to the phosphorylation and activation of MAPK/ERK kinase (MEK) and its downstream substrate MAPK. Activated MAPK phosphorylates a variety of substrates, including Elk-1, and mediates nuclear events that regulate cell growth and differentiation (for a review see Ref. 5).
In addition to Shc, the IR also interacts with several other proteins, in particular, the pleckstrin homology (PH)- and SH2 domain-containing protein Grb10 (6, 7, 8, 9, 10). Through the SH2 domain and a novel domain located between the PH and SH2 domains known as the BPS (between the PH and SH2) domain, Grb10 binds to the autophosphorylated tyrosine residues within the kinase domain of the IR upon insulin stimulation (7, 9, 11, 12, 13, 14, 15).
The functional roles of Grb10 in insulin signaling remain controversial. Overexpression of full-length mouse Grb10 has been found to either have no effect (16) or positively regulate insulin-mediated mitogenic and metabolic effects (17, 18). On the other hand, stable expression of the PH domain-truncated human Grb10 isoform in Chinese hamster ovary (CHO)/IR cells reduced insulin-stimulated tyrosine phosphorylation of insulin receptor substrate 1 (IRS-1) and inhibited insulin-stimulated activation of PI 3-kinase (6). Overexpression of full-length human Grb10 inhibits insulin-stimulated tyrosine phosphorylation of the 60-kDa GTPase-activating protein-associated protein p62dok (19) and IRS-1 (15) in CHO/IR cells and 3T3-L1 adipocytes. Overexpression of human Grb10 has also been found to decrease insulin-stimulated glycogen synthase activity and glycogen synthesis in primary hepatocytes, albeit without affecting insulin-induced IRS1/2 phosphorylation, PI 3-kinase activation, and ERK1/2 MAPK activity (20). Very recently, it has been shown that disrupting Grb10 function by targeted deletion of the Grb10 gene leads to overgrowth of mice, suggesting that endogenous Grb10 acts as a negative regulator of growth (21).
In this study, we investigated the effect of Grb10 on insulin-stimulated MAPK activation. We found that overexpression of Grb10 in CHO/IR cells, 3T3-L1 adipocytes, and rat primary adipocytes inhibits insulin-stimulated MAPK and Shc phosphorylation. The inhibitory effect of Grb10 was diminished when the SH2 domain of the protein was deleted, suggesting that binding of Grb10 to the IR is necessary for the inhibition. Suppression of Grb10 expression by RNA interference (RNAi) enhanced basal and insulin-stimulated phosphorylation of MAPK and Shc, suggesting that endogenous Grb10 plays a negative role in the MAPK signaling pathway. Because phosphorylation of Shc and MAPK is essential for insulin-stimulated mitogenic events, our results suggest a potential molecular mechanism by which disruption of Grb10 function leads to overgrowth in knockout mice (21).
 |
RESULTS
|
|---|
Grb10 Inhibits MAPK Phosphorylation in CHO/IR Cells and 3T3-L1 Adipocytes
To investigate the potential effect of Grb10 on insulin-stimulated activation of the MAPK signaling pathway, we transiently expressed myc-tagged p42 MAPK in CHO/IR cells either alone or together with human Grb10. Significant phosphorylation of MAPK was observed within 5 min of insulin stimulation (Fig. 1A
, upper panel, lanes 1 and 2). Overexpression of Grb10 inhibited insulin-stimulated MAPK phosphorylation (Fig. 1A
, upper panel, lane 2 vs. lane 4). We also tested whether adenoviral-mediated overexpression of Grb10 inhibits insulin-stimulated activation of endogenous MAPK in 3T3-L1 adipocytes, a cell line that is physiologically relevant to insulin signaling. We found that insulin treatment led to a significant phosphorylation of endogenous p44/p42 MAPK within 5 min, which was inhibited by overexpression of Grb10 (Fig. 1B
, top panel).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1. Overexpression of Human Grb10 Inhibits MAPK Signaling
A, CHO/IR cells were transiently transfected with either Myc-tagged p42 MAPK alone or cotransfected with MAPK and Grb10. After 24 h, the cells were washed with 1x PBS, incubated in serum-free medium for 2 h, and subsequently treated with (+) or without (-) insulin (10-8 M) for 5 min. Cell lysates were separated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membranes were blotted with antibody to either the HA tag to Grb10 (bottom panel), or phospho-MAPK (top panel). The phospho-MAPK membrane was stripped and reblotted with Myc antibody to visualize MAPK (middle panel). Data are representative of three independent experiments. B, Fully differentiated 3T3-L1 adipocytes were infected at an infection efficiency of 90% with either green fluorescent protein (GFP) or Grb10 adenovirus. Cells were serum starved overnight, washed with PBS, and then serum starved for 1 additional hour. The cells were subsequently treated with (+) or without (-) 100 nM insulin for 5 min. Cell lysates were separated by SDS-PAGE and transferred onto nitrocellulose membranes. The membranes were blotted with an antibody to either the HA tag to Grb10 (bottom panel) or phospho-MAPK (top panel). The whole-cell lysates were reloaded and blotted with an antibody to p44/42 MAPK (middle panel). Data are representative of three independent experiments. C, Rat primary adipocytes were transiently cotransfected with pFA-Elk1, pFR-Luc, and pCIS, PH domain-truncated human Grb10, or full-length human Grb10 by electroporation. After overnight incubation, the cells were treated without or with insulin (100 nM, 5 h). The cells were then lysed and the luciferase activity in each sample was determined. Results shown are the mean ± SEM of six independent experiments performed in triplicate (normalized to the group transfected with pCIS and stimulated with insulin).
