help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2003-0443
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/4/968    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, I.
Right arrow Articles by Ji, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, I.
Right arrow Articles by Ji, T. H.
Molecular Endocrinology 18 (4): 968-978
Copyright © 2004 by The Endocrine Society

Trans-Activation of Mutant Follicle-Stimulating Hormone Receptors Selectively Generates Only One of Two Hormone Signals

Inhae Ji, ChangWoo Lee, MyoungKun Jeoung, YongBum Koo, Gail A. Sievert and Tae H. Ji

Department of Chemistry (I.J., C.L., M.J., G.A.S., T.H.J.), University of Kentucky, Lexington, Kentucky 40506-0055; and School of Biotechnology and Biomedical Science (Y.K.), InJe University, GimHae 621-749, Korea

Address all correspondence and requests for reprints to: Tae H. Ji, Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055. E-mail: tji{at}uky.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Previously, we reported that a liganded LH receptor (LHR) is capable of activating itself (cis-activation) and other nonliganded LHRs to induce cAMP (trans-activation). Trans-activation of the LHR raises two crucial questions. Is trans-activation unique to LHR or common to other G protein-coupled receptors? Does trans-activation stimulate phospholipase Cß as it does adenylyl cyclase? To address these questions, two types of novel FSH receptors (FSHRs) were constructed, one defective in hormone binding and the other defective in signal generation. The FSHR, a G protein-coupled receptor, comprises two major domains, the N-terminal extracellular exodomain that binds the hormone and the membrane-associated endodomain that generates the hormone signals. For signal defective receptors, the exodomain was attached to glycosyl phosphatidylinositol (ExoGPI) or the transmembrane domain of CD8 immune receptor (ExoCD). ExoGPI and ExoCD can trans-activate another nonliganded FSH. Surprisingly, the trans-activation generates a signal to activate either adenylyl cyclase or phospholipase Cß, but not both. These results indicate that trans-activation in these mutant receptors is selective and limited in signal generation, thus providing new approaches to investigating the generation of different hormone signals and a novel means to selectively generate a particular hormone signal. Our data also suggest that the FSHR’s exodomain could not trans-activate LHR.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
G PROTEIN-COUPLED receptors (GPCRs) constitute the major class of hormone receptors (1). When a hormone binds to its GPCR, that liganded receptor molecule is thought to activate itself and generate hormone signals (Fig. 1Go). However, we recently presented evidence that a liganded LH receptor (LHR) molecule is capable of intermolecularly activating nonliganded LHR molecules and inducing cAMP production (2, 3). These distinct activations are termed (2) as cis-activation (Fig. 1BGo) and trans-activation (Fig. 1Go, C and D). The trans-activation of the thrombin receptor was reported but was discounted, because it requires nearly 1000-fold higher ligand concentrations (4). Is trans-activation common to other GPCRs? The observation also raises other important questions. Because FSH stimulates adenylyl cyclase (AC) to produce cAMP and phospholipase Cß (PLCß) to produce inositol phosphate (IP) (5), it is logical to raise the question whether trans-activation stimulates PLCß in addition to AC. Although the primary signal of FSH receptor (FSHR) is to activate AC (6), the FSHR system will serve as a valuable model for investigating the differential generation of two or more.



View larger version (47K):
[in this window]
[in a new window]
  		Fig. 1. Models of cis-Activation and Trans-Activation

A, Domain structure of FSHR showing the exodomain where the ligand binds and the endodomain where the hormone signals are generated. B, A ligand (red) binds to the exodomain, and the ligand/exodomain complex intramolecularly interacts with its own endodomain and activates it (cis-activation). C, A functional exodomain (gray) is linked to the nonfunctional transmembrane and cytoplasmic domain of CD8 (blue). The resulting hybrid (ExoCD) binds FSH, and interacts with the endodomain of a mutant FSHR that is defective in ligand binding and trans-activates it. D, A functional exodomain was attached to GPI. The resulting hybrid can bind ligand but cannot generate signal. Functional part is shown in gray and nonfunctional part in blue. FSH binds to the exodomain of ExoGPI, and the liganded exodomain intermolecularly interacts with the endodomain of a receptor that is defective in ligand binding, and activates it (trans-activation).

 
A simple system to test trans-activation is a receptor that comprises distinct regions of hormone binding and signal generation. The receptors for glycoprotein hormones, FSH, LH/human chorionic gonadotropin (hCG), and TSH, satisfy that requirement. The receptors are members of GPCRs (1) and comprise two halves (7, 8, 9, 10), the N-terminal extracellular exodomain and the membrane-associated endodomain (Fig. 1AGo). High-affinity hormone binding occurs at the exodomain, whereas signals are generated at the endodomain (1, 11, 12, 13). These receptors generate two signals, one to activate adenylyl cyclase (AC) to generate cAMP and the other to activate PLCß to produce IPs and diacylglycerol. Furthermore, these two signals are generated by distinct mechanisms (14, 15). The hormones initially bind to the exodomain (16, 17), and the resulting hormone/exodomain complex modulates the endodomain (1, 11, 18). Therefore, hormone binding and signal generation are generally assumed to occur intramolecularly within a receptor molecule (cis-activation as shown in Fig. 1BGo). Two different mutants of such a receptor, one defective in hormone binding and the other defective in signal generation, would allow testing of intermolecular activation (trans-activation in Fig. 1Go, C and D). Trans-activation of two or more receptors by a receptor molecule could amplify hormone signals, although signal amplification is generally attributed to second messengers or some activated receptor Tyr kinases that could phosphorylate other targets (19).

A large number of binding-deficient mutants, although expressed on the cell surface, have been identified in association with diseases and disorders. It has been difficult, if not impossible to investigate effects of nonbinding mutations on signaling mechanisms. Trans-activation by our receptor complementation assay provides a unique means to examine the signaling capacity of nonbinding mutants. In addition, trans-activation may provide a means to generate a particular signal without provoking other signals associated with a hormone and receptor (1). Trans-activation could alleviate disorders caused by two defective heterozygous receptors, one binding defective and the other signaling defective, because they may cooperate and rescue signaling. In fact, there are reports of patients carrying defective compound heterozygous FSHRs (20, 21, 22) and LHRs (23, 24). Therefore, trans-activation has significant implications in the understanding of signal generation mechanisms and therapeutics.

In the previous reports, nonbinding LHR was trans-activated by signal-deficient LHRs, the LHR exodomain attached to the transmembrane domain of CD8 immune receptor (ExoCD) as shown in Fig. 1CGo or a single amino acid mutant of LHR. These trans-activating molecules possess one or seven transmembrane helices. Therefore, the putative effect of the transmembrane domain(s) on trans-activation could not be dismissed. To address this issue in this article, we have generated a new hybrid consisting of the FSHR exodomain attached to glycosyl phosphatidylinositol (ExoGPI) as shown in Fig. 1DGo. In addition, we used an array of nonbinding FSHRs with a single amino acid mutation (15, 25). The evidence is presented that ExoGPI complexed with FSH is capable of trans-activating some of the nonbinding FSHRs. The trans-activation of mutant FSHRs induces either cAMP production or IP, but not both, thus providing a means for selective signal generation.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A simple test for trans-activation is to coexpress two different defective receptors in a cell, a nonbinding mutant with intact signal generation (FSHR-FSH/+cAMP), and another mutant that is capable of hormone binding but incapable of generating signal (FSHR+FSH/-cAMP). When each of these receptors is individually expressed in cells, the cells do not induce cAMP production. However, when these two defective receptors are coexpressed, trans-activation between them may occur to rescue cAMP production. Therefore, it is necessary to establish FSHR-FSH/+cAMPand FSHR+FSH/-cAMP.

Generally, mutations that impair hormone binding are found in the FSHR exodomain, such as C15A, P24A, D26A, L27A, and F36A (Fig. 2Go). To verify the defective binding, human embryonic kidney (HEK) 293 cells were stably transfected with each of the FSHR mutants, and assayed for 125I-FSH binding and cAMP production in the presence of increasing concentrations of FSH. None of the transfected cells bound 125I-FSH (Fig. 2Go, A and B), nor induced cAMP production in response to FSH (Fig. 2EGo). In contrast, the cells stably transfected with the wild-type FSHR-bound 125I-FSH and produced cAMP in response to FSH (Fig. 2Go). To test whether the mutants are incapable of binding the hormone or capable of binding the hormone but trapped in the cytoplasm, the cells were solubilized in Nonidet P-40 (NP-40) and assayed for 125I-FSH binding. None of the cells bound the hormone (Fig. 2Go, C and D), indicating that they are incapable of hormone binding. However, the result does not necessarily prove the surface expression of the nonbinding mutants and futile binding on the surface. Therefore, the cells expressing nonbinding mutants were probed with 125I-anti-FSHR antibody. The antibody bound to the cells, indicating the mutants’ surface expression and their inability to bind the hormone on the cell surface. This conclusion is underscored by the fact that the surface expression levels of the mutants were comparable to the wild-type receptor level.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 2. FSH Binding and cAMP Induction of Wild-Type and Mutant FSHRs

HEK 293 cells were stably transfected with the wild-type FSHR or nonbinding FSHR mutants, FSHRC15A, FSHRP24A, FSHRPD26A, and FSHRF36A. These cells were assayed for 125I-FSH binding to intact cells (A) and the Scatchard plot (B), 125I-FSH binding to receptors solubilized in NP-40 and Scatchard plot (D), and cAMP production (E) in the presence of increasing concentrations of nonradioactive FSH. The assays presented in this figure and after figures were repeated four to six times in duplicate (n = 8–12), and means and SDs were calculated. The 125I-FSH binding data were used for Scatchard plots to determine Kd values and receptor concentrations as shown in table. ND, Not detectable.

 
For FSHR+FSH/-cAMP, an ideal candidate is an FSHR lacking the endodomain, where hormone signals are generated (1, 26). For that purpose, a hybrid of the FSHR exodomain attached to the glycosyl phosphatidylinositol (GPI) anchor sequence (27) was constructed. The resulting ExoGPI lacks the endodomain (Fig. 1DGo). When it was stably expressed in cells, the cells bound 125I-FSH but did not induce cAMP (Fig. 3Go). Interestingly, the binding affinity of ExoGPI was notably better than the wild-type value, which warrants hormone binding in the following coexpression studies.



View larger version (38K):
[in this window]
[in a new window]
  		Fig. 3. Trans-Activation of Nonbinding FSHRs by ExoGPI

HEK 293 cells stably expressing ExoGPI were transfected again with FSHRC15A, FSHRP24A, FSHRD26A, FSHRL27A, or FSHRF36A and assayed for hormone binding and induction of cAMP and IP as described in the legend to Fig. 2Go and Materials and Methods.

 
Rescue of Either cAMP or IP Induction
Next, the cells stably expressing ExoGPI were transiently transfected with each of the nonbinding mutants, C15A, P24A, D26A, L27A, and F36A, and assayed for hormone binding and induction of cAMP and IP production (Fig. 3Go). All of the cells bound FSH, and the Kd values were similar to the ExoGPI value, indicating successful hormone binding. The concentrations ofFSH binding sites on intact cells were in the range of 22,500–46,300/cell, which are in the range of the wild-type receptor concentration. Despite the fewer binding sites, the cells coexpressing ExoGPI/FSHRP24A, ExoGPI/FSHRD26A, and ExoGPI/FSHRPF36A produced cAMP in an FSH dose-dependent manner (Fig. 3CGo). The maximum cAMP levels were substantial, approximately 40% of the wild type for ExoGPI/FSHRP24A, approximately 53% for ExoGPI/FSHRD26A, and approximately 35% for ExoGPI/FSHRF36A (Fig. 3Go, table). The successful cAMP induction was particularly impressive because the hormone binding sites were fewer than the binding site on the cells expressing ExoGPI, which did not respond to FSH and produce cAMP. These results clearly show the distinction of the hormone binding from the cAMP signal generation. This is more obvious in the case of the ExoGPI/FSHRC15A pair. This pair did not respond to FSH binding to produce cAMP despite high affinity FSH binding at a comparable number of sites. In addition to FSHRC15A, other nonbinding mutants failed to produce cAMP when coexpressed with ExoGPI and treated with FSH (data not shown). The mutants are L27A, I83A, I85A, I110A, L158A, L181A, L183A, L206A, and I208A (25). No cAMP induction of these mutants demonstrates specificity in the rescue of cAMP induction and in the cooperation of ExoGPI with nonbinding mutant FSHRs. However, it is also possible that some of these nonbinding mutants may be defective in signal generation or other problems.

The data in Fig. 3DGo show that IP was not induced by the four pairs of ExoGPI/nonbinding FSHR, ExoGPI/FSHRC15A, ExoGPI/FSHRP24A, ExoGPI/FSHRD26A, and ExoGPI/FSHRPF36A. This is particularly interesting because some of the pairs successfully produced cAMP. In contrast, ExoGPI/FSHRL27A induced IP production in an FSH dose-dependent manner, but surprisingly, it was incapable of producing cAMP. Although the IP induction was 1.22-fold over the basal level, the maximum IP level was 55% of the wild-type value and reproducible.

Chemical Cross-Linking of 125I-FSH to ExoGPI and Mechanisms of cAMP Rescue
A simple explanation for the successful cAMP rescue is that ExoGPI binds FSH, and that the resulting FSH/exodomain complex of ExoGPI activates the endodomain of the nonbinding mutant receptors to generate the cAMP signal. To prove that FSH bound to ExoGPI, not the nonbinding mutants, bound 125I-FSH was subjected to chemical cross-linking. The cells coexpressing ExoGPI/FSHRF36A were incubated with 125I-FSH, rinsed to remove unbound 125I-FSH, treated with a homobifunctional cross-linker (SES) and solubilized. The solubilized samples were electrophoresed and the gels were processed. Untreated 125I-FSH appeared as a single band (Fig. 4Go, first lane), suggesting that both of the {alpha} and ß subunits comigrated in the single band as previously reported (15). Upon cross-linking with SES, the FSH subunits were cross-linked and appeared as the 40-kDa {alpha}ß dimer (Fig. 4Go, lane 2). 125I-FSH bound to the cells expressing ExoGPI or the cells coexpressing ExoGPI/FSHRF36A, which were not cross-linked, appeared in the monomeric band (Fig. 4Go, lanes 3 and 4). In contrast, when 125I-FSH bound to the cells expressing only ExoGPI or coexpressing ExoGPI/FSHRF36A was treated with SES, the 65-kDa and 85-kDa bands appeared, in addition to the 40-kDa {alpha}ß dimer band (Fig. 4Go, lanes 5–7, respectively). The 65-kDa band corresponds to the 20-kDa {alpha} or ß/45-kDa ExoGPI, whereas the 85-kDa band corresponds to the 40-kDa {alpha}ß dimer/45-kDa ExoGPI. It is important to note that there was no difference in the band profile of 125I-FSH cross-linked to ExoGPI and ExoGPI/FSHRF36A pair. Above the 85-kDa band, there was a band at gel top.



View larger version (113K):
[in this window]
[in a new window]
  		Fig. 4. Autoradiograph of 125I-FSH Cross-Linked to Receptors

Lanes 1 and 2, 125I-FSH was treated with (lane 2) or without (lane 1) cross-linking reagent (SES), solubilized under reducing conditions, and electrophoresed. The cross-linked sampled show the FSH {alpha}ß dimer. Cells stably expressing ExoGPI were incubated with 125I-FSH, washed to remove unbound hormone, treated with SES, solubilized, electrophoresed, and processed for autoradiogram (lane 5) as described in Materials and Methods. Lane 3, The same as the lane 5 sample, but without cross-linking. Lanes 4, 6, and 7, Cells stably expressing ExoGPI were transiently transfected with FSHRF36A, a nonbinding mutant, and incubated with 125I-FSH, treated with SES 0 mM (lane 4), 1 mM (lane 6), and 2 mM (lane 7), and processed the same as the lane 5 sample.

 
cAMP Rescue by ExoCD
In addition to ExoGPI, ExoCD (Fig. 1CGo), consisting of the FSHR exodomain attached to the transmembrane and cytoplasmic domains of CD8 (4, 28), was constructed. Cells stably expressing ExoCD were transiently transfected with a panel of nonbinding mutant FSHRs. All of the coexpressed pairs bound FSH, and their equilibrium dissociation constant (Kd) values and receptor concentrations were similar to the wild-type values (Fig. 5Go). Despite successful hormone binding, most of the pairs failed to induce cAMP and IP production (data not shown). The pairs of ExoCD/FSHRP24A, ExoCD/FSHRD26A, and ExoCD/FSHRF36A produced cAMP, but the maximum cAMP levels were less than those produced by the corresponding ExoGPI pairs. The ExoCD/C15A pair also induced cAMP production, but the maximum cAMP level was insignificant. Furthermore, none of the pairs induced IP production. To test whether unrelated molecules in the cells were expressed by pcDNA3 transfection and cooperated with ExoCD, the cells stably expressing ExoCD were transfected with empty pcDNA3. The cells did not induce cAMP (data not included). ExoCD was mutated for F36A to knock out the hormone binding activity. When cells were cotransfected with ExoF36ACD and FSHRF36A, they did not bind FSH nor produce cAMP (data not included). When the cells stably expressing ExoCD was transiently transfected with nonbinding LHR, LHRI55A, the cells did not respond to FSH nor produce cAMP and IP (Fig. 6DGo). When the cells stably expressing wild-type FSHR (FSHRWT) were transiently transfected for FSHR-ExoGPI or FSHR-ExoCD, the cAMP and IP induction was not impacted.



View larger version (41K):
[in this window]
[in a new window]
  		Fig. 5. Trans-Activation of Nonbinding FSHRs by ExoCD

HEK 293 cells stably expressing ExoCD were transfected again with FSHRC15A, FSHRP24A, FSHRD26A, FSHRF36A, FSHRI83A, FSHRI85A, FSHRI110A, FSHRL181A, FSHRL183A, FSHRL206A or FSHRI208A, and assayed for hormone binding and induction of cAMP and IP as described in the legend to Fig. 2Go and Materials and Methods. FSHRI83A, FSHRI85A, FSHRI110A, FSHRL181A, FSHRL183A, FSHRL206A, and FSHRI208A were not trans-activated. These negative results are not shown.

 


View larger version (66K):
[in this window]
[in a new window]
  		Fig. 6. Test of Trans-Activation between FSHR and LHR

HEK 293 cells stably expressing FSHR-ExoCD were transfected with a nonbinding FSHR mutant (FSHRF36A) or a nonbinding LHR mutant (LHRI55A). In addtion, the cells stably expressing wild-type FSHR (FSHRWT) were transiently transfected with FSHR-ExoGPI or FSHR-ExCD. The cells were assayed for 125I-FSH binding and production of cAMP and IP in response to increasing concentrations of FSH as described in the legend to Fig. 5Go. In addition, cells were transfected with LHR-ExoCD or LHRI55A and assayed for 125I-hCG binding and production of cAMP and IP. Furthermore, the cells stably expressing LHR-ExoCD or FSHR-ExoCD were transfected with LHRI55A, and assayed for 125I-hCG binding and cAMP and IP production in response to increasing concentrations of nonlabeled hCG.

 
When the cells stably expressing ExoCD were transiently transfected with wild-type LHR, the cells responded to hCG and produced cAMP and IP (Fig. 6Go, G and H). The EC values and maximum levels of cAMP and IP were similar to the wild-type LHR values. These results show that ExoCD did not interfere with G protein coupling with the receptors. When the cells stably expressing LHR-ExoCD, a hybrid of the exodomain of LHR attached to CD8, were transiently transfected with nonbinding LHR, LHRI55A, the cells bound hCG and produced cAMP, but not IP. The result indicates that LHR-ExoCD trans-activated nonbinding LHR, which induced cAMP but not IP. Therefore, no IP induction by trans-activation is common to some FSHR pairs and LHR pairs. Another notable observation is that FSH-ExoCD could not trans-activate the nonbinding LHR, LHRI55A.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Our results show that a liganded ExoGPI or ExoCD trans-activates the endodomain of FSHRP24A, FSHRD26A, and FSHRF36A to induce cAMP but not IP. The same result was observed with trans-activation of nonbinding LHRI55A by LHR-ExoCD. Conversely, trans-activation of FSHRL27A by ExoGPI produced IP but not cAMP.

Trans-Activation Is Selective and Requires Hormone Binding to the Exodomain
There is ample evidence that trans-activation is selective. For example, only a limited number of pairs were capable of trans-activating themselves, whereas most of pairs failed. Trans-activation requires the hormones and is dependent on the hormone dose. It requires both of the nonbinding receptor and the signal-deficient receptor. The efficacy and potency of trans-activation are significant. The exodomain attached to GPI or CD8 could not have activated nonbinding FSHR mutants by itself without bound hormone, because the trans-activation requires FSH and the ExoCD with the F36A mutation did not trans-activate FSHRF36A. The results further indicate that the signal was generated in the four nonbinding FSHRs. ExoGPI and ExoCD did not enable the nonbinding mutants to bind FSH (Fig. 4Go). In conclusion, the FSH/exodomain complex of ExoGPI or ExoCD interacted and activated FSHRP24A, FSHRD26A FSHRL27A, and FSHRF36A.

It has been an enigma how a hormone receptor can generate two or more signals (1), such as FSHR being capable of activating two enzymes, AC and PLCß. Particularly, it is unclear whether one receptor molecule can generate only one signal at a time, or two signals simultaneously or sequentially. However, it has been difficult to investigate the issue because of a lack of adequate methods. This issue is of fundamental importance because hormones generate multiple signals to induce various effects. When a hormone drug is intended for a specific action but induces multiple actions, the side effects become a major medical problem: how to reduce or eliminate side effects of a drug. One approach is to generate a specific signal for the desired action. Our data show that trans-activation of FSHRP24A, FSHRD26A, FSHRL27A, and FSHRF36A generate only one of the two known signals. It would be interesting to see whether this trans-activation approach could be adopted to reduce or eliminate side effects of hormone therapy.

It is intriguing how the liganded exodomain of ExoGPI and ExoCD interacts with the endodomain of the nonbinding receptors and selectively generates the cAMP signal, without invoking the PLCß signal. Because exoloops in the endodomain, in particular exoloop 3, are involved in the signal generation (15, 29, 30), a simple explanation is that the liganded exodomain interacts with the exoloop differently in trans-activation than in cis-activation. Exoloop 3 comprises 11 amino acids, 580KVPLITVSKAK590, and most of them are involved in the PLCß signal. In contrast, only L583, I584, and K590 are essential for the AC signal generation (15). All of these residues are likely intramolecularly accessible to the liganded exodomain in cis-activation. On the other hand, the futile PLCß signal of trans-activation can be explained if a liganded exodomain is intermolecularly accessible to L583, I584, and K590, but not other residues.

It is curious which part of the liganded exodomain, the hormone, exodomain, or both, is responsible for interacting and activating the exoloops. FSH complexed with the exodomain has been shown to interact with exoloop 3, possibly in the orientation of the FSH {alpha}-subunit toward exoloop 3 and the ß subunit toward the N-terminal region of the exodomain (31). In addition to the hormone, the exodomain also interacts with the exoloops and modulates the signal generation (29, 30, 32, 33, 34, 35).

Interestingly, P24A, D26A, L27A, and F36A, which are permissible for trans-activation, are localized in a short N-terminal region and play significant roles in hormone binding (31). In particular, L27 is interesting, because it is the only and prominent aliphatic residue in the middle of the -P24-S25-D26-L27-P28-R29-sequence. Such a long aliphatic residue is likely to serve as a contact residue (36). In contrast, the receptors with mutations upstream or downstream of the D24-F36 sequence could not be trans-activated. A simple explanation is that the location of nonbinding mutations plays a role in trans-activation. The nonbinding mutations in the N-terminal region are permissible for trans-activation, whereas the nonbinding mutations downstream of the N-terminal region are not. It is possible that some of the non-trans-activatable mutants may be inherently defective in signaling in addition to nonbinding. Interestingly, some amino acid residues in this nonpermissible region are involved in modulating the endodomain and the signal generation. For example, S255 of LHR suppresses the cAMP signaling of the endodomain (32, 33, 34), whereas G91 of LHR appears to promote the signaling (37). These residues are conserved in FSHR, LHR, and TSH receptor. Furthermore, there is evidence that these regions make contacts with the endodomain. Because the hormones also interact with the exodomain and endodomain (15, 33, 38, 39, 40), it is likely that the interactions among the hormone, exodomain and endodomain differ in trans-activation and cis-activation. The interactions appear to be more restricted in trans-activation.

Our results show that the maximum cAMP induction via ExoGPI and ExoCD differs significantly, 53% of the wild-type value and 26%, respectively. The disparate trans-activation efficiency suggests a crucial difference in ExoGPI and ExoCD. ExoGPI is anchored to the membrane via two fatty chains, whereas ExoCD is anchored to the membrane via the transmembrane domain CD8. The fatty chains are likely to diffuse in the membrane matrix consisting of lipids, significantly faster by 10- to 100-fold than the diffusion of the helical transmembrane domain (41). GPI-anchored proteins are localized in lipid rafts, the cholesterol- and sphingolipid-rich and detergent-resistant domain of the plasma membrane (42, 43). Lipid rafts are involved in signaling, membrane trafficking, and other functions. Trans-activation of nonbinding FSHRs by ExoGPI suggests their presence in lipid rafts. This is consistent with our observations that a portion of photoaffinity-labeled FSHR and LHR could not be solubilized in nonionic detergent. The fast lateral diffusion of ExoGPI would enable it to encounter nonbinding FSHR more frequently than ExoCD would, which could facilitate trans-activation. This hypothesis would be a valid if ExoGPI and ExoCD were not stably associated with other proteins including nonbinding FSHRs. Interestingly, desensitized (postactivated) LHR forms larger complexes with other LHR and signal molecules than predesensitized LHR (44). It is also possible that the exodomain attached to GPI may be more flexible and free than the one attached to CD8, as ExoCD may experience the steric hindrance from the rigid transmembrane domain. In fact, the hinge region of the exodomain is less structured than the Leu-rich repeats (13).

It is tempting but premature to conclude that ExoGPI or ExoCD forms a stable dimer with a nonbinding FSHR. In a dimeric situation, a liganded FSHR could cis-activate itself and then, trans-activate its partner FSHR in the dimer. Our cross-linking data do not exclude multimeric FSHRs. Therefore, the trans-activation observed in this study likely involves, at least, the transient interaction of the FSHRs or multimeric FSHRs. LHRs tend to self-aggregate (45), particularly post desensitization (44). It would be interesting to see how the trans-activating and trans-activated FSHRs interact before and after trans-activation and where the cross-linked FSH/ExoGPI complex fits in these dynamic receptor states. The exodomain of the metabotropic glutamate receptor form a disulfide-linked dimer and each monomeric unit binds the ligand (46) as do the Ca2+ receptor (47) and m3 muscarinic receptor (48). It is unclear whether these neurotransmitter receptors are cis-activated and/or trans-activated. Interestingly, however, some isoforms of these receptors do not form dimers (49). The same question can be raised about dimers and oligomers of the hormone receptors with a single transmembrane domain, which is involved in receptor Tyr-phosphorylation and activation (50). It is not quite clear how the dimeric exo-domains activate the Tyr-kinase of the endodomain.

In summary, we presented evidence that the FSHR exodomain attached to GPI or CD binds FSH, and that the FSH/exodomain complex is capable of trans-activating nonbinding FSHR mutants. However, the trans-activation of these mutants generates either the AC signal or PLCß signal, but not both. The results indicate that trans-activation is selective and limited in signal generation, thus providing new insights into the generation of different hormone signals and a means to selectively generate a hormone signal. Our model and results, however, do not fully explain the reduced signaling potency in trans-activation. Obviously, all trans-activation is not the same, and it remains to be seen whether some trans-activations might generate both signals.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
FSHR cDNA, Mutagenesis, and Functional Expression
The signal sequence of the human FSHR cDNA (51) was replaced with the prolactin signal sequence (MDSKGSSQKGSRLL; 5-ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCG CCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC-3) and flag epitope (DYKJDDDK; 5-GATTACAAAGATGATGATGATAAG-3). For the receptors that bind FSH but cannot generate signals, the endodomain was truncated, and the remaining exodomain was attached to the boldfaced Ser residue in the GPI anchor sequence (LELVPRGSIEGRGTSITAYNSEGESAEFFFLLILLLLLVLV; 5-CTCGAGCT- GGTGCCAAGAGGCTCTATCGAGGGCAGAGGCACATCCATC-ACGGCCTA TAA TAG TG AG GGGGAGTCAGCTGAGTTCTTCTTCCTACTCATCCTTCTGCTCCTGCTCGTGCTCGTC-3). In addition to the resulting exodomain-GPI hybrid (ExoGPI) as shown in Fig. 1CGo, the truncated exodomain was attached to the transmembrane-cytoplasmic domain of CD8 (4, 52) to produce ExoCD as previously described (2). Mutant FSHRs were prepared in a pSELECT vector using the non-PCR-based Altered Sites Mutagenesis System (Promega, Madison, WI), sequenced, subcloned into pcDNA3 (Invitrogen, Carlsbad, CA), and sequenced again as previously described (25, 53). Plasmids were transfected into HEK 293 cells by the calcium phosphate method (54), and transiently transfected cells were assayed 60–72 h after transfection. Stable cell lines were established in MEM containing 8% horse serum and 500 µg/ml G-418.

125I-FSH Binding to FSHR on Intact Cells and Solubilized FSHR
Human FSH was purchased from the National Hormone and Pituitary Program and radioiodinated as previously described (55). Stable cells were assayed for 125I-FSH binding in the presence of increasing concentrations of nonradioactive FSH. The Kd values were determined by Scatchard plots. To solubilize receptors, transfected cells were washed twice with ice cold 150 mM NaCl, 20 mM HEPES (pH 7.4) (buffer A). Cells were scraped on ice, collected in buffer A containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 5 mM N-ethylmaleimide, and 10 mM EDTA), and pelleted by centrifugation at 1300 x g for 10 min. Cells were resuspended in 0.6 ml of buffer A containing 1% NP-40, 20% glycerol, and the above protease inhibitors (buffer B), incubated on ice for 15 min, and diluted with 5.4 ml of buffer A containing 20% glycerol plus the protease inhibitors (buffer C). The mixture was centrifuged at 100,000 x g for 60 min. The supernatant (500 µl) was mixed with 100,000 cpm of 125I-FSH and 6.5 µl of 0.9% NaCl and 10 mM Na2HPO4 at pH 7.4 containing increasing concentrations of unlabeled FSH. After incubation for 12 h at 4 C, the solution was thoroughly mixed with 250 µl of buffer A containing bovine {gamma}-globulin (5 µg/ml) and 750 µl of buffer A containing 20% polyethylene glycol 8000. After incubation for 10 min at 4 C, samples were pelleted at 1300 x g for 30 min and supernatants removed. Pellets were resuspended in 1.5 ml of buffer A containing 20% polyethylene glycol 8000, centrifuged, and counted for radioactivity.

Monoclonal anti-FSHR 106.105 antibody was kindly provided by Dr. James Dias (David Axelrod Institute, Albany, NY), radioiodinated, and used for assaying nonbinding mutant FSHRs expressed on the intact cell surface as previously described (56). All assays were carried out in duplicate and repeated three to four times. Means and SDs were calculated.

Assays for cAMP and IP
For intracellular cAMP assay, cells were washed twice with DMEM and incubated in the media containing isobutylmethylxanthine (0.1 mg/ml) for 15 min. Increasing concentrations of FSH were then added and the incubation was continued for 45 min at 37 C. After removing the media, the cells were rinsed once with fresh media without isobutylmethylxanthine, lysed in 70% ethanol, freeze-thawed in liquid nitrogen, and scraped. After pelleting cell debris at 16,000 x g for 10 min at 4 C, the supernatant was collected, dried under vacuum, and resuspended in 10 µl of the cAMP assay buffer, which was provided by the manufacturer. cAMP concentrations were determined with an 125I-cAMP assay kit (Amersham, Piscataway, NJ) following the manufacturer’s instruction and validated for use in our laboratory.

To assay IP, stable cells were plated in 12-well plates and grown in inositol-free DMEM (Atlanta Biologicals, Atlanta, GA) supplemented with 8% heat-inactivated horse serum and 2 µCi/ml 3H-inositol (NEN, Beverly, MA) for 48 h to 40–50% confluency. After removing the medium, the cells were incubated in 1 ml of fresh wash buffer consisting of DMEM without inositol and 15 mM HEPES (pH 7.3) for 1 h at 37 C. This medium was removed and 0.3 ml wash buffer containing 20 mM LiCl was added and incubated for 15 min at 37 C. After the cells were stimulated with increasing concentrations of hormone for 30 min at 37 C, the incubation was terminated by the removal of medium and the addition of 0.25 ml of 0.6 N HCl to each well. The cells were scraped and transferred into microcentrifuge tubes, and the wells were again washed with 0.25 ml of 0.6 N HCl. The combined washes were treated with 0.9 ml of a mixture of chloroform:methanol (2:1), vortexed, and centrifuged at 1000 x g for 5 min at room temperature. The top aqueous layer, which was free of phospholipids, was removed and the remaining chloroform layer treated with 0.2 ml of methanol:water (1:1), vortexed, and centrifuged, as above. This aqueous layer was added to the previous aqueous layer and the samples dried in a vacuum concentrator. The dried samples were redissolved in 0.5 ml of 50 mM Tris-HCl (pH 8) and applied to Dowex AG 1-X8 formate (Bio-Rad, Hercules, CA) columns. The microcentrifuge tubes were washed twice with 0.5 ml of the same buffer and the washes applied to the columns for a total of 1.5 ml. The columns were sequentially washed with 4.5 ml H2O and 4.5 ml 60 mM ammonium formate and 5 mM sodium tetraborate to elute the free inositol and the GPI. IP was eluted with 4 ml of 0.1 N formic acid in 0.2 M, 0.75 M ammonium formate, and 1.1 M ammonium formate and collected in 1-ml fractions. Aliquots of 200 µl were counted for radioactivity in 1.5 ml of Ultima AF scintillation fluid (PerkinElmer, Downers Grove, IL). Peak radioactivities were used for the data analysis.

Affinity Cross-Linking
HEK 293 cells stably expressing FSHR ExoGPI were grown in a 10-cm culture dish, incubated with 700,000 CPM of 125I-FSH at 37 C for 90 min, and washed twice with PBS to remove unbound 125I-FSH. The cells were collected in 3 ml of PBS, pelleted at 600 x g, resuspended in 70 µl of ice-cold PBS, and aliquoted for cross-linking. The cells complexed with 125I-FSH were incubated with 1 mM SES for 15 min at 5 C. The cross-linking reaction was terminated by adding 7.2 µl 100 mM glycine in PBS. Samples were solubilized with 40 µl solubilizing buffer [1% Triton X-100, 100 mM dithiothreitol, 4 M Urea, 0.1% sodium dodecyl sulfate, 0.9% NaCl (pH 7.4)]. After centrifugation at 13,000 rpm for 5 min, the supernatants were collected into new microtubes, and mixed with 10 µl of 7x loading buffer (4 M Urea, 100 mM dithiothreitol, 2% sodium dodecyl sulfate, 1% glycerol). After boiling for 3 min, the solubilized samples were electrophoresed on 8–10% gradient sodium dodecyl sulfate-polyacrylamide gel. After drying the gels on filter paper, they were exposed to PhosphorImager screen (Molecular Dynamics, Sunnyvale, CA) for analysis.


   FOOTNOTES
 
This work was supported by Grants DK-51469 and HD-18702 from the NIH.

Abbreviations: AC, Adenylyl cyclase; ExoGPI, glycosyl phosphatidylinositol; ExoCD, transmembrane domain of CD8 immune receptor; FSHR, FSH receptor; GPCR, G protein-coupled receptor; GPI, glycosyl phosphatidylinositol; hCG, human chorionic gonadotropin; HEK, human embryonic kidney; IP, inositol phosphate; Kd, equilibrium dissociation constant; LHR, LH receptor; NP-40, Nonidet P-40; PLCß, phospholipase; SES, homobifunctional cross-linker.

Received for publication November 14, 2003. Accepted for publication January 5, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ji TH, Grossmann M, Ji I 1998 G protein-coupled receptors I: diversity of receptor-ligand interactions. J Biol Chem 273:17299–17302[Free Full Text]
  2. Ji I, Lee C, Song Y, Conn PM, Ji TH 2002 Cis- and trans-activation of hormone receptors: the LH receptor. Mol Endocrinol 16:1299–1308[Abstract/Free Full Text]
  3. Lee C, Ji I, Ryu K, Song Y, Conn PM, Ji TH 2002 Two defective heterozygous luteinizing hormone receptors can rescue hormone action. J Biol Chem 277:15795–15800[Abstract/Free Full Text]
  4. Chen J, Ishii M, Wang L, Ishii K, Coughlin SR 1994 Thrombin receptor activation. Confirmation of the intramolecular tethered liganding hypothesis and discovery of an alternative intermolecular liganding mode. J Biol Chem 269:16041–16045[Abstract/Free Full Text]
  5. Gudermann T, Birnbaumer M, Birnbaumer L 1992 Evidence for dual coupling of the murine luteinizing hormone receptor to adenylyl cyclase and phosphoinositide breakdown and Ca2+ mobilization. Studies with the cloned murine luteinizing hormone receptor expressed in L cells. J Biol Chem 267:4479–4488[Abstract/Free Full Text]
  6. Das S, Maizels E, DeManno Sr D, Clair E, Adam S, Hunzicker-Dunn M 1996 A stimulatory role of cyclic adenosine 3'5'-monophosphate in follicle stimulating hormone activated mitogen activated protein kinase signaling pathway in rat ovarian granulosa cells. Endocrinology 137:967–974[Abstract]
  7. McFarland K, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245:494–499[Abstract/Free Full Text]
  8. Loosfelt H, Misrahi M, Atger M, Salesse R, Vu Hai-Luu Thi MT, Jolivet A, Guiochon-Mantel A, Sar S, Jallal B, Garnier J, Milgrom E 1989 Cloning and sequencing of porcine LH-CG receptor cDNA: variants lacking transmembrane domain. Science 245:525–528[Abstract/Free Full Text]
  9. Nagayama Y, Kaufman KD, Seto P, Rapoport B 1989 Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem Biophys Res Commun 165:1184–1190[CrossRef][Medline]
  10. Sprengel R, Braun T, Nikolics K, Segaloff DL, Seeburg PH 1990 The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA. Mol Endocrinol 4:525–530[Abstract]
  11. Ji TH, Murdoch WJ, Ji I 1995 Activation of membrane receptors. Endocrine 3:187–194
  12. Puett D, Bhowmick N, Fernandez LM, Huang J, Wu C, Narayan P 1996 hCG-receptor binding and transmembrane signaling. Mol Cell Endocrinol 125:55–64[CrossRef][Medline]
  13. Fralish GB, Narayan P, Puett D 2003 Consequences of single chain translation on the structure of two chorionic gonadotropin yoked analogs in {alpha}-ß and ß-{alpha} configurations. Mol Endocrinol 17:757–767[Abstract/Free Full Text]
  14. Gilchrist RL, Ryu K-S, Ji I, Ji TH 1996 The luteinizing hormone/human choriogonadotropin receptor has distinct transmembrane conductors for cAMP and inositol phosphate signals. J Biol Chem 271:19283–19287[Abstract/Free Full Text]
  15. Sohn J, Ryu KS, Sievert G, Jeoung M, Ji I, Ji TH 2002 Follicle stimulating hormone interacts with exoloop 3 of the receptor. J Biol Chem 277:50165–50175[Abstract/Free Full Text]
  16. Lustbader JW, Lobel L, Wu H, Elliott MM 1998 Structural and molecular studies of human chorionic gonadotropin and its receptor. Recent Prog Horm Res 53:395–424[Medline]
  17. Lobel LI, Pollak S, Klein J, Lustbader JW 2001 High-level bacterial expression of a natively folded, soluble extracellular domain fusion protein of the human luteinizing hormone/chorionic gonadotropin receptor in the cytoplasm of Escherichia coli. Endocrine 14:205–212[CrossRef][Medline]
  18. Dufau ML 1998 The luteinizing hormone receptor. Annu Rev Physiol 60:461–496[CrossRef][Medline]
  19. Schlessinger J 2002 All signaling is local? Mol Cell 10:218–219[CrossRef][Medline]
  20. Beau I, Touraine P, Meduri G, Gougeon A, Desroches A, Matuchansky C, Milgrom E, Kuttenn F, Misrahi M 1998 A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. J Clin Invest 102:1352–1359[Medline]
  21. Touraine P, Beau I, Gougeon A, Meduri G, Desroches A, Pichard C, Detoeuf M, Paniel B, Prieur M, Zorn JR, Milgrom E, Kuttenn F, Misrahi M 1999 New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype. Mol Endocrinol 13:1844–1854[Abstract/Free Full Text]
  22. Doherty E, Pakarinen P, Tiitinen A, Kiilavuori A, Huhtaniemi I, Forrest S, Aittomaki K 2002 A Novel mutation in the FSH receptor inhibiting signal transduction and causing primary ovarian failure. J Clin Endocrinol Metab 87:1151–1155[Abstract/Free Full Text]
  23. Laue L, Wu SM, Kudo M, Hsueh AJ, Cutler Jr GB, Jelly DH, Diamond FB, Chan WY 1996 Heterogeneity of activating mutations of the human luteinizing hormone receptor in male-limited precocious puberty. Biochem Mol Med 58:192–198[CrossRef][Medline]
  24. Wu S, Hallermeier KM, Laue L, Brain C, Berry AC, Grant DB, Griffin JE, Wilson JD, Cutler Jr GB, Chan WY 1998 Inactivation of the luteinizing hormone/chorionic gonadotropin receptor by an insertional mutation in Leydig cell hypoplasia. Mol Endocrinol 2:1651–1660
  25. Song YS, Ji I, Beauchamp J, Isaacs NW, Ji TH 2001 Hormone interactions to Leu rich repeats in the gonadotropin receptors: I. analysis of Leu rich repeats of human luteinizing hormone/chorionic gonadotropin receptor and follicle stimulating hormone receptor. J Biol Chem 276:3426–3435[Abstract/Free Full Text]
  26. Ji I, Ji TH 1995 Differential roles of exoloop 1 of the human follicle-stimulating hormone receptor in hormone binding and receptor activation. J Biol Chem 270:15970–15973[Abstract/Free Full Text]
  27. Arreaza G, Brown D 1995 Sorting and intracellular trafficking of a glycosylphosphatidylinositol-anchored protein and two hybrid transmembrane proteins with the same ectodomain in Madin-Darby canine kidney epithelial cells. J Biol Chem 270:23641–23647[Abstract/Free Full Text]
  28. Osuga Y, Kudo M, Kaipia A, Kobilka B, Hsueh AJ 1997 Derivation of functional antagonists using N-terminal extracellular domain of gonadotropin and thyrotropin receptors. Mol Endocrinol 11:1659–1668[Abstract/Free Full Text]
  29. Ryu K, Lee H, Kim S, Beauchamp J, Tung CS, Isaacs NW, Ji I, Ji TH 1998 Modulation of high affinity hormone binidng: human choriogonadotropin binding to the exodomain of the receptor is influenced by exoloop 2 of the receptor. J Biol Chem 273:6285–6291[Abstract/Free Full Text]
  30. Ryu K, Gilchrist RL, Tung C, Ji I, Ji TH 1998 High affinity hormone binding to the extracellular N-terminal exodomain of the follicle-stimulating hormone receptor is critically modulated by exoloop 3. J Biol Chem 273:28953–28958[Abstract/Free Full Text]
  31. Sohn J, Youn H, Jeoung M, Koo Y, Yi C, Ji I, Ji TH 2003 Orientation of FSH subunits complexed with the FSH receptor: ß subunit toward the N terminus of exodomain and {alpha} subunit to exoloop 3. J Biol Chem 278:47868–47876[Abstract/Free Full Text]
  32. Nakabayashi K, Kudo M, Kobilka B, Hsueh AJ 2000 Activation of the luteinizing hormone receptor following substitution of Ser-277 with selective hydrophobic residues in the ectodomain hinge region. J Biol Chem 275:30264–30271[Abstract/Free Full Text]
  33. Zeng H, Phang T, Song YS, Ji II, Ji TH 2001 The role of the hinge region in the luteinizing hormone receptor in hormone interaction and signal generation. J Biol Chem 276:3451–3458[Abstract/Free Full Text]
  34. Nishi S, Nakabayashi K, Kobilka B, Hsueh AJ 2002 The ectodomain of the luteinizing hormone receptor interacts with exoloop 2 to constrain the transmembrane region: studies using chimeric human and fly receptors. J Biol Chem 277:3958–3964[Abstract/Free Full Text]
  35. Sudo S, Kumagai J, Nishi S, Layfield S, Ferraro T, Bathgate RA, Hsueh AJ 2003 H3 relaxin is a specific ligand for LGR7 and activates the receptor by interacting with both the ectodomain and the exoloop 2. J Biol Chem 278:7855–7862[Abstract/Free Full Text]
  36. Janin J, Chothia C 1990 The structure of protein-protein recognition sites. J Biol Chem 265:16027–16030[Free Full Text]
  37. Song YS, Ji I, Beauchamp J, Isaacs NW, Ji TH 2001 Hormone interactions to Leu rich repeats in the gonadotropin receptors: II. analysis of Leu rich repeat 4 of human luteinizing hormone/chorionic gonadotropin receptor. J Biol Chem 276:3436–3442[Abstract/Free Full Text]
  38. Phang T, Kundu G, Hong S, Ji I, Ji TH 1998 The amino-terminal region of the lutropin/choriogonadotropin receptor contacts both subunits of human choriogonadotropin: II. photoaffinity labeling. J Biol Chem 273:13841–13847[Abstract/Free Full Text]
  39. Jeoung M, Phang T, Song YS, Ji I, Ji TH 2001 Hormone interactions to Leu rich repeats in the gonadotropin receptors: III. photoaffinity labeling of human chorionic gonadotropin with receptor Leu rich repeat 4 peptide. J Biol Chem 276:3443–3450[Abstract/Free Full Text]
  40. Yi C, Song Y, Ryu K, Sohn J, Ji I, Ji T 2002 Common and differential mechanisms of gonadotropin receptors. Cell Mol Life Sci 59:932–940[CrossRef][Medline]
  41. Yeagle P 1987 The membranes of cells. Orlando, FL: Academic Press
  42. Brown DA, London E 2000 Structure and function of sphingolipid- and cholesterol-rich membrane rafts. J Biol Chem 275:17221–17224[Free Full Text]
  43. Nabi IR, Le PU 2003 Caveolae/raft-dependent endocytosis. J Cell Biol 161:673–677[Abstract/Free Full Text]
  44. Hunzicker-Dunn M, Barisas G, Song J, Roess DA 2003 Membrane organization of luteinizing hormone receptors differs between actively signaling and desensitized receptors. J Biol Chem 278:42744–42749[Abstract/Free Full Text]
  45. Shinozaki H, Butnev V, Tao YX, Ang KL, Conti M, Segaloff DL 2003 Desensitization of Gs-coupled receptor signaling by constitutively active mutants of the human lutropin/choriogonadotropin receptor. J Clin Endocrinol Metab 88:1194–1204[Abstract/Free Full Text]
  46. Kunishima N, Shimada Y, Tsuji Y, Sato T, Yamamoto M, Kumasaka T, Nakanishi S, Jingami H, Morikawa K 2000 Structural basis of glutamate recognition by a dimeric metabotropic glutamate receptor. Nature 407:971–977[CrossRef][Medline]
  47. Zhang Z, Sun S, Quinn SJ, Brown EM, Bai M 2001 The extracellular calcium-sensing receptor dimerizes through multiple types of intermolecular interactions. J Biol Chem 276:5316–5322[Abstract/Free Full Text]
  48. Zeng FY, Wess J 1999 Identification and molecular characterization of m3 muscarinic receptor dimers. J Biol Chem 274:19487–19497[Abstract/Free Full Text]
  49. Zeng F, Wess J 2000 Molecular aspects of muscarinic receptor dimerization. Neuropsychopharmacology 23:S19–S31
  50. Weiss A, Schlessinger J 1998 Switching signals on or off by receptor dimerization. Cell 94:277–280[CrossRef][Medline]
  51. Tilly JL, Aihara T, Nishimori K, Jia XC, Billig H, Kowalski KI, Perlas EA, Hsueh AJ 1992 Expression of recombinant human follicle-stimulating hormone receptor: species-specific ligand binding, signal transduction, and identification of multiple ovarian messenger ribonucleic acid transcripts. Endocrinology 131:799–806[Abstract]
  52. Osuga Y, Hayashi M, Kudo M, Conti M, Kobilka B, Hsueh A 1997 Co-expression of defective luteinizing hormone receptor fragments partially reconstitutes ligand-induced signal generation. J Biol Chem 272:25006–25012[Abstract/Free Full Text]
  53. Ji I, Ji TH 1991 Asp383 in the second transmembrane domain of the lutropin receptor is important for high affinity hormone binding and cAMP production. J Biol Chem 266:14953–14957[Abstract/Free Full Text]
  54. Chen C, Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752[Abstract/Free Full Text]
  55. Ji I, Ji T 1981 Both {alpha} and ß subunits of human choriogonadotropin photoaffinity label the hormone receptor. Proc Natl Acad Sci USA 78:5465–5469[Abstract/Free Full Text]
  56. Hong S, Phang T, Ji I, Ji TH 1998 The amino-terminal region of the lutropin/choriogonadotropin receptor contacts both subunits of human choriogonadotropin: I. mutational analysis. J Biol Chem 273:13835–13840[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
A. M. Svendsen, M. Vrecl, T. M. Ellis, A. Heding, J. B. Kristensen, J. D. Wade, R. A. D. Bathgate, P. De Meyts, and J. Nohr
Cooperative Binding of Insulin-Like Peptide 3 to a Dimeric Relaxin Family Peptide Receptor 2
Endocrinology, March 1, 2008; 149(3): 1113 - 1120.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
R. M. Thomas, C. A. Nechamen, J. E. Mazurkiewicz, M. Muda, S. Palmer, and J. A. Dias
Follice-Stimulating Hormone Receptor Forms Oligomers and Shows Evidence of Carboxyl-Terminal Proteolytic Processing
Endocrinology, May 1, 2007; 148(5): 1987 - 1995.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
W. Guo, L. Shi, M. Filizola, H. Weinstein, and J. A. Javitch
From The Cover: Crosstalk in G protein-coupled receptors: Changes at the transmembrane homodimer interface determine activation
PNAS, November 29, 2005; 102(48): 17495 - 17500.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/4/968    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, I.
Right arrow Articles by Ji, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, I.
Right arrow Articles by Ji, T. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals