Molecular Endocrinology, doi:10.1210/me.2003-0371
Molecular Endocrinology 18 (3): 533-548
Copyright © 2004 by The Endocrine Society
Conserved Transcriptional Regulatory Domains of the pdx-1 Gene
Kevin Gerrish,
Jennifer C. Van Velkinburgh and
Roland Stein
Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215
Address all correspondence and requests for reprints to: Roland Stein, Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, 723 Light Hall, Nashville, Tennessee 37215. E-mail: roland.stein{at}vanderbilt.edu.
 |
ABSTRACT
|
|---|
The pancreas and duodenum homeobox protein 1 (PDX-1) homeodomain-containing transcription factor affects both pancreatic endocrine cell development and adult islet ß-cell function. Cell-type-specific expression is controlled by sequences 5' flanking the pdx-1 gene transcription start site. One principal control region is located roughly between -2800 and -1600 bp and spans three conserved, distinct, and functionally important subdomains, termed areas I, II, and III. In this study, we found that an upstream control region in the rat pdx-1 gene located between -6200 and -5670 bp is also present in the mouse, chicken, and human genes. This region is capable of independently directing pancreatic ß-cell-selective reporter gene expression and potentiating area I/II-driven activity. This newly recognized conserved subdomain has been termed area IV. The islet-enriched forkhead box A2 (FoxA2), NK2 homeobox 2.2 (Nkx2.2), and pancreas and duodenum homeobox protein 1 (PDX-1) transcription factors have been shown to activate area IV-driven reporter gene expression as well as bind to this region of the endogenous gene in ß-cells. Analysis of the histone H3 and H4 acetylation level also indicated that areas IIV are within transcriptionally active chromatin in ß-cells. Our data suggests that pdx-1 transcription is also regulated by factors acting upon conserved area IV sequences.
 |
INTRODUCTION
|
|---|
EXPRESSION OF THE pancreas and duodenum homeobox protein 1 (PDX-1) homeodomain transcription factor is critical in the development of cells in the antral stomach, pancreas, and duodenum (1, 2, 3, 4). Most strikingly, the pancreas is not formed in humans (5) or mice (2, 3) that are homozygous for an inactivating mutation in PDX-1, apparently due to a block in the proliferation and differentiation of endocrine and exocrine pancreatic precursor cells (2, 3). PDX-1 is also preferentially expressed within islet ß-cells in the adult pancreas (6), where it regulates transcription of a number of ß-cell-enriched genes, including insulin (7, 8, 9, 10, 11, 12), glucose transporter type 2 (GLUT2) (13), islet amyloid polypeptide (7, 14, 15, 16), and ß-glucokinase (7, 17). Selectively removing PDX-1 from adult ß-cells using a Cre-LoxP strategy caused diabetes in mice, at least in part due to reduced insulin and GLUT2 gene expression (18). Glucose sensing is also compromised in humans (19) and mice (18, 20) carrying only one functional pdx-1 allele, causing a form of non-insulin-dependent diabetes in humans (19, 21, 22).
Because PDX-1 is essential in pancreas development and islet ß-cell function, a considerable effort has focused on identifying and characterizing the factors involved in transcriptional regulation. Experiments performed with pdx-1-driven transgenes demonstrated that selective expression was mediated by 5'-flanking sequences within 6.5 and 4.5 kbp from the transcription start site within the rat (23) and mouse (24) genes, respectively. Three nuclease hypersensitive sites, termed HSS1 (-2560 to -1880 bp), HSS2 (-1330 to -880 bp), and HSS3 (-260 to +180 bp), were identified within the proximal 4.5-kb region of the endogenous mouse gene. However, only HSS1 sequences could direct ß-cell-specific expression in vitro and in vivo (24). In addition, HSS1 represented the principal area of identity within this region of the chicken, human, and mouse genes and was subdivided based upon this property into areas I (-2839 to -2520 bp), II (-2252 to -2023 bp), and III (-1939 to -1664 bp). In contrast to areas I and III, a species-specific pdx-1 function may be associated with area II due to its unique presence in the mammalian gene (25).
Areas I and II were capable of independently and effectively directing ß-cell-selective reporter gene activity in transfection assays (25). Moreover, a transgene spanning areas I and II (-2917/PstI to -1918/BstEII) was expressed in the majority of islet ß-cells in vivo (24, 26). Mutational and functional analyses of the conserved sequence blocks found within these subdomains localized sites for both positive- and negative-acting factors, including metabolic and developmental regulators [i.e. FoxA2, formerly known as hepatocyte nuclear factor 3ß (HNF3ß)] (25, 27, 28), RIPE3b1/Maf (29), HNF1
(30), PAX6 (7, 27), and PDX-1 itself (7, 28, 30). Taken together, these data strongly suggested that the conserved sequences within the pdx-1 control region define the sites for binding of factors critical in expression.
In addition to areas I and II, selective expression of the vertebrate pdx-1 gene may be controlled by sequences corresponding to -6200 to -5670 bp of the rat gene. Thus, this region appears to influence both cell-specific and glucocorticoid-regulated transcription of rat pdx-1 (23, 31). Here we show that sequences highly related to the -6200 to -5670-bp region are found upstream of the human, mouse, and chicken genes. This region, termed area IV, is shown to independently direct ß-cell-selective reporter gene expression and potentiate area I/II-mediated activity. forkhead box A2 (FoxA2), NK2 homeobox 2.2 (Nkx2.2), and PDX-1 were identified as regulators of activation. Our data imply that functional interactions between the conserved subdomains direct selective expression of pdx-1, each of which are found in an open chromatin domain in ß-cells spanning approximately 14 kbp upstream of the transcription start site.
 |
RESULTS
|
|---|
A -6200 to -5670-bp-Like Region Is Present in the Mouse, Human, and Chicken pdx-1 Genes
Substantial sequence identity to the rat -6200 to -5670-bp region was found between -6529 to -6047 bp in mouse (88%), -8656 to -8155 bp (82%) in human, and -1912 to -1777 bp (68%) in chicken (Fig. 1A
). This region was termed area IV to correspond with the previous nomenclature (25). The size and level of identity of the -6200 to -5670-bp-like region was comparable to areas I, II, and III (Fig. 1B
).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 1. Sequence Identity between Mouse, Human, and Chicken pdx-1 and the Rat -6200- to -5670-bp Region
A, The shaded sequences represent identity. The conserved potential PDX-1 [TAATK, where K = G or T (58 )], Nkx2.2 [TAAGTG (56 )] and FoxA2 [ANTRTTKRYTY, where N =A, C, T, or G; W = A or T; K = G or T; Y = C or T; R = G or A (59 )] binding sites are labeled. Essential nucleotides required for BETA2 binding to the E-box site are not conserved in mouse or chicken [CANNTG (31 60 61 )]. Area I-, II-, and III-like regions were found in the proximal region of the rat gene by Southern analysis (data not shown). B, Diagram of the 5'-flanking region of mouse, human, and chicken pdx-1. Areas I, II, III, and IV are represented in white, black, hatched, and checked boxes, respectively. The percent identity of the human and chicken to mouse area IIV is indicated below each locus. The identity of the rat to mouse area IV is 88%. The position of area IV in mouse (-6529 to -6047 bp) and human (-8656 to -8155 bp) is relative to the S1 transcription start site, whereas the chicken (-1912 to -1777 bp) is numbered relative to the coding ATG codon. No other significant sequence identity has been detected between these 5'-flanking regions, with the exception of sequences near the promoter (25 ).
|
|
Area IV Directs Islet ß-Cell-Selective Reporter Gene Expression
Areas I and II effectively stimulate ß-cell-selective expression of a herpes simplex thymidine kinase minimal promoter-driven reporter construct in transfection assays (25). To determine whether area IV had similar properties, area IV:pTK activity was compared with area I- and area II-driven activity in ß- (HIT T-15 and INS-1) and non-ß- (NIH3T3) cell lines. The normalized activity of each transfected construct is presented as the ratio of pdx-1 to pTK expression in ß- to non-ß-cells.
Rat and mouse area IV:pTK were both more active in ß-cells than NIH3T3 cells (Fig. 2A
). Because only the -6182 to-6047-bp part of mammalian area IV is conserved in chicken (Fig. 1A
), we next compared the stimulatory activity of this region in mouse to the 5' mammalian specific -6529 to -6183-bp subdomain. Both of these area IV subdomains were more active in ß-cells than in non-ß-cells (Fig. 2A
), suggesting that area IV-selective activation can be mediated by the -6182 to -6047-bp region alone (i.e. in chicken) or together with -6529 to -6183 bp (i.e. in mammals).


View larger version (57K):
[in this window]
[in a new window]
|
Fig. 2. Area IV Imparts ß-Cell-Specific Activation
A, Mouse and rat pdx-1:pTK constructs driven by areas I (cross-hatched boxes), II (right-hatched boxes), and IV (checked boxes) were transfected into HIT T-15, INS-1, and NIH3T3 cells. The pdx-1 sequences within each construct are denoted. The ratio of the normalized pdx-1:pTK to pTK vector activity is calculated for each cell line. The results are presented as the relative activity of pdx-1:pTK activity ± SEM in HIT T-15 or INS-1 divided by NIH3T3 cells. B, Mouse pdx-1:pTK constructs driven by area IV (AIV), Pst-Bst, and AIV+Pst-Bst were transfected into HIT T-15 (black boxes) and ßTC3 (hatched boxes) cells. The ratio of the normalized pdx-1:pTK to pTK vector activity is calculated for each cell line. The results are presented as the relative activity of AIV and AIV+Pst-Bst:pTK ± SEM divided by Pst-Bst:pTK. A two-tailed t test was performed to determine the statistical significance of adding AIV to Pst-Bst (*, P < 0.05). C, Mouse pdx-1:pTK constructs driven by areas I (cross-hatched box), II (right-hatched box), IV (small-checked box), -467 to -831 bp (large-checked box), -3004 to -3367 bp (vertically striped box), and -8766 to -9060 bp (hatched and striped box) were transfected into ßTC3 cells. The ratio of the normalized pdx-1:pTK to pTK ± SEM is shown.
|
|
Conserved areas I, II, and IV, but not III, can independently direct ß-cell-selective reporter gene expression (Fig. 2
and Ref. 25). However, functional interactions between areas I and II are also important for activation. For example, the area I- and area II-spanning Pst-Bst transgenic reporter is expressed in all islet ß-cells in mice, whereas an area II-alone transgene is expressed in only a fraction of the islet ß-cell population, and area I or III not at all (24, 26, 27). We tested whether area IV influenced area I/II activity by placing this region directly upstream of the Pst-Bst control domain. Area IV sequences potentiated the ß-cell activity of Pst-Bst:pTK in a greater than additive manner (Fig. 2B
). Collectively, these data suggest that areas I, II, and IV may act cooperatively to mediate the developmental and cell-type specific expression pattern of the pdx-1 gene.
FoxA2, Nkx2.2, and PDX-1 Bind to Area IV
Transcription factor database analysis identified several potential binding sites within the conserved sequences of area IV, including one each for FoxA2, Nkx2.2, and PDX-1 (Fig. 1A
). The FoxA2 site and a BETA2 control site had been shown to be involved in stimulation of the rat -6200 to -5700 region (31). However, the E-box element at -6302 to -6297 bp that is required for BETA2 binding is not conserved in the mouse or chicken genes (Fig. 1A
). Gel mobility shift assays performed with in vitro-trans-lated FoxA2, Nkx2.2, and PDX-1 demonstrated that each were capable of binding to area IV sequences(Fig. 3
). Furthermore, competition analysis performed with excess wild type (WT) and a binding-defective mutant suggested that factor binding was specific.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3. FoxA2, Nkx 2.2, and PDX-1 Bind to Area IV Sequences in Vitro
Binding assays were performed with probes to (A) -6264/-6233 bp, (B) -6110/-6077 bp, and (C) -6112/-6083 bp in the presence or absence of in vitro translated FoxA2, PDX-1, or Nkx2.2. Binding specificity was determined by competition with a molar excess of WT or MUT competitors. The nonspecific (NS) bands in panel C are indicated.
|
|
The chromatin immunoprecipitation (ChIP) assay was next performed to determine whether FoxA2, Nkx2.2, and PDX-1 bind within the area IV region of the endogenous pdx-1 gene. The antibodies to FoxA2, Nkx2.2, and PDX-1 immunoprecipitated area IV sequences from ßTC3 cells, whereas the IgG and the no-antibody controls did not (Fig. 4
, AC). In addition, these antibodies did not immunoprecipitate the 5'-regulatory sequences of the phosphoenolpyruvate carboxykinase (PEPCK) gene, a transcriptionally inactive gene in ß-cells (Fig. 4D
). When considered together, the gel shift and ChIP results demonstrate that FoxA2, Nkx2.2, and PDX-1 bind within the area IV control region of the pdx-1 gene in ß-cells.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4. FoxA2, Nkx 2.2, and PDX-1 Bind within the Area IV Region of the Endogenous pdx-1 Gene
Cross-linked chromatin from ßTC3 cells was incubated in lane 3 with antibodies raised to (A) FoxA2, (B) Nkx2.2, or (C) PDX-1. The immunoprecipitated DNA was analyzed by PCR for area IV sequences. As controls, PCRs were run with total input chromatin (lane 1), no DNA (lane 2), and DNA obtained from immunoprecipitation with IgG (lane 4) or no antibody (lane 5). The PEPCK PCRs (D) were run with total input chromatin (lane 1), no DNA (lane 2), and DNA obtained after immunoprecipitation with FoxA2 (lane 3), goat IgG (lane 4), Nkx2.2 (lane 5), mouse IgG (lane 6), PDX-1 (lane7), rabbit IgG (lane 8), or no antibody (lane 9).
|
|
FoxA2, Nkx2.2, and PDX-1 Stimulate Area IV Activation
To test how FoxA2, Nkx2.2, and PDX-1 influenced area IV-mediated activation, a binding-defective mutant in each site was generated in area IV:pTK and area IV+Pst-Bst:pTK (Fig. 5
). Mutation of the FoxA2 or Nkx2.2 site in area IV:pTK significantly decreased activity in both HIT T-15 and ßTC3 cells (
3050%; P < 0.05), whereas little or no effect was found in the PDX-1 site mutant (Fig. 5A
). Moreover, the FoxA2 and Nkx2.2 double mutant in area IV further reduced activity, although the level of reduction (to
30% of WT) suggests that each factor activates independently. In contrast to area IV alone, FoxA2, Nkx2.2, and PDX-1 were required for area IV+Pst-Bst activation (Fig. 5A
; P < 0.05). These data indicate that FoxA2, Nkx2.2, and PDX-1 are activators of area IV-mediated reporter gene expression in ß-cells.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5. FoxA2, Nkx2.2, and PDX-1 Stimulates Area IV-Driven Activity in ß-Cells
Binding site mutants for the FoxA2 (-6264 TGGGAGAACAGCCCTGCCGCCGCCAGAGCCC -6233), Nkx2.2 (-6112 TGTGGGCAGAATGCCTTGGAATTAGCTAAC -6083), and PDX-1 (-6110 TGGGCAGAATTAAGTGGACGGCGCTAACAAATTA -6077) were constructed in (A) area IV:pTK and (B) area IV+Pst-Bst:pTK. The pdx-1:pTK plasmids were transfected into ßTC3 (hatched boxes) and HIT T-15 (black boxes) cells. The normalized activity ± SEM of each mutant construct is presented as the fraction of the WT. A two-tailed t test was performed to determine the significance between MUT and WT (*, P < 0.05) and between the double and single MUT (+, P < 0.05).
|
|
Areas IIV Are within a Transcriptionally Active Nucleosomal Structure in ß-Cells
The chromatin environment surrounding a transcriptional control region strongly influences gene expression (32, 33). An important determinant of chromatin structure is the complement of posttranslational modifications targeting the amino-terminal tails of the core histone proteins, such as acetylation, phosphorylation, and methylation (34). For example, hyperacetylation of histones H3 and H4 has been shown to contribute to remodeling of chromatin structure and gene activation (35, 36, 37, 38, 39). To determine the H3 and H4 acetylation status of the pdx-1 control region, a 5'-flanking region ChIP analysis was performed with acetylated histone H3- and H4-specific antisera in ßTC3 cells and the non-PDX-1-expressing endocrine islet
TC6 cell line. A high level of acetylated histone H3 or H4 was associated with the regions of high sequence conservation in ßTC3 cells, including areas IIV and the proximal promoter region (Fig. 6A
). The high level of acetylation was maintained to approximately -12 kb with little or none detected at -14 or -17 kb (Fig. 6B
). The specificity of association was demonstrated by the absence of PCR products from the transcriptionally inactive PEPCK gene and the no-antibody or IgG immunoprecipitations (Fig. 6A
). Interestingly, little or no activation was observed from upstream nonconserved region-driven reporter constructs of the hyperacetylated chromatin domain (compare -831/-467, -3367/-3004, and -9060/-8766 to area I, II, or IV in Fig. 2C
).



View larger version (56K):
[in this window]
[in a new window]
|
Fig. 6. Areas IIV of the Endogenous pdx-1 Gene Are within a Transcriptionally Active Nucleosomal Structure
A, Cross-linked chromatin from ßTC3 cells was incubated with antibodies raised to acetylated histone H3 (lane 3) and H4 (lane 4). The immunoprecipitated DNA was analyzed by PCR for areas I, II, III, IV, pdx-1 proximal promoter (-233 to -5 bp), and PEPCK sequences. As controls, PCRs were run with total input chromatin (lane 1), no DNA (lane 2), and DNA obtained from immunoprecipitation with rabbit IgG (lane 5) or no antibody (lane 6). B, The histone H3 (upper) and H4 (lower) acetylation pattern within the 5'-flanking region of the pdx-1 gene in ßTC3 cells. The relative H3 and H4 acetylation levels were determined by ChIP analysis and plotted as a function of the position relative to the transcription start site. The band intensity of the acetylated histone product was quantitated using NIH Image Version 1.62. Band intensities (mean ± SEM) were expressed relative to the 1% of input DNA signal. C, The histone H3 (upper) and H4 (lower) acetylation pattern within the pdx-1 and glucagon 5'-flanking region in ßTC3 (black boxes) and TC6 cells (cross-hatched boxes). The relative H3 and H4 acetylation levels were determined by ChIP analysis and presented relative to the transcription start site for pdx-1. The band intensity of the acetylated histone product was quantitated using NIH Image Version 1.62. Band intensities (mean ± SEM) were expressed relative to the 1% of input DNA signal.
|
|
In contrast to ßTC3 cells, a low level of histone H3 and H4 acetylation was associated with the proximal promoter region and areas I, II, and III in
TC6 cells (Fig. 6C
). However, the H3 acetylation level of area IV was similar between
TC6 and ßTC3 cells, although the histone H4 level was much lower in
TC6. Unlike area IV, a high level of both H3 and H4 acetylation was found over the control region of the transcriptionally active glucagon gene in
TC6 cells (Fig. 6C
). The regulatory significance of the high area IV H3 acetylation level within these endocrine cell lines is unknown. Importantly, these data strongly suggest that areas IIV are present within a region competent to control pdx-1 transcription in ß-cells.
 |
DISCUSSION
|
|---|
In this study, we have identified a sequence domain conserved between the vertebrate pdx-1 homologs located at nucleotides -6200 to -5670, -6529 to -6047, -8656 to -8155, and -1912 to -1777 in rat, mouse, human, and chicken pdx-1, respectively. In this region, the level of sequence identity to rat is 88 (mouse), 82 (human), and 68% (chicken). This subdomain, termed area IV, could independently direct pancreatic ß-cell-selective reporter gene expression. In addition, area IV significantly potentiated area I/II-driven activity in ß-cells, a process mediated by area IV binding to FoxA2, Nkx2.2, and PDX-1 itself. Areas IIV were also found within a transcriptional open chromatin domain in ß-cells. Collectively, the data imply that these shared regions are the primary regulators of pdx-1 transcription.
Areas I, II, and IV were each independently capable of driving ß-cell-selective reporter gene expression in transient transfection assays (Fig. 2
and Ref. 25), yet only an area II-driven transgene and not I or III were active in vivo (26, 27). Furthermore, the area II reporter transgene was only expressed in a fraction of the islet ß-cell population (27) and therefore contains far from enough information to recapitulate the broad expression pattern of the endogenous pdx-1 gene or the islet-specific pattern driven by the area I/II-spanning Pst-Bst reporter transgene. Functional interactions between the factors acting directly on areas I and II appear to enable the Pst-Bst transgene to be active in all islet ß-cells (data not shown). Similarly, the ability of area IV to stimulate area I/II activity suggests that communication between distal control domains is essential for appropriate pdx-1 expression (Fig. 3
).
Although the detailed role of area IV in regulating the expression and function of pdx-1 remains to be discovered, its cell-type-selective transcriptional activity suggests that these conserved sequences contribute to the complex and dynamic expression pattern of this gene. However, there is some evidence that area IV is not involved in setting up the global expression territory of pdx-1 within the developing foregut endoderm. For example, area IV was absent from a -4.5-kbp pdx-1-lacZ reporter construct that drives expression in a pattern similar to that of the endogenous pdx-1 gene [i.e. in the antral stomach, duodenum, and pancreas (24)]. In addition, a native mouse pdx-1 construct spanning area IV had the same selective expression activity in transfection assays as the area IIII construct ending at -4.5 kbp (data not shown). We presume that the islet-specific expression of the 4.5-kbp-driven transgene arises via the inherent cell-type-specific activity of areas IIII, as transgenes spanning areas I and II (i.e. Pst-Bst) (24), or representing area II alone (27), show endocrine-selective expression. Furthermore, the general difficulty of obtaining regulatory function from a far distal control region within a native promoter context could contribute to our "negative" results in transfection analysis. Yet these results could also indicate that area IV is not required for pdx-1 expression in the foregut overall, or in pancreatic endocrine cell differentiation.
Recent gene manipulation experiments in mice, however, argue that non-area IIII sequences, such as area IV, do contribute to normal pdx-1 function. Thus, areas IIII were deleted from the endogenous murine pdx-1 gene at the one-cell stage of embryogenesis using a Cre-LoxP strategy (personal communication, Fujitani, Y., and C. V. E. Wright, Vanderbilt University Medical Center, Nashville, TN). Mice that are homozygous for a pdx-1 allele that harbors a deletion of areas IIII displayed highly abrogated pancreas development. But, in contrast to the global pdx-1 homozygous null phenotype reported previously (2, 3), the neonatal stage pancreatic rudiment of areas IIII-deficient animals is appreciably larger and contains significant numbers of weakly insulin-positive cells, many glucagon-positive cells, and a substantial amount of acinar tissue. Strikingly, and again in contrast to the global pdx-1 knockout (3), duodenum and antral stomach development is relatively normal in areas IIII-deficient mice.
These in vivo results demonstrate that areas IIII are required for full pdx-1 function in pancreas organogenesis, whereas distinct sequences mediate some degree of pancreas outgrowth and exocrine/endocrine differentiation as well as normal duodenum and antral stomach epithelial cell development. We believe that conserved area IV sequences are essential for expression in the duodenum and stomach and, possibly, for potentiation of areas IIII-mediated activation in the pancreas, for example in the fine-tuning of pdx-1 expression in the endocrine cells of the islet of Langerhans. It is also very unlikely that control is imparted by another region, because area IV represents the only other conserved sequence domain within 15 kbp of the transcription start site. Unfortunately, pdx-1-expressing cell lines of the duodenum and antral stomach are not available to directly test the significance of area IV control, although at least the FoxA2 activator of area IV is expressed in these cell types (40). In contrast, a key role for area IV in pdx-1 transcription in ß-cells is supported by several observations, including: 1) the ability to independently direct cell-selective reporter gene expression as well as stimulate area I/II-mediated transcription (Fig. 2
); 2) regulation by key transcription factors of endocrine cell development and function (Figs. 35

) (31); 3) central involvement in glucocortocoid-induced transcriptional inhibition (31); and 4) presence within a transcriptionally open chromatin domain containing areas IIII in ß-cells (Fig. 6
).
Comparison of the mouse, rat, human, and chicken pdx-1 promoter regions strongly suggests that area II is found only in the mammalian gene (Fig. 1
). The mechanistic importance of this region in transcription of the mammalian gene is unknown. Because the tissue-specific expression pattern of the pdx-1 gene is similar between chicken and mammals (41), one could speculate that the condensed promoter structure of the chicken gene may be of regulatory significance (Fig. 1
). It is possible the chicken area IV (-6182 to -6047 bp) region, which has comparable activity to area II in transfection assays (Fig. 2C
), compensates for area II function.
FoxA2, Nkx2.2, and PDX-1 itself bind specifically to conserved area IV sequences in vivo and influence transfected reporter gene expression. Nkx2.2 and PDX-1 also regulate the expression of other ß-cell-enriched gene products, including the islet amyloid polypeptide, ß-glucokinase, and pax-4 genes (7, 14, 15, 16, 17, 42). In addition, FoxA2 binds to and activates from a site in areas I (25) and II (24) and PDX-1 in area I (28, 30). Removing FoxA2 in vivo specifically from ß-cells also affects pdx-1 mRNA levels (43). The FoxA2 and Nkx2.2 site mutants (alone or in combination), and not PDX-1, significantly reduced area IV-independent activation, whereas all three were required for area IV+Pst-Bst:pTk (Fig. 5
). In contrast, the FoxA2 site mutant had no effect on area II-independent activation, although it had an effect on Pst-Bst reporter activity in transfection (24, 25) and transgenic assays (27). These results highlight the importance of interactions between conserved region control factors in pdx-1 transcription.
Chromatin modification mechanisms serve a critical function in affecting the transcriptional status of genes. For example, the open chromatin domains marked by histone H3 and H4 acetylation within the human GH and the mouse ß-globin genes play a major role in regulating cell-specific expression (44, 45). However, the molecular determinants that impart these epigenetic changes are unclear. One proposed mechanism involves the recruitment of histone modifying p300/cAMP response element binding protein-associated protein-containing complexes by transcriptional activators (38). Thus, the actions of the multiple cell-enriched activators and p300/CBP have been shown to control the histone modification state surrounding the ß-globin gene locus (46). A similar mechanism appears to influence the transcriptional competency of the pdx-1 gene in ß-cells, as PDX-1 (47), HNF1
(48), and Pax6 (49) associate with p300/CBP. The presence of areas IIV within the hyperacetylated 5'-flanking domain of the pdx-1 gene implies that their collective actions serve to establish transcriptional activity by both influencing higher-order chromatin structure and by recruiting the basal transcriptional machinery. Interactions between PDX-1, Pax6, and HNF1
and the p300/CBP histone acetyltransferases likely also effect the transcriptional activation state of other ß-cell-enriched target genes, including insulin, ß-glucokinase, islet amyloid polypeptide, and GLUT2.
Islet ß-cell-specific gene expression clearly relies on the activity of many cell-enriched transcription factors, which function cooperatively to impart control (50, 51). The analysis of conserved pdx-1 control sequences has begun to provide insight into the factors involved in temporal and cell-type specific expression (24, 25, 26, 27, 28, 29, 30, 31). However, little is known about the mechanisms that are used to convert a silent gene to a transcriptionally active one. The data presented suggest that transcription factors required for activating pdx-1 also serve to influence chromatin structure. We believe that efforts focused on characterizing the regulators of conserved areas I, II, III, and IV will provide valuable information on how expression of this essential developmental and islet ß-cell activator is affected under normal and disease conditions.
 |
MATERIALS AND METHODS
|
|---|
Area IV Sequence Determination
Human, mouse, and chicken pdx-1 5'-flanking region sequences were obtained by direct sequencing of the insulin promoter factor 1 P1 clone (human) (52), p572 (mouse) (24), and cpdx-1 no. 4 (chicken) (25) plasmids, and by searching the Celera database. The DNA alignments were determined with the MacVector analysis program (Accelrys, San Diego, CA). The GenBank accession numbers for the area IV region of mouse, human, and chicken are AF334615, AF334613, and AF334614, respectively.
Transfection Constructs
Mouse (-6529 to -6010 bp, -6529 to -6183 bp, and -6182 to -6010 bp) and rat (-6200 to -5670 bp) area IV sequences were generated by PCR and cloned directly upstream of the herpes simplex virus thymidine kinase (TK) promoter region in the chloramphenicol acetyltransferase (CAT) expression vector, pTK(An) (53). The mouse area I- and II-driven pTK constructs were described previously (25). Pst-Bst:pTK contains mouse pdx-1 sequences from -2917 (PstI) to -1918 (BstEII) bp (24). The mouse area IV:Pst-Bst constructs were generated by subcloning area IV sequences directly upstream of the PstI restriction site within Pst-Bst:pTK. The QuikChange mutagenesis kit (Stratagene, La Jolla, CA) was used to generate noncomplementary transversional block and point mutations (G to T; C to A) of mouse area IV using the following oligonucleotides: FoxA2 MUT, -6264 TGGGAGAACAGCCCTGCCCGCCGCCAGAGCCC -6233; Nkx2.2 MUT, -6112 TGTGGGCAGAATGCCTTGAATTAGCTAAC -6083; PDX-1 MUT, -6110 TGGGCAGAATTAAGTGGACGGCGCTAACAAATTA -6077. All the mutated sequences are underlined, and each construct was verified by sequencing.
Cell Transfections
The monolayer cultures of ß- (HIT T-15, ßTC3, INS-1) and non-ß- (NIH3T3 and
TC6) cells were maintained and transfected as described previously (29, 30). Extracts were prepared 4048 h after transfection and analyzed for luciferase (LUC) (54) and CAT (55) activity. The CAT activity from each pdx-1:reporter construct was normalized to the LUC activity of the internal pRSVLUC control plasmid. These experiments were carried out on at least three independent occasions. The data was statistically analyzed (two-tailed t test) using the GraphPad Prism program (GraphPad Software Inc., San Diego, CA).
EMSAs
Gel shift conditions to detect Nkx2.2 (36), FoxA2 (25), and PDX-1 (30) binding were carried out as described. The TNT-coupled reticulocyte lysate system (Promega, Madison, WI) was used to in vitro transcribe and translate Nkx2.2 [pBAT11.shNkx2.2 (56)], FoxA2 [pGEM1-FoxA2 (57)], and PDX-1 (pGEM7-PDX-1). The double-stranded oligonucleotide probes were Klenow labeled with [
-32P]dATP, and the binding reactions (20 µl total volume) were conducted with in vitro-translated proteins. The conditions for the competition analyses were the same except that a 50- to 100-fold molar excess of competitor DNA was included in the mixture before addition of probe. The mouse area IV probe and competitor sequences were: FoxA2 WT, -6264 TGGGAGAACAGAAAGTAAATAAGCCAGAGCCC -6233; FoxA2 MUT, -6264 TGGGAGAACAGCCCTGCCCGCCGCCAGAGCCC -6233); Nkx2.2 WT, -6112 TGTGGGCAGAATTAAGTGGAATTAGCTAAC -6083; Nkx2.2 MUT, -6112 TGTGGGCAGAATGCCTTGGAATTAGCTAAC -6083; PDX-1 WT, -6104 GAATTAAGTGGAATTAGCTAACAAATTA -6077; PDX-1 MUT, -6110 TGGGCAGAATTAAGTGGACGGCGCTAACAAATTA -6077. The mutated nucleotides are underlined.
ChIP Assays
ßTC3 and
TC6 cells (
0.5 x 108 to 1.0 x 108) were formaldehyde cross-linked, and the sonicated protein-DNA complexes were isolated under conditions described previously (30). Sonicated chromatin was incubated for 1 h at 4 C with antisera that specifically recognized PDX-1 (1 µl; Ref. 30), Nkx2.2 (25 µl; Developmental Studies Hybridoma Bank, Iowa City, IA), FoxA2 (15 µl; Santa Cruz Biotechnology, Santa Cruz, CA), acetylated histone H3 (10 µl; Upstate Biotechnology, Lake Placid, NY), or acetylated histone H4 (10 µl; Upstate Biotechnology). Control reactions were performed in the presence of species-matched IgG (rabbit, mouse, or goat IgG; 10 µl; Santa Cruz Biotechnology) or no antibody. Antibody-protein-DNA complexes were isolated by incubation with A/G-agarose (Santa Cruz Biotechnology). PCR was performed on one tenth of the purified, immunoprecipitated DNA using Ready-to-go PCR beads (Amersham Pharmacia Biotech, Rockville, MD) and 15 pmol of each primer. The PCRs were performed under the following conditions: one cycle of 95 C for 2 min followed by 28 cycles for 30 sec at 95 C, 61 C, and 72 C. The mouse pdx-1 amplification primers were to: area I, -2785 (5'-CCACTAAGAAGGAAGGCCAG-3') to -2435 (5'-CTGAGGTTCTTTCTCTGCCTCTCTG-3'); area II, -2208 (5'-GGTGGGAAATCCTTCCCTCAAG-3') to -1927 (5'-CCTTAGGGATAGACCCCCTGC-3'); area III, -1920 (5'-CAGGTGAAGGAAGGTCCCTATCTTT-3') to -1545 (5'-AACTCTGAAAATACTTTCCCTCTTG-3'); area IV, -6529 (5'-TCTAG-AGAGTTCTTCTGTTTGCTAG-3') to -6010 (5'-CACTCTCTC-TATTCTAACTGTGACC-3'); -233 (5'-GAGAGCTCCACAGC-AGCAAGC-3') to -5 (5'-CCAGATCGCTTTGACAGTTCTCC-3'); -831 (5'-GGGAGTGTGTTCTGAGTTAATC-3') to -467 (5'-AGGTGTAAGGCACAGCGTCTAA-3'); -1294 (5'-ATCTTCCAG-TGTCCTTGGAGGA-3') to -910 (5'-TGTGACCATCCTGG-CGTCTTTA-3'); -3362 (5'-CATGGTGTTTTATCAAAGCAAT-AG-3') to -3004 (5'-GCCCTGAGTTGAGAAAACCCAAG-3'); -3914 (GTATGCAACTTCTAGGGGAGGC-3') to -3561 (5'-GTCGGGAGACCTATCTGGTGG-3'); -4657 (5'-GTATGGGTGTGTGCATGTGA-3') to -4363 (5'-CTATAGGTAGCTCACAACTG-3'); -9060 (5'-GAGAGCGTGGTTTCCTGACA-3') to -8766 (5'-TGGAGTACTGGGACTAAAGG-3'); -11,653 (5'-CCTCCAGTATTGGCACTGTA-3') to -11,346 (5'-GACACGCATACTTTCTAGCC-3'); -14,241 (5'-AGGTTAAGAGTGCCAACTGC-3') to -13,932 (5'-TGCTTCCTGAGTACTGGGAT-3'); and -16,691 (5'-CACCTCGGTGTACTCTGAGA-3') to -16,394 (5'-TCCTGCATCCATCTCGCTCT-3'). The primers used for amplification of the mouse PEPCK 5'-control region spanned -434 (5'-GAGTGACACCTCACAGCTGTGG-3') to -96 (5'-GGCAGGCCTTTGGATCATAGCC-3'). The primers used for amplification of the mouse glucagon 5'-control region spanned -353 (5'-CCAAATCAAGGGATAAGACCCTC-3') to +7 (5'-AAGCTCTGCCCTTCTGCACCAG-3'). The PCR products were confirmed by sequencing. Amplified products were electrophoresed through a 1.4% agarose gel in Tris-acetate EDTA buffer containing ethidium bromide. The band intensity of the acetylated H3 and H4 antibody immunoprecipitation products were quantitated using NIH Image Version 1.62. Band intensities (±SEM) were expressed relative to the 1% of input DNA signal. Each experiment was carried out at least three times.
 |
ACKNOWLEDGMENTS
|
|---|
The authors are grateful to all members of the Stein lab for thoughtful comments during the course of this work, as well as to Drs. Y. Fujitani and C. Wright for providing unpublished information on the areas IIII deletion in mice. We also thank Dr. Marc Montminy for providing the sequence of the rat -6200- to -5670-bp region and Dr. M. Alan Permutt for the insulin promoter factor 1P1 clone.
 |
FOOTNOTES
|
|---|
This work was supported by grants from the NIH (RO1 DK50203, to R.S.; Training Grant 5T32 CA09385-18, to J.V.) and partial support from the Vanderbilt University Diabetes Research and Training Center Molecular Biology Core Laboratory (Public Health Service Grant P60 DK20593).
Abbreviations: CAT, Chloramphenicol acetyltransferase; CBP, cAMP response element binding protein-associated protein; ChIP, chromatin immunoprecipitation; FoxA2, forkhead box A2; GLUT2, glucose transporter type 2; HNF, hepatocyte nuclear factor; LUC, luciferase; MUT, mutant; Nkx2.2, NK2 homeobox 2.2; Pcx6, paired box protein 6; PDX-1, pancreas and duodenum homeobox protein 1; PEPCK, phosphoenolpyruvate carboxykinase; TK, thymidine kinase; WT, wild-type.
Received for publication September 23, 2003.
Accepted for publication December 17, 2003.
 |
REFERENCES
|
|---|
- Larsson LI, Madsen OD, Serup P, Jonsson J, Edlund H 1996 Pancreatic-duodenal homeobox role in gastric endocrine patterning. Mech Dev 60:175184[CrossRef][Medline]
- Jonsson J, Carlson L, Edlund T, Edlund H 1994 Insulin promoter factor is required for pancreas development in mice. Nature 371:606609[CrossRef][Medline]
- Offield MF, Jetton TL, Labosky PA, Stein RW, Magnuson MA, Hogan BL, Wright CV 1996 PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983995[Abstract]
- Gannon M, Wright CVE 1999 Endodermal patterning and organogenesis. In: Moody SA, ed. Cell lineage and fate determination. San Diego: Academic Press; 583615
- Stoffers DA, Ferrer J, Clarke WL, Habener JF 1997 Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat Genet 17:138139[CrossRef][Medline]
- Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE, Teitelman G 1995 Expression of murine STF-1, a putative insulin gene transcription factor, in ß cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:1118[Abstract]
- Cissell MA, Zhao L, Sussel L, Henderson E, Stein R 2003 Transcription factor occupancy of the insulin gene in vivo. Evidence for direct regulation by Nkx2.2. J Biol Chem 278:751756[Abstract/Free Full Text]
- Ohlsson H, Karlson K, Edlund T 1993 IPF-1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:42514259[Medline]
- Olson LK, Sharma A, Peshavaria M, Wright CVE, Towle HC, Robertson RP, Stein R 1995 Reduction of insulin gene transcription in HIT T15 ß cells chronically exposed to a supraphysiological glucose concentration is associated with loss of STF-1 transcription factor. Proc Natl Acad Sci USA 92:91279131[Abstract/Free Full Text]
- Peers B, Leonard J, Sharma S, Teitelman G, Montminy MR 1995 Insulin expression in pancreatic islet cells relies on cooperative interactions between the helix-loop-helix factor E47 and homeobox factor STF-1. Mol Endocrinol 8:17981806
- Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R 1994 XlHBox8, and endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806816[Abstract]
- Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD 1994 Transcriptional regulation of the human insulin gene is dependent on the homeodomain proteins STF1/IPF1 acting through CT boxes. Proc Natl Acad Sci USA 91:1046510469[Abstract/Free Full Text]
- Waeber G, Thompson N, Nicod P, Bonny C 1996 Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol 10:13271334[Abstract]
- Bretherton-Watt D, Gore N, Boam DSW 1996 Insulin upstream factor 1 and a novel ubiquitous factor bind to the human islet amyloid polypeptide/amylin gene promoter. Biochem J 313:495502
- Carty MD, Lilliquist JS, Peshavaria M, Stein R, Soeller WC 1997 Identification of cis- and trans-active factors regulating islet amyloid polypeptide expression in pancreatic ß cells. J Biol Chem 272:1198611993[Abstract/Free Full Text]
- Watada H, Kajimoto Y, Kaneto H, Matsuoka T, Fujitani Y, Miyazaki J, Yamasaki Y 1996 Involvement of the homeodomain-containing transcription factor PDX-1 in islet amyloid polypeptide gene transcription. Biochem Biophys Res Commun 229:746751[CrossRef][Medline]
- Watada H, Kajimoto Y, Miyagawa J, Hanafusa T, Hamaguchi K, Matsuoka T, Yamamoto K, Matsuzawa Y, Kawamori R, Yamasaki Y 1996 PDX-1 induces insulin and glucokinase gene expression in
TC1 clone 6 cells in the presence of betacellulin. Diabetes:18261831
- Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H 1998 ß-Cell-specific inactivation of the mouse Ipf-1/Pdx-1 gene results in loss of the ß-cell phenotype and maturity onset diabetes. Genes Dev 12:17631768[Abstract/Free Full Text]
- Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF 1997 Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 coding sequence. Nature Genetics 15:106110[CrossRef][Medline]
- Dutta S, Bonner-Weir S, Montminy M, Wright CVE 1998 Regulatory factor linked to late-onset diabetes. Nature 392:560[Medline]
- Hani EH, Stoffers DA, Chevre JC,Durand E, Stanojevic V, Dina C, Habener JF, Froguel P 1999 Defective mutations in the insulin promoter factor-1 (IPF-1) gene in late-onset type 2 diabetes mellitus. J Clin Invest 104:R41R48
- Macfarlane WM, Frayling TM, Ellard S, Evans JC, Allen LI, Bulman MP, Ayres S, Shepherd M, Clark P, Millward A, Demaine A, Wilkin T, Docherty K, Hattersley AT 1999 Missense mutations in the insulin promoter factor-1 gene predispose to type 2 diabetes. J Clin Invest 104:R33R39
- Sharma S, Leonard J, Chapman H, Leiter E, Montminy M 1996 Pancreatic islet restricted expression of the homeobox factor STF-1 relies on an E-box motif which binds USF. J Biol Chem 271:22942299[Abstract/Free Full Text]
- Wu KL, Gannon M, Peshavaria M, Offield MF, Henderson E, Ray M, Marks A, Gamer LW, Wright CV, Stein R 1997 Hepatocyte nuclear factor 3ß is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene. Mol Cell Biol 17:60026013[Abstract]
- Gerrish K, Gannon M, Shih D, Henderson E, Stoffel M, Wright CV, Stein R 2000 Pancreatic ß cell-specific transcription of the pdx-1 gene. The role of conserved upstream control regions and their hepatic nuclear factor 3ß sites. J Biol Chem 275:34853492[Abstract/Free Full Text]
- Gannon M, Gamer LW, Wright CVE 2001 Regulatory regions driving developmental and tissue specific expression of the essential pancreatic gene pdx-1. Dev Biol 238:185201[CrossRef][Medline]
- Samaras SE, Cissell MA, Gerrish K, Wright CV, Gannon M, Stein R 2002 Conserved sequences in a tissue-specific regulatory region of the pdx-1 gene mediate transcription in pancreatic ß cells: role for hepatocyte nuclear factor 3ß and Pax6. Mol Cell Biol 22:47024713[Abstract/Free Full Text]
- Marshak S, Benshushan E, Shoshkes M, Havin L, Cerasi E, Melloul D 2000 Functional conservation of regulatory elements in the pdx-1 gene: PDX-1 and hepatocyte nuclear factor 3ß transcription factors mediate ß-cell-specific expression. Mol Cell Biol 20:75837590[Abstract/Free Full Text]
- Samaras SE, Zhao L, Means A, Henderson E, Matsuoka TA, Stein R 2003 The islet ß cell-enriched RIPE3b1/Maf transcription factor regulates pdx-1 expression. J Biol Chem 278:1226312270[Abstract/Free Full Text]
- Gerrish K, Cissell MA, Stein R 2001 The role of hepatic nuclear factor 1
and PDX-1 in transcriptional regulation of the pdx-1 gene. J Biol Chem 276:4777547784[Abstract/Free Full Text]
- Sharma S, Jhala US, Johnson T, Fereri K, Leonard J, Montminy M 1997 Hormonal regulation of an islet-specific enhancer in the pancreatic homeobox gene STF-1. Mol Cell Biol 17:25982604[Abstract]
- Workman JL, Kingston RE 1998 Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67:545579[CrossRef][Medline]
- Kornberg RD, Lorch Y 1999 Chromatin-modifying and -remodeling complexes. Curr Opin Genet Dev 9:148151[CrossRef][Medline]
- Strahl BD, Allis CD 2000 The language of covalent histone modifications. Nature 403:4145[CrossRef][Medline]
- Alberts AS, Geneste O, Treisman R 1998 Activation of SRF-regulated chromosomal templates by Rho-family GTPases requires a signal that also induces H4 hyperacetylation. Cell 92:475478[CrossRef][Medline]
- Chen H, Lin RJ, Xie W, Wilpitz D, Evans RM 1999 Regulation of hormone-induced histone hyperacetylation and gene activation via acetylation of an acetylase. Cell 98:675686[CrossRef][Medline]
- Krebs JE, Kuo MH, Allis CD, Peterson CL 1999 Cell cycle-regulated histone acetylation required for expression of the yeast HO gene. Genes Dev 13:14121421[Abstract/Free Full Text]
- Kuo MH, Allis CD 1998 Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20:615626[CrossRef][Medline]
- Parekh BS, Maniatis T 1999 Virus infection leads to localized hyperacetylation of histones H3 and H4 at the IFN-ß promoter. Mol Cell 3:125129[CrossRef][Medline]
- Monaghan AP, Kaestner KH, Grau E, Schutz G 1993 Postimplantation expression patterns indicate a role for the mouse forkhead/HNF-3
, ß and
genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development 119:567578[Abstract]
- Kim SK, Hebrok M, Melton DA 1997 Notochord to endoderm signaling is required for pancreas development. Development 124:42434252[Abstract]
- Smith SB, Watada H, Scheel DW, Mrejen C, German MS 2000 Autoregulation and maturity onset diabetes of the young transcription factors control the human PAX4 promoter. J Biol Chem 275:3691036919[Abstract/Free Full Text]
- Lee CS, Sund NJ, Vatamaniuk MZ, Matschinsky FM, Stoffers DA, Kaestner KH 2002 Foxa2 controls Pdx1 gene expression in pancreatic ß-cells in vivo. Diabetes 51:25462551[Abstract/Free Full Text]
- Elefant F, Cooke NE, Liebhaber SA 2000 Targeted recruitment of histone acetyltransferase activity to a locus control region. J Biol Chem 275:1382713834[Abstract/Free Full Text]
- Forsberg EC, Downs KM, Christensen HM, Im H, Nuzzi PA, Bresnick EH 2000 Developmentally dynamic histone acetylation pattern of a tissue-specific chromatin domain. Proc Natl Acad Sci USA 97:1449414499[Abstract/Free Full Text]
- Kiekhaefer CM, Grass JA, Johnson KD, Boyer ME, Bresnick EH 2002 Hematopoietic-specific activators establish an overlapping pattern of histone acetylation and methylation within a mammalian chromatin domain. Proc Natl Acad Sci USA 99:1430914314[Abstract/Free Full Text]
- Qiu Y, Guo M, Huang S, Stein R 2002 Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA2, and E47. Mol Cell Biol 22:412420[Abstract/Free Full Text]
- Soutoglou E, Papafotiou G, Katrakili N, Talianidis I 2000 Transcriptional activation by hepatocyte nuclear factor-1 requires synergism between multiple coactivator proteins. J Biol Chem 275:1251512520[Abstract/Free Full Text]
- Hussain MA, Habener JF 1999 Glucagon gene transcription activation mediated by synergistic interactions of pax-6 and cdx-2 with the p300 co-activator. J Biol Chem 274:2895028957[Abstract/Free Full Text]
- Sander M, German MS 1997 The ß cell transcription factors and development of the pancreas. J Mol Med 75:327340[CrossRef][Medline]
- Stein R 2001 Insulin gene transcription: factors involved in cell type-specific and glucose-regulated expression in islet ß cells are also essential during pancreatic development. In: Jefferson LS, Cherrington AD, Goodman HM, eds. Handbook of physiology. Section 7: the endocrine system. New York: Oxford University Press; 2547
- Inoue H, Riggs AC, Tanizawa Y, Ueda K, Kuwano A, Liu L, Donis-Keller H, Permutt MA 1996 Isolation, characterization, and chromosomal mapping of the human insulin promoter factor 1 (IPF-1) gene. Diabetes 45:789794[Abstract]
- Jacoby DB, Zilz ND, Towle ND 1989 Sequences within the 5'-flanking region of the S14 gene confer responsiveness to glucose in primary hepatocyte. J Biol Chem 264:1762317626[Abstract/Free Full Text]
- DeWet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene:structure and expression in mammalian cells. Mol Cell Biol 7:725737[Abstract/Free Full Text]
- Nordeen SK, Green III PP, Fowles DM 1987 Laboratory methods. A rapid, sensitive and inexpensive assay for chloramphenicol acetyltransferase. DNA 6:173178[Medline]
- Watada H, Mirmira RG, Kalamaras J, German MS 2000 Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins. Proc Natl Acad Sci USA 97:94439448[Abstract/Free Full Text]
- Samadani U, Qian X, Costa RH 1996 Identification of a transthyretin enhancer site that selectively binds the hepatocyte nuclear factor-3ß isoform. Gene Expr 6:2333[Medline]
- Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:11451156[Medline]
- Overdier DG, Porcella A, Costa RH 1994 The DNA binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino acid residues adjacent to the recognition helix. Mol Cell Biol 14:27552766[Abstract/Free Full Text]
- Naya FJ, Stellrecht MM, Tsai MJ 1995 Tissue-specific-regulation of the insulin gene by a novel helix-loop-helix transcription factor. Gene Dev 9:10091019[Abstract/Free Full Text]
- Whelan J, Poon D, Weil PA, Stein R 1989 Pancreatic ß-cell-type-specific expression of the rat insulin II gene is controlled by positive and negative cellular transcriptional elements. Mol Cell Biol 9:32533259[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
P. O. Wiebe, J. D. Kormish, V. T. Roper, Y. Fujitani, N. I. Alston, K. S. Zaret, C. V. E. Wright, R. W. Stein, and M. Gannon
Ptf1a Binds to and Activates Area III, a Highly Conserved Region of the Pdx1 Promoter That Mediates Early Pancreas-Wide Pdx1 Expression
Mol. Cell. Biol.,
June 1, 2007;
27(11):
4093 - 4104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Eto, V. Kaur, and M. K. Thomas
Regulation of Pancreas Duodenum Homeobox-1 Expression by Early Growth Response-1
J. Biol. Chem.,
March 2, 2007;
282(9):
5973 - 5983.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Raum, K. Gerrish, I. Artner, E. Henderson, M. Guo, L. Sussel, J. C. Schisler, C. B. Newgard, and R. Stein
FoxA2, Nkx2.2, and PDX-1 Regulate Islet {beta}-Cell-Specific mafA Expression through Conserved Sequences Located between Base Pairs -8118 and -7750 Upstream from the Transcription Start Site
Mol. Cell. Biol.,
August 1, 2006;
26(15):
5735 - 5743.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev,
April 1, 2006;
86(2):
465 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Fujitani, S. Fujitani, D. F. Boyer, M. Gannon, Y. Kawaguchi, M. Ray, M. Shiota, R. W. Stein, M. A. Magnuson, and C. V.E. Wright
Targeted deletion of a cis-regulatory region reveals differential gene dosage requirements for Pdx1 in foregut organ differentiation and pancreas formation
Genes & Dev.,
January 15, 2006;
20(2):
253 - 266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Van Velkinburgh, S. E. Samaras, K. Gerrish, I. Artner, and R. Stein
Interactions between Areas I and II Direct pdx-1 Expression Specifically to Islet Cell Types of the Mature and Developing Pancreas
J. Biol. Chem.,
November 18, 2005;
280(46):
38438 - 38444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. K. Hagman, L. B. Hays, S. D. Parazzoli, and V. Poitout{paragraph}
Palmitate Inhibits Insulin Gene Expression by Altering PDX-1 Nuclear Localization and Reducing MafA Expression in Isolated Rat Islets of Langerhans
J. Biol. Chem.,
September 16, 2005;
280(37):
32413 - 32418.
[Abstract]
[Full Text]
[PDF]
|
 |
|