|
|
Human Grb10 Isoforms Inhibit Insulin-Stimulated Elk-1 Activity in Primary Rat Adipocytes
To test whether Grb10 inhibits insulin signaling downstream of MAPK, we examined the effects of overexpressing Grb10 on insulin-stimulated Elk1 phosphorylation in primary rat adipocytes. Elk-1 is a ternary complex factor that is known to be phosphorylated by activated MAPK upon insulin stimulation (22). Plasmids encoding either full-length (11) or the PH domain-truncated (6) human Grb10 isoforms were electroporated into primary rat adipocytes together with a plasmid encoding the GAL4 binding domain fused to the Elk1 activation domain (GAL4/Elk1) and a plasmid encoding a GAL4 binding sequence/luciferase. Phosphorylation of the GAL4/Elk1 fusion protein leads to activation of Elk1 and a subsequent increase in luciferase expression, which can be monitored by luciferase assays. We found that insulin treatment of cells transfected with an empty vector pCIS led to a 2-fold increase in luciferase activity, correlating with an activation of Elk1 (Fig. 1C
). The insulin-stimulated luciferase activity was significantly decreased (P < 0.006) in cells overexpressing Grb10 (Fig. 1C
). These data suggest that overexpression of Grb10 is sufficient to inhibit an insulin-stimulated MAPK-dependent mitogenic signaling pathway in adipocytes.
Grb10 Inhibits Insulin-Stimulated Tyrosine Phosphorylation of Shc in CHO/IR Cells and 3T3-L1 Adipocytes
To investigate the mechanism by which Grb10 inhibits insulin-stimulated activation of the MAPK pathway, we tested whether Grb10 inhibits tyrosine phosphorylation of the adapter protein p52 Shc, an adapter protein that functions in close proximity to the IR and mediates insulin-stimulated MAPK phosphorylation. We found that in CHO/IR cells, Shc underwent rapid insulin-stimulated tyrosine phosphorylation (Fig. 2A
, lane 1 vs. lane 2). Coexpression of Grb10 with Shc resulted in a marked inhibition of insulin-stimulated tyrosine phosphorylation of Shc (Fig. 2A
, lane 2 vs. lane 4). Shc tyrosine phosphorylation was inhibited by Grb10 in a dose-dependent manner (Fig. 2B
, lane 2 vs. lanes 36). We also tested whether adenoviral-mediated overexpression of Grb10 inhibits insulin-stimulated activation of endogenous Shc in 3T3-L1 adipocytes. We found that insulin treatment led to a notable phosphorylation of endogenous Shc within 5 min, which was inhibited by overexpression of Grb10 (Fig. 2C
, top panel).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2. Grb10 Inhibits Insulin-Stimulated Tyrosine Phosphorylation of Shc
A, Myc-tagged p52 Shc was transiently expressed in CHO/IR cells either alone or with HA-tagged human Grb10. Cells were serum starved for 6 h and then treated with (+) or without (-) 10 nM insulin for 15 min. Cells were lysed and Shc was immunoprecipitated with antibody to the protein. The immunoprecipitates were washed three times in ice-cold buffer B, separated by SDS-PAGE, and transferred onto a nitrocellulose membrane. The tyrosine phosphorylation of Shc was determined by Western blot using an antiphosphotyrosine antibody (top panel). Shc was detected with an antibody to the myc tag (middle panel). The expression of Grb10 was determined by Western blot using an antibody to the HA tag (bottom panel). Data are representative of three independent experiments. B, Myc-tagged Shc was cotransfected with increasing amounts (1, 4, 7, or 10 µg) of HA-tagged hGrb10 into CHO/IR cells. Cells were serum-starved for 4 h, stimulated with (+) or without (-) 10 nM insulin for 5 min, and lysed. Western blot analysis was determined as in panel A. Data are representative of three independent experiments. C, 3T3-L1 adipocytes were infected at an infection efficiency of 90% with either GFP or Grb10 adenovirus. Cells were serum starved overnight, washed with PBS, and then serum starved for 1 additional hour. The cells were subsequently treated with (+) or without (-) 100 nM insulin for 5 min. Cell lysates were separated by SDS-PAGE and transferred onto nitrocellulose membranes. The tyrosine phosphorylation of Shc was determined by Western blot using an antiphospho Shc antibody (top panel). Shc was detected with an antibody to the protein (middle panel). The expression of Grb10 was determined by Western blot using an antibody to the HA tag (bottom panel). D, Schematic of human Grb10 truncations. E, Myc-tagged Shc was transiently expressed in CHO/IR cells either alone or with HA-tagged truncations of human Grb10. Cells were serum-starved for 2 h and then either left untreated or treated with 10 nM insulin for 5 min. Western blot analysis was determined as in panel A. Data are representative of three independent experiments. F, Myc-tagged p42 MAPK was transiently expressed in CHO/IR cells either alone or with HA-tagged truncations of human Grb10. After 24 h, the cells were washed with 1x PBS, incubated in serum-free medium for 2 h, and subsequently treated with (+) or without (-) insulin (10-8 M) for 5 min. Cell lysates were separated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membranes were blotted with antibody to either the HA tag to Grb10 (bottom panel), phospho-MAPK (top panel), or Myc antibody to visualize MAPK (middle panel). Data are representative of three independent experiments. G, Myc-tagged Shc was transiently expressed in CHO/IR cells alone or with either HA-tagged human Grb10 or human Grb10R520G. Cells were serum starved for 2 h and then left untreated or treated with 10 nM insulin for 5 min. Cells were lysed and Shc was immunoprecipitated using antibody to the Myc tag. Western blot analysis was determined as in panel A. Data are representative of three independent experiments.
|
|
The SH2 Domain of Grb10 Is Important in the Inhibition of Insulin-Stimulated Shc Tyrosine Phosphorylation in Cells
Our results suggest that Grb10 inhibits insulin signaling to MAPK through inhibition of insulin-stimulated phosphorylation of the adaptor protein Shc. To understand the mechanism of the inhibition, we expressed Myc-tagged Shc in CHO/IR cells together with either wild-type or various truncation mutants of Grb10 (Fig. 2D
). Consistent with our previous findings, full-length wild-type Grb10 expression resulted in a considerable decrease in Shc tyrosine phosphorylation (Fig. 2E
, lane 2 vs. 3). In contrast, coexpression of Grb10 mutants lacking either the SH2 domain alone (
SH2) or both the BPS and SH2 domains [
(BPS+SH2)] restored insulin-stimulated tyrosine phosphorylation of Shc (Fig. 2E
, lane 3 vs. lanes 4 and 5). Deletion of the SH2 domain of Grb10 also restores MAPK phosphorylation in the presence of overexpressed Grb10 (Fig. 2F
, lane 3 vs. lanes 4 and 5). In addition, the mutant human Grb10R520G, in which the function of the SH2 domain is impaired through mutation of the critical arginine (Arg520) to glycine (15, 23), only partially reversed the ability of Grb10 to inhibit insulin-stimulated Shc tyrosine phosphorylation (Fig. 2G
, lane 3 vs. 4). Taken together, the data indicate that the SH2 domain of Grb10, which has been shown to mediate the interaction between Grb10 and the IR (7, 11, 12, 13, 15, 23), is critical for the inhibitory effect of Grb10 on insulin-stimulated activation of the MAPK pathway.
Inhibition of Endogenous hGrb10 Expression Results in an Increase of Insulin Signaling to MAPK, Shc, and Akt
Because the above studies were carried out in cells overexpressing Grb10, it is unclear whether the inhibitory effect of Grb10 on MAPK signaling is due to amplifying or blocking the endogenous functions downstream of Grb10. To address this question, we attempted to investigate the functional role of endogenous Grb10 by RNAi. The RNAi target sequence corresponds to nucleotides (nt 498518) of full-length human Grb10, hGrb10
, although both the human Grb-IR/hGrb10ß and hGrb10
isoforms contain the identical sequence in this region (24). We generated a Grb10 RNAi plasmid using the pBS/U6/RNAi plasmid (25) and examined the effect and specificity of the Grb10 RNAi in HeLa/IR cells. As seen in Fig. 3A
, Western blot analysis of whole-cell lysates showed that transfection of the control plasmid pBS/U6/RNAi in HeLa/IR cells had no effect on the expression levels of Grb10 (lanes 13). On the other hand, Grb10 expression was greatly inhibited when cells were cotransfected with the pBS/U6/RNAi/Grb10 plasmid in a dose-dependent manner (lanes 46). This inhibition was specific because expression of the Grb10 RNAi plasmid had no effect on the coexpressed p70 S6 kinase (lanes 79).
To investigate the functional role of endogenous Grb10, we generated a HeLa/IR stable cell line in which the expression of endogenous hGrb10 was impaired by RNAi. When probed with antibody to human Grb10, HeLa/IR lysates reveal bands that comigrate only with full-length human Grb10, hGrb10
, indicating that the experiments conducted would be targeting this human Grb10 isoform. We chose HeLa cells due to the fact that they have been shown to be a successful model system to study RNAi-mediated gene silencing (26). RT-PCR and Western blot analysis revealed that the expression of Grb10 mRNA (Fig. 3B
) and protein (Fig. 3C
) was almost completely blocked in Grb10-suppressed HeLa/IR cells. We also examined the effect of Grb10 RNAi on the two other members of the Grb7 family, namely Grb7 and Grb14. RT-PCR analysis revealed that Grb14 mRNA was not expressed in HeLa/IR cells (data not shown). In addition, we found that suppression of Grb10 by RNAi had no effect on Grb7 mRNA expression in the HeLa/IR/
Grb10 cells (Fig. 3B
). These findings indicated that suppression of Grb10 expression had no effect on expression levels of other members of the Grb7/10/14 family.
