| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Max-Planck Institute for Immunobiology, 79108 Freiburg, Germany
Address all correspondence and requests for reprints to: Matthias Hammerschmidt, Max-Planck Institute for Immunobiology, Stuebeweg 51, 79108 Freiburg, Germany. E-mail: hammerschmid{at}immunbio.mpg.de.
| ABSTRACT |
|---|
|
|
|---|
, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsu
-positive cells is normal despite the loss of gsu
and tshß coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhß, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species. | INTRODUCTION |
|---|
|
|
|---|
-subunit (GSU
) chain that forms heterodimers with TSHß, LHß, or FSHß. The development of the different adenohypophyseal cell types from a common primordium is governed by various transcription factors that are expressed throughout the adenohypophyseal anlage in partly overlapping patterns (reviewed in Refs.1, 2, 3, 4, 5, 6, 7). These transcription factors act as cell-autonomous determinants, allowing differential and position-dependent specification of pituitary cell fates by embryonic d 10.5 (e10.5)e12.5 of mouse development. They belong to different classes of proteins, including Lim homeodomain (Lhx3, Lhx4, Isl1), paired-like homeodomain (Prop1, Rpx), bicoid-like homeodomain (Pitx), sine oculis-related homeodomain (Six1, Six3), and zinc finger proteins (Gata2). Terminal differentiation of the different pituitary cell types in response to such patterns, however, involves additional transcription factors, such as Pit1 (see below), the orphan receptor Sf1 (8) (gonadotropes), the T-box protein T-pit/Tbx19 (9, 10, 11), and possibly Stat3 (12) (Pomc-expressing cells).
Pit-1 is a Pou-homeodomain transcription factor that was initially identified and cloned based on its ability to bind and transactivate the expression of the Gh and Prl genes (13, 14). In addition, Pit-1 is able to regulate the expression of the Tshß gene via low-affinity Pit-1 binding sites (15). Spontaneous mutations in the mouse or human Pit-1 gene lead to hypopituitarism and dwarfism (16, 17, 18, 19). Lactotropes, somatotropes, and thyrotropes, constituting the Pit-1 lineage, fail to differentiate. In the case of thyrotropes, only the later differentiating (e15.5) caudomedial cells are affected in Pit-1 mutant mice, whereas the earlier differentiating (e12.5) rostral tip thyrotropes develop independently of Pit-1 (15). In caudomedial thyrotropes, Pit-1 induces Tshß expression in synergy with Gata2, which is present in the ventral part of the adenohypophyseal anlage (20). Simultaneously, Pit-1 inhibits the expression of gonadotrope-specific genes such as Lhß by blocking binding of Gata2 to promoters which, in contrast to Tshß (21), do not contain adjacent Pit-1 bindings sites (2, 7, 20). Accordingly, Pit-1 mutant Snell dwarf mice show ectopic expression of the Gata2-dependent gonadotrope markers Lhß and Sf1 in cells that presumably would have normally given rise to caudomedial thyrotropes (20). In contrast to Tshß, the somatotroph-specific Gh gene and the lactotroph-specific Prl gene lack Gata2 binding sites. Here, the differential effect of Pit-1 (Gh on and Prl off in somatotropes, and vice versa in lactotropes) is mediated by a 2-bp difference in the spacing between the binding sites for the Pit-1 Pou domain and the Pit-1 homeodomain (7, 22). This altered spacing, in concert with additional cell type-specific DNA binding factors, leads to the recruitment of corepressor complexes to the Gh gene in lactotropes, whereas the Prl gene is activated, and to an activation of Gh and a repression of Prl transcription in somatotropes (7, 22).
Pit-1 also acts as a positive transcriptional regulator of its own gene (23, 24), mediated by Pit-1 binding elements within a distal enhancer (25, 26). In Pit-1 mutant mice, Pit-1 expression is normally initiated at e13.5; however, expression declines between e15.5 and e16.5 (27), indicating that Pit-1 is required for the maintenance of Pit-1 expression.
Here, we report the isolation and characterization of pit1 and pit1 mutants from zebrafish. Comparing our results with data obtained for the mouse, we find both conserved and class-specific aspects of Pit1 function. As in the mouse, zebrafish pit1 is expressed in and required for the development of lactotropes, somatotropes, and thyrotropes, causing severe dwarfism in mutants. As in the mouse, Pit1 is positive autoregulative and most likely required for the blockage of gonadotroph differentiation. However, zebrafish pit1 expression starts much earlier than that of its mouse homolog and might have earlier and additional roles, as indicated by the high death rate of mutant larvae. On the molecular level, zebrafish Pit1 seems responsible for the much earlier onset of prl expression in fish compared with mouse. In addition, zebrafish Pit1 appears to act as a negative regulator of the Pomc lineage, whereas in mouse, this lineage is supposed to specify before Pit-1 comes into play.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
, prl, and pomc
were carried out. At 24 hpf, all pit1-positive cells also express lim3 (Fig. 3
Double staining with prl at 25 hpf reveals that the pit1-positive cells at the ANR are lactotropes, whereas the pit1-expressing cells organized in the two longitudinal stripes located lateral and posterior of the ANR are prl-negative, most likely representing presumptive somatotropes and thyrotropes (Fig. 3
, F and G). At 40 hpf, these lateral stripes have converged to the midline, forming a single domain of pit1-positive, prl-negative cells located directly posterior to the lactotropes (Fig. 3H
). Double stainings of pit1 with gh or tshß at 72 hpf show that this domain contains somatotropes and thyrotropes that coexpress pit1 and gh, or pit1 and tshß, respectively (data not shown, but compare with Ref.29).
In contrast to the other adenohypophyseal cell lineages, no hormone marker gene for zebrafish gonadotropes (lhß, fshß) has been described as yet. However, we have cloned the zebrafish gsu
homolog, encoding the
-chain shared by the gonadotroph hormones and Tsh of the thyrotropes (see Materials and Methods). In contrast to tshß, which in zebrafish is only found in pit1-positive cells (data not shown), two different types of gsu
-positive cells can be distinguished (Fig. 3
, I and J; 32 hpf): cells coexpressing gsu
and pit1, which most likely represent thyrotropes, and cells lacking pit1 transcripts, which most likely represent gonadotropes. This would be as in mammals, where thyrotropes are part of the Pit1 lineage, whereas gonadotropes derive from Pit1-negative precursor cells. Interestingly, the putative gonadotropes are preferentially located in the ventral half of the adenohypophyseal anlage, revealing dorsoventral polarity of the anlage (Fig. 3J
).
Like gonadotropes, cells of the zebrafish Pomc lineage (corticotropes and melanotropes) lack pit1 expression, as revealed via double stainings for pit1 and pomc transcripts at 25 hpf (Fig. 3
, K and L) and 32 hpf (Fig. 3M
). At these stages, pit1 and pomc are expressed in a complementary fashion, with the two cell populations intermingled in a salt-and-pepper pattern. During further development, the lineages sort out along the AP and the dorsoventral axis of the anlage. At 48 hpf (Fig. 3N
), three domains can be distinguished, an anterior-dorsal domain with pit1- and pomc-positive cells, an anterior-ventral domain with pit1-positive cells only, and a posterior domain with more pomc- than pit1-positive cells (see also Fig. 3O
for 72 hpf). The dorsoventral asymmetry in the anterior part of the anlage appears to be rather transient. At 120 hpf (Fig. 3P
), the three domains are aligned along the AP axis, with the domain of pit1-positive cells only being shifted into an intermediate AP position, separating the anterior domain of the lactotropes and corticotropes, and the posterior domain of the corticotropes and melanotropes (29, 30).
Antisense-Mediated Inactivation of pit1 Leads to the Loss of Lactotropes, Somatotropes, and Thyrotropes
In mouse, Pit-1 loss-of-function mutations lead to hypocellular and hypoplastic pituitary glands, lacking Prl, Gh, and Tshß expression (16). This indicates that Pit-1 is required for the proliferation and/or survival of lactotropes, somatotropes, and thyrotropes, and for the transcriptional activation of their hormone genes. To inactivate pit1 during zebrafish development, embryos were injected with antisense morpholino oligonucleotides (MOs). Such MOs have been shown to efficiently block the translation of targeted mRNAs throughout the first 3 d of development (31). At 72 hpf, zebrafish embryos injected with pit1 MOs display a complete absence of prl (Fig. 4
, A and B), gh (Fig. 4
, D and E) and tshß expression (Fig. 4
, G and H), indicating that Pit1 is required for lactotroph, somatotroph, and thyrotroph specification. In contrast, pomc is expressed at normal levels and in an increased number of cells (Fig. 4
, J and K), indicating that Pit1 is dispensable for or might even have a negative effect on the specification of corticotropes and melanotropes.
|
Using a total of 495 mutant embryos (990 meioses) from Tue-wik intercrosses, one of the mutations, t21379, was mapped via segregation linkage analysis into a 0.5-cM interval around 52 cM from the north end of linkage group 9 (Fig. 1B
, and Materials and Methods). Via radiation hybrid mapping, the pit1 gene was located to the same region (Fig. 1B
). This, together with the identical phenotypes of mutants and morphants, strongly suggested that the pituitary phenotypes of t22072 and t21379 mutants might be caused by pit1 mutations. To test this notion, we cloned the pit1 cDNA and the different exons of the pit1 gene, including flanking intron sequences, from t22072 and t21379 mutant embryos.
For both mutants, severe splice site mutations in the pit1 gene were found. In t22072, the splice donor of intron 5/6 displays a GT
AT mutation. As an alternative splice donor, the GT at the 5'-end of exon 5 is used, leading to a deletion of all 165 exon 5-encoded nucleotides in the mRNA (Fig. 5A
). The resulting protein lacks 55 internal aa residues, including 40 aa residues of the highly conserved Pou-specific domain (Fig. 5C
). The t21379 allele displays an AG
GG mutation in the splice acceptor site of intron 2/3. Here, two different alternative transcripts are formed, one with a 53-bp insertion, caused by the usage of an intron 2/3-internal AG as splice acceptor, and one with a 5-bp deletion, caused by the usage of an AG in the 5'-region of exon 3 (Fig. 5B
). Both mutations lead to frame shifts and to proteins with unrelated sequences after the first 94 aa encoded by exons 1 and 2, and premature termination after 97 and 117 aa residues, respectively. Most importantly, both proteins lack the entire Pou-specific domain and the entire Pou homeodomain (Fig. 5C
). We conclude that both mutations lead to nonfunctioning Pit1 proteins. They can therefore be regarded as null mutations.
Pit1 Is Required for the Initiation of prl and tshß, and the Maintenance of pit1 Expression
Mouse Pit-1 has been shown to act as a positive autoregulator of its own expression, mediated via binding to a late distal enhancer element (25). Accordingly, Pit-1 mutant mice display a progressive loss of Pit-1 expression (27). The same is true for zebrafish pit1. Although at 19 hpf, pit1 mutants and wild-type siblings display undistinguishable pit1 expression (data not shown), the number of pit1-positive cells and the pit1 staining intensity are significantly reduced in mutant embryos at 24 hpf (Fig. 6
, AC). After 26 hpf, no pit1 expression is detectable in mutant embryos at all (Fig. 6I
and data not shown). This progressive loss of pit1 transcripts indicates that Pit1 is required for the maintenance of its own expression. This is in contrast to the role of Pit1 as a transcriptional activator of the prl, gh, and tsh genes. Here, no transcripts are detectable in pit1 mutant embryos even at stages when expression is initiated in wild-type siblings (Fig. 6
, A and C for prl at 24 hpf; Fig. 6
, M and O, for tshß at 58 hpf), indicating that Pit1 is required for the initiation of hormone gene expression.
|
-positive cells is unaltered in mutant embryos (Fig. 6
pit1 Mutant Pituitaries Display Normal Numbers of gsu
-, and Increased Numbers of pomc-Positive Cells, Some of Which Display Coexpression with pit1
In Pit1 mutant mice, one subset of the Pit1 lineage, the caudomedial thyrotropes, are supposed to be transfated to gonadotropes (20). Gonadotroph precursors also appear to exist in zebrafish embryos, characterized by the expression of gsu
in the absence of pit1 (see above; Fig. 3
, I and J) or tshß transcripts (Fig. 6
, M and N). In pit1 mutant adenohypophyses, the number of gsu
-positive cells is unaltered, although none of them co-expresses tshß (Fig. 6O
). In other words, the number of gsu
-positive, tshß-negative cells in pit1 mutants is approximately double as high as in wild-type siblings (Fig. 6
, M and O). This suggests that in the absence of Pit1, thyrotrope precursors become gonadotropes, the number of which increases accordingly. To support this notion, it will be necessary to analyze the expression of the gonadotropin ß genes (lhß, fshß). We have failed to clone the zebrafish homologs thus far; however, we would expect them to be expressed in all gsu
-positive cells of pit1 mutant embryos, whereas in wild types, expression should be restricted to the gsu
-positive, tshß-negative cells.
In addition to this likely expansion of gonadotropes, pit1 mutants display an unambiguous increase in the number of pomc-positive cells. At 24 hpf, shortly before the initiation of pomc expression in wild-type embryos (Fig. 6D
; compare with Fig. 3K
), pit1 mutants display pomc expression in several cells at the ANR (Fig. 6E
). Interestingly, these cells coexpress pit1 (Fig. 6
, E and F), whereas in wild-type embryos, pomc and pit1 expression is mutually exclusive from earliest stages onward (Fig. 3
, K and L, for 25 hpf; Fig. 6
, G and H, for 26 hpf). This transient coexpression of pit1 and pomc in the same adenohypophyseal cells of pit1 mutants indicates that in the absence of functioning Pit1 protein, pomc expression is ectopically activated in cells of the Pit1 lineage, as expected in the case of transfating. At 26 hpf (Fig. 6
, GI), when pit1 transcripts have become undetectable in pit1 mutants, and at 32 hpf (Fig. 6
, J and K), the number of pomc-positive cells in pit1 mutants is approximately double as high as in wild-type siblings. At later stages (from 48 hpf onward), pomc cells normally segregate out, avoiding mixing with other cell types with the exception of the lactotropes (29), which are absent in pit1 mutants. In this light, the large expansion of the pomc population could be the reason why the remaining other pituitary cells of pit1 mutants are organized in a more compact fashion than in wild-type siblings, as revealed by the gsu
expression pattern at 48 hpf (Fig. 6L
) and at 58 hpf (Fig. 6
, N and O).
pit1 Mutant Pituitaries Are of Normal Size and without Any Sign of Increased Cell Death Rates
In mouse Pit-1 mutants, lactotrope and somatotrope precursor cells are thought not to transfate, but to remain unspecified until they die by apopotosis, eventually leading to smaller pituitary glands. In contrast, the adenohypophysis of zebrafish pit1 mutants seems of normal size at all investigated stages (24 hpf to 120 hpf), as determined via whole-mount in situ hybridization with lim3 (Fig. 6
, J and K; 32 hpf) or pomc (Fig. 4
, J and L; 72 hpf), and via microscope inspection of live embryos and larvae, using Nomarski optics (Fig. 7
, CF; 32 hpf and 54 hpf). Also, pit1 mutant pituitary glands display normal cell death rates, as determined via acridine orange (Fig. 7
, CF) or TUNEL (terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling) stainings (Fig. 7
, A, B, G, and H) at various stages between 24 and 120 hpf. As a positive control, parallel stainings of another pituitary mutant were performed, which showed significantly increased numbers of acridine orange- and TUNEL-positive adenohypophyseal cells at 28 hpf (data not shown). In sum, this indicates that cells of the Pit1 lineage remain alive during the investigated stages of pit1 mutant zebrafish pituitary glands.
|
|
| DISCUSSION |
|---|
|
|
|---|
The analysis of the role of pit1 during zebrafish development turned out to be very helpful in further illuminating the mechanisms of pituitary patterning in fish. In addition, it allowed us to further compare pituitary development in fish and mouse, revealing both conserved and class-specific aspects of Pit1 function.
Zebrafish Adenohypophysis Patterning and Morphogenesis, as Revealed by pit1 and gsu
Expression
Thus far, we only had prl and pomc as early lineage-restricted markers to follow the patterning within the adenohypophyseal anlage before and during its movement into the head (29). Expression of the gh and tshß genes is only initiated after this posterior movement, when cells have almost reached their final positions within the pituitary. Based on this limited set of data, we had proposed a model of pituitary patterning according to which somatotropes and thyrotropes might derive from medial regions of the adenohypophyseal placode at the ANR, surrounded by lactotropes and corticotropes more laterally. However, with the availability of the pit1 probe as an early marker for somatotropes and thyrotropes, we have to withdraw this view. Our pit1/prl double stainings show that somatotropes and thyrotropes are formed in two longitudinal stripes that extend from lateral regions of the ANR in a posterior direction to an AP level in line with the anterior border of the forming eyes. During further development, these posterior-lateral cells appear to directly converge to the midline (compare Fig. 3F
with Fig. 3H
), rather than following the route of the anterior-medial cells (29).
Similarly, the expression patterns of pit1 and gsu
revealed a thus far missed transient dorsoventral asymmetry in the adenohypophyseal anlage, with gonadotropes, characterized by gsu
expression in the absence of pit1 and tshß transcripts, positioned ventral of the Pit1 lineage. A similar dorsoventral polarity was also observed within the Pit1 lineage itself. Here, an anterior ventral domain consisting of pit1-positive cells can be distinguished from an anterior dorsal domain, in which cells of the Pit1 lineage are intermingled with cells of the Pomc lineage. This is consistent with the situation described for the mouse, where the dorsoventral polarity of Rathkes pouch is very prominent, with gonadotropes in ventral-most locations, and cells of the Pomc lineage positioned dorsal of the Pit-1 lineage (36), although according to recent reviews, only the melanotropes are dorsal, whereas corticotropes are ventral (6, 7).
Zebrafish and Mouse Pit1 Are Required for the Specification of the Same Cell Types
As in mouse, zebrafish pit1 is expressed only in a subset of adenohypophyseal cells, defining the Pit1 lineage that consists of lactotropes, somatotropes, and thyrotropes. In mouse, two distinct populations of thyrotropes can be distinguished, the caudomedial population that arises at e15.5 and serves as the precursors of the mature thyrotropes, and the rostral tip thyrotropes that appear much earlier, at e12, but disappear again around birth (15). The rostral tip thyrotropes develop independently of Pit-1. They lack Pit-1 expression during normal development, and are present in Pit-1 mutant mice, whereas caudomedial thyrotropes, somatotropes, and lactotropes are not specified (15). In zebrafish, we found tsh expression to come up in one domain and at one time point only (29), always coexpressed with pit1. Accordingly, zebrafish pit1 mutants lack all thyrotropes, lactotropes, and somatotropes. This suggests that a cell population equivalent to the mammalian rostral tip thyrotropes does not exist in zebrafish, whereas the concept of the Pit1-dependent lineage of caudomedial thyrotopes, somatotropes, and lactotropes has been conserved among mammals and fish.
Possible Earlier Roles of Zebrafish Pit1
Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. Whereas mouse Pit-1 expression is initiated much later than that of Lhx3 (Pit-1 at e13.5; Lhx3 at e8.5; Ref.4), zebrafish pit1 expression starts at the same time or even slightly earlier than lim3. This is approximately 6 h before the onset of pomc expression (pit1, lim3 at 18 hpf; pomc at 24 hpf), whereas in mouse, Pit-1 expression starts approximately 1 d after that of Pomc (Pomc at e12.5; Pit-1 at e13.5; Ref.4). This earlier onset of pit1 expression in the zebrafish together with lim3 might have several implications. Consistent with the reported synergism of mouse Pit-1 and Lhx3 on the transcriptional activation of the mouse Prl gene (37), it might lead to the earlier onset of zebrafish prl expression, as reported previously (29). Compared with mammals, Prl in fish is supposed to have earlier and additional developmental functions, e.g. as an osmoregulator (29, 38). This might be the reason for the observed high frequency of larval lethality of pit1 mutant zebrafish, whereas mouse Pit1 mutants normally survive to adulthood (33).
Pit1 Appears to Repress pomc and Gonadotropin Expression
Another consequence of the early expression of pit1 might be concerned with the observed increase of pomc-positive cells in pit1 mutant embryos. We cannot rule out that this is partly due to an overproliferation of the Pomc lineage, as a secondary consequence of the loss of the Pit1 cells. However, the expansion of the pomc-positive cells is seen from earliest stages onward (24 hpf). Most strikingly, at these early stages, mutants display a coexpression of pit1 and pomc in the same adenohypophyseal cells at the ANR. During normal development, such ANR cells only show coexpression of pit1 and prl, whereas pit1 and pomc are expressed in a mutually exclusive fashion. Therefore, we conclude that the increase in the number of pomc-expressing cells in pit1 mutant embryos is caused by a transfating of cells of the Pit1 lineage, most likely lactotropes, to the Pomc lineage. This would mean that during normal development, Pit1 acts as a negative regulator of pomc expression. Analyses of the zebrafish pomc enhancer/promoter region (30) will be necessary to confirm this notion and to investigate whether Pit1 acts a direct transcriptional repressor of the pomc gene. Alternatively, Pit1 might repress pomc expression in a DNA binding-independent fashion, similarly to how it has been described for mouse Pit-1 and the Lh gene in thyrotropes, where Pit1 prevents Lhß transcription by binding and blocking the Gata2 transcription factor (2, 7, 20).
A similar gondatropin-repressive function might also apply to zebrafish Pit1. This is indicated by the expression pattern of gsu
, encoding the
-chain normally forming heterodimers with Tshß in thyrotropes, and with Lhß or Fshß in gonadotropes. In wild-type zebrafish embryos, approximately half of the gsu
-positive cells also express tshß, identifying them as thyrotropes, whereas the second half lacks tshß expression, most likely representing gonadotropes. In pit1 mutant embryos, the number of gsu
-positive cells is unaltered, although none of them shows tshß expression, suggesting that the thyrotropes of zebrafish pit1 mutants might have acquired a gonadotroph fate, as in mouse Pit-1 mutants. Final proof of this notion will require expression analyses of gonadotroph-specific markers (lhß, fshß), which are not available as yet. Also, to prove transfating, it will be necessary to demonstrate ectopic lhß or fshß expression in pit1-positive cells of mutant embryos. This will only be possible if the gonadotroph hormone genes are expressed as early as pomc (25 hpf), because slightly later, pit1 expression in pit1 mutants ceases, due to the inability of mutant Pit1 protein to fulfill its positive autoregulative function.
In mouse, no Pomc-repressing role of Pit-1 has been reported. Rather, the POMC lineage is supposed to split off before Pit-1 expression is initiated (see above and Refs.1 , 4 , and 7 , for reviews). Thus, the loss of mouse Pit-1 is supposed to cause thyrotropegonadotrope transfating only (20), similar to our interpretation of the zebrafish gsu
data described above, whereas presumptive somatotropes and lactotropes are thought to remain unspecified and nonproliferative to eventually undergo apoptosis, thereby causing pituitary hypoplasia in juvenile and adult mouse mutants (Ref.16 , and references therein). In zebrafish, we could not detect any sign of increased apoptosis rates or decreased sizes of pit1 mutant pituitary glands during all investigated larval stages (up to 120 hpf, which corresponds approximately to a developmental stage around birth in mouse).
In the future, it will be interesting to investigate whether surviving zebrafish pit1 mutants develop later pituitary hypoplasia, and, if not, whether this is due to the proposed transfating of the entire Pit1 lineage. Interestingly, human Pit-1 patients have pituitary glands of proportionally normal size (18), making it tempting to speculate that similar transfating mechanisms might be at play. In addition, it will be interesting to investigate the fate of somatotrope precursors in zebrafish pit1 mutants. In mammals, several lines point to transdifferentiation potentials between somatotropes and thyrotropes, lactotropes or gonadotropes. Thus, during the regulation of the reproductive system, GH-generating cells can become multihormonal and act as cogonadotropes (39, 40), with somatotrope-gonadotrope switching in extreme cases (41). Similarly, reversible somatotrope-lactotrope transdifferentiation has been reported during pituitary hyperplasia (42), and somatotrope-thyrotrope transdifferentiation has been described as an ultimate response of human patients suffering from hypothyroidism (43). In light of these data, somatotrope precursors of pit1 mutant zebrafish might acquire a gonadotrope fate, similar to thyrotropes, or a Pomc fate, similar to lactotropes. Nevertheless, it is interesting to note that around the time point of gh expression initiation during normal development, pit1 mutants still contain gsu
- and pomc-negative cells in the medial adenohypophyseal domain (Fig. 6L
), suggesting that transfating of somatotropes might occur later, or might not be complete.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For genomic mapping of the pit1 gene, PCR was carried out on the T51 radiation hybrid panel (44), using primers GGA TTG AAC ATA AAA CAA TTA CGC (sense) and CTC ACA TAC AAG CGT ACC G (antisense). The genomic location was calculated after submission of the obtained amplification pattern to web site (http://134.174.23.167/zonrhmapper/instantMapping.htm).
For cloning of genomic pit1 fragments from mutant larvae, mutants were identified via gh whole-mount in situ hybridization at 120 hpf, followed by preparation of genomic DNA in 40 µl of lysis buffer (0.5 µg/µl proteinase K in 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 0.3% Tween 20; 0.3% Nonidet 40). pit1 exons were amplified, using the following intron-encoded primers: for exon1: CAC AGC CCA TAT CAG ATT GCA G (sense) and CAC ACA AGC CAT AAT TAG CGA GAG (antisense), for exon 2-exon 3: TGC TCA GAT CCC ATG GTG AC (sense) and GGT GAA CTG TCC GCT TTA ATG G (antisense), for exon 5: GAT GAC CAA ATT GTG GCC AAT ATG (sense) and TCT TCA TGG AAC CAC AAA AGC TC (antisense), for exon 6-exon 7: TCA GCT AAC AGC AAT CTG TGC and ACA GTG CAT GTG CTC TTT GG (antisense). For exon 4, no sequence information of the 5'-region of intron 4/5 was available to design an antisense primer. Therefore, exon 4 was amplified via RT-PCR from total RNA, using the primers GCG ACT CCT TCA GCG GTT TAG (sense, exon 1) and GCT CGT GCA GAC CCA TCT TC (antisense, exon 6).
Cloning of the Zebrafish gsu
cDNA
A 180-bp fragment of the zebrafish gsu
cDNA was cloned by degenerate RT-PCR with total RNA from wild-type embryos of 4896 hpf of age, and the primers CA(AG)TG(CT)ATGGG(AGCT)TG(CT)TG(CT)TT (sense), and CA(AG)TG(AG)CA(AGCT)TC(AGCT)GT(AG)TG(AG)TT (antisense). PCR conditions were: 94 C (3 min), 94 C (30 sec), 67 C (30 sec), 72 C (40 sec) with a 1 C decrement for seven cycles, followed by 33 cycles at 94 C (30 sec), 60 C (30 sec), 72 C (40 sec), and 72 C (3 min). To obtain the 5'- and 3'-sequences of the zebrafish gsu
, RACE-PCR was carried out with the SMART RACE cDNA Amplification Kit (BD Biosciences). The RACE primers were: GCT ACA CAG CAA GTG GCT TCT GAT G (5') and CAC GCT CCG CCG GAA GTC GAG (3'). We amplified a fragment of 1480 bp in length (GenBank accession no. AY522553), containing 33 bp of 5'-untranslated region (UTR), 351 bp of the coding region, and 1096 bp of 3'-UTR, which was cloned into pCRII vector (Invitrogen, San Diego, CA).
Meiotic Mapping of the pitt21379 Mutation
Mutant carriers of the t21379 mutation, generated and maintained in the Tuebingen backgound, were outcrossed to the polymorphic wik line (45). Identified F1 carriers were crossed to each other, and F2 offspring were fixed at 120 hpf for in situ hybridization with gh probe to allow the identification of mutant larvae. For rough mapping, genomic DNA of pools of 20 mutants or 40 wild-type siblings was assayed via PCR with a selected panel of SSLP (simple sequence length polymorphism) markers [Tuebingen version 4; primer sequences available (http://zebrafish.mgh.harvard.edu)] spanning the entire zebrafish genome (45, 46). By this method, we found marker z20031 located 59.6 cM from the north end of linkage group 9 (LG9) to be linked to the mutation. For fine mapping, DNA of single mutants and additional published LG9 SSLP markers were used. In addition, new polymorphic markers were identified, taking advantage of expressed sequence tag (EST) sequences that, according to radiation hybrid mapping (44), are located in the same region (Fig. 1B
). EST-encoded primer pairs generating such newly identified polymorphisms are: fb50e04 (SSLP), ATC GCC ACC TAC TGG ACC, CCT CAT CAC AAC CCA CAT TGA A; fi38c08 (single nucleotide polymorphism), GCT GTG ATT CCT TTC GCG CTC, GAA CCG TGG TGC GCG TTT C; fi04c05 (single nucleotide polymorphism) GCA GTT CCC TCC TCT ACA GAG, CTA CGC CAC CAT GGG AAG C. Analyzing a total of 495 single-mutant embryos, the t21379 mutation was found to map approximately 5152 cM from the north end of LG9, 0.8 cM (six recombinations in 756 meioses) north of z6845 (52.3 cM), 0.26 cM (one recombination in 378 meioses) north of fi04c05, 1.8 cM (18 recombinations in 990 meioses) south of fb50e04, and 0.27 cM (one recombination in 368 meioses) south of fi38c08.
Genotyping of pit1 Mutants
Individual mutant embryos, larvae and juvenile fish, and their wild-type siblings were genotyped after photography via PCR of genomic DNA, followed by sequencing or restriction analysis. For t21379, primers used were TGC TCA GAT CCC ATG GTG AC and GGT GAA CTG TCC GCT TTA ATG G, amplifying exons 2 and 3, and flanking intron sequences. The PCR product was digested with BpmI for 2 h at 37 C. In mutant DNA, the BmpI site is destroyed by the mutation, and the amplified fragment remains uncleaved at 800 bp, whereas the wild-type band is cut, yielding a 600-bp and a 200-bp band. For t22072, parts of exon 5 and intron 5/6 were amplified with primers CAG CCA AAC CAC AAT CTG C and TCT TCA TGG AAC CAC AAA AGC, and the resulting 150-bp fragment was sequenced after gel elution. Heterozygous animals gave an A/G double peak.
Morpholino Injections
Antisense MOs were injected into embryos at the one- to four-cell stage, as described previously (47). The sequence of the pit1 antisense MO is ACTCTTCATCGGCCACCGTTGTGAC, corresponding to nucleotides 4 to 28 in the 5'-UTR of the pit1 cDNA. Injections were done at a concentration of 0.25 nmol/µl.
In Situ Hybridizations, Acridine Orange Stainings, and TUNEL Stainings
In situ hybridizations were done as described previously (48). pit1 antisense probe was synthesized from plasmid pCRII-pit1, containing a 1.1-kb pit1 cDNA insert, with SP6 RNA polymerase after linearization with EcoRV. gsu
probe was synthesized from plasmid pCR2.1-gsu7, containing a 1.5-kb gsu
cDNA insert, with T7 RNA polymerase after linearization with NotI. Probes for lim3, prl, pomc, tsh, and gh were synthesized, and red/blue double in situ hybridizations were carried out, as previously described (29). Double-stained embryos were kept in 80% glycerol. In glycerol-benzyl alcohol (5:1), only the blue stain is stable, whereas the red fades out within minutes. To confirm whether individual cells are positive for one probe only (red) or for both probes (red and blue), embryos were mounted in glycerol-benzyl alcohol (5:1), and photos were taken right after mounting and after the red had vanished (Figs. 3
and 6
).
For detection of apoptotic cells, acridine orange or TUNEL stainings were carried out. For acridine orange stainings, dechorionated live embryos and larvae were incubated for 30 min in 5 µg/ml acridine orange (Sigma Chemical Co., St. Louis, MO) in E3 medium, followed by fluorescent microscopy (Zeiss axiophot; Carl Zeiss, Thornwood, NY) and photography, using an ORCA ER digital camera C474295 (Hamamatzu, Bridgewater, NJ). Bright-field and fluorescent images were superimposed with Openlab software (Improvision, Lexington, MA). TUNEL stainings were performed using the In Situ Cell Death Detection Kit (Roche Clinical Laboratories, Indianapolis, IN), essentially as described by Cole and Ross (49).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
G.N. and W.H. contributed equally to this work and should both be considered first authors.
Abbreviations: aa, Amino acid(s); ANR, anterior neural ridge; AP, anteroposterior; cM, centiMorgan; dpf, days post fertilization; e10.5, embryonic d 10.5; EST, expressed sequence tag; GSU
, gonadotropin
-subunit; hpf, hours post fertilization; MO, morpholino oligonucleotide; POMC, proopiomelanocortin; PRL, prolactin; SSLP, simple sequence length polymorphism; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling; UTR, untranslated region.
Received for publication September 26, 2003. Accepted for publication February 17, 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Guner, A. T. Ozacar, J. E. Thomas, and R. O. Karlstrom Graded Hedgehog and Fibroblast Growth Factor Signaling Independently Regulate Pituitary Cell Fates and Help Establish the Pars Distalis and Pars Intermedia of the Zebrafish Adenohypophysis Endocrinology, September 1, 2008; 149(9): 4435 - 4451. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hans and M. Westerfield Changes in retinoic acid signaling alter otic patterning Development, July 1, 2007; 134(13): 2449 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. To, S. Hahner, G. Nica, K. B. Rohr, M. Hammerschmidt, C. Winkler, and B. Allolio Pituitary-Interrenal Interaction in Zebrafish Interrenal Organ Development Mol. Endocrinol., February 1, 2007; 21(2): 472 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
I M McGonnell and R C Fowkes Fishing for gene function - endocrine modelling in the zebrafish. J. Endocrinol., June 1, 2006; 189(3): 425 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-A. Liu, Q. Liu, K. Wawrowsky, Z. Yang, S. Lin, and S. Melmed Prolactin Receptor Signaling Mediates the Osmotic Response of Embryonic Zebrafish Lactotrophs Mol. Endocrinol., April 1, 2006; 20(4): 871 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Pogoda, S. von der Hardt, W. Herzog, C. Kramer, H. Schwarz, and M. Hammerschmidt The proneural gene ascl1a is required for endocrine differentiation and cell survival in the zebrafish adenohypophysis Development, March 15, 2006; 133(6): 1079 - 1089. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-K. So, H.-F. Kwok, and W. Ge Zebrafish Gonadotropins and Their Receptors: II. Cloning and Characterization of Zebrafish Follicle-Stimulating Hormone and Luteinizing Hormone Subunits--Their Spatial-Temporal Expression Patterns and Receptor Specificity Biol Reprod, June 1, 2005; 72(6): 1382 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Herzog, C. Sonntag, S. von der Hardt, H. H. Roehl, Z. M. Varga, and M. Hammerschmidt Fgf3 signaling from the ventral diencephalon is required for early specification and subsequent survival of the zebrafish adenohypophysis Development, August 1, 2004; 131(15): 3681 - 3692. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Herzog, C. Sonntag, B. Walderich, J. Odenthal, H.-M. Maischein, and M. Hammerschmidt Genetic Analysis of Adenohypophysis Formation in Zebrafish Mol. Endocrinol., May 1, 2004; 18(5): 1185 - 1195. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |