help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0377
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/5/1196    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nica, G.
Right arrow Articles by Hammerschmidt, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nica, G.
Right arrow Articles by Hammerschmidt, M.
Molecular Endocrinology 18 (5): 1196-1209
Copyright © 2004 by The Endocrine Society

Zebrafish pit1 Mutants Lack Three Pituitary Cell Types and Develop Severe Dwarfism

Gabriela Nica, Wiebke Herzog, Carmen Sonntag and Matthias Hammerschmidt

Max-Planck Institute for Immunobiology, 79108 Freiburg, Germany

Address all correspondence and requests for reprints to: Matthias Hammerschmidt, Max-Planck Institute for Immunobiology, Stuebeweg 51, 79108 Freiburg, Germany. E-mail: hammerschmid{at}immunbio.mpg.de.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsu{alpha}, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsu{alpha}-positive cells is normal despite the loss of gsu{alpha} and tshß coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhß, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ANTERIOR PITUITARY gland, also called the adenohypophysis, consists of at least six different cell types, characterized by the hormones they generate and secrete. Corticotropes and melanotropes produce proopiomelanocortin (POMC), which is proteolytically cleaved to give rise to ACTH in corticotropes and MSH in melanotropes; lactotropes generate prolactin (PRL), somatotropes generate GH, thyrotropes generate TSHß, and gonadotropes generate gonadotropins, such as FSHß and LHß. Thyrotropes and gonadotropes in addition produce a gonadotropin {alpha}-subunit (GSU{alpha}) chain that forms heterodimers with TSHß, LHß, or FSHß.

The development of the different adenohypophyseal cell types from a common primordium is governed by various transcription factors that are expressed throughout the adenohypophyseal anlage in partly overlapping patterns (reviewed in Refs.1, 2, 3, 4, 5, 6, 7). These transcription factors act as cell-autonomous determinants, allowing differential and position-dependent specification of pituitary cell fates by embryonic d 10.5 (e10.5)–e12.5 of mouse development. They belong to different classes of proteins, including Lim homeodomain (Lhx3, Lhx4, Isl1), paired-like homeodomain (Prop1, Rpx), bicoid-like homeodomain (Pitx), sine oculis-related homeodomain (Six1, Six3), and zinc finger proteins (Gata2). Terminal differentiation of the different pituitary cell types in response to such patterns, however, involves additional transcription factors, such as Pit1 (see below), the orphan receptor Sf1 (8) (gonadotropes), the T-box protein T-pit/Tbx19 (9, 10, 11), and possibly Stat3 (12) (Pomc-expressing cells).

Pit-1 is a Pou-homeodomain transcription factor that was initially identified and cloned based on its ability to bind and transactivate the expression of the Gh and Prl genes (13, 14). In addition, Pit-1 is able to regulate the expression of the Tshß gene via low-affinity Pit-1 binding sites (15). Spontaneous mutations in the mouse or human Pit-1 gene lead to hypopituitarism and dwarfism (16, 17, 18, 19). Lactotropes, somatotropes, and thyrotropes, constituting the Pit-1 lineage, fail to differentiate. In the case of thyrotropes, only the later differentiating (e15.5) caudomedial cells are affected in Pit-1 mutant mice, whereas the earlier differentiating (e12.5) rostral tip thyrotropes develop independently of Pit-1 (15). In caudomedial thyrotropes, Pit-1 induces Tshß expression in synergy with Gata2, which is present in the ventral part of the adenohypophyseal anlage (20). Simultaneously, Pit-1 inhibits the expression of gonadotrope-specific genes such as Lhß by blocking binding of Gata2 to promoters which, in contrast to Tshß (21), do not contain adjacent Pit-1 bindings sites (2, 7, 20). Accordingly, Pit-1 mutant Snell dwarf mice show ectopic expression of the Gata2-dependent gonadotrope markers Lhß and Sf1 in cells that presumably would have normally given rise to caudomedial thyrotropes (20). In contrast to Tshß, the somatotroph-specific Gh gene and the lactotroph-specific Prl gene lack Gata2 binding sites. Here, the differential effect of Pit-1 (Gh on and Prl off in somatotropes, and vice versa in lactotropes) is mediated by a 2-bp difference in the spacing between the binding sites for the Pit-1 Pou domain and the Pit-1 homeodomain (7, 22). This altered spacing, in concert with additional cell type-specific DNA binding factors, leads to the recruitment of corepressor complexes to the Gh gene in lactotropes, whereas the Prl gene is activated, and to an activation of Gh and a repression of Prl transcription in somatotropes (7, 22).

Pit-1 also acts as a positive transcriptional regulator of its own gene (23, 24), mediated by Pit-1 binding elements within a distal enhancer (25, 26). In Pit-1 mutant mice, Pit-1 expression is normally initiated at e13.5; however, expression declines between e15.5 and e16.5 (27), indicating that Pit-1 is required for the maintenance of Pit-1 expression.

Here, we report the isolation and characterization of pit1 and pit1 mutants from zebrafish. Comparing our results with data obtained for the mouse, we find both conserved and class-specific aspects of Pit1 function. As in the mouse, zebrafish pit1 is expressed in and required for the development of lactotropes, somatotropes, and thyrotropes, causing severe dwarfism in mutants. As in the mouse, Pit1 is positive autoregulative and most likely required for the blockage of gonadotroph differentiation. However, zebrafish pit1 expression starts much earlier than that of its mouse homolog and might have earlier and additional roles, as indicated by the high death rate of mutant larvae. On the molecular level, zebrafish Pit1 seems responsible for the much earlier onset of prl expression in fish compared with mouse. In addition, zebrafish Pit1 appears to act as a negative regulator of the Pomc lineage, whereas in mouse, this lineage is supposed to specify before Pit-1 comes into play.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Zebrafish pit1 Gene
Based on partial sequence information from the zebrafish genome project, we carried out RACE (rapid amplification of cDNA ends) and RT-PCR to clone the full length cDNA of a protein of 350 amino acids (aa) length which, according to overall aa similarity and phylogenetic analysis, is a zebrafish homolog of the Pou domain homeoprotein Pit1 (Fig. 1AGo; GenBank accession no. AY421970). Over the entire length of the protein, zebrafish Pit1 is 90.3% identical to carp Pit1, and 70.4% identical to mouse and human Pit1. The N-terminal parts of the proteins are most divergent. Here, zebrafish Pit1 has three insertions of 20, 34, and 7 aa, respectively, which are also present in carp, but absent in mouse and human. Within the C-terminal region containing the Pou-specific and the Pou homeodomain (aa 193–347), aa identity between zebrafish and mouse Pit1 is 89%, and 97.5% between zebrafish and carp Pit1 (Fig. 1AGo). Comparison of the zebrafish pit1 cDNA with genomic zebrafish sequences [Sanger database (http://www.ensembl.org/Multi/textview), contig 10298.1] revealed that the coding region of the zebrafish pit1 gene is subdivided into seven exons (see Fig. 5CGo for overview; GenBank accession nos. AY421971–AY421975, including flanking intron sequences). This is one exon more than in the mouse Pit-1 gene (16). The additional exon 3 encodes the 34-aa insertion of the zebrafish Pit1 protein mentioned above, whereas the positions of four of the remaining five introns are conserved between the mouse and the zebrafish gene. In sum, these data show that our cloned gene is the ortholog of mouse Pit-1. Radiation hybrid mapping located the zebrafish pit1 gene around 52 centimorgans (cM) from the north end of linkage group 9 (Fig. 1BGo).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Zebrafish pit1 and Its Genomic Location

A, Phylogenetic tree of zebrafish, mouse, human, chicken, and carp Pit1 proteins, calculated with DNA Star MegAlign software (Jotun Hein Method). B, Genomic location of the pit1 gene, as determined via radiation hybrid mapping, and of the t21379 mutation, as determined via meiotic segregation linkage analysis (see Materials and Methods). pit1 maps close to EST fb80e05 (LOD score, 5.809), which according to <http://wwwmap.tuebingen.mpg.de> is located within 1.1 cM north of z6845. t21379 was mapped to the same region, 0.8 cM north of z6845.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. t21379 and t22072 Mutants Bear Mutations in Splice Sites of the pit1 Genes, Leading to Truncated Proteins

On the left of panels A and B, RT-PCR analyses of mutant and wild-type sibling embryos are shown. The cartoons on the right of A and B show the genomic structure of the affected regions of the pit1 gene, with exons in dark blue, introns in black, and exon nucleotides deleted in the smaller transcripts in light blue. The point mutations are indicated, and the resulting false transcripts are outlined below. A, t22072: G->A exchange in the splice donor of intron 5/6, leading to a smaller transcript with the 165 nucleotides encoded by exon 5 deleted. B, t21379: A->G exchange in the splice acceptor of intron 2/3 leads to two false splice products, a larger transcript with a 53-bp insertion encoded by intron 2/3, and a slightly smaller transcript with the first five nucleotides of exon 3 deleted. The internal AG of the intron 2/3 used to give rise to the larger transcript, and the AG in exon 3 used to give rise to the smaller transcript are underlined. C, Schematic drawing of truncated Pit1 proteins resulting from the falsely spliced pit1 transcripts. The exons of the pit1 gene are represented as segmented blue lines, with coding nucleotides numbered in blue, and corresponding aa residues numbered in black. The Pou-specific domain is indicated in black, the Pou-homeodomain in gray; regions with unrelated sequences caused by frame shifts are indicated as lines.

 
pit1 Is Continuously Expressed throughout the Course of Adenohypophysis Development
In the developing mouse pituitary, Pit-1 starts to be expressed at e13.5, approximately 5 d after the initiation of Lhx3 expression (see Refs.4 and 5 for review). In zebrafish, the pituitary-specific expression of the Lhx3 homolog lim3 is initiated at 19 h post fertilization (hpf) (28). We carried out whole-mount in situ hybridization to determine the temporal and spatial expression pattern of pit1 during zebrafish development. First pit1-positive cells within the adenohypophyseal placode at the anterior neural ridge (ANR) were detected at 18 hpf (18-somite stage; Fig. 2AGo), preceding the reported initiation of lim3 expression by 1 h. Similar to early lim3 expression, the expression of pit1 starts in a left-right asymmetric fashion anterior to the eyes, with more pit1-expressing cells on the left side than on the right side of the placode, whereas the medial part of the placode is devoid of pit1 expression. The left-right asymmetry is lost within the next 30 min (Fig. 2BGo). However, pit1-positive cells remain largely restricted to the surface of the anlage, occupying lateral and dorsal- and ventral-most positions (Fig. 2CGo; compare with Fig. 3BGo). Between 24 hpf (Fig. 2DGo) and 25 hpf (Fig. 2Go, E and G), two additional longitudinal stripes of pit1-positive cells become apparent, which extend from lateral regions of the ANR in a posterior direction. Between 25 hpf and 32 hpf, these lateral, posterior cells converge to the midline where they meet with cells from the opposing side and from the ANR to form a single, roundish expression domain (Fig. 2FGo; 32 hpf). At the same time, all pit1-positive cells start to move posteriorly and into the head (compare position of pit1-positive cells relative to eyes in Fig. 2Go, E and F, and Fig. 2Go, G and H). During the entire relocation process, which occurs in synchrony with the formation of the stomodeum (29), the adenohypophyseal cells remain in a subepithelial position directly dorsal of the oral ectoderm (Fig. 2HGo; 72 hpf), eventually ending up at an anteroposterior (AP) level in line with the posterior border of the eyes (Fig. 2IGo; 120 hpf).



View larger version (152K):
[in this window]
[in a new window]
 
Fig. 2. Spatial Expression Pattern of pit1, determined via Whole-Mount in Situ Hybridization

Ages of embryos are shown in lower right corner. A, B, D, E, F, and I, Ventral views on head region, anterior to the left; C, frontal view; dorsal up; G and H, lateral views, anterior to the left, dorsal up. Arrows in panels E and G point to pit1-positive cells in longitudinal stripes extending from lateral regions of the ANR in a posterior direction. In panel H, the oral cavity is outlined by dots. e, Eye.

 


View larger version (127K):
[in this window]
[in a new window]
 
Fig. 3. pit1 Is Expressed in a Subset of the lim3-Positive Pituitary Cells, and prl in a Subset of the pit1-Positive Cells, Whereas gsu{alpha} and pit1 Show Only Partly Overlapping, and pomc and pit1 Show Completely Complementary Expression Patterns

Embryos stained via whole-mount blue/red double in situ hybridization with probes indicated in the corresponding colors in the lower right corners. Ages of embryos are shown in lower right corners. In panels D, G, and L, the same embryos as in panels C, F, and K are shown, after the red color was washed out. A, J, and N, Lateral views, anterior to the left, dorsal up; B, frontal view, dorsal up; C–I, K, L, M, O, and P, ventral view, anterior to the left. All red cells of the embryo shown in panel C are also blue (D), indicating that all pit1-positive cells also express lim3. Arrowheads in panel F point to prl-negative, pit1-positive cells in lateral longitudinal stripes, which will most likely give rise to somatotropes and thyrotropes. Arrowheads in panel I point to cells that are stained in both red and blue, indicative of gsu{alpha} and pit1 coexpression, suggesting that they are thyrotropes. Arrows in panels I and J point to gsu{alpha}-positive (blue), but pit1-negative cells, which most likely are gonadotropes. Note that in panel J, blue cells are restricted to the ventral domain of the adenohypophyseal anlage, revealing transient dorsoventral polarity. Arrows in panels K–N point to red cells (K, M, and N) which lack blue staining (L), indicating that pomc-positive cells do not express pit1. Arrowhead in panel N points to ventral anterior domain containing pit1-positive cells only, revealing transient dorsoventral polarity as in panel J. Asterisks in panels N, O, and P mark endorphin-synthesizing pomc-positive neurons of the hypothalamus, which are not part of the adenohypophysis. Dots in panel N outline the oral cavity.

 
pit1 Expression in Comparison to lim3, gsu{alpha}, prl, and pomc
In mammals, Pit-1 expression is restricted to the lactotroph, somatotroph, and thyrotroph lineages. To determine the nature of the zebrafish pit1-positive adenohypophyseal cells, double in situ hybridization with the pan-adenohypophyseal marker lim3, and the lineage-specific markers prl, pomc, and gsu{alpha} were carried out. At 24 hpf, all pit1-positive cells also express lim3 (Fig. 3Go, C and D); however, only a subset of the lim3-expressing cells is positive for pit1 (Fig. 3Go, A and B). Such pit1-positive cells are located in marginal regions of the adenohypophysis primordium, whereas inner cells lack pit1 expression. At 48 hpf, pit1-positive cells have given up this regionalized pattern and are more uniformly distributed within the lim3 expression domain (Fig. 3EGo).

Double staining with prl at 25 hpf reveals that the pit1-positive cells at the ANR are lactotropes, whereas the pit1-expressing cells organized in the two longitudinal stripes located lateral and posterior of the ANR are prl-negative, most likely representing presumptive somatotropes and thyrotropes (Fig. 3Go, F and G). At 40 hpf, these lateral stripes have converged to the midline, forming a single domain of pit1-positive, prl-negative cells located directly posterior to the lactotropes (Fig. 3HGo). Double stainings of pit1 with gh or tshß at 72 hpf show that this domain contains somatotropes and thyrotropes that coexpress pit1 and gh, or pit1 and tshß, respectively (data not shown, but compare with Ref.29).

In contrast to the other adenohypophyseal cell lineages, no hormone marker gene for zebrafish gonadotropes (lhß, fshß) has been described as yet. However, we have cloned the zebrafish gsu{alpha} homolog, encoding the {alpha}-chain shared by the gonadotroph hormones and Tsh of the thyrotropes (see Materials and Methods). In contrast to tshß, which in zebrafish is only found in pit1-positive cells (data not shown), two different types of gsu{alpha}-positive cells can be distinguished (Fig. 3Go, I and J; 32 hpf): cells coexpressing gsu{alpha} and pit1, which most likely represent thyrotropes, and cells lacking pit1 transcripts, which most likely represent gonadotropes. This would be as in mammals, where thyrotropes are part of the Pit1 lineage, whereas gonadotropes derive from Pit1-negative precursor cells. Interestingly, the putative gonadotropes are preferentially located in the ventral half of the adenohypophyseal anlage, revealing dorsoventral polarity of the anlage (Fig. 3JGo).

Like gonadotropes, cells of the zebrafish Pomc lineage (corticotropes and melanotropes) lack pit1 expression, as revealed via double stainings for pit1 and pomc transcripts at 25 hpf (Fig. 3Go, K and L) and 32 hpf (Fig. 3MGo). At these stages, pit1 and pomc are expressed in a complementary fashion, with the two cell populations intermingled in a salt-and-pepper pattern. During further development, the lineages sort out along the AP and the dorsoventral axis of the anlage. At 48 hpf (Fig. 3NGo), three domains can be distinguished, an anterior-dorsal domain with pit1- and pomc-positive cells, an anterior-ventral domain with pit1-positive cells only, and a posterior domain with more pomc- than pit1-positive cells (see also Fig. 3OGo for 72 hpf). The dorsoventral asymmetry in the anterior part of the anlage appears to be rather transient. At 120 hpf (Fig. 3PGo), the three domains are aligned along the AP axis, with the domain of pit1-positive cells only being shifted into an intermediate AP position, separating the anterior domain of the lactotropes and corticotropes, and the posterior domain of the corticotropes and melanotropes (29, 30).

Antisense-Mediated Inactivation of pit1 Leads to the Loss of Lactotropes, Somatotropes, and Thyrotropes
In mouse, Pit-1 loss-of-function mutations lead to hypocellular and hypoplastic pituitary glands, lacking Prl, Gh, and Tshß expression (16). This indicates that Pit-1 is required for the proliferation and/or survival of lactotropes, somatotropes, and thyrotropes, and for the transcriptional activation of their hormone genes. To inactivate pit1 during zebrafish development, embryos were injected with antisense morpholino oligonucleotides (MOs). Such MOs have been shown to efficiently block the translation of targeted mRNAs throughout the first 3 d of development (31). At 72 hpf, zebrafish embryos injected with pit1 MOs display a complete absence of prl (Fig. 4Go, A and B), gh (Fig. 4Go, D and E) and tshß expression (Fig. 4Go, G and H), indicating that Pit1 is required for lactotroph, somatotroph, and thyrotroph specification. In contrast, pomc is expressed at normal levels and in an increased number of cells (Fig. 4Go, J and K), indicating that Pit1 is dispensable for or might even have a negative effect on the specification of corticotropes and melanotropes.



View larger version (120K):
[in this window]
[in a new window]
 
Fig. 4. pit1 Morphants and t21379 and t22072 Mutants Show a Loss of Lactotropes, Somatotropes, and Thyrotropes, Whereas the Pomc Lineage Is Expanded

All panels show larvae at 72 hpf, ventral views on head region, anterior to the left. First column shows uninjected or wild-type sibling controls; second column shows embryos injected with pit1 antisense MOs (indicated in upper right corner), and third column shows t22072 mutants (indicated with mut in upper right corner). t21379 mutants show the same phenotype. Used probes are indicated in lower right corner. In panel J, arrows point to pomc-positive cells of the adenohypophysis, whereas asterisks mark endorphin-synthesizing pomc-positive neurons of the hypothalamus. The endorphin-specific staining can serve as an internal reference demonstrating that the expanded pomc expression in the adenohypophysis in embryos in panels K and L is not due to overstaining.

 
Two Zebrafish pit1 Null Mutants
The same combination of phenotypic traits as in pit1 morphant embryos was observed in two noncomplementing zebrafish mutants, recently isolated in a large-scale N-ethyl-N-nitrosourea mutagenesis screen for abnormal gh expression [Fig. 4Go, C, F, I, and L, and accompanying paper by Herzog et al. (32)].

Using a total of 495 mutant embryos (990 meioses) from Tue-wik intercrosses, one of the mutations, t21379, was mapped via segregation linkage analysis into a 0.5-cM interval around 52 cM from the north end of linkage group 9 (Fig. 1BGo, and Materials and Methods). Via radiation hybrid mapping, the pit1 gene was located to the same region (Fig. 1BGo). This, together with the identical phenotypes of mutants and morphants, strongly suggested that the pituitary phenotypes of t22072 and t21379 mutants might be caused by pit1 mutations. To test this notion, we cloned the pit1 cDNA and the different exons of the pit1 gene, including flanking intron sequences, from t22072 and t21379 mutant embryos.

For both mutants, severe splice site mutations in the pit1 gene were found. In t22072, the splice donor of intron 5/6 displays a GT->AT mutation. As an alternative splice donor, the GT at the 5'-end of exon 5 is used, leading to a deletion of all 165 exon 5-encoded nucleotides in the mRNA (Fig. 5AGo). The resulting protein lacks 55 internal aa residues, including 40 aa residues of the highly conserved Pou-specific domain (Fig. 5CGo). The t21379 allele displays an AG->GG mutation in the splice acceptor site of intron 2/3. Here, two different alternative transcripts are formed, one with a 53-bp insertion, caused by the usage of an intron 2/3-internal AG as splice acceptor, and one with a 5-bp deletion, caused by the usage of an AG in the 5'-region of exon 3 (Fig. 5BGo). Both mutations lead to frame shifts and to proteins with unrelated sequences after the first 94 aa encoded by exons 1 and 2, and premature termination after 97 and 117 aa residues, respectively. Most importantly, both proteins lack the entire Pou-specific domain and the entire Pou homeodomain (Fig. 5CGo). We conclude that both mutations lead to nonfunctioning Pit1 proteins. They can therefore be regarded as null mutations.

Pit1 Is Required for the Initiation of prl and tshß, and the Maintenance of pit1 Expression
Mouse Pit-1 has been shown to act as a positive autoregulator of its own expression, mediated via binding to a late distal enhancer element (25). Accordingly, Pit-1 mutant mice display a progressive loss of Pit-1 expression (27). The same is true for zebrafish pit1. Although at 19 hpf, pit1 mutants and wild-type siblings display undistinguishable pit1 expression (data not shown), the number of pit1-positive cells and the pit1 staining intensity are significantly reduced in mutant embryos at 24 hpf (Fig. 6Go, A–C). After 26 hpf, no pit1 expression is detectable in mutant embryos at all (Fig. 6IGo and data not shown). This progressive loss of pit1 transcripts indicates that Pit1 is required for the maintenance of its own expression. This is in contrast to the role of Pit1 as a transcriptional activator of the prl, gh, and tsh genes. Here, no transcripts are detectable in pit1 mutant embryos even at stages when expression is initiated in wild-type siblings (Fig. 6Go, A and C for prl at 24 hpf; Fig. 6Go, M and O, for tshß at 58 hpf), indicating that Pit1 is required for the initiation of hormone gene expression.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 6. Pit1 Is Required for the Initiation of prl and tshß Expression, the Maintenance of pit1 Expression, and the Repression of pomc Expression, But Not for gsu{alpha} Expression

All panels show embryos after whole-mount in situ hybridizations with the probes indicated in the corresponding colors in right lower corners. The pit1 genotype and the ages of the embryos are indicated in upper right corners. A–C, Frontal views, dorsal to the right. D–K and M–O, Ventral views on head region, anterior to the left. L, Lateral view, anterior to the left. In panels B, F, H, and N the same embryos as in panels A, E, G, and M are shown, after the red color had faded out. The 24 hpf mutant embryo in panel C lacks red prl staining to begin with; arrows in panel C point to remaining cells with low pit1 expression in blue. The 24 hpf wild-type embryo in panel D does not display pomc expression as yet, whereas the mutant in panel E shows premature pomc expression (indicated with red arrows) in cells coexpressing pit1 (indicated with blue arrows in panel F). The fate of the pit1-positive cells in panel E that lack pomc expression is unclear. They might initiate pomc expression slightly later, or transfate to other lineages. The 26 hpf mutant embryo in panel I has lost pit1 expression in all but one cell (indicated by blue arrow). This cell also expresses pomc. Compared with the wild-type sibling (panel G), the total number of pomc-positive cells in the mutant (panel I) is approximately doubled. Red arrows in panel G point to pomc-positive cells, all of which lack pit1 expression (indicated by black arrows in H). A similar increase in the number of pomc-positive cells is observed in mutants at 32 hpf (J and K). Despite the similar sizes of the lim3 expression domains in red, counting of pomc-positive adenohypophyseal cells after removal of red color revealed 31 cells for mutant (panel K), and 15 cells for wild type (panel J). The 58 hpf mutant embryo in panel O lacks red tshß staining to begin with, but contains 22 gsu{alpha}-positive cells, all of which are tshß negative. The wild-type sibling in panel N contains a similar number of gsu{alpha}-positive cells (20 ), approximately one half of which (11 ) coexpresses tshß (panel M). The 48 hpf mutant embryo in panel L contains few pomc- and gsu{alpha}-negative cells located in dorsal positions of the intermediate anteroposterior domain. These might be somatotrope precursors that have not transfated as yet (see Discussion).

 
This loss of prl-, tshß-, and pit1-positive cells in pit1 mutant embryos is not due to a general reduction in the number of adenohypophyseal cells, as pit1 mutants of the same and older ages show an adenohypophyseal lim3 expression domain of normal size, and with normal staining intensity [Fig. 6Go, J, and K; see also Fig. 1Go of accompanying paper by Herzog et al. (32)]. Similarly, the number of gsu{alpha}-positive cells is unaltered in mutant embryos (Fig. 6Go, N and O).

pit1 Mutant Pituitaries Display Normal Numbers of gsu{alpha}-, and Increased Numbers of pomc-Positive Cells, Some of Which Display Coexpression with pit1
In Pit1 mutant mice, one subset of the Pit1 lineage, the caudomedial thyrotropes, are supposed to be transfated to gonadotropes (20). Gonadotroph precursors also appear to exist in zebrafish embryos, characterized by the expression of gsu{alpha} in the absence of pit1 (see above; Fig. 3Go, I and J) or tshß transcripts (Fig. 6Go, M and N). In pit1 mutant adenohypophyses, the number of gsu{alpha}-positive cells is unaltered, although none of them co-expresses tshß (Fig. 6OGo). In other words, the number of gsu{alpha}-positive, tshß-negative cells in pit1 mutants is approximately double as high as in wild-type siblings (Fig. 6Go, M and O). This suggests that in the absence of Pit1, thyrotrope precursors become gonadotropes, the number of which increases accordingly. To support this notion, it will be necessary to analyze the expression of the gonadotropin ß genes (lhß, fshß). We have failed to clone the zebrafish homologs thus far; however, we would expect them to be expressed in all gsu{alpha}-positive cells of pit1 mutant embryos, whereas in wild types, expression should be restricted to the gsu{alpha}-positive, tshß-negative cells.

In addition to this likely expansion of gonadotropes, pit1 mutants display an unambiguous increase in the number of pomc-positive cells. At 24 hpf, shortly before the initiation of pomc expression in wild-type embryos (Fig. 6DGo; compare with Fig. 3KGo), pit1 mutants display pomc expression in several cells at the ANR (Fig. 6EGo). Interestingly, these cells coexpress pit1 (Fig. 6Go, E and F), whereas in wild-type embryos, pomc and pit1 expression is mutually exclusive from earliest stages onward (Fig. 3Go, K and L, for 25 hpf; Fig. 6Go, G and H, for 26 hpf). This transient coexpression of pit1 and pomc in the same adenohypophyseal cells of pit1 mutants indicates that in the absence of functioning Pit1 protein, pomc expression is ectopically activated in cells of the Pit1 lineage, as expected in the case of transfating. At 26 hpf (Fig. 6Go, G–I), when pit1 transcripts have become undetectable in pit1 mutants, and at 32 hpf (Fig. 6Go, J and K), the number of pomc-positive cells in pit1 mutants is approximately double as high as in wild-type siblings. At later stages (from 48 hpf onward), pomc cells normally segregate out, avoiding mixing with other cell types with the exception of the lactotropes (29), which are absent in pit1 mutants. In this light, the large expansion of the pomc population could be the reason why the remaining other pituitary cells of pit1 mutants are organized in a more compact fashion than in wild-type siblings, as revealed by the gsu{alpha} expression pattern at 48 hpf (Fig. 6LGo) and at 58 hpf (Fig. 6Go, N and O).

pit1 Mutant Pituitaries Are of Normal Size and without Any Sign of Increased Cell Death Rates
In mouse Pit-1 mutants, lactotrope and somatotrope precursor cells are thought not to transfate, but to remain unspecified until they die by apopotosis, eventually leading to smaller pituitary glands. In contrast, the adenohypophysis of zebrafish pit1 mutants seems of normal size at all investigated stages (24 hpf to 120 hpf), as determined via whole-mount in situ hybridization with lim3 (Fig. 6Go, J and K; 32 hpf) or pomc (Fig. 4Go, J and L; 72 hpf), and via microscope inspection of live embryos and larvae, using Nomarski optics (Fig. 7Go, C–F; 32 hpf and 54 hpf). Also, pit1 mutant pituitary glands display normal cell death rates, as determined via acridine orange (Fig. 7Go, C–F) or TUNEL (terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling) stainings (Fig. 7Go, A, B, G, and H) at various stages between 24 and 120 hpf. As a positive control, parallel stainings of another pituitary mutant were performed, which showed significantly increased numbers of acridine orange- and TUNEL-positive adenohypophyseal cells at 28 hpf (data not shown). In sum, this indicates that cells of the Pit1 lineage remain alive during the investigated stages of pit1 mutant zebrafish pituitary glands.



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 7. The Pituitary Glands of pit1 Mutant Larvae Are of Normal Size, Lacking any Sign of Increased Cell Apoptosis Rates

The pit1 genotypes and the ages of the shown embryos and larvae are indicated in upper right corners. A, B, G, and H, TUNEL stainings, lateral views on heads. The region of the adenohypophysis is indicated by arrows. In panels A and B, the framed insets show apoptotic cells in the olfactory epithelium in another focal plane of the same embryos (compare with Ref.49 ). In panels G and H, insets show apoptotic cells in cranial neuromasts of the same larvae. C–F, Bright-field images of pituitary glands of live embryos, superimposed with fluorescent images showing acridine orange-positive apoptotic cells. A and B, 32 hpf, frontal view, dorsal up; C and D, 54 hpf, ventral view, anterior up. Borders of the pituitary gland are indicated with white arrows. Light green cells in panels A and B show several fold weaker staining intensity than apoptotic cells in retina and olfactory epithelium and than apoptotic adenohypophyseal cells of a reference mutant line (data not shown).

 
Most pit1 Mutants Die during Early Juvenile Stages, Whereas Survivors Develop Severe Dwarfism
In mouse and human, Pit-1 null mutations are viable. However, mutant mice reach adulthood as dwarfs with about one-third of the normal size (32). Similarly, human patients suffer from severe cretinism (17, 18, 19). We also tried to raise our zebrafish pit1 mutants. At 5 d post fertilization (dpf), they display a normal inflation of their swim bladders and start to swim and feed normally. However, between 7 and 8 dpf, most of the mutants die without any apparent sign of altered morphology, except a slightly bent body axis (of normal size) and a collapsing swim bladder (Fig. 8Go, A and B). Less than 5% of the zebrafish pit1 mutants (4 of 85) survived beyond 8 dpf. They could soon be recognized by their reduced growth. Whereas until 25 dpf, wild-type siblings display a 3-fold increase of their body length, pit1 mutants stagnate at the length of 7 dpf (Fig. 8Go, C and D), although they continued to show normal swimming and feeding behavior. All body structures, including the pectoral fins, are proportionally reduced in size. This strongly suggests that like in mouse, Gh from the pituitary gland is required for normal linear growth of juvenile zebrafish.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 8. Surviving pit1 Mutants Display Severe Dwarfism

Ages of larvae and juvenile fish are indicated in lower right corners; the pit1 genotype is shown in the upper right corners (t21379 allele). Panels A and B show lateral views; C shows dorso-lateral view; and D shows dorsal view. All panels show animals at same magnification.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In mouse, the first spontaneous Pit-1 mutant, named Snell dwarf mouse, was already described in 1929 (33). With its molecular cloning in 1990 (16, 34), Pit-1 was the first gene proven to be essential for mammalian pituitary development. Only two years later, several cases of human combined pituitary hormone deficiencies (CPHD) were shown to be caused by mutations in the human Pit-1 homolog (17, 18, 19). Now, we describe the cloning of pit1 from zebrafish, and the isolation of zebrafish pit1 mutants, representing the first Pit1 loss-of-function scenario in a nonmammalian vertebrate. The mutants were found in a large-scale screen for N-ethyl-N-nitrosourea-induced recessive mutations causing altered Gh gene expression [see accompanying paper by Herzog et al. (32)] Juvenile and adult mutants display severe dwarfism, which appears even more dramatic than in mouse mutants and human patients. To our knowledge, no spontaneous zebrafish dwarf mutants have been isolated thus far, although zebrafish has been a popular aquarium fish for many decades and has been used in research for more than 25 yr (35). One reason could be the extremely high lethality of zebrafish pit1 mutants during larval stages.

The analysis of the role of pit1 during zebrafish development turned out to be very helpful in further illuminating the mechanisms of pituitary patterning in fish. In addition, it allowed us to further compare pituitary development in fish and mouse, revealing both conserved and class-specific aspects of Pit1 function.

Zebrafish Adenohypophysis Patterning and Morphogenesis, as Revealed by pit1 and gsu{alpha} Expression
Thus far, we only had prl and pomc as early lineage-restricted markers to follow the patterning within the adenohypophyseal anlage before and during its movement into the head (29). Expression of the gh and tshß genes is only initiated after this posterior movement, when cells have almost reached their final positions within the pituitary. Based on this limited set of data, we had proposed a model of pituitary patterning according to which somatotropes and thyrotropes might derive from medial regions of the adenohypophyseal placode at the ANR, surrounded by lactotropes and corticotropes more laterally. However, with the availability of the pit1 probe as an early marker for somatotropes and thyrotropes, we have to withdraw this view. Our pit1/prl double stainings show that somatotropes and thyrotropes are formed in two longitudinal stripes that extend from lateral regions of the ANR in a posterior direction to an AP level in line with the anterior border of the forming eyes. During further development, these posterior-lateral cells appear to directly converge to the midline (compare Fig. 3FGo with Fig. 3HGo), rather than following the route of the anterior-medial cells (29).

Similarly, the expression patterns of pit1 and gsu{alpha} revealed a thus far missed transient dorsoventral asymmetry in the adenohypophyseal anlage, with gonadotropes, characterized by gsu{alpha} expression in the absence of pit1 and tshß transcripts, positioned ventral of the Pit1 lineage. A similar dorsoventral polarity was also observed within the Pit1 lineage itself. Here, an anterior ventral domain consisting of pit1-positive cells can be distinguished from an anterior dorsal domain, in which cells of the Pit1 lineage are intermingled with cells of the Pomc lineage. This is consistent with the situation described for the mouse, where the dorsoventral polarity of Rathke’s pouch is very prominent, with gonadotropes in ventral-most locations, and cells of the Pomc lineage positioned dorsal of the Pit-1 lineage (36), although according to recent reviews, only the melanotropes are dorsal, whereas corticotropes are ventral (6, 7).

Zebrafish and Mouse Pit1 Are Required for the Specification of the Same Cell Types
As in mouse, zebrafish pit1 is expressed only in a subset of adenohypophyseal cells, defining the Pit1 lineage that consists of lactotropes, somatotropes, and thyrotropes. In mouse, two distinct populations of thyrotropes can be distinguished, the caudomedial population that arises at e15.5 and serves as the precursors of the mature thyrotropes, and the rostral tip thyrotropes that appear much earlier, at e12, but disappear again around birth (15). The rostral tip thyrotropes develop independently of Pit-1. They lack Pit-1 expression during normal development, and are present in Pit-1 mutant mice, whereas caudomedial thyrotropes, somatotropes, and lactotropes are not specified (15). In zebrafish, we found tsh expression to come up in one domain and at one time point only (29), always coexpressed with pit1. Accordingly, zebrafish pit1 mutants lack all thyrotropes, lactotropes, and somatotropes. This suggests that a cell population equivalent to the mammalian rostral tip thyrotropes does not exist in zebrafish, whereas the concept of the Pit1-dependent lineage of caudomedial thyrotopes, somatotropes, and lactotropes has been conserved among mammals and fish.

Possible Earlier Roles of Zebrafish Pit1
Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. Whereas mouse Pit-1 expression is initiated much later than that of Lhx3 (Pit-1 at e13.5; Lhx3 at e8.5; Ref.4), zebrafish pit1 expression starts at the same time or even slightly earlier than lim3. This is approximately 6 h before the onset of pomc expression (pit1, lim3 at 18 hpf; pomc at 24 hpf), whereas in mouse, Pit-1 expression starts approximately 1 d after that of Pomc (Pomc at e12.5; Pit-1 at e13.5; Ref.4). This earlier onset of pit1 expression in the zebrafish together with lim3 might have several implications. Consistent with the reported synergism of mouse Pit-1 and Lhx3 on the transcriptional activation of the mouse Prl gene (37), it might lead to the earlier onset of zebrafish prl expression, as reported previously (29). Compared with mammals, Prl in fish is supposed to have earlier and additional developmental functions, e.g. as an osmoregulator (29, 38). This might be the reason for the observed high frequency of larval lethality of pit1 mutant zebrafish, whereas mouse Pit1 mutants normally survive to adulthood (33).

Pit1 Appears to Repress pomc and Gonadotropin Expression
Another consequence of the early expression of pit1 might be concerned with the observed increase of pomc-positive cells in pit1 mutant embryos. We cannot rule out that this is partly due to an overproliferation of the Pomc lineage, as a secondary consequence of the loss of the Pit1 cells. However, the expansion of the pomc-positive cells is seen from earliest stages onward (24 hpf). Most strikingly, at these early stages, mutants display a coexpression of pit1 and pomc in the same adenohypophyseal cells at the ANR. During normal development, such ANR cells only show coexpression of pit1 and prl, whereas pit1 and pomc are expressed in a mutually exclusive fashion. Therefore, we conclude that the increase in the number of pomc-expressing cells in pit1 mutant embryos is caused by a transfating of cells of the Pit1 lineage, most likely lactotropes, to the Pomc lineage. This would mean that during normal development, Pit1 acts as a negative regulator of pomc expression. Analyses of the zebrafish pomc enhancer/promoter region (30) will be necessary to confirm this notion and to investigate whether Pit1 acts a direct transcriptional repressor of the pomc gene. Alternatively, Pit1 might repress pomc expression in a DNA binding-independent fashion, similarly to how it has been described for mouse Pit-1 and the Lh gene in thyrotropes, where Pit1 prevents Lhß transcription by binding and blocking the Gata2 transcription factor (2, 7, 20).

A similar gondatropin-repressive function might also apply to zebrafish Pit1. This is indicated by the expression pattern of gsu{alpha}, encoding the {alpha}-chain normally forming heterodimers with Tshß in thyrotropes, and with Lhß or Fshß in gonadotropes. In wild-type zebrafish embryos, approximately half of the gsu{alpha}-positive cells also express tshß, identifying them as thyrotropes, whereas the second half lacks tshß expression, most likely representing gonadotropes. In pit1 mutant embryos, the number of gsu{alpha}-positive cells is unaltered, although none of them shows tshß expression, suggesting that the thyrotropes of zebrafish pit1 mutants might have acquired a gonadotroph fate, as in mouse Pit-1 mutants. Final proof of this notion will require expression analyses of gonadotroph-specific markers (lhß, fshß), which are not available as yet. Also, to prove transfating, it will be necessary to demonstrate ectopic lhß or fshß expression in pit1-positive cells of mutant embryos. This will only be possible if the gonadotroph hormone genes are expressed as early as pomc (25 hpf), because slightly later, pit1 expression in pit1 mutants ceases, due to the inability of mutant Pit1 protein to fulfill its positive autoregulative function.

In mouse, no Pomc-repressing role of Pit-1 has been reported. Rather, the POMC lineage is supposed to split off before Pit-1 expression is initiated (see above and Refs.1 , 4 , and 7 , for reviews). Thus, the loss of mouse Pit-1 is supposed to cause thyrotrope–gonadotrope transfating only (20), similar to our interpretation of the zebrafish gsu{alpha} data described above, whereas presumptive somatotropes and lactotropes are thought to remain unspecified and nonproliferative to eventually undergo apoptosis, thereby causing pituitary hypoplasia in juvenile and adult mouse mutants (Ref.16 , and references therein). In zebrafish, we could not detect any sign of increased apoptosis rates or decreased sizes of pit1 mutant pituitary glands during all investigated larval stages (up to 120 hpf, which corresponds approximately to a developmental stage around birth in mouse).

In the future, it will be interesting to investigate whether surviving zebrafish pit1 mutants develop later pituitary hypoplasia, and, if not, whether this is due to the proposed transfating of the entire Pit1 lineage. Interestingly, human Pit-1 patients have pituitary glands of proportionally normal size (18), making it tempting to speculate that similar transfating mechanisms might be at play. In addition, it will be interesting to investigate the fate of somatotrope precursors in zebrafish pit1 mutants. In mammals, several lines point to transdifferentiation potentials between somatotropes and thyrotropes, lactotropes or gonadotropes. Thus, during the regulation of the reproductive system, GH-generating cells can become multihormonal and act as cogonadotropes (39, 40), with somatotrope-gonadotrope switching in extreme cases (41). Similarly, reversible somatotrope-lactotrope transdifferentiation has been reported during pituitary hyperplasia (42), and somatotrope-thyrotrope transdifferentiation has been described as an ultimate response of human patients suffering from hypothyroidism (43). In light of these data, somatotrope precursors of pit1 mutant zebrafish might acquire a gonadotrope fate, similar to thyrotropes, or a Pomc fate, similar to lactotropes. Nevertheless, it is interesting to note that around the time point of gh expression initiation during normal development, pit1 mutants still contain gsu{alpha}- and pomc-negative cells in the medial adenohypophyseal domain (Fig. 6LGo), suggesting that transfating of somatotropes might occur later, or might not be complete.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning of the pit1 cDNA, Genomic Mapping, and Cloning of pit1 from Mutants
Based on sequences found in BLAST searches of the zebrafish genome database (www.ensembl.org/Danio_rerio/), a zebrafish pit1 cDNA fragment was cloned by RT-PCR. Total RNA was isolated from zebrafish embryos, using Trizol LS reagent (Life Technologies, Gaithersburg, MD), and first-strand cDNA synthesis was carried from 1 µg of total RNA with SuperscriptII reverse transcriptase (Life Technologies) and oligodT primer. 5'-RACE was performed with cDNA prepared using the SMART-Kit (BD Biosciences, San Diego, CA). PCR primers were, for amplification of the initial pit1 fragment: TCA CAA CGG TGG CCG ATG (sense), GGA CAA CAT GAA TGA ATT TGT GG (antisense); for 5'-RACE: GCT GAG CTG CAG GTT CTC AAA GCG GCA G. For the amplification of pit1 cDNA fragments from mutant embryos (Fig. 5Go), primers used were GCG ACT CCT TCA GCG GTT TAG (sense) and GCT CGT GCA GAC CCA TCT TC (antisense) for the t21379 allele, and CTG AGC ACA GTT TGG CTG GAG (sense) and CTC GGC CAT TCG CAC GAT C (antisense) for the t22072 allele.

For genomic mapping of the pit1 gene, PCR was carried out on the T51 radiation hybrid panel (44), using primers GGA TTG AAC ATA AAA CAA TTA CGC (sense) and CTC ACA TAC AAG CGT ACC G (antisense). The genomic location was calculated after submission of the obtained amplification pattern to web site (http://134.174.23.167/zonrhmapper/instantMapping.htm).

For cloning of genomic pit1 fragments from mutant larvae, mutants were identified via gh whole-mount in situ hybridization at 120 hpf, followed by preparation of genomic DNA in 40 µl of lysis buffer (0.5 µg/µl proteinase K in 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 0.3% Tween 20; 0.3% Nonidet 40). pit1 exons were amplified, using the following intron-encoded primers: for exon1: CAC AGC CCA TAT CAG ATT GCA G (sense) and CAC ACA AGC CAT AAT TAG CGA GAG (antisense), for exon 2-exon 3: TGC TCA GAT CCC ATG GTG AC (sense) and GGT GAA CTG TCC GCT TTA ATG G (antisense), for exon 5: GAT GAC CAA ATT GTG GCC AAT ATG (sense) and TCT TCA TGG AAC CAC AAA AGC TC (antisense), for exon 6-exon 7: TCA GCT AAC AGC AAT CTG TGC and ACA GTG CAT GTG CTC TTT GG (antisense). For exon 4, no sequence information of the 5'-region of intron 4/5 was available to design an antisense primer. Therefore, exon 4 was amplified via RT-PCR from total RNA, using the primers GCG ACT CCT TCA GCG GTT TAG (sense, exon 1) and GCT CGT GCA GAC CCA TCT TC (antisense, exon 6).

Cloning of the Zebrafish gsu{alpha} cDNA
A 180-bp fragment of the zebrafish gsu{alpha} cDNA was cloned by degenerate RT-PCR with total RNA from wild-type embryos of 48–96 hpf of age, and the primers CA(AG)TG(CT)ATGGG(AGCT)TG(CT)TG(CT)TT (sense), and CA(AG)TG(AG)CA(AGCT)TC(AGCT)GT(AG)TG(AG)TT (antisense). PCR conditions were: 94 C (3 min), 94 C (30 sec), 67 C (30 sec), 72 C (40 sec) with a 1 C decrement for seven cycles, followed by 33 cycles at 94 C (30 sec), 60 C (30 sec), 72 C (40 sec), and 72 C (3 min). To obtain the 5'- and 3'-sequences of the zebrafish gsu{alpha}, RACE-PCR was carried out with the SMART RACE cDNA Amplification Kit (BD Biosciences). The RACE primers were: GCT ACA CAG CAA GTG GCT TCT GAT G (5') and CAC GCT CCG CCG GAA GTC GAG (3'). We amplified a fragment of 1480 bp in length (GenBank accession no. AY522553), containing 33 bp of 5'-untranslated region (UTR), 351 bp of the coding region, and 1096 bp of 3'-UTR, which was cloned into pCRII vector (Invitrogen, San Diego, CA).

Meiotic Mapping of the pitt21379 Mutation
Mutant carriers of the t21379 mutation, generated and maintained in the Tuebingen backgound, were outcrossed to the polymorphic wik line (45). Identified F1 carriers were crossed to each other, and F2 offspring were fixed at 120 hpf for in situ hybridization with gh probe to allow the identification of mutant larvae. For rough mapping, genomic DNA of pools of 20 mutants or 40 wild-type siblings was assayed via PCR with a selected panel of SSLP (simple sequence length polymorphism) markers [Tuebingen version 4; primer sequences available (http://zebrafish.mgh.harvard.edu)] spanning the entire zebrafish genome (45, 46). By this method, we found marker z20031 located 59.6 cM from the north end of linkage group 9 (LG9) to be linked to the mutation. For fine mapping, DNA of single mutants and additional published LG9 SSLP markers were used. In addition, new polymorphic markers were identified, taking advantage of expressed sequence tag (EST) sequences that, according to radiation hybrid mapping (44), are located in the same region (Fig. 1BGo). EST-encoded primer pairs generating such newly identified polymorphisms are: fb50e04 (SSLP), ATC GCC ACC TAC TGG ACC, CCT CAT CAC AAC CCA CAT TGA A; fi38c08 (single nucleotide polymorphism), GCT GTG ATT CCT TTC GCG CTC, GAA CCG TGG TGC GCG TTT C; fi04c05 (single nucleotide polymorphism) GCA GTT CCC TCC TCT ACA GAG, CTA CGC CAC CAT GGG AAG C. Analyzing a total of 495 single-mutant embryos, the t21379 mutation was found to map approximately 51–52 cM from the north end of LG9, 0.8 cM (six recombinations in 756 meioses) north of z6845 (52.3 cM), 0.26 cM (one recombination in 378 meioses) north of fi04c05, 1.8 cM (18 recombinations in 990 meioses) south of fb50e04, and 0.27 cM (one recombination in 368 meioses) south of fi38c08.

Genotyping of pit1 Mutants
Individual mutant embryos, larvae and juvenile fish, and their wild-type siblings were genotyped after photography via PCR of genomic DNA, followed by sequencing or restriction analysis. For t21379, primers used were TGC TCA GAT CCC ATG GTG AC and GGT GAA CTG TCC GCT TTA ATG G, amplifying exons 2 and 3, and flanking intron sequences. The PCR product was digested with BpmI for 2 h at 37 C. In mutant DNA, the BmpI site is destroyed by the mutation, and the amplified fragment remains uncleaved at 800 bp, whereas the wild-type band is cut, yielding a 600-bp and a 200-bp band. For t22072, parts of exon 5 and intron 5/6 were amplified with primers CAG CCA AAC CAC AAT CTG C and TCT TCA TGG AAC CAC AAA AGC, and the resulting 150-bp fragment was sequenced after gel elution. Heterozygous animals gave an A/G double peak.

Morpholino Injections
Antisense MOs were injected into embryos at the one- to four-cell stage, as described previously (47). The sequence of the pit1 antisense MO is ACTCTTCATCGGCCACCGTTGTGAC, corresponding to nucleotides –4 to –28 in the 5'-UTR of the pit1 cDNA. Injections were done at a concentration of 0.25 nmol/µl.

In Situ Hybridizations, Acridine Orange Stainings, and TUNEL Stainings
In situ hybridizations were done as described previously (48). pit1 antisense probe was synthesized from plasmid pCRII-pit1, containing a 1.1-kb pit1 cDNA insert, with SP6 RNA polymerase after linearization with EcoRV. gsu{alpha} probe was synthesized from plasmid pCR2.1-gsu7, containing a 1.5-kb gsu{alpha} cDNA insert, with T7 RNA polymerase after linearization with NotI. Probes for lim3, prl, pomc, tsh, and gh were synthesized, and red/blue double in situ hybridizations were carried out, as previously described (29). Double-stained embryos were kept in 80% glycerol. In glycerol-benzyl alcohol (5:1), only the blue stain is stable, whereas the red fades out within minutes. To confirm whether individual cells are positive for one probe only (red) or for both probes (red and blue), embryos were mounted in glycerol-benzyl alcohol (5:1), and photos were taken right after mounting and after the red had vanished (Figs. 3Go and 6Go).

For detection of apoptotic cells, acridine orange or TUNEL stainings were carried out. For acridine orange stainings, dechorionated live embryos and larvae were incubated for 30 min in 5 µg/ml acridine orange (Sigma Chemical Co., St. Louis, MO) in E3 medium, followed by fluorescent microscopy (Zeiss axiophot; Carl Zeiss, Thornwood, NY) and photography, using an ORCA ER digital camera C4742–95 (Hamamatzu, Bridgewater, NJ). Bright-field and fluorescent images were superimposed with Openlab software (Improvision, Lexington, MA). TUNEL stainings were performed using the In Situ Cell Death Detection Kit (Roche Clinical Laboratories, Indianapolis, IN), essentially as described by Cole and Ross (49).


    ACKNOWLEDGMENTS
 
We are grateful to Michael Schorpp, Markus Leicht, Elvira Nold, Thorsten Nolting, Carolin Riegger, Dagmar Diekhoff, and Tanna Franz from Freiburg, and to the Tuebingen screen consortium (MPI for Developmental Biology: F. van Bebber, E. Busch-Nentwich, R. Dahm, H.-G. Frohnhöfer, H. Geiger, D. Gilmour, S. Holley, J. Hooge, D. Jülich, H. Knaut, F. Maderspacher, H.-M. Maischein, C. Neumann, T. Nicolson, C. Nüsslein-Volhard, H. Roehl, U. Schönberger, C. Seiler, C. Söllner, M. Sonawane, A. Wehner, C. Weiler; Exelixis Germany GmbH: P. Erker, H. Habeck, U. Hagner, C. Hennen, E. Kaps, A. Kirchner, T. Koblitzek, U. Langheinrich, C. Loeschke, C. Metzger, R. Nordin, J. Odenthal, M. Pezzuti, K. Schlombs, J. deSatana-Stamm, T. Trowe, G. Vacun, B. Walderich, A. Walker, C. Weiler) for carrying out the large-scale mutant screen during which the pit1 alleles were isolated. In addition, we thank Donatus Boensch for excellent fish care, and Thomas Boehm for support and discussions. Many thanks also to Jing-Wen Ting and Chi-Yao Chang for sending us the gh plasmid before publication, and to Igor Dawid for the lim3 plasmid.


    FOOTNOTES
 
Work in the laboratory of M.H. was supported by the Max-Planck Society.

G.N. and W.H. contributed equally to this work and should both be considered first authors.

Abbreviations: aa, Amino acid(s); ANR, anterior neural ridge; AP, anteroposterior; cM, centiMorgan; dpf, days post fertilization; e10.5, embryonic d 10.5; EST, expressed sequence tag; GSU{alpha}, gonadotropin {alpha}-subunit; hpf, hours post fertilization; MO, morpholino oligonucleotide; POMC, proopiomelanocortin; PRL, prolactin; SSLP, simple sequence length polymorphism; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling; UTR, untranslated region.

Received for publication September 26, 2003. Accepted for publication February 17, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Burrows HL, Douglas KR, Seasholtz AF, Camper SA 1999 Genealogy of the anterior pituitary gland: tracing a family tree. Trends Endocrinol Metab 10:343–352[CrossRef][Medline]
  2. Dasen JS, Rosenfeld MG 1999 Combinatorial codes in signaling and synergy: lessons from pituitary development. Curr Opin Gen Dev 9:566–574[CrossRef][Medline]
  3. Dasen JS, Rosenfeld MG 1999 Signaling mechanisms in pituitary morphogenesis and cell fate determination. Curr Opin Cell Biol 11:669–677[CrossRef][Medline]
  4. Kioussi C, Carrière C, Rosenfeld MG 1999 A model for the development of the hypothalamic-pituitary axis: transcribing the hypophysis. Mech Dev 81:23–35[CrossRef][Medline]
  5. Sheng HZ, Westphal H 1999 Early steps in pituitary organogenesis. Trends Genet 15:236–240[CrossRef][Medline]
  6. Burgess R, Lunyak V, Rosenfeld MG 2002 Signaling and transcriptional control of pituitary development. Curr Opin Genet Dev 12:534–539[CrossRef][Medline]
  7. Scully KM, Rosenfeld MG 2002 Pituitary development: regulatory codes in mammalian organogenesis. Science 295:2231–2235[Abstract/Free Full Text]
  8. Zhao L, Bakke M, Krimkevich Y, Cushman LJ, Parlow AF, Camper SA, Parker KL 2001 Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128:147–154[Abstract]
  9. Lamolet B, Pulichino A-M, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849–859[CrossRef][Medline]
  10. Liu J, Lin C, Gleiberman A, Ohgi KA, Herman MA, Huang H, Tsai MJ, Rosenfeld MG 2001 Tbx19, a tissue-selective regulator of POMC gene expression. Proc Natl Acad Sci USA 98:8674–8679[Abstract/Free Full Text]
  11. Pulichino A-M, Vallette-Kasic S, Tsai JP-Y, Couture C, Gauthier Y, Drouin J 2003 Tpit determines alternate fates during pituitary cell differentiation. Genes Dev 17:738–747[Abstract/Free Full Text]
  12. Bousquet C, Zatelli MC, Melmed S 2000 Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing. J Clin Invest 106:1417–1425[Medline]
  13. Bodner M, Castrillo J-L, Theill LE, Deerinck T, Ellisman M, Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 50:267–275
  14. Ingraham HA, Chen R, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson LW, Rosenfeld MG 1988 A tissue-specific transcription factor containing a homeodomain specifies pituitary phenotype. Cell 50:519–529[CrossRef]
  15. Lin S-C, Li S, Drolet DW, Rosenfeld MG 1994 Pituitary ontogeny of the Snell dwarf mouse reveals Pit-1-independent and Pit-1-dependent origins of the thyrotrope. Development 120:515–522[Abstract]
  16. Li S, Crenshaw III EB, Rawson EJ, Simmons DM, Swanson LW, Rosenfeld MG 1990 Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene Pit-1. Nature 347:528–533[CrossRef][Medline]
  17. Tatsumi K-i, Miyai K, Notomi T, Kaibe K, Amino N, Mizuno Y, Kohno H 1992 Cretinism with combined hormone deficiency caused by a mutation in the PIT1 gene. Nat Genet 1:56–58[CrossRef][Medline]
  18. Pfäffle RW, DiMattia GE, Parks JS, Brown MR, Wit JM, Jansen M, Van der Nat H, Van den Brande JL, Rosenfeld MG, Ingraham HA 1992 Mutation of the Pou-specific domain of Pit-1 and hypopituitarism without pituitary hypoplasia. Science 257:1118–1121[Abstract/Free Full Text]
  19. Radovick S, Nations M, Du Y, Berg LA, Weintraub B, Wondisford FE 1992 A mutation in the POU-homeodomain of Pit-1 responsible for combined pituitary hormone deficiency. Science 257:1115–1118[Abstract/Free Full Text]
  20. Dasen JS, O'Connell SM, Flynn SE, Treier M, Gleiberman AS, Szeto DP, Hooshmand F, Aggarwal AK, Rosenfeld MG 1999 Reciprocal interactions of Pit1 and GATA2 mediate signaling gradient-induced determination of pituitary cell types. Cell 97:587–598[CrossRef][Medline]
  21. Gordon DF, Lewis SR, Haugen BR, James RA, McDermott MT, Wood WM, Ridgway EC 1997 Pit-1 and GATA-2 interact and functionally cooperate to activate the thyrotropin ß-subunit promoter. J Biol Chem 272:24339–24347[Abstract/Free Full Text]
  22. Scully KM, Jabobson EM, Jepsen K, Lunyak V, Viadiu H, Carrière C, Rose DW, Hooshmand F, Aggarwal AK, Rosenfeld MG 2000 Allosteric effects of Pit-1 DNA sites on long-term repression in cell type specification. Science 290:1127–1131[Abstract/Free Full Text]
  23. Chen RP, Ingraham HA, Treacy MN, Albert VR, Wilson L, Rosenfeld MG 1990 Autoregulation of pit-1 gene expression mediated by two cis-active promoter elements. Nature 346:583–586[CrossRef][Medline]
  24. McCormick A, Brady H, Theil LE, Karin M 1990 Regulation of the pituitary-specific homeobox gene GHF1 by cell-autonomous and environmental cues. Nature 345:829–832[CrossRef][Medline]
  25. Rhodes SJ, Chen R, DiMattia GE, Scully KM, Kalla KA, Lin S-C, Yu VC, Rosenfeld MG 1993 A tissue specific enhancer confers Pit-1 dependent morphogen inducibility and autoregulation of pit-1 gene. Genes Dev 7:913–932[Abstract/Free Full Text]
  26. DiMattia GE, Rhodes SJ, Krones A, Carriere C, O’Connell S, Kalla KA, Arias C, Sawchenko PE, Rosenfeld MG 1997 The Pit-1 gene is regulated by distinct early and late pituitary-specific enhancers. Dev Biol 182:180–190[CrossRef][Medline]
  27. Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, Rosenfeld MG 1993 Molecular basis of the little mouse phenotype and implications for cell type-specific growth. Nature 364:208213.
  28. Glasgow E, Karavanov AA, Dawid IB 1997 Neuronal and neuroendocrine expression of lim3, a LIM class homeobox gene, is altered in mutant zebrafish with axial signaling defects. Dev Biol 192:405–419[CrossRef][Medline]
  29. Herzog W, Zeng X, Lele Z, Sonntag C, Ting J-W, Chang C-Y, Hammerschmidt M 2003 Adenohypophysis formation in the zebrafish and its dependence on sonic hedgehog. Dev Biol 254:36–49[CrossRef][Medline]
  30. Liu N-A, Huang H, Yang Z, Herzog W, Hammerschmidt M, Lin S, Melmed S 2003 Pituitary corticotroph ontogeny and regulation in transgenic zebrafish. Mol Endocrinol 17:959–966[Abstract/Free Full Text]
  31. Nasevicius A, Ekker SC 2000 Effective targeted gene ’knockdown’ in zebrafish. Nat Genet 26:216–220[CrossRef][Medline]
  32. Herzog W, Sonntag C, Walderich B, Odenthal J, Maischein H-M, Hammerschmidt M 2004 Genetic analysis of adenohypophysis formation in zebrafish. Mol Endocrinol 18:1185–1195[Abstract/Free Full Text]
  33. Snell GD 1929 A new mendelian recessive character of the house mouse. Proc Natl Acad Sci USA 15:733–734[Free Full Text]
  34. Camper SA, Saunder TL, Katz RW, Reeves RH 1990 The Pit-1 transcription factor gene is a candidate for the murine snell dwarf mutation. Genomics 8:586–590[CrossRef][Medline]
  35. Streisinger G, Walker C, Dower N, Knauber D, Singer F 1981 Production of clones of homozygous diploid zebrafish, Brachydanio rerio. Nature 291:293–296[CrossRef][Medline]
  36. Treier M, Gleiberman AS, O’Connell SM, Szeto DP, McMahon JA, McMahon AP, Rosenfeld MG 1998 Multistep signaling requirements for pituitary organogenesis in vivo. Genes Dev 12:1691–1704[Abstract/Free Full Text]
  37. Bach I, Rhodes SJ, Pearse RV, Heinzel T, Gloss B, Scully KM, Sawchenko PE, Rosenfeld MG 1995 P-LIM, a LIM homeodomain factor, is expressed during pituitary organ and cell commitment and synergizes with Pit-1. Proc Natl Acad Sci USA 92:2720–2724