Using the Grb10-deficient cells, we examined the phosphorylation of endogenous MAPK and Shc. We found that both the basal and insulin-stimulated phosphorylation of MAPK (Fig. 4A
) and Shc (Fig. 4B
) was notably increased in the HeLa/IR/
Grb10 cell line as compared with the wild-type HeLa/IR cells. The reduced effect of insulin on MAPK and Shc phosphorylation in HeLa/IR cells compared with the other cell types is most likely due to the difference in the cellular contents of these cell types. Like other cancer cells, HeLa cells have a higher basal phosphorylation and are not very insulin sensitive. However, as demonstrated previously (26) and also confirmed in our studies, HeLa cells provide an excellent model system for RNAi studies. We also examined whether suppression of Grb10 expression had an effect on insulin stimulation of the PI 3-kinase pathway by measuring Akt phosphorylation. Our results showed that insulin-stimulated phosphorylation of Akt at both Thr308 and Ser473 was markedly increased in the HeLa/IR/
Grb10 cells as compared with the wild-type HeLa/IR cells (Fig. 4C
). These findings are strong evidence that endogenous Grb10 plays a negative role in insulin signaling.
 |
DISCUSSION
|
|---|
Grb10 is known to associate with the insulin receptor in response to insulin stimulation (6, 7, 8, 9, 12, 27); however, the role of Grb10 in insulin signaling remains controversial. Because most, if not all, of the previous studies were carried out in cells overexpressing Grb10, it is unclear whether the inhibitory or stimulatory roles of Grb10 in insulin signaling were caused by direct inhibition of the signaling pathway or due to sequestration of molecules necessary for signaling.
In the present study, we show that overexpression of Grb10 inhibits insulin-stimulated MAPK signaling in a variety of cells. In addition, we showed that suppression of Grb10 expression by RNAi led to enhanced insulin-stimulated Akt, Shc, and MAPK phosphorylation (Fig. 4
). This is the first evidence suggesting that endogenous Grb10 plays a negative role in insulin signaling. As for other members of the Grb7/10/14 family (24, 28), suppression of Grb10 by RNAi did not affect the expression of Grb7. Thus, the inhibitory effect of Grb10 is specific and is not caused by altering the expression levels of other members of the Grb7/10/14 family, which may potentially up-regulate insulin signaling. Therefore, the most likely explanation for our results is that endogenous Grb10 normally functions to negatively regulate insulin signaling and that removal of this suppression up-regulates insulin signaling. Our results are consistent with a recent finding showing that disruption of Grb10 function by gene targeting leads to mouse overgrowth, suggesting that endogenous Grb10 is a potent growth inhibitor in vivo (21).
Recently, we have shown that human Grb10 inhibits insulin-stimulated activation of the PI-3 kinase pathway by blocking the insulin-stimulated association between the IR and IRS, resulting in the inhibition of IRS tyrosine phosphorylation (15). Results from the present study suggest that Grb10 may use a similar mechanism to negatively regulate the MAPK pathway. Consistent with this, we found that overexpression of Grb10 inhibits insulin-stimulated tyrosine phosphorylation of the adapter protein Shc, which has been shown to mediate insulin-stimulated MAPK phosphorylation. This result is in agreement with a recent finding that Grb10 inhibits Shc tyrosine phosphorylation by the IR in vitro (14). The idea that Grb10 reduces MAPK phosphorylation by inhibiting Shc tyrosine phosphorylation is consistent with the finding that a mutation in the SH2 domain, which inhibits the interaction between Grb10 and the tyrosine-phosphorylated IR (7, 11, 12, 13), reduces the inhibitory effect of Grb10 on insulin-stimulated Shc tyrosine phosphorylation (Fig. 2
, E and G). However, because we (11) and others (7, 12, 13) have previously found that Grb10 binds to the kinase domain of the IR whereas Shc binds to autophosphorylated tyrosines in either the juxtamembrane region (3) or at the C terminus of the IR (3, 4), it is likely that the inhibition of Shc association with the IR is caused by either a Grb10-induced conformational change of the IR or a physical hindrance by Grb10, which prevents the IR from phosphorylating Shc, rather than by competitive binding of Grb10 and Shc for the same site on the IR. We attempted to verify, by coimmunoprecipitation studies, whether Grb10 inhibits Shc binding to the IR; however, we were unable to detect an interaction between the IR and Shc in our cell systems (data not shown), perhaps due to the transient nature of the association.
In summary, we show that overexpression of Grb10 inhibits insulin signaling to the MAPK pathway in CHO/IR cells as well as in cells physiologically relevant to insulin action such as 3T3-L1 adipocytes and rat primary adipocytes. In addition, we show that suppression of endogenous Grb10 expression enhanced insulin-stimulated phosphorylation of MAPK, Shc, and Akt. These results strongly suggest that Grb10 normally functions as a negative regulator of insulin-mediated metabolic and mitogenic events. Our results elucidate a molecular mechanism for the recent observation that disruption of Grb10 expression leads to mouse overgrowth (21).
 |
MATERIALS AND METHODS
|
|---|
Materials
The CHO cell line overexpressing the IR (CHO/IR) was described previously (6, 8, 23). 3T3-L1 cells were from ATCC (Manassas, VA). The HeLa/IR cell line, a human IR-overexpressing cell line, was created by cotransfecting HeLa cells with cDNA encoding the human IR (29) and the puromycin resistance vector pSV2 using the LipofectAMINE reagent according to the manufacturers protocol (Life Technologies, Gaithersburg, MD). Transfectants were selected with puromycin, and colonies were screened by Western blot analysis with an anti-IRß antibody. Monoclonal antibody to the hemagglutinin (HA) tag was purchased from COVANCE (Berkeley, CA). Anti-Myc antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Phospho-specific antibodies to MAPK, Akt, and ShcY317 and antibodies to Akt and hGrb10 were obtained from Cell Signaling Technology (Beverly, MA). The polyclonal phosphotyrosine (RC20) antibody was purchased from Transduction Laboratories, Inc. (Lexington, KY). Monoclonal and polyclonal Shc antibodies were purchased from Santa Cruz Biotechnology, Inc. and Upstate Biotechnology, Inc. (Lake Placid, NY), respectively. Secondary antibodies conjugated to alkaline phosphatase and horseradish peroxidase were purchased from Promega Corp. (Madison, WI). Protein G- and protein A-conjugated Sepharose beads were obtained from Amersham Pharmacia Biotech (Arlington Heights, IL).
Construction of Plasmids and Adenoviruses
Plasmids encoding HA-tagged PH domain-truncated human Grb10, full-length human Grb10, and the SH2 domain point mutant human Grb10R520G were described previously (6, 8, 23). The Myc-tagged Shc expression vector, pRK5/myc p52 Shc, was a generous gift from Dr. Ben Margolis (University of Michigan, Ann Arbor, MI). Myc-tagged p42 MAPK was a gift from Dr. Kun-Liang Guan (University of Michigan). Adenoviruses encoding human Grb10 were described previously (15).
Generation of Grb10 Truncation Mutants
A cDNA encoding the SH2 domain-deleted mutant of Grb10 (amino acid residues 1492; Grb10
SH2) was generated by PCR using full-length hGrb10 cDNA (8, 11) as a template. The PCR primers used were forward (FW): 5'-TGCTCTAGACAGTGCTACAGAGCCAAC-3'; and reverse (RV): 5'-GCGAATTCGTGCTGTGTCCTGTGAATC-3'. Using the same FW primer and a RV primer (5'-GCG AAT TCC TTC CTC TGC TGA GGG ATT C-3'), we generated another truncation mutant of Grb10 [amino acids 1414; Grb10
(BPS+SH2)]. After restriction digestion, the cDNA fragments were subcloned into the mammalian expression plasmid pBEX, in frame at their C termini with a sequence encoding the HA tag.
Cell Culture
CHO/IR cells were maintained in Hams F-12 medium (Life Technologies) supplemented with 10% newborn calf serum and 1% penicillin/streptomycin. HeLa/IR and HeLa/IR/
Grb10 cells were grown in DMEM with 10% fetal bovine serum and 1% penicillin/streptomycin. 3T3-L1 cells were grown in DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. The cells were grown to confluency and then differentiated by addition of the same medium containing isobutylmethylxanthine (500 µM), dexamethasone (25 µM), and insulin (4 µg/ml) for 3 d and then by addition of the medium containing insulin for 3 additional days. The medium was then changed every 3 d until the cells were fully differentiated, which typically occurred on the 10th day.
Immunoprecipitation and Western Blot
Transfections of CHO/IR cells were performed in either 60-mm or 100-mm plates with 5 or 10 µg total recombinant plasmid, respectively, using the LipofectAMINE reagent according to the manufacturers protocol (Life Technologies). Twenty-four hours after transfection, cells were treated accordingly and then lysed in 300 µl of buffer A (50 mM HEPES, pH 7.6; 150 mM NaCl; 1% Triton X-100; 10 mM NaF; 20 mM sodium pyrophosphate; 20 mM ß-glycerol phosphate; 1 mM sodium orthovanadate; 10 µg/ml leupeptin; 10 µg/ml aprotinin; 1 mM phenylmethylsulfonyl fluoride). The lysates were centrifuged (14,000 x g, 4 C, 10 min), and the supernatants were incubated with specific antibodies preadsorbed to protein G beads (Amersham Pharmacia Biotech) overnight at 4 C with gentle rotation. The immunoprecipitates were then washed three times with ice-cold buffer B (50 mM HEPES, pH 7.6; 150 mM NaCl; and 0.1% Triton X-100). Proteins bound to the beads were eluted by heating at 95 C for 4 min in SDS-PAGE sample loading buffer. The eluted proteins were separated by SDS-PAGE, transferred onto a nitrocellulose membrane, and detected with specific antibodies.
Transfection of Rat Adipose Cells and Elk-1 Phosphorylation Assay
Rat adipose cells in primary culture were prepared from epididymal fat pads and transfected by electroporation as described (30). Each experimental group was transfected with a total of 5 µg DNA/cuvette. After transfected cells were processed and cultured (31), the Path-Detect system (Stratagene, La Jolla, CA) was used to assess the effects of Grb10 constructs on the phosphorylation of an Elk-1 reporter as described previously (32). The adipocytes were subject to serum starvation overnight (as described in the legend to Fig. 1C
), treated with or without insulin (100 nM, 5 h), and cell lysates were assayed for luciferase activity. Paired t tests were used to compare results from the Elk-1 phosphorylation experiments. Values of P < 0.05 were considered to represent statistical significance.
Generation of the pBS/U6/Grb10 RNAi Construct and the Grb10-Suppressed HeLa/IR Cell Line
To generate the pBS/U6/Grb10 RNAi construct, a 22-nt oligo corresponding to nt 498518 of full-length human Grb10 (8, 11) (GGTTCTTTACCTCCGAGCCAG) was first inserted into the ApaI (blunted) and XhoI sites of pBS/U6/RNAi construct [a generous gift of Dr. Y. Shi, Harvard Medical School, Boston, MA (25)]. The selected coding sequence has no significant sequence homology to genes other than Grb10 isoforms as determined by BLAST (basic local alignment search tool) search. The second step involved subcloning the inverted sequence that contains a 6-nt spacer and five Ts into the HindIII and EcoRI sites of the intermediate plasmid. Oligo 1 is 5'-GGTTCTTTACCTCCGAGCCAGA-3' (FW) and 5'-AGCTTCTGGCTCGGAGGTAAAGAACC-3' (RV). Oligo 2 is 5'-AGCTTCTGGCTCGGAGGTAAAGAACCCTTTTTG-3' (FW) and 5'-AATTCAAAAAGGGTTCTTTACCTCCGAGCCAG-3' (RV). The added restriction sites are underlined. The successful generation of the pBS/U6/Grb10 RNAi construct was confirmed by DNA sequencing. The HeLa/IR/
Grb10 stable cell line was created by cotransfecting the pBS/U6/Grb10 RNAi plasmid with the puromycin resistance vector pSV2, using the LipofectAMINE reagent according to the manufacturers protocol (Life Technologies). Transfectants were selected with puromycin, and colonies were screened by immunoblot analysis with an anti-hGrb10 antibody (Cell Signaling Technology).
RT-PCR Experiments
Total RNA was isolated from either wild-type HeLa/IR or HeLa/IR/
Grb10 cells using Trizol (Life Technologies, Inc.). RT-PCR was performed using the SuperScript First-Strand Synthesis System RT-PCR kit from Invitrogen (San Diego, CA) according to the manufacturers instructions. cDNA was synthesized from total RNA (5 µg) using oligo(deoxythymidine) primers and Superscript II RT (Invitrogen). Of the resulting single-strand cDNA reaction (20 µl), 2 µl were used as templates for RT-PCR. FW and RV primers used to amplify human Grb10, Grb7, Grb14, and glyceraldehyde phosphate dehydrogenase (GAPDH) were as follows: Grb10-FW (5'-GACCTGGAAGCCCTGGTG-3'), Grb10-RV (5'-CGTGAGCACAGGGGGGCT3'); Grb7-FW (5-TGTGAAATGCTGGTGCAGCGAGC-3), Grb7-RV (5'-ATCTGAGGCACTTCTCAAGGGTGG-3'); Grb14-FW (5'-ACCAGCAGGGCTTTAGATGTACC-3'), Grb14-RV (5'-GAACTGCAGCCACTTCTACCTTG-3'); GAPDH-FW (5'-ACCACAGTCCATGCCATCAC-3'), GAPDH-RV (5'-TCCACCACCCTGTTGCTGTA-3'). Expected sizes for the Grb10 fragment, Grb7 fragment, and the GAPDH fragment are 0.3 kb, 0.7 kb, and 0.4 kb, respectively.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Ben Margolis, Kun-Liang Guan, and Y. Shi for providing plasmid constructs used in this study. We also thank Drs. KeriLyn Wick, Mike Wick, and Mei Ann Lim for their insightful comments.
 |
FOOTNOTES
|
|---|
This work was supported by NIH R01 Grant DK52933.
Abbreviations: BPS, Between the PH and SH2; CHO, Chinese hamster ovary; FW, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HA, hemagglutinin; IR, insulin receptor; IRS, IR substrate; nt, nucleotide; PH, pleckstrin homology; PI 3-kinase, phosphatidylinositol 3'-kinase; RNAi, RNA interference; RV, reverse; SH2, Src-homology 2.
Received for publication April 3, 2003.
Accepted for publication November 5, 2003.
 |
REFERENCES
|
|---|
- Saltiel AR, Kahn CR 2001 Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414:799806[CrossRef][Medline]
- White MF 2002 IRS proteins and the common path to diabetes. Am J Physiol Endocrinol Metab 283:E413E422
- Gustafson TA, He W, Craparo A, Schaub CD, ONeill TJ 1995 Phosphotyrosine-dependent interaction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domain. Mol Cell Biol 15:25002508[Abstract]
- Yonezawa K, Ando A, Kaburagi Y, Yamamoto-Honda R, Kitamura T, Hara K, Nakafuku M, Okabayashi Y, Kadowaki T, Kaziro Y, Kasuga M 1994 Signal transduction pathways from insulin receptors to Ras. Analysis by mutant insulin receptors. J Biol Chem 269:46344640[Abstract/Free Full Text]
- Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH 2001 Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 22:153183[Abstract/Free Full Text]
- Liu F, Roth RA 1995 Grb-IR: a SH2-domain-containing protein that binds to the insulin receptor and inhibits its function. Proc Natl Acad Sci USA 92:1028710291[Abstract/Free Full Text]
- ONeill TJ, Rose TW, Pillay TS, Hotta K, Olefsky JM, Gustafson TA 1996 Interaction of a GRB-IR splice variant (a human GRB10 homolog) with the insulin and insulin-like growth factor I receptors. Evidence for a role in mitogenic signaling. J Biol Chem 271:2250622513[Abstract/Free Full Text]
- Dong LQ, Du H-Y, Porter S, Kolakowski Jr LF, Lee AV, Mandarino LJ, Fan JB, Yee D, Liu F 1997 Cloning, chromosome localization, expression, and characterization of an SH2 and PH domain-containing insulin receptor binding protein hGrb10
. J Biol Chem 272:2910429112[Abstract/Free Full Text]
- Frantz JD, Giorgetti-Peraldi S, Ottinger EA, Shoelson SE 1997 Human GRB-IRß/GRB10 splice variants of an insulin and growth factor receptor-binding protein with PH and SH2 domains. J Biol Chem 272:26592667[Abstract/Free Full Text]
- Laviola L, Giorgino F, Chow JC, Baquero JA, Hansen H, Ooi J, Zhu J, Riedel H, Smith RJ 1997 The adapter protein Grb10 associates preferentially with the insulin receptor as compared with the IGF-I receptor in mouse fibroblasts. J Clin Invest 99:830837[Medline]
- Dong LQ, Farris S, Christal J, Liu F 1997 Site-directed mutagenesis and yeast two-hybrid studies of the insulin and insulin-like growth factor-1 receptors: the src-homology-2 domain-containing protein hGrb10 binds to the autophosphorylated tyrosine residues in the kinase domain of the insulin receptor. Mol Endocrinol 11:17571765[Abstract/Free Full Text]
- He W, Rose DW, Olefsky JM, Gustafson TA 1998 Grb10 interacts differentially with the insulin receptor, insulin-like growth factor I receptor, and epidermal growth factor receptor via the Grb10 Src homology 2 (SH2) domain and a second novel domain located between the Pleckstrin homology and SH2 domains. J Biol Chem 273:68606867[Abstract/Free Full Text]
- Stein EG, Ghirlando R, Hubbard SR 2003 Structural basis for dimerization of the Grb10 Src homology 2 domain. Implications for ligand specificity. J Biol Chem 278:1325713264[Abstract/Free Full Text]
- Stein EG, Gustafson TA, Hubbard SR 2001 The BPS domain of Grb10 inhibits the catalytic activity of the insulin and IGF1 receptors. FEBS Lett 493:106111[CrossRef][Medline]
- Wick KR, Werner ED, Langlais P, Ramos FJ, Dong LQ, Shoelson SE, Liu F 2003 Grb10 inhibits insulin-stimulated insulin receptor substrate (IRS)-phosphatidylinositol 3-kinase/Akt signaling pathway by disrupting the association of IRS-1/IRS-2 with the insulin receptor. J Biol Chem 278:84608467[Abstract/Free Full Text]
- Morrione A, Valentinis B, Resnicoff M, Xu S-Q, Baserga R 1997 The role of mGrb10
in insulin-like growth factor I-mediated growth. J Biol Chem 272:2638226387[Abstract/Free Full Text]
- Wang J, Dai H, Yousaf N, Moussaif M, Deng Y, Boufelliga A, Swamy OR, Leone ME, Riedel H 1999 Grb10, a positive, stimulatory signaling adapter in platelet-derived growth factor BB-, insulin-like growth factor I-, and insulin-mediated mitogenesis. Mol Cell Biol 19:62176228[Abstract/Free Full Text]
- Deng Y, Bhattacharya S, Swamy OR, Tandon R, Wang Y, Janda R, Riedel H 2003 Grb10 as a partner of PI 3-kinase in metabolic insulin action. J Biol Chem 278:3931139322[Abstract/Free Full Text]
- Wick MJ, Dong LQ, Hu D, Langlais P, Liu F 2001 Insulin receptor-mediated p62dok tyrosine phosphorylation at residues 362 and 398 plays distinct roles for binding GTPase-activating protein and Nck and is essential for inhibiting insulin-stimulated activation of Ras and Akt. J Biol Chem 276:4284342850[Abstract/Free Full Text]
- Mounier C, Lavoie L, Dumas V, Mohammad-Ali K, Wu J, Nantel A, Bergeron JJ, Thomas DY, Posner BI 2001 Specific inhibition by hGRB10
of insulin-induced glycogen synthase activation: evidence for a novel signaling pathway. Mol Cell Endocrinol 173:1527[CrossRef][Medline]
- Charalambous M, Smith FM, Bennett WR, Crew TE, Mackenzie F, Ward A 2003 Disruption of the imprinted Grb10 gene leads to disproportionate overgrowth by an Igf2-independent mechanism. Proc Natl Acad Sci USA 100:82928297[Abstract/Free Full Text]
- Janknecht R, Ernst WH, Pingoud V, Nordheim A 1993 Activation of ternary complex factor Elk-1 by MAP kinases. EMBO J 12:50975104[Medline]
- Langlais P, Dong LQ, Hu D, Liu F 2000 Identification of Grb10 as a direct substrate for members of the Src tyrosine kinase family. Oncogene 19:28952903[CrossRef][Medline]
- Lim MA, Riedel, H, Liu, F 2004 Grb10: more than a simple adapter protein. Front Biosci 9:387403[Medline]
- Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC 2002 A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA 99:55155520[Abstract/Free Full Text]
- Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T 2001 Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494498[CrossRef][Medline]
- Hansen H, Svensson U, Zhu J, Laviola L, Giorgino F, Wolf G, Smith RJ, Riedel H 1996 Interaction between the Grb10 SH2 domain and the insulin receptor carboxyl terminus. J Biol Chem 271:88828886[Abstract/Free Full Text]
- Riedel H 2003 Grb10: Exceeding the boundaries of a common signaling adapter. Front Biosci 9:603618
- Ebina Y, Ellis L, Jarnagin K, Edery M, Graf L, Clauser E, Ou JH, Masiarz F, Kan YW, Goldfine ID, Roth RA, Rutter WJ 1985 The human insulin receptor cDNA: the structural basis for hormone-activated transmembrane signalling. Cell 40:747758[CrossRef][Medline]
- Quon MJ, Zarnowski MJ, Guerre-Millo M, de la Luz Sierra M, Taylor SI, Cushman SW 1993 Transfection of DNA into isolated rat adipose cells by electroporation: evaluation of promoter activity in transfected adipose cells which are highly responsive to insulin after one day in culture. Biochem Biophys Res Commun 194:338346[CrossRef][Medline]
- Chen H, Wertheimer SJ, Lin CH, Katz SL, Amrein KE, Burn P, Quon MJ 1997 Protein-tyrosine phosphatases PTP1B and syp are modulators of insulin-stimulated translocation of GLUT4 in transfected rat adipose cells. J Biol Chem 272:80268031[Abstract/Free Full Text]
- Nystrom FH, Chen H, Cong LN, Li Y, Quon MJ 1999 Caveolin-1 interacts with the insulin receptor and can differentially modulate insulin signaling in transfected Cos-7 cells and rat adipose cells. Mol Endocrinol 13:20132024[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
B. Giovannone, W. G. Tsiaras, S. de la Monte, J. Klysik, C. Lautier, G. Karashchuk, S. Goldwurm, and R. J. Smith
GIGYF2 gene disruption in mice results in neurodegeneration and altered insulin-like growth factor signaling
Hum. Mol. Genet.,
December 1, 2009;
18(23):
4629 - 4639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu, M. Liu, J. Zhang, X. Bai, F. Ramos, H. Van Remmen, A. Richardson, F.-Y. Liu, L. Q. Dong, and F. Liu
Downregulation of Grb2 contributes to the insulin-sensitizing effect of calorie restriction
Am J Physiol Endocrinol Metab,
May 1, 2009;
296(5):
E1067 - E1075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shiura, K. Nakamura, T. Hikichi, T. Hino, K. Oda, R. Suzuki-Migishima, T. Kohda, T. Kaneko-Ishino, and F. Ishino
Paternal deletion of Meg1/Grb10 DMR causes maternalization of the Meg1/Grb10 cluster in mouse proximal Chromosome 11 leading to severe pre- and postnatal growth retardation
Hum. Mol. Genet.,
April 15, 2009;
18(8):
1424 - 1438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Liu, L. Zhou, A. Xu, K. S. L. Lam, M. D. Wetzel, R. Xiang, J. Zhang, X. Xin, L. Q. Dong, and F. Liu
From the Cover: A disulfide-bond A oxidoreductase-like protein (DsbA-L) regulates adiponectin multimerization
PNAS,
November 25, 2008;
105(47):
18302 - 18307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Rampersaud, C. M. Damcott, M. Fu, H. Shen, P. McArdle, X. Shi, J. Shelton, J. Yin, Y.-P. C. Chang, S. H. Ott, et al.
Identification of Novel Candidate Genes for Type 2 Diabetes From a Genome-Wide Association Scan in the Old Order Amish: Evidence for Replication From Diabetes-Related Quantitative Traits and From Independent Populations
Diabetes,
December 1, 2007;
56(12):
3053 - 3062.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. J. Ramos, P. R. Langlais, D. Hu, L. Q. Dong, and F. Liu
Grb10 mediates insulin-stimulated degradation of the insulin receptor: a mechanism of negative regulation
Am J Physiol Endocrinol Metab,
June 1, 2006;
290(6):
E1262 - E1266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Nambiar, A. Mirmohammadsadegh, R. Doroudi, A. Gustrau, A. Marini, G. Roeder, T. Ruzicka, and U. R. Hengge
Signaling Networks in Cutaneous Melanoma Metastasis Identified by Complementary DNA Microarrays
Arch Dermatol,
February 1, 2005;
141(2):
165 - 173.
[Abstract]
[Full Text]
[PDF]
|
 |
|