help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0384
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herzog, B.
Right arrow Articles by Granner, D. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herzog, B.
Right arrow Articles by Granner, D. K.
Molecular Endocrinology 18 (4): 807-819
Copyright © 2004 by The Endocrine Society

Peroxisome Proliferator-Activated Receptor {gamma} Coactivator-1{alpha}, as a Transcription Amplifier, Is Not Essential for Basal and Hormone-Induced Phosphoenolpyruvate Carboxykinase Gene Expression

Birger Herzog, Robert K. Hall, Xiaohui L. Wang, Mary Waltner-Law and Daryl K. Granner

Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine and Veteran’s Affairs Medical Center, Nashville, Tennessee 37232-0615

Address all correspondence and requests for reprints to: Daryl K. Granner, Department of Molecular Physiology and Biophysics, 707 Light Hall, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0615. E-mail: daryl.granner{at}vanderbilt.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Phosphoenolpyruvate carboxykinase (PEPCK) catalyzes the initial step in hepatic gluconeogenesis. In the fasted state, PEPCK gene expression is activated by glucagon (via cAMP) and glucocorticoids. Peroxisome proliferator-activated receptor {gamma} coactivator 1{alpha} (PGC-1{alpha}) plays an important role in energy homeostasis and is considered to be a key regulator of hepatic gluconeogenesis in response to fasting. It is not clear whether PGC-1{alpha} is obligatory for the activation of the transcription program of gluconeogenic genes, or whether it amplifies an existing process. H4IIE hepatoma cells were used to address this key point. These cells respond appropriately to all of the hormones involved in the regulation of gluconeogenic genes, yet they are devoid of PGC-1{alpha}. Also, these hormone responses occur in the absence of ongoing protein synthesis, so the necessary complement of transcription factors exists in untreated cells. However, exogenous expression of PGC-1{alpha} in these cells does enhance basal and hormone-induced expression of the PEPCK and glucose-6-phosphatase genes. Mutational analyses of the PEPCK gene promoter reveal that one element in the PEPCK gene promoter, glucocorticoid accessory factor 3, which binds chicken ovalbumin upstream promoter-transcription factor, is of particular importance. Taken together, these data suggest that, under chronic fasting conditions, i.e. when high levels of cAMP and glucocorticoids induce PGC-1{alpha} expression, this coactivator markedly amplifies PEPCK gene expression and gluconeogenesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PHOSPHOENOLPYRUVATE CARBOXYKINASE (EC 4.1.1.32; PEPCK) catalyzes the irreversible conversion of oxaloacetate to phosphoenolpyruvate, an important initial step in hepatic gluconeogenesis (1, 2). The critical role of PEPCK in the primary route of hepatic gluconeogenesis is supported by the results of studies in which the gene is selectively eliminated in mice (3). PEPCK gene transcription is tightly regulated by glucagon, glucocorticoids, retinoic acid, thyroid hormone, and insulin (4, 5) as well as glucose (6). Each of the hormones exerts its effect through a hormone response unit, which consists of a complex array of DNA elements and associated transcription factors (7).

For example, induction of PEPCK gene expression by glucocorticoids is mediated through a complex glucocorticoid response unit (GRU) composed of two nonconsensus, low-affinity glucocorticoid receptor (GR) binding sites, three adjacent accessory factor elements [glucocorticoid accessory factor (gAF) 1–3] (see Fig. 6Go), and a downstream cAMP response element (CRE). Each of these elements has been shown to bind several transcription factors, such as retinoic acid receptor (RAR), retinoid X receptor (RXR) (8) forkhead box (FOX) family members (9), CCAAT/enhancer-binding protein (C/EBP) {alpha}, and cAMP response element binding protein (CREB) (10), but various experimental approaches have demonstrated that chicken ovalbumin upstream promoter-transcription factor (COUP-TFI) and hepatic nuclear factor (HNF)-4{alpha} mediate the accessory activity of the gAF1 element, whereas FOXA2 (HNF-3ß), COUP-TFI, and C/EBPß mediate the accessory activity of gAF2, gAF3, and the CRE, respectively (10, 11, 12, 13, 14). Mutation of any one of these elements results in a blunted glucocorticoid response and mutation of any two abolishes the response. Previous work suggests that these factors provide an environment that stabilizes GR binding to the PEPCK promoter (15, 16). Thus, the dissociation rate of GR is differentially slowed by the gAF1/gAF3 or gAF2 elements that bind functionally distinct accessory factors, COUP-TFI/HNF-4{alpha} and FOXA2, respectively. How these different accessory factors exert their function remains to be investigated. Some of these elements are also part of other hormone response units. For example, the gAF3 site is also part of the cAMP response unit (17).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6. Model of the Interaction of PGC-1{alpha} with Components of the PEPCK Gene GRU

In the wild-type PEPCK gene promoter, with low-affinity GR binding sites (A), the accessory factors HNF-4{alpha} and COUP-TFI facilitate high-affinity binding of GR (16 ). We propose that this allows PGC-1{alpha} to form a functional complex that amplifies PEPCK gene expression (note arrow width). FOXA2 also enhances GR binding to the PEPCK gene promoter, perhaps through a direct interaction with GR (41 ) but is not involved in the PGC-1{alpha} effect. In the absence of gAF1 and/or gAF3 (B), this complex does not form and transcription, even in the presence of ligand-bound GR, is reduced. When a high-affinity GR binding site is substituted for GR1 (e.g. a palindromic GRE), COUP-TF and HNF-4{alpha} are not required for complex formation between PGC-1{alpha} and the GRU (C).

 
GR, COUP-TFI, and HNF-4{alpha} are members of the nuclear receptor superfamily of transcription factors (18, 19), whereas FOXA2 (HNF-3ß) is a member of the forkhead family of transcription factors (20, 21) and C/EBPß is a member of the basic-leucine zipper family of proteins (22). These DNA-binding transcription factors function by recruiting coregulators to the promoter, which in turn results in the activation or repression of transcription (23). Several coactivators appear to be involved in transactivation through the PEPCK gene promoter, including steroid receptor coactivator-1 (SRC-1), GR-interacting protein-1 (GRIP-1), cAMP response element binding protein-binding protein/p300 (CBP/p300), sterol regulatory element-binding protein (SREBP-1), and SNF2-related-CBP-activator protein (SCRAP) (24, 25, 26, 27). It is not clear whether any or all of these proteins serve obligatory roles, whether a selection of different combinations suffices, or if some act to amplify an existing, lower level response.

Many coactivators are ubiquitously expressed and are recruited to specific promoters by ligand-activated nuclear receptors to form a functional complex with other components of the transcription machinery (23). Certain coactivators, however, are expressed in a tissue-specific manner and are involved in specific metabolic processes. For example, the peroxisome proliferator-activated receptor {gamma} coactivator 1{alpha} (PGC-1{alpha}) is induced in brown adipose tissue by exposure to cold temperature, and it is a key regulator of the transcriptional program required for thermogenesis (28). PGC-1{alpha} is also expressed in muscle and heart as well as liver and kidney, the two organs primarily responsible for gluconeogenesis. Fasting leads to an induction of PGC-1{alpha} gene expression in liver (29), and glucocorticoids and cAMP induce PGC-1{alpha} mRNA expression in isolated hepatocytes (30). The induction of PEPCK, fructose-1,6-bisphosphatase (FBPase), and glucose-6-phosphatase (G6Pase) gene expression by PGC-1{alpha} has led to the suggestion that it is a critical regulator of gluconeogenesis in response to fasting (31, 32). In support of this view, insulin is an important regulator of PGC-1{alpha} expression as demonstrated by its altered regulation in mouse models of impaired insulin function (32) and in transfection studies in which insulin represses a PGC-1{alpha} promoter-driven reporter gene (33).

This paper presents studies concerning the role PGC-1{alpha} plays in basal and hormone-induced PEPCK gene expression. Although H4IIE cells are deficient in PGC-1{alpha} mRNA and protein, the PEPCK and G6Pase genes are regulated by glucocorticoids, cAMP and insulin, the major effectors of the gluconeogenic program. Glucocorticoids and cAMP do not induce PGC-1{alpha} in H4IIE cells, and the acute effects of these agents do not require ongoing protein synthesis. By contrast, the exogenous expression of PGC-1{alpha} enhances basal and hormone-induced expression of the PEPCK and G6Pase genes in H4IIE cells and in isolated hepatocytes. We used transient transfection and mutation analyses to identify the promoter elements responsible for the PGC-1{alpha}-mediated increase of basal and hormone-induced PEPCK gene expression. The gAF3 element (which binds COUP-TFI) is of critical importance for the effect of this coactivator on basal expression; gAF1 (which binds COUP-TFI and HNF-4{alpha}) contributes less to the effect, and gAF2 (which binds FOXA2) is not involved. Substitution of the weak, nonconsensus binding sites for the glucocorticoid receptor in the PEPCK GRU with a high-affinity, consensus GRE relieves the requirement for COUP-TFI and HNF-4{alpha}, which appear to promote complex formation between PGC-1{alpha} and GR in the wild-type PEPCK gene promoter (Fig. 6Go). PGC-1{alpha} thus is not an obligatory factor for PEPCK gene expression, but it does play an important amplifying role.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Correlation of PGC-1{alpha} and PEPCK Gene Expression in H4IIE Hepatoma Cells and Isolated Hepatocytes
PGC-1{alpha} mRNA cannot be detected in H4IIE rat hepatoma cells and in primary hepatocytes isolated from rats (Fig. 1AGo), and Western blot analyses failed to detect any PGC-1{alpha} protein in these cells (data not shown). Previous studies showed that fasting induces PEPCK and PGC-1{alpha} mRNA expression in rats (29, 30). cAMP and glucocorticoids, the main signals of fasting, fail to induce PGC-1{alpha} mRNA in H4IIE cells, but do induce this mRNA in isolated hepatocytes, as does fasting in liver (Fig. 1AGo). Setting the signal of H4IIE cells and basal hepatocytes at 1, the relative values for PGC-1{alpha} mRNA in treated hepatocytes is about 9.8; in fed liver, 5.7; and in fasted liver, 15.4. Similar results were obtained for PGC-1ß (data not shown), but this isoform is a weak activator of the expression of gluconeogenic genes and was therefore not further investigated (34). As noted previously, cAMP and glucocorticoids induce PEPCK mRNA expression by about 8-fold in H4IIE cells (35) (Fig. 1BGo). A significant induction of G6Pase mRNA expression was also observed, as expected (36) (Fig. 1BGo). The same experiment was performed using hepatocytes isolated from fed rats. In these cells, basal PGC-1{alpha} expression is induced about 20-fold after a 4-h treatment with dexamethasone and cAMP (Fig. 1AGo). Interestingly, the fold induction of PEPCK and G6Pase mRNAs by these hormones in primary hepatocytes (Fig. 1CGo) is much higher than that noted in H4IIE cells (Fig. 1BGo). These observations suggest that PGC-1{alpha} is not required for basal expression of the PEPCK gene but that its expression amplifies the action of glucocorticoids and cAMP on the PEPCK and G6Pase genes. Finally, the induction of PEPCK gene expression by cAMP and glucocorticoids in H4IIE cells is independent of ongoing protein synthesis (Fig. 1DGo); thus, de novo synthesis of transcription factors, presumably including PGC-1{alpha}, is not required for the acute effects of hormones on PEPCK gene expression.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. Induction of PEPCK, G6Pase, and PGC-1{alpha} mRNA Expression by Dexamethasone and cAMP

A, PCR products obtained after 28 cycles with PGC-1{alpha} or cyclophilin-specific primers were visualized on an agarose gel. Template RNAs were isolated from H4IIE cells, primary hepatocytes that were not treated (N) or were treated with dexamethasone and cAMP (DC) for 16 h or rat livers from fed or 24 h-fasted animals. H4IIE cells (B) or primary hepatocytes (C) were treated for 4 h with dexamethasone and cAMP (DC). PEPCK, G6Pase, and PGC-1{alpha} mRNAs were determined using quantitative real-time PCR and the results were compared with untreated cells (N). Results were normalized to cyclophilin mRNA and are expressed as the fold induction ± SEM as compared with untreated cells. The results represent three to six separate experiments. D, H4IIE cells were treated with no hormone (N), dexamethasone (D), or D and cAMP (DC) for 2 h in the presence or absence of 10 µM cycloheximide. PEPCK mRNA was quantified using real-time PCR. The data, expressed as described above, represent four to seven separate experiments.

 
PGC-1{alpha} Expression in H4IIE Cells Induces PEPCK and G6Pase Gene Expression and Enhances the Effect of Glucocorticoids
PGC-1{alpha} is proposed to be a key regulator of hepatic gluconeogenesis (32), a metabolic pathway that is stimulated by cAMP and glucocorticoids. Adenoviruses expressing either green fluorescent protein (GFP) and PGC-1{alpha}, or GFP alone, were used to investigate the relationship between PGC-1{alpha} and glucocorticoids. Total H4IIE cell RNA was harvested 48 h after infection and PEPCK, FBPase, G6Pase, and liver-pyruvate kinase (L-PK) mRNAs were quantified using real-time PCR. As illustrated in Fig. 2AGo, the endogenous G6Pase and PEPCK genes are strongly induced by PGC-1{alpha} in the absence of hormones. The action of PGC-1{alpha} is specific for gluconeogenic genes because the expression of L-PK mRNA is not further increased by this coactivator. By contrast, the gene encoding FBPase, which is mainly regulated by allosteric effectors, is highly expressed in H4IIE cells but is minimally induced by PGC-1{alpha} (<2-fold, data not shown). PEPCK gene induction by PGC-1{alpha} was also observed in another hepatoma cell line (HepG2) to an extent comparable to that noted in H4IIE cells (data not shown). These observations show that PGC-1{alpha} can indeed activate the expression of genes that encode proteins involved in the gluconeogenic pathway in liver-derived cell lines.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Induction of Genes of Gluconeogenesis by PGC-1{alpha}

A, H4IIE cells were infected with a PGC-1{alpha} and GFP-expressing adenovirus (GFP/PGC-1{alpha}) at a titer of approximately 7.5 x 108 plaque-forming units/ml. RNA was harvested after 48 h. cDNA segments of the indicated genes were quantified using real-time PCR and are expressed relative to samples that were infected with a GFP expression virus. B, H4IIE cells were infected with a GFP or GFP/PGC-1{alpha} expressing adenovirus, as described above. PEPCK mRNA was measured in cells that were treated with serum-free medium (N), dexamethasone (D), or D and cAMP (DC). Results were normalized to cyclophilin and expressed as the fold increase ± SEM compared with cells infected with a GFP expressing control virus. The results represent three independent experiments.

 
The effect of PGC-1{alpha} on the induction of the PEPCK and G6Pase genes by glucocorticoids and cAMP was examined next. As illustrated in Fig. 2BGo, PGC-1{alpha} expression enhances PEPCK and G6Pase mRNA induction by glucocorticoids alone, or in combination with cAMP. The relative response of PEPCK gene expression, however, remains the same because PGC-1{alpha} causes about a 5-fold increase of the basal mRNA level. Similar results were observed with G6Pase. PGC-1{alpha} elevates basal expression of this gene about 8-fold and dexamethasone and cAMP further induce the expression of G6Pase mRNA.

To investigate the promoter elements required for the PGC-1{alpha} effect on genes of gluconeogenesis, we first needed to establish that reporter gene constructs, which contain the PEPCK, FBPase, or G6Pase gene promoters, respond like the endogenous genes. As shown in Table 1Go, PGC-1{alpha} stimulates transcription of the PEPCK and G6Pase reporter gene constructs to a great extent; however, it has no effect on the FBPase reporter gene. The G6Pase and PEPCK reporter gene constructs are induced by dexamethasone, and the addition of PGC-1{alpha} results in an enhanced effect on expression from these reporter genes. Dexamethasone and PGC-1{alpha} have no effect on FBPase reporter gene expression (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of PGC-1{alpha} Cotransfection on PEPCK, FBPase, and G6Pase Reporter Gene Activities

 
PGC-1{alpha} Activates the PEPCK Promoter through the Orphan Nuclear Receptors HNF-4{alpha} and COUP-TFI
We generated a series of mutations, known to prevent accessory factor binding, to identify the DNA elements required for the PGC-1{alpha} effect on the PEPCK gene, as shown in Fig. 3AGo. Two elements, gAF1 and gAF3, are required for the effect of PGC-1{alpha} in the absence of hormones because block mutations of these elements, which have no effect on basal expression per se, resulted in a 50% and 90% loss of the PGC-1{alpha} effect, respectively (Fig. 3AGo). By contrast, the mutation of gAF2 had no effect on the PGC-1{alpha}-enhanced expression of the reporter gene. A double mutation of gAF1 and gAF3 almost abolished the effect of PGC-1{alpha} (mAF1 + AF3). The gAF1 element binds HNF-4{alpha} and COUP-TFI and the gAF3 site binds only COUP-TFI (12, 14). The gAF3 element seems to be more important for the PGC-1{alpha} effect, as a mutation of this element almost eliminates the PGC-1{alpha} response, whereas a mutation of gAF1 resulted only in an about 50% reduction of this effect. We therefore tested whether the relative positions of these elements, or the factors that bind to them, are important. We found that the gAF1 and gAF3 sites are interchangeable, as replacing the gAF3 site with gAF1 had no effect on expression in response to PGC-1{alpha} (compare constructs WT and AF1AF1 in Fig. 3BGo). We next compared two constructs that had a mutated gAF1 site and either the wild-type gAF3 sequence (mAF1 in Fig. 3AGo) or this element replaced by the gAF1 sequence (mAF1AF1 in Fig. 3BGo). Both constructs retain a significant, but reduced, 10-fold PGC-1{alpha} response, which leads us to conclude that the position relative to the transcription start site, rather than the exact sequence of these elements, is important.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. Activation of the PEPCK Gene Promoter by PGC-1{alpha} through COUP-TFI and HNF-4{alpha}

A, Elements of the PEPCK glucocorticoid response unit are shown in order relative to the transcription start site. Transient transfection of H4IIE cells with reporter constructs that contain mutations of individual elements were performed. Luciferase activity was measured after an 18-h incubation. The data represent the fold increase of activity caused by PGC-1{alpha} cotransfection as compared with transfection with an empty expression vector. B, Additional constructs were tested to investigate the relative contributions of gAF1 and gAF3. Plasmids with consensus binding sites for COUP-TF and HNF-4{alpha} were used to investigate the role of these factors in the effect of PGC-1{alpha}. Data are expressed as the fold increase caused by PGC-1{alpha} ± SEM as compared with transfection with an empty expression vector. The data represent the results from three to 10 independent experiments.

 
The gAF1 site binds both HNF-4{alpha} and COUP-TFI. We used previously characterized consensus binding sites for each of these orphan nuclear receptors (12, 37) to test whether both can coactivate with PGC-1{alpha}. Replacing gAF1 with a consensus HNF-4{alpha} or COUP-TFI site resulted in comparable, wild-type PGC-1{alpha} responses (see AF1COUP vs. AF1HNF-4 in Fig. 3BGo). Also, replacing gAF1 and gAF3 with a COUP-TFI consensus sequence results in a full PGC-1{alpha} activation that is comparable to that elicited from the wild-type construct (AF1 + 3COUP in Fig. 3BGo). This observation suggests that both HNF-4{alpha} and COUP-TFI can mediate the PGC-1{alpha} effect in the absence of hormones.

The gAF3 element consists of three sites, defined by transcription factor contact points, termed {alpha}, ß, and {gamma}, respectively (8). The {alpha} site is critical for the binding of a RAR/RXR heterodimer, whereas the {gamma} site binds both COUP-TFI and RAR/RXR and is required for the glucocorticoid effect (14). HNF-4{alpha} does not bind to the gAF3 element (14). The {alpha} site of gAF3 was mutated to test whether a nonliganded RAR/RXR heterodimer contributes to the effect of PGC-1{alpha} on the PEPCK promoter. This mutation had no effect on the response to PGC-1{alpha} (mAF3{alpha} in Fig. 3BGo), whereas a mutation of the {gamma} site in this element resulted in the same effect as the block mutation of gAF3 (compare mAF3 in Fig. 3AGo and mAF3{gamma} in Fig. 3BGo). Furthermore, replacing gAF1 and gAF3 with consensus RAR/RXR binding sites resulted in a construct that failed to show activation by PGC-1{alpha} in the absence of hormones (data not shown). These results suggest that nonliganded RAR/RXR heterdimers do not contribute to the PGC-1{alpha} effect and emphasize the importance of COUP-TFI at the gAF3 element.

COUP-TFI, HNF-4{alpha}, GR, and PGC-1{alpha} Bind to the PEPCK Promoter in Vivo
GR translocation to the nucleus and its binding to target DNA elements is ligand dependent (38). We performed the chromatin immunoprecipitation (ChIP) assay on untreated, or on dexamethasone and cAMP-treated H4IIE cells to test whether the in vivo binding of HNF-4{alpha} and COUP-TFI, which serve as accessory factors for GR on the PEPCK promoter, is hormone dependent. Cross-linked and sheared chromatin was subjected to precipitation with either anti-GR, anti-HNF-4{alpha}, anti-COUP-TFI antibodies or a no-antibody control. PEPCK gene promoter segments were amplified using primers spanning the GRU region, or a far upstream region (-1.7 kb), as a control. As shown in Fig. 4AGo, we observed ligand-dependent binding of GR to the GRU-containing region of the PEPCK promoter, as expected (39). No binding to the upstream region was observed (data not shown). Treatment of cells with cAMP served as a control and showed, as anticipated, no GR recruitment. By contrast, we observed constitutive binding of COUP-TFI and HNF-4{alpha} to the promoter. This observation confirms previous results for the binding of HNF-4{alpha} and GR to the PEPCK gene promoter (39) and shows that COUP-TFI also binds to the GRU region of the promoter in H4IIE cells in vivo. PGC-1{alpha} is not bound to the PEPCK gene promoter in untreated H4IIE cells, nor is it bound after treatment of the cells with Dex and cAMP (Fig. 4CGo). This is not surprising given the observation that these cells have undetectable amounts of PGC-1{alpha} mRNA and protein (see above). H4IIE cells were infected with an adenovirus that expresses PGC-1{alpha} to ascertain whether this coregulator can bind to the PEPCK gene promoter. As shown in Fig. 4CGo, binding is readily detected in the infected cells in both the basal and Dex-induced conditions. The lack of hormone dependency in this binding is in accord with the functional data illustrated in Table 1Go.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4. In Vivo Binding of the Glucocorticoid Receptor, COUP-TFI, HNF-4{alpha}, and PGC-1{alpha} to the PEPCK Gene Promoter

A, ChIP, using antibodies directed against the indicated proteins, was performed after cells were treated for 2 h with serum-free medium (N), dexamethasone (D), or cAMP (C). The immunoprecipitated DNA fragments were amplified by PCR using primers specific for the PEPCK gene promoter (see Materials and Methods). The data shown are representative of three to six individual experiments. B, The results of three to six individual experiments were quantified using real-time PCR. The numbers represent the average signal detected compared with the no antibody controls, which are set at 1.0. C, This is a representative experiment in which H4IIE cells were infected with adenoviruses that express either GFP or PGC-1{alpha}. 36 h later the cells were treated with dexamethasone (D) or kept in serum-free medium (N) for 30 min and ChIP assays were performed using antibodies directed against the indicated proteins, as described in Materials and Methods.

 
PGC-1{alpha} Requires an Intact PEPCK GRU to Enhance the Glucocorticoid Response
We observed an enhanced glucocorticoid response of the PEPCK gene in the presence of PGC-1{alpha}, on both the endogenous and reporter gene promoters (Fig. 2Go; Table 1Go). PGC-1{alpha} can interact with and coactivate transcription with the glucocorticoid receptor (40). Therefore, additional reporter constructs were analyzed to test whether the glucocorticoid receptor and accessory factors contribute equally to PGC-1{alpha}-enhanced expression in the presence of glucocorticoids. As illustrated in Fig. 5AGo, a transfected wild-type PEPCK reporter gene construct is induced about 100-fold in the presence of both dexamethasone and PGC-1{alpha} in H4IIE cells. A mutation of any of the accessory elements results in a 50% reduction of the glucocorticoid response per se, as reported previously (15). However, the effect of these mutations differs significantly in the presence of PGC-1{alpha} and glucocorticoids. A mutation of gAF1 or gAF3 results in a blunted PGC-1{alpha}-enhanced glucocorticoid response, and the gAF3 mutation has the most profound effect. However, a reporter gene with a mutation of the gAF2 element retains most of the PGC-1{alpha} effect. These data suggest that HNF-4{alpha} and COUP-TFI are required for the formation of a functional complex between PGC-1{alpha} and GR, and that COUP-TFI may be the more important of the two.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. The Role of the gAF3 Element in the PGC-1{alpha}-Enhanced Glucocortiocoid Response

A, Reporter constructs with the wild type promoter (WT), and others with mutations in the gAF1 (mAF1), gAF2 (mAF2), or gAF3 (mAF3) elements, were transiently transfected into H4IIE cells. Cells were treated for 18 h with dexamethasone (D) and cotransfected with PGC-1{alpha}, as indicated. Results obtained from the reporter gene analysis in four to six independent experiments are shown. B, The GR1 site in the PEPCK promoter was replaced with a palindromic GR binding sequence in the context of intact (palGR) or mutated (palGRmAF1 + 3) accessory elements. The results from four to six independent experiments represent the mean fold increase ± SEM as compared with untreated cells.

 
High-Affinity Binding of GR Is Required for the PGC-1{alpha} Effect in the Presence of Glucocorticoids
The accessory factors in the PEPCK GRU are required to facilitate the high affinity binding of the glucocorticoid receptor to the promoter, as shown by fluorescence anisotropy experiments (16). However, these proteins might exert this role in different ways—FOXA2 (HNF-3ß) by a direct interaction with GR, as observed in vitro (41), and COUP-TFI and HNF-4{alpha} by promoting the formation of complexes with coactivators like PGC-1{alpha} (Fig. 6Go).

To further test this idea, we changed the GR1 site to a palindromic sequence that binds the glucocorticoid receptor with an approximately 30 times higher affinity than does GR1 (16). This maneuver results in a strong increase in the dexamethasone response because the palindromic GRE results in about a 60-fold induction compared with the 8-fold obtained with the wild-type GR1 (15) (Fig. 5Go, A and B). The addition of PGC-1{alpha} further enhances this effect, to about a 500-fold induction. Mutation of both gAF1 and gAF3 (see palGRmAF1 + 3 in Fig. 5BGo) resulted in a total loss of the basal PGC-1{alpha} effect, as expected (compare with Fig. 3AGo), but only a minor reduction of the dexamethasone response, which is similar to results observed previously (15). However, when PGC-1{alpha} was provided and dexamethasone was added, mutations of the gAF1 and gAF3 sites had no effect. This result suggests that, in the presence of high affinity binding of GR to the GRE, the glucocorticoid receptor can interact directly with PGC-1{alpha} and that COUP-TFI and HNF-4{alpha} are no longer required to position this coactivator on the promoter (Fig. 6Go).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The gluconeogenic pathway converts noncarbohydrate precursors into glucose and helps sustain a normal blood glucose concentration under fasting conditions. This process is regulated at various steps by several hormones and signal transduction mechanisms to achieve an appropriate response to variable physiological demands, which require increased or decreased rates of glucose production (2). PEPCK catalyzes the first irreversible step in this process, the conversion of oxaloacetate to phosphoenolpyruvate. Expression of the PEPCK gene is enhanced by glucagon (acting via cAMP), glucocorticoids, retinoic acid, thyroid hormone, and it is decreased by insulin and glucose. We previously showed that the short-term regulation of PEPCK gene transcription by cAMP and insulin is exerted within minutes and is independent of ongoing protein synthesis (4). We show here that the same is true for glucocorticoids (Fig. 1DGo). Thus, the complement of coregulators and transcription factors present when these hormones are added is sufficient for these early effects.

These hormone effects have been defined in H4IIE cells. The observation that PGC-1{alpha} is not present in detectable amounts in these cells (Fig. 1Go), nor is it detectable on the PEPCK gene promoter (Fig. 4Go), implies that this coregulator may not be a necessary component of the PEPCK gene transcription complex. Nonetheless, our results do show that PGC-1{alpha}, when provided from an exogenous source, increases both basal and glucocorticoid/cAMP-induced expression of the PEPCK and G6Pase genes in H4IIE cells. In this context, it is noteworthy that glucocorticoids and cAMP, which are signals of fasting and regulate gluconeogenic demands in animals, induce PGC-1{alpha} in isolated hepatocytes. Interestingly, these cells show increased responses of the PEPCK and G6Pase genes to these effectors, as compared with H4IIE cells, in which PGC-1{alpha} is not expressed or induced. It is conceivable that PGC-1{alpha} induction by long-term fasting is important for increased hepatic glucose production as a second, delayed level of regulation. In fact, such a long-term effect of glucocorticoids in primary hepatocytes has been reported (42). It is also important to note that the induction of PEPCK gene expression by glucocorticoids and cAMP precedes that of PGC-1{alpha} (30).

PGC-1{alpha} coactivates transcription with a number of ligand-bound nuclear receptors (40). Using transient transfection and in vivo binding assays, we identified the orphan nuclear receptors COUP-TFI and HNF-4{alpha} as targets for PGC-1{alpha} on the PEPCK promoter. A previous report noted that HNF-4{alpha} is critical for this effect (32), and this was supported by the observation that PGC-1{alpha} does not induce PEPCK gene expression in hepatocytes derived from animals with a liver-specific HNF-4{alpha} knockout (32, 43). This observation is somewhat surprising because HNF-4{alpha} binds only to the gAF1 accessory element in the PEPCK promoter, whereas COUP-TFI binds to both gAF1 and gAF3. We also found that when gAF1 is replaced with an element that binds COUP-TFI but not HNF-4{alpha}, the response to PGC-1{alpha} is the same as that obtained with the wild-type gAF1 sequence. These apparently disparate observations can be reconciled if the HNF-4{alpha} knockout, which has a severe metabolic phenotype (44), results in a changed expression pattern of an hepatic transcription factor network which includes COUP-TFI.

The involvement of PGC-1{alpha} in target gene promoters is apparently quite complex. PGC-1{alpha}-mediated expression of the PEPCK gene requires both HNF-4{alpha} and COUP-TFI promoter binding elements, whereas PGC-1{alpha} has no effect on the L-PK gene promoter even though COUP-TFI and HNF-4{alpha} both bind to this promoter (45). Other hepatic genes, like carnitine palmitoyl transferase 1 and medium-chain acyl-CoA dehydrogenase, which are essential for fatty acid transport and oxidation, do not require HNF-4{alpha} for activation by PGC-1{alpha} (43). Interestingly, the PGC-1{alpha} effect on G6Pase gene expression is more profound than on PEPCK gene expression. An HNF-4{alpha} binding site that is critical for the PGC-1{alpha} effect has recently been identified in the G6Pase promoter. It is located much closer to the TATA box than are the gAF1 and gAF3 elements in the PEPCK promoter, which might account for this difference (46).

A recent study suggests that FOXO1, another member of the winged helix/forkhead transcription factor family, is critical for the regulation of gluconeogenesis by PGC-1{alpha} (47). FOXO1 is expressed in H4IIE cells and it binds to the gAF2 site in the PEPCK promoter (9, 48). However, a mutation of this promoter element does not affect the response to PGC-1{alpha} in either H4IIE cells (Fig. 3AGo) or in Fao rat hepatoma cells (32). Alternatively, FOXO1 could bind to other promoter sites and thus contribute to the PGC-1{alpha} effect. This putative site must be located outside of the promoter region from -467 to +65 investigated in our study because a double mutation of the gAF1 and gAF3 sites (that do not bind FOXO1) completed abrogates the PGC-1{alpha} effect. Also, in the G6Pase gene promoter, a mutation of the FOXO1 binding element has no effect on the PGC-1{alpha} response (43, 46).

Glucocorticoids typically regulate genes through a complex array of promoter elements, referred to as a GRU (11, 14). Two elements in the PEPCK GRU, gAF1 and especially gAF3, are critical for the stimulatory effect of PGC-1{alpha} in the absence of hormones. These elements are also required for the glucocorticoid response. To study their importance in the presence of glucocorticoids, we performed a mutation analysis of the relevant promoter elements. We found that the glucocorticoid receptor alone, which binds weakly to the GR1/GR2 elements, cannot confer activation by PGC-1{alpha} on the PEPCK gene promoter when the gAF1 and gAF3 sites are mutated, although the interaction between GR and PGC-1{alpha} has been demonstrated in other promoter contexts (31). We have previously shown that these accessory factors enhance the affinity and stabilize the binding of the glucocorticoid receptor to its weak binding elements in the PEPCK promoter. However, these accessory factors appear to achieve this in different ways. For example FOXA2, the accessory factor at the gAF2 site, can interact directly with the glucocorticoid receptor (41). The FOXA2-mediated GR interaction with the PEPCK GREs is much more difficult to disrupt than the GR-GRE interaction promoted by HNF-4{alpha} or COUP-TFI (16). Also, the spatial orientation and alignment of FOXA2, with respect to GR, is much more stringent than that of HNF-4{alpha} and COUP-TFI (41). The FOXA2-gAF2 interaction is apparently not involved in the PGC-1{alpha} effect on the PEPCK gene promoter. By contrast, HNF-4{alpha} and COUP-TFI at gAF1, and COUP-TFI at gAF3, are essential. This combination of elements and associated accessory factors has two functions. It increases the affinity of GR binding to its weak binding elements, and it provides an environment for the interaction of PGC-1{alpha} with the GRU transcription complex. These may be related functions because the substitution of GR1 with a palindromic GRE, which binds GR with high affinity, obviates the requirement of the accessory factors, as illustrated in Fig. 6Go.

The PEPCK gene promoter, with an array of interacting hormone response units and a complex assembly of coregulators, affords a wide range of response to numerous signals of the external environment. This is in keeping with the necessity to finely tune the gluconeogenic response of the hepatocyte and the role this plays in glucose homeostasis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
RNA Isolation, Reverse Transcription, and Real-Time PCR
RNA was isolated from cultured cells using the Tri Reagent (Molecular Research Center Inc., Cincinnati, OH) according to the recommended instructions. About 2 µg of total RNA were reverse transcribed into cDNA using an oligo d(T)16 primer and the reagents from the TaqMan RT Kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol. Real-time PCR (SYBR Green) was performed using the iQ Supermix on an iCycler (Bio-Rad, Hercules, CA). Primer pairs used to amplify cDNA fragments were: 5'-GCTTCCTTCAAGTGCTGTGCA and 5'-GTATTGAGATAGAAGCTGGGC for L-PK; 5'-TGAAACTTTCAGCCACATCCG and GCAGGTAAAATCCAAGTGCGAA for G6Pase; 5'-GAATCAGCCAGATGTAATCCCG and 5'-CATTGTGCTTGCTGGTTTGC for PEPCK; 5'-GACTAAACGGCCCAGTCTAC and 5'-CTGTGGAAGAACAGATGTGC for PGC-1{alpha}. Data were normalized to cyclophilin, which was amplified in parallel using primers 5'-AAGGTGAAAGAAGGCATGAGCA and 5'-AGTTGTCCACAGTCGGAGATGG. Samples were quantified relative to untreated cells using the comparative threshold cycle method, as described (Applied Biosystems, User Bulletin 2, 1997).

Adenovirus Infection
The adenovirus expressing PGC-1{alpha} was a gift from Daniel Kelly (Washington University, St. Louis, MO) (49). H4IIE cells were infected at a titer of about 7.5 x 108 plaque-forming units/ml for 48 h before hormone treatment. An infection efficiency of about 80% was estimated by fluorescent microscopy of GFP-expressing cells.

Plasmids
The construction of the PEPCK (-467/+69), FBPase (-405/+25), and G6Pase (-751/+66) reporter genes has been described previously (39, 50, 51). Mutations in the PEPCK gene promoter context have been described previously for mAF1 (52), mAF2, mGR1, mAF3, mAF3{alpha}, mAF3{gamma}, palGR (15), and AF1AF1 (41). Sequences for selective binding of COUP-TFI and HNF-4{alpha} were used to generate the constructs AF1COUP, and AF1HNF4 as described previously (12). The constructs AF1 + 3COUP, mAF1AF1, mAF1 + AF3, and palGR1mAF1 + 3 are double mutations in the PEPCK promoter context and were generated by cassette exchange using the EcoRI and NdeI restriction sites. The gAF3 element was replaced with a consensus COUP-TFI binding sequence using the QuikChange Site-Directed Mutagenesis method (Stratagene, La Jolla, CA) and the primer (sense strand): 5'-CGTCCCGGCCCAAGGTCATGACCTGTGCCACCTGACAA. The expression plasmid for PGC-1{alpha} was a gift from Richard O’Brien at Vanderbilt University (Nashville, TN) (46).

Cell Culture and Transient Transfection
Maintenance and transfection of H4IIE rat hepatoma cells by calcium chloride precipitation has been described previously (53).

Antibodies
Anti HNF-4{alpha} (sc-8987), anti-GR (sc-1004), and anti-PGC-1{alpha} (SC-13067) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The antibody against COUP-TFI was a gift from Ming-Jer Tsai at Baylor College of Medicine (Houston, TX) (54).

ChIP Assay
ChIP assays were performed based on a modified protocol obtained from Upstate Biotechnology (Lake Placid, NY). H4IIE cells were grown to 80% confluency in 150 mm dishes, incubated for 24 h in serum-free medium, followed by hormone treatment for 2 h. Chromatin was cross-linked with 1% formaldehyde (in DMEM) for 5 min at 37 C. The reaction was stopped with glycine (125 mM final concentration) for 5 min and cells were washed once in PBS. Cells were harvested by scraping with ice-cold PBS containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride and 1 µg/ml each of pepstatin A, leupeptin, and aprotinin). Cells were then pelleted by centrifugation at 1000 rpm for 2 min at 4 C. The cell pellet was resuspended in 600 µl sodium dodecyl sulfate (SDS) lysis buffer [1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1)] and incubated for 10 min on ice. About 250 mg washed glass beads (MO-SCI Corp., Rollo, MO; GL-0191) were added and lysates were sonicated with a 2.5-mm tip, by using 10 x 10-sec pulses at 4 watts. Cell debris was removed by centrifugation at 13,000 rpm for 10 min at 4 C. Five hundred microliters supernatant were diluted 10-fold in immunoprecipitation buffer containing 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), 167 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, and 1 µg/ml each of pepstatin A, leupeptin, aprotinin. Samples were precleared with 200 µl A/G PLUS-Agarose (SC-2003) containing 100 µg/ml sonicated salmon sperm DNA for 2 h at 4 C with rotation to reduce nonspecific background. Samples were centrifuged for 2 min at 1000 rpm at 4 C and the supernatant fractions were collected. One hundred and fifty microliters of this solution were saved as the input sample and to confirm shearing efficiency. The protein concentration was measured using Bradford reagent (Bio-Rad). Equal amounts of chromatin (1–5 mg) per precipitation were used. Three micrograms of antibody were added to the samples and incubated overnight at 4 C with rotation. Immune complexes were precipitated with 40 µl A/G Agarose Plus for 3 h at 4 C with rotation. Pellets were washed for 10 min with low salt buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 150 mM NaCl (pH 8.1)], high salt buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 500 mM NaCl (pH 8.1)], LiCl buffer [0.25 M LiCl, 1% Nonidet P-40, 1% (wt/vol) sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl (pH 8.1)] and twice with TE buffer [10 mM Tris-HCl, 1 mM EDTA, (pH 8.0)]. Immune complexes were eluted with 160 µl elution buffer (1% SDS, 0.1 M NaHCO3) at room temperature for 2 h with rotation. Cross-linking was reversed by an overnight incubation at 65 C. DNA was purified using the QIAquick PCR purification kit (QIAGEN, Valencia, CA). Precipitated DNA was amplified by Standard (Taq) or real-time (SYBR-Green) PCR and primers: pPEPfo2: 5'-AGCTGTGGTGTTTTGACAACCA and pPEPre2: 5'-CCTCTTGGACTTCATATGCTGCT. Primers 5'-TTCTCCTCCTCCATCATTGG-3' and 5'-TGCATCCCTGGAAGGTTAAG-3' for a far upstream promoter region (-1713 to -1571) served as control for the specificity of antibody recognition.


    ACKNOWLEDGMENTS
 
We thank Drs. B. Spiegelman, D. Kelly, R. O’Brien, and M. Tsai for sharing reagents. We also thank R. O’Brien for useful discussions and a critical review of the manuscript, and C. Caldwell and R. Prasad for their technical assistance.


    FOOTNOTES
 
This work was supported by a Mentor-Based Research Fellowship award from the American Diabetes Association, the Veterans Affairs research service, and by grants from the National Institutes of Health (DK35107 and DK02887) and by the Vanderbilt Diabetes Research and Training Center (DK20593).

Abbreviations: C/EBP, CCAAT/enhancer-binding protein; ChIP, chromatin immunoprecipitation assay; COUP-TF, chicken ovalbumin upstream promoter-transcription factor; CRE, cAMP response element; FBPase, fructose-1,6-bisphosphatase; FOX, forkhead box; G6Pase, glucose-6-phosphatase; gAF, glucocorticoid accessory factor; GFP, green fluorescent protein; GR, glucocorticoid receptor; GRE, glucocorticoid response element; GRU, glucocorticoid response unit; HNF, hepatic nuclear factor; L-PK, liver-pyruvate kinase; PGC, peroxisome proliferator-activated receptor {gamma} coactivator; PEPCK, phosphoenolpyruvate carboxykinase; RAR, retinoic acid receptor; RXR, retinoid X receptor; SDS, sodium dodecyl sulfate.

Received for publication October 2, 2003. Accepted for publication January 12, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Beale EG, Chrapkiewicz NB, Scoble HA, Metz RJ, Quick DP, Noble RL, Donelson JE, Biemann K, Granner DK 1985 Rat hepatic cytosolic phosphoenolpyruvate carboxykinase (GTP). Structures of the protein, messenger RNA, and gene. J Biol Chem 260:10748–10760[Abstract/Free Full Text]
  2. Pilkis SJ, Granner DK 1992 Molecular physiology of the regulation of hepatic gluconeogenesis and glycolysis. Annu Rev Physiol 54:885–909[CrossRef][Medline]
  3. She P, Shiota M, Shelton KD, Chalkley R, Postic C, Magnuson MA 2000 Phosphoenolpyruvate carboxykinase is necessary for the integration of hepatic energy metabolism. Mol Cell Biol 20:6508–6517[Abstract/Free Full Text]
  4. Sasaki K, Cripe TP, Koch SR, Andreone TL, Petersen DD, Beale EG, Granner DK 1984 Multihormonal regulation of phosphoenolpyruvate carboxykinase gene transcription. The dominant role of insulin. J Biol Chem 259:15242–15251[Abstract/Free Full Text]
  5. Hanson RW, Reshef L 1997 Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Biochem 66:581–611[CrossRef][Medline]
  6. Scott DK, O’Doherty RM, Stafford JM, Newgard CB, Granner DK 1998 The repression of hormone-activated PEPCK gene expression by glucose is insulin-independent but requires glucose metabolism. J Biol Chem 273:24145–24151[Abstract/Free Full Text]
  7. Granner D, O’Brien R, Imai E, Forest C, Mitchell J, Lucas P 1991 Complex hormone response unit regulating transcription of the phosphoenolpyruvate carboxykinase gene: from metabolic pathways to molecular biology. Recent Prog Horm Res 47:319–346[Medline]
  8. Scott DK, Mitchell JA, Granner DK 1996 Identification and charaterization of the second retinoic acid response element in the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:6260–6264[Abstract/Free Full Text]
  9. Hall RK, Yamasaki T, Kucera T, Waltner-Law M, O’Brien R, Granner DK 2000 Regulation of phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein-1 gene expression by insulin. The role of winged helix/forkhead proteins. J Biol Chem 275:30169–30175[Abstract/Free Full Text]
  10. Yamada K, Duong DT, Scott DK, Wang JC, Granner DK 1999 CCAAT/enhancer-binding protein ß is an accessory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 274:5880–5887[Abstract/Free Full Text]
  11. Imai E, Stromstedt PE, Quinn PG, Carlstedt-Duke J, Gustafsson JA, Granner DK 1990 Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 10:4712–4719[Abstract/Free Full Text]
  12. Hall RK, Sladek FM, Granner DK 1995 The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci USA 92:412–416[Abstract/Free Full Text]
  13. Wang JC, Stromstedt PE, O’Brien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the stimulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Mol Endocrinol 10:794–800[Abstract/Free Full Text]
  14. Scott DK, Mitchell JA, Granner DK 1996 The orphan receptor COUP-TF binds to a third glucocorticoid accessory factor element within the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:31909–31914[Abstract/Free Full Text]
  15. Scott DK, Stromstedt PE, Wang JC, Granner DK 1998 Further characterization of the glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. The role of the glucocorticoid receptor-binding sites. Mol Endocrinol 12:482–491[Abstract/Free Full Text]
  16. Stafford JM, Wilkinson JC, Beechem JM, Granner DK 2001 Accessory factors facilitate the binding of glucocorticoid receptor to the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 276:39885–39891[Abstract/Free Full Text]
  17. Waltner-Law M, Duong DT, Daniels MC, Herzog B, Wang XL, Prasad R, Granner DK 2003 Elements of the glucocorticoid and retinoic acid response units are involved in cAMP-mediated expression of the PEPCK gene. J Biol Chem 278:10427–10435[Abstract/Free Full Text]
  18. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  19. Enmark E, Gustafsson JA 1996 Orphan nuclear receptors—the first eight years. Mol Endocrinol 10:1293–1307[Free Full Text]
  20. Zaret K 1999 Developmental competence of the gut endoderm: genetic potentiation by GATA and HNF3/fork head proteins. Dev Biol 209:1–10[CrossRef][Medline]
  21. Kaestner KH 2000 The hepatocyte nuclear factor 3 (HNF3 or FOXA) family in metabolism. Trends Endocrinol Metab 11:281–285[CrossRef][Medline]
  22. Ramji DP, Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365:561–575[Medline]
  23. McKenna NJ, O’Malley BW 2002 Minireview: nuclear receptor coactivators—an update. Endocrinology 143:2461–2465[Abstract/Free Full Text]
  24. Wang JC, Stafford JM, Granner DK 1998 SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 273:30847–30850[Abstract/Free Full Text]
  25. Klemm DJ, Colton LA, Ryan S, Routes JM 1996 Adenovirus E1A proteins regulate phosphoenolpyruvate carboxykinase gene transcription through multiple mechanisms. J Biol Chem 271:8082–8088[Abstract/Free Full Text]
  26. Chakravarty K, Leahy P, Becard D, Hakimi P, Foretz M, Ferre P, Foufelle F, Hanson RW 2001 Sterol regulatory element-binding protein-1c mimics the negative effect of insulin on phosphoenolpyruvate carboxykinase (GTP) gene transcription. J Biol Chem 276:34816–34823[Abstract/Free Full Text]
  27. Monroy MA, Ruhl DD, Xu X, Granner DK, Yaciuk P, Chrivia JC 2001 Regulation of cAMP-responsive element-binding protein-mediated transcription by the SNF2/SWI-related protein, SRCAP. J Biol Chem 276:40721–40726[Abstract/Free Full Text]
  28. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM 1998 A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92:829–839[CrossRef][Medline]
  29. Shen W, Scearce LM, Brestelli JE, Sund NJ, Kaestner KH 2001 Foxa3 (hepatocyte nuclear factor 3{gamma}) is required for the regulation of hepatic GLUT2 expression and the maintenance of glucose homeostasis during a prolonged fast. J Biol Chem 276:42812–42817[Abstract/Free Full Text]
  30. Louet JF, Hayhurst G, Gonzalez FJ, Girard J, Decaux JF 2002 The coactivator PGC-1 is involved in the regulation of the liver carnitine palmitoyltransferase I gene expression by cAMP in combination with HNF4 {alpha} and cAMP-response element-binding protein (CREB). J Biol Chem 277:37991–38000[Abstract/Free Full Text]
  31. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M 2001 CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413:179–183[CrossRef][Medline]
  32. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM 2001 Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413:131–138[CrossRef][Medline]
  33. Daitoku H, Yamagata K, Matsuzaki H, Hatta M, Fukamizu A 2003 Regulation of PGC-1 promoter activity by protein kinase B and the forkhead transcription factor FKHR. Diabetes 52:642–649[Abstract/Free Full Text]
  34. Lin J, Tarr PT, Yang R, Rhee J, Puigserver P, Newgard CB, Spiegelman BM 2003 PGC-1ß in the regulation of hepatic glucose and energy metabolism. J Biol Chem 278:30843–30848[Abstract/Free Full Text]
  35. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353–5356[Abstract/Free Full Text]
  36. Schmoll D, Wasner C, Hinds CJ, Allan BB, Walther R, Burchell A 1999 Identification of a cAMP response element within the glucose-6-phosphatase hydrolytic subunit gene promoter which is involved in the transcriptional regulation by cAMP and glucocorticoids in H4IIE hepatoma cells. Biochem J 338 (Pt 2):457–463
  37. Ladias JA, Karathanasis SK 1991 Regulation of the apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily. Science 251:561–565[Abstract/Free Full Text]
  38. Becker P, Renkawitz R, Schutz G 1984 Tissue-specific DNaseI hypersensitive sites in the 5'-flanking sequences of the tryptophan oxygenase and the tyrosine aminotransferase genes. EMBO J 3:2015–2020[Medline]
  39. Duong DT, Waltner-Law ME, Sears R, Sealy L, Granner DK 2002 Insulin inhibits hepatocellular glucose production by utilizing liver-enriched transcriptional inhibitory protein to disrupt the association of CREB-binding protein and RNA polymerase II with the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 277:32234–32242[Abstract/Free Full Text]
  40. Knutti D, Kaul A, Kralli A 2000 A tissue-specific coactivator of steroid receptors, identified in a functional genetic screen. Mol Cell Biol 20:2411–2422[Abstract/Free Full Text]
  41. Sugiyama T, Scott DK, Wang JC, Granner DK 1998 Structural requirements of the glucocorticoid and retinoic acid response units in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 12:1487–1498[Abstract/Free Full Text]
  42. Nebes VL, Morris Jr SM 1987 Induction of mRNA for phosphoenolpyruvate carboxykinase (GTP) by dexamethasone in cultured rat hepatocytes requires on-going protein synthesis. Biochem J 246:237–240[Medline]
  43. Rhee J, Inoue Y, Yoon JC, Puigserver P, Fan M, Gonzalez FJ, Spiegelman BM 2003 Regulation of hepatic fasting response by PPAR{gamma} coactivator-1{alpha} (PGC-1): requirement for hepatocyte nuclear factor 4{alpha} in gluconeogenesis. Proc Natl Acad Sci USA 100:4012–4017[Abstract/Free Full Text]
  44. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ 2001 Hepatocyte nuclear factor 4{alpha} (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21:1393–1403[Abstract/Free Full Text]
  45. Lou DQ, Tannour M, Selig L, Thomas D, Kahn A, Vasseur-Cognet M 1999 Chicken ovalbumin upstream promoter-transcription factor II, a new partner of the glucose response element of the L-type pyruvate kinase gene, acts as an inhibitor of the glucose response. J Biol Chem 274:28385–28394[Abstract/Free Full Text]
  46. Boustead JN, Stadelmaier BT, Eeds AM, Wiebe PO, Svitek CA, Oeser JK, O’Brien RM 2003 Hepatocyte nuclear factor-4 {alpha} mediates the stimulatory effect of peroxisome proliferator-activated receptor {gamma} co-activator-1 alpha (PGC-1 {alpha}) on glucose-6-phosphatase catalytic subunit gene transcription in H4IIE cells. Biochem J 369:17–22[CrossRef][Medline]
  47. Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y, Altomonte J, Dong H, Accili D, Spiegelman BM 2003 Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1{alpha} interaction. Nature 423:550–555[CrossRef][Medline]
  48. Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther R, Unterman TG 2000 Regulation of glucose-6-phosphatase gene expression by protein kinase B{alpha} and the forkhead transcription factor FKHR. Evidence for insulin response unit-dependent and -independent effects of insulin on promoter activity. J Biol Chem 275:36324–36333[Abstract/Free Full Text]
  49. Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, Kelly DP 2000 Peroxisome proliferator-activated receptor {gamma} coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 106:847–856[Medline]
  50. Herzog B, Waltner-Law M, Scott DK, Eschrich K, Granner DK 2000 Characterization of the human liver fructose-1,6-bisphosphatase gene promoter. Biochem J 351(Pt 2):385–392
  51. Dickens M, Svitek CA, Culbert AA, O’Brien RM, Tavare JM 1998 Central role for phosphatidylinositide 3-kinase in the repression of glucose-6-phosphatase gene transcription by insulin. J Biol Chem 273:20144–20149[Abstract/Free Full Text]
  52. Mitchell J, Noisin E, Hall R, O’Brien R, Imai E, Granner D 1994 Integration of multiple signals through a complex hormone response unit in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 8:585–594[Abstract/Free Full Text]
  53. O’Brien RM, Noisin EL, Suwanichkul A, Yamasaki T, Lucas PC, Wang JC, Powell DR, Granner DK 1995 Hepatic nuclear factor 3- and hormone-regulated expression of the phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein 1 genes. Mol Cell Biol 15:1747–1758[Abstract]
  54. Wang LH, Tsai SY, Cook RG, Beattie WG, Tsai MJ, O’Malley BW 1989 COUP transcription factor is a member of the steroid receptor superfamily. Nature 340:163–166[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   RXRα  |  COUP-TFI  |  AR
Coregulators:   PGC-1
Ligands:   Dexamethasone



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Perilhou, C. Tourrel-Cuzin, I. Kharroubi, C. Henique, V. Fauveau, T. Kitamura, C. Magnan, C. Postic, C. Prip-Buus, and M. Vasseur-Cognet
The Transcription Factor COUP-TFII Is Negatively Regulated by Insulin and Glucose via Foxo1- and ChREBP-Controlled Pathways
Mol. Cell. Biol., November 1, 2008; 28(21): 6568 - 6579.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. Zhang, L. O'Loughlin, D. N. Brindley, and K. Reue
Regulation of lipin-1 gene expression by glucocorticoids during adipogenesis
J. Lipid Res., July 1, 2008; 49(7): 1519 - 1528.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Wang, T. H. Peiris, A. Mowery, J. Le Lay, Y. Gao, and L. E. Greenbaum
CCAAT/Enhancer Binding Protein-{beta} Is a Transcriptional Regulator of Peroxisome-Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Regenerating Liver
Mol. Endocrinol., July 1, 2008; 22(7): 1596 - 1605.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. W. Limesand, P. J. Rozance, D. Smith, and W. W. Hay Jr.
Increased insulin sensitivity and maintenance of glucose utilization rates in fetal sheep with placental insufficiency and intrauterine growth restriction
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1716 - E1725.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Herzog, M. Hallberg, A. Seth, A. Woods, R. White, and M. G. Parker
The Nuclear Receptor Cofactor, Receptor-Interacting Protein 140, Is Required for the Regulation of Hepatic Lipid and Glucose Metabolism by Liver X Receptor
Mol. Endocrinol., November 1, 2007; 21(11): 2687 - 2697.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. K. Hall, X. L. Wang, L. George, S. R. Koch, and D. K. Granner
Insulin Represses Phosphoenolpyruvate Carboxykinase Gene Transcription by Causing the Rapid Disruption of an Active Transcription Complex: A Potential Epigenetic Effect
Mol. Endocrinol., February 1, 2007; 21(2): 550 - 563.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Herzog, J. Cardenas, R. K. Hall, J. A. Villena, P. J. Budge, V. Giguere, D. K. Granner, and A. Kralli
Estrogen-related Receptor {alpha} Is a Repressor of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., January 6, 2006; 281(1): 99 - 106.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Gautier-Stein, G. Mithieux, and F. Rajas
A Distal Region Involving Hepatocyte Nuclear Factor 4{alpha} and CAAT/Enhancer Binding Protein Markedly Potentiates the Protein Kinase A Stimulation of the Glucose-6-Phosphatase Promoter
Mol. Endocrinol., January 1, 2005; 19(1): 163 - 174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Stein, E. K. Thomas, B. Herzog, M. D. Westfall, J. V. Rocheleau, R. S. Jackson II, M. Wang, and P. Liang
NDRG1 Is Necessary for p53-dependent Apoptosis
J. Biol. Chem., November 19, 2004; 279(47): 48930 - 48940.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bhalla, C. Ozalp, S. Fang, L. Xiang, and J. K. Kemper
Ligand-activated Pregnane X Receptor Interferes with HNF-4 Signaling by Targeting a Common Coactivator PGC-1{alpha}: FUNCTIONAL IMPLICATIONS IN HEPATIC CHOLESTEROL AND GLUCOSE METABOLISM
J. Biol. Chem., October 22, 2004; 279(43): 45139 - 45147.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Yubero, E. Hondares, M. C. Carmona, M. Rossell, F. J. Gonzalez, R. Iglesias, M. Giralt, and F. Villarroya
The Developmental Regulation of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} Expression in the Liver Is Partially Dissociated from the Control of Gluconeogenesis and Lipid Catabolism
Endocrinology, September 1, 2004; 145(9): 4268 - 4277.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. L. Wang, B. Herzog, M. Waltner-Law, R. K. Hall, M. Shiota, and D. K. Granner
The Synergistic Effect of Dexamethasone and All-trans-retinoic Acid on Hepatic Phosphoenolpyruvate Carboxykinase Gene Expression Involves the Coactivator p300
J. Biol. Chem., August 13, 2004; 279(33): 34191 - 34200.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herzog, B.
Right arrow Articles by Granner, D. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herzog, B.
Right arrow Articles by Granner, D. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals