| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Max-Planck-Institut für experimentelle Endokrinologie (J.M., R.R., L.G., M.L., K.B.), D-30625 Hannover, Germany; Heinrich-Heine Universität (U.R.), D-40225 Düsseldorf, Germany; National Hormone & Peptide Program (A.F.P.), Torrance, California 90509; and Department of Internal Medicine (T.J.V.), Erasmus University Medical School, NL-3000 DR Rotterdam, The Netherlands
Address all correspondence and requests for reprints to: Karl Bauer, Max-Planck-Institut für experimentelle Endokrinologie, Feodor-Lynen-Strasse 7, D-30625 Hannover, Germany. E-mail: karl.bauer{at}mpihan.mpg.de.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
At TRH target sites the peptidergic signal is transduced by two receptors that have been identified so far. TRH receptor 1 (TRH-R1) was originally cloned from a mouse pituitary cDNA library in 1990 (8) whereas TRH-R2 was cloned more recently from a rat brain cDNA library (9, 10). Both receptors belong to the family of G-protein-coupled receptors acting via the inositol phospholipid-calcium-protein kinase C signal transduction pathway. In brain, a distinct and complementary distribution of both receptors has been demonstrated by in situ hybridization histochemistry (11). TRH-R2 mRNA is widely distributed and strongly expressed in brain areas, such as the cerebral and cerebellar cortex, thalamus, medial habenulae, medial geniculate nucleus, pontine nuclei, and reticular formation, that are important for the transmission of somatosensory signals and higher central nervous system functions. In contrast, TRH-R1 mRNA is predominantly expressed in neuroendocrine brain regions (e.g. paraventricular hypothalamic nucleus, arcuate nucleus, anterior hypothalamic nucleus), the autonomic nervous system, and visceral brainstem regions. In the pituitary, only TRH-R1 is expressed; TRH-R2 transcripts are not detectable (11).
Tight regulation of the TRH signal is of paramount importance to control the synthesis and release of TSH and thus plays a pivotal role in the regulation of the hypothalamic-pituitary-thyroid axis. As in tertiary hypothyroidism, which is due to hypothalamic damage or defects, secondary hypothyroidism resulting from pituitary insufficiency leads to the same clinical manifestation, namely insufficient TSH secretion in the presence of low levels of thyroid hormones, a condition collectively designated as central hypothyroidism (12). Moreover, as in other cases of impaired hypothalamic-pituitary signaling [e.g. hypoplasia of somatotropes observed in the GHRH receptor-deficient lit/lit dwarf mice (13) or hypogonadism due to the inactivation of the GnRH gene (14)] disruption of the TRH signaling pathway may conceivably also affect the development of the pituitary. In fact, after administrating TRH to rat dams, stimulation of fetal pituitary and thyroid functions has been observed (15, 16). With embryonic pituitaries in culture it has also been reported that TRH influences rat pituitary cell type differentiation (17). However, embryonic development of pituitary thyrotropes independent of hypothalamic TRH was found in anencephalic human fetus that showed normal TSH levels (18, 19). Consistent with this report, recent studies with TRH-deficient mice mutants also indicated that TRH is not essential for fetal thyrotrope development. Remarkably, however, these studies also indicated that postnatally, TRH is required for normal thyrotrope function (20, 21). To the contrary, in a patient suffering from central hypothyroidism due to inactivating mutations in the TRH-R1 gene (22), TSH levels at birth and the age of 8.9 yr were within normal values. This has been taken as an indication that TRH deficiency is distinguishable from TRH receptor dysfunction (20). So far, unfortunately, there has not been an animal model available to study the effect of TRH-R1 deficiency on pituitary development and maintenance of proper pituitary function. In this study we describe the generation of a mouse mutant deficient in TRH-R1 and report on the effect of this mutation on pituitary function.
| Experimental Animals |
|---|
|
|
|---|
| RESULTS |
|---|
|
|
|---|
|
Initial Characterization of TRH-R1/ Mice
Male and female fertility in the TRH-R1/ mice appeared to be normal, but litter size was slightly affected; mean litter sizes in 28 wild-type and 26 TRH-R1/ pregnancies were 7.18 ± 1.81 and 6.07 ± 1.89, respectively. There was no difference in body weight at birth. Irrespective of the genotype of the mothers, the pups of both genotypes developed at a comparable rate up to the age of 16 d. Moreover, when nourished by NMRI foster mothers, there was also no difference in the growth rate of wild-type and TRH-R1/ pups up to postnatal d 16. Thereafter, however, around the time of weaning at postnatal d 20 and up to the age of 12 wk, the growth of the TRH-R1/ male (Fig. 2
) and female animals (data not shown) was clearly reduced compared with wild-type animals. By cross-breeding, the TRH-R1 gene was also deleted in 129/Sv and NMRI mice. The growth rate of these TRH-R1/ mice was affected comparably to that of C57/B6 mice with the deleted TRH-R1 gene, indicating that this effect is not due to strain differences. A difference in the growth rate could not be observed between wild-type and heterozygous (TRH-R1+/) animals. In bedded cages with nesting material, TRH-R1/ mice (12 wk old) were also able to survive exposure to the cold (4 C) for the 3 d tested.
|
|
|
Analysis of Pituitary Hormone Expression
The mRNA expression for the pituitary hormones TSH, PRL, and GH was analyzed by in situ hybridization histochemistry. In agreement with the unchanged TSH serum levels, the pituitaries of wild-type and TRH-R1/ mice exhibited comparable TSHß-mRNA expression patterns (Fig. 4
). In contrast, the intensity of PRL transcript signals was greatly reduced in pituitaries of female (Fig. 4
) and male (data not shown) animals compared with wild-type animals. However, the number of PRL mRNA expressing cells was not significantly reduced. The same pattern was found for GH mRNA expression (Fig. 4
). As expected from the hypothyroid condition of the TRH-R1 knockout animals, expression of GH mRNA was significantly reduced in TRH-R1/ mice compared with control animals, but the number of GH mRNA-expressing cells was not affected.
|
|
PRL Expression during Lactation
Despite the low PRL serum levels and the decreased PRL mRNA levels, female TRH-R1/ mice became readily pregnant and, as can be seen from the growth curve shown in Fig. 2
, they obviously nourished their pups well. Analysis by in situ hybridization (Fig. 6
, upper panel) and by quantitative real-time PCR (Fig. 6
, lower panel) revealed that in TRH-R1/ mice as in wild-type animals, pituitary PRL mRNA expression significantly increased during lactation compared with the nonlactating state of these animals. During lactation, an increase by a factor of 1.6 was observed in wild-type animals, and an increase by a factor of 3.3 was found in TRH-R1/ mice. Nevertheless, in lactating TRH-R1 knockout mice, the PRL-mRNA expression levels were strongly reduced compared with those of lactating control animals.
|
| DISCUSSION |
|---|
|
|
|---|
Analysis of the mouse mutants, which we generated by targeted disruption of the TRH-R1 gene, revealed the same picture. In adult male and female mutants, total T4 and T3 serum levels were reduced by 6070%, but the inactivation of the TRH-R1 gene did not affect adult TSH serum levels, neither in the female nor in the male mutants. Only the known sex differences in mice TSH levels (23, 24, 25) were noted. In contrast, the PRL serum levels were significantly reduced in the mutant compared with wild-type animals, moderately in male (by 37%) and drastically (by 87%) in female mutants.
As in the clinical cases of central hypothyroidism (26, 27, 28), in mouse thyrotropic tumors (29) and hypothyroid rat pituitaries (30), the apparently normal TSH levels in the hypothyroid TRH-R1/ mice are most likely explained by the synthesis of biologically inactive TSH with decreased receptor binding due to the inappropriate glycosylation of TSH (31). It has been established that this defect in glycosylation and biological action can be corrected by TRH treatment (32). It remains to be shown whether the same explanation applies to the differences in the serum TSH levels of male and female mice (23, 24, 25).
As expected from the low thyroid hormone levels, the TRH-R1 knockout mice are clearly growth retarded. This is not surprising because it is well documented that GH transcription and synthesis are strongly reduced in rats rendered hypothyroid by PTU treatment or surgery (33, 34) as well as in congenital hypothyroid animal models such as the hyt/hyt (35), the
GSU/ (36), and the Pax8/ (37) mouse. Furthermore, thyroid hormones in rodents are known to be directly and positively involved in GH gene transcription (38, 39, 40, 41). Indeed, when TRH-R1/ mice were treated with a supplementary dose of T4 for 4 d, GH transcription was significantly increased.
Whereas our data are in perfect agreement with those of the patient with inactivating mutations of the TRH-R1 gene and also fit well with the clinical data in most cases of central hypothyroidism, there are major differences when compared with TRH/ mouse mutants. Despite a decrease (by 35%) in the number of thyrotropes, a decrease (by 65%) in pituitary TSH content and even a reduction in TSHß and TSH
-mRNA expression levels (to 79.1 ± 0.7% and 71.8 ± 5%, respectively; as assessed by Northern blot analysis), the TSH serum levels in TRH/ mice were highly increased (by 83%) compared with wild-type controls (20, 21).
These increased TSH levels in TRH/ mice were unexpected because TSH levels were reduced in mice in which TRH deficiency was acutely induced by hypothalamic destruction (electrolesion and knife-cut deafferentation) (42, 43). Corresponding to this, we observed in young TRH-R1/ mice a strong reduction in TSH transcript levels. This decrease was most pronounced at the age of 2 wk when the serum T4 and T3 levels reach peak values (44) and the hypothalamic-hypophyseal communication system is finally established (45, 46). At this stage of development, however, the institution of the pituitary-thyroid feedback regulatory system still proceeds, a process characterized by a decrease in TSH response to TRH and by an increase in TSH sensitivity to T3 suppression (45). In accordance with these data, we observed that the reduction in TSH transcript levels in TRH-R1/ mice diminishes with increasing age and at the age of 12 wk, the TSH transcript levels of TRH-R1/ mice matches those of control animals. Thus, once firmly established in adult animals, the pituitary-thyroid regulatory system may conceivably operate, to a large extent, autonomously as the principal thyrostat as long as the conditions remain constant. During development and for the adjustment to altered conditions (e.g. adaptation to cold environment), however, hypothalamic TRH is required as the important central modulator for the dynamic regulation of TSH and thus thyroid hormone secretion.
As revealed by in situ hybridization histochemistry, the deletion of the TRH-R1 gene in adult TRH-R1/ mice had no obvious effect on the number of TSHß-mRNA expressing cells or on the number of PRL-mRNA expressing cells. Thus, TRH-R1 is apparently required neither for the development nor the maintenance of both TRH target cells in the pituitary. Again, this is a significant difference to the TRH/ mice in which TRH seems to be important for postnatal maintenance of TSH immunopositive cells although not required for the proliferation or differentiation of embryonic pituitary thyrotropes. Surprisingly, however, the number of PRL-producing cells is not reduced in TRH/ mice (20, 21). When compared with other mouse mutants with defects in the hypothalamic-hypophyseal signaling system, it is interesting to note that in adult CRF and CRF-R1 knockout mice, the ACTH-producing cells are also not affected (47, 48), whereas GHRH-receptor-deficient lit/lit (13) and GnRH-deficient (hypogonadal, hpg) mice (14, 49) exhibit hypoplasia of somatotropes and gonadotropes, respectively.
With regard to GH and PRL expression levels, differences between TRH/ and TRH-R1/ mice are also quite evident. Despite their hypothyroidism, the serum GH levels of TRH/ mice are not different from control values, whereas in the TRH-R1/ animals the expression of GH mRNA is significantly reduced. Even more surprising is the fact that in TRH/ mice, neither the serum PRL levels nor the PRL expression patterns differ from those of wild-type animals although TRH is known as a potent and robust PRL secretagog in all species tested in vivo and in vitro (3, 4, 50). As expected from these and other published data, the PRL mRNA expression levels and the serum PRL values are drastically reduced in TRH-R1/ mice. The low expression levels are not unexpected because, unlike thyrotropes, lactotropes lack a feedback-regulatory system by a target hormone, and thus they cannot compensate via autoregulatory mechanisms.
Despite the low PRL levels, neither reproduction nor lactation was severely impaired in TRH-R1/ mice. Although PRL levels are reduced in TRH-R1/ compared with control mice, there is apparently enough PRL produced to promote in mammary alveoli the synthesis and secretion of milk proteins in sufficient amounts (for review see Refs.50, 51, 52). Furthermore, the fact that TRH-R1/ mice nourish their pups well does not support the concept that suckling-induced PRL release is essentially mediated by TRH, a much debated issue for which supporting and contradictory experimental results have been reported (for review see Refs.51 and 53).
In summary, our results obtained from the analysis of TRH-R1/ mice fit well with the clinical data in cases of central hypothyroidism, and they are in full agreement with the data reported from the patient with inactivating mutations of the TRH-R1 gene. Surprisingly, however, there are striking differences when TRH-R1/ and TRH/ mice are compared, indicating that tertiary hypothyroidism due to TRH deficiency might be distinguishable from secondary hypothyroidism due to pituitary TRH-receptor dysfunction. This notion is supported by some clinical reports (54) on patients with presumed hypothalamic hypothyroidism, although there are no patients in which isolated TRH deficiency has been defined. Because TRH is not only expressed in the thyrotropic paraventricular nucleus of the hypothalamus, but also in other hypothalamic brain areas, one explanation for the discrepancy might be that the deficiency of the signaling peptide TRH within the hypothalamus may affect other neuroendocrine communication systems, e.g. via the synthesis and/or release of somatostatin, GHRH, dopamine, and other factors. If this interpretation is correct, it will be very interesting to study with these mouse mutants the precise mechanisms underlying the different patterns of pituitary hormone secretion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
A 4.6-kb HindIII-HindIII DNA fragment including the first and part of the second exon and a 3.1-kb EcoRI-EcoRI DNA fragment including part of the fifth exon were subcloned into pBluescript KSII+ (Stratagene Europe, Amsterdam, The Netherlands). To enrich for homologous recombination events, the herpes simplex virus thymidine kinase gene was introduced. The flanking sequences and the negative selection cassette were further subcloned into the pGNA plasmid. The replacement vector finally contained 7.7 kb of homologous genomic DNA in which the complete coding region of the TRH-R1 gene was removed and replaced by a lacZ and Rous sarcoma virus-Neo cassette.
After electroporation, R1-ES cells (55) were selected by adding G418 (200 µg/ml) and gancyclovir (2 µM) to the medium. Homologous recombinant cell clones were identified by Southern blot analysis as described below. These ES cells were thus injected into 3.5-d-old NMRI blastocysts that were subsequently implanted into pseudopregnant recipients. The resulting chimeras were mated with NMRI females, and germline transmission of the mutant allele was identified by Southern blot analysis.
Genotype Determination
For DNA preparations, ES cells or mouse tails were incubated overnight at 60 C in extraction buffer (50 mM Tris-HCl, pH 8.0; 100 mM NaCl; 100 mM EDTA; 1% sodium dodecyl sulfate; 50 µg/ml Proteinase K).
Southern blot.
DNA (10 µg) was digested with EcoRI, size separated on a 0.8% agarose gel, and then capillary transferred to a nylon membrane (Hybond N, Amersham Bioscience, Braunschweig, Germany). The membranes were hybridized with
32P-labeled 370 bp BglII-HindIII fragment specific for a region upstream of the first exon of the TRH-R1 gene that was not included in the targeting vector, and then washed twice at 60 C and once at 65 C in 20 mM sodium phosphate (pH 7.2) containing 1% sodium dodecyl sulfate. The signals were analyzed using a Fujix BAS 1000 phospho-imager (Fuji Photo Film Co., Ltd., Düsseldorf, Germany).
PCR.
Standard PCR assays were performed in 10 µl with 15 pmol of primer A and B and 5 pmol of primer C (A: TGAGTGTGGCTTGATTGG; B: GTGCTGTTGAAGCATCTG; C: GACTGTCCTGGCCGTAAC).
TRH Binding Assay
Five mouse pituitaries per genotype were homogenized in 500 µl sodium phosphate buffer (10 mM; pH 7.4) containing 0.04% NaN3. To inactivate TRH-degrading enzymes the homogenate was supplemented with 5 µM N-Cbz-Gly-Pro-diazomethyl ketone and 5 µM pyro-Glu-diazomethyl ketone and incubated on ice for 30 min. The homogenate was centrifuged for 10 min at 50,000 x g and the pellet was then washed by rehomogenization and recentrifugation in 1 ml phosphate buffer. After resuspension in 200 µl buffer, 90 µl of the membrane homogenate were incubated for 4 h at 4 C with 10 µl [3H]-3Me-TRH (32 nCi; 0.4 pmol) in 45 mM Tris-HCl, 0.5 mM MgCl2, pH 7.4. For the determination of unspecific binding, this incubation mixture was supplemented with 40 pmol unlabeled TRH. Ice-cold sodium phosphate buffer (5 ml) was then added, and the assay mixture was filtered through Whatman GF-C glass fiber disks. The filters were successively washed three times with ice-cold phosphate buffer and then transferred to scintillation vials. After addition of 1 ml sodium citrate buffer (100 mM; pH 2.5) and incubation at RT for 20 min (to release the membrane-bound tracer), 10 ml scintillation cocktail were added before radioactivity was measured by a scintillation counter.
Northern Blot
For each experimental group pituitary samples from more than 10 animals were pooled and homogenized. Polyadenylated (poly-A) RNA was isolated using oligo(deoxythymidine) Dynabeads (Deutsche DynAl, Hamburg, Germany) as suggested by the supplier. RNA samples were size fractionated on a denaturing formaldehyde-agarose gel, capillary transferred to Hybond XL membrane (Amersham Bioscience), and analyzed under high stringency conditions. The probe for TRH-R1 (GenBank accession no. NM_013696) was generated by PCR using cDNA from mouse pituitaries. The cDNA probe was labeled with [
-32P]deoxy-CTP using random primers. Hybridization was carried out at 42 C in UltraHyb solution (Ambion, Inc., Austin, TX). After extensive washing to final stringencies of 0.2x SSPE [0.15 M NaCl, 0.01 M sodium phosphate, and 1 mM EDTA (pH 7.4)]/0.3% sodium dodecyl sulfate for 30 min at 59 C, signals were detected by exposure to x-ray film.
Real-Time PCR
Polyadenylated (poly-A) RNA was isolated from mouse pituitaries as described above. cDNA was generated with the Invitrogen Thermoscript RT-PCR System (Invitrogen, San Diego, CA) and digested with RNAse as suggested by the supplier. Quantitative real-time PCR was performed by using the iCycler iQ Multi-Color Real-time PCR Detection System and the iQ SYBR Green Supermix (Bio-Rad, Munich, Germany). Cyclophilin was used as housekeeping gene for normalization. The following primers were chosen to generate the PCR fragment:
Cyclophilin: GCAAGGATGGCAAGGATTGA and agcaattctgcctggatagc
ßTSH: CCGCACCATGTTACTCCTTA and gttctgacagcctcgtgtat
PRL: GCAGTCACCATGACCATGAA and agattggcagaggctgaaca
GH: CGCTTCTCGCTGCTGCTCAT and gtccgaggtgccgaacatca
In Vitro Transcription
Radioactive- or digoxigenin-labeled RNA probes were generated from cDNA subclones in Bluescript SKII+ plasmids or pGEM-plasmids (Promega, Mannheim, Germany). In vitro transcription was carried out according to standard protocols with [35S]UTP and [35S]CTP as labeled nucleotides (nt) (56) or by using a DIG RNA Labeling Kit (Boehringer, Mannheim, Germany). Probes were generated from cDNA fragments corresponding to nt 190445 (GenBank accession no. M10902) of ßTSH, nt 248445 (GenBank accession no. U62779) of GH, nt 15661749 (GenBank accession no. J00769) of PRL and nt 245488 (GenBank accession no. M94384) of TRH-R1. cRNA probes were diluted in hybridization buffer (50% formamide; 10% dextran sulfate; 0.6 M NaCl; 10 mM Tris-HCl, pH 7.4; 1x Denhardts solution; 100 µg/ml sonicated salmon sperm DNA; 1 mM EDTA; and 10 mM dithiothreitol) to a final concentration of 5 x 104 cpm/µl for radioactive- and 5 ng/µl for digoxygenin-labeled probes.
In Situ Hybridization
After the animals were decapitated, pituitaries were removed rapidly, embedded in Tissue-Tek medium (Sakura Finetek, Torrance, CA) and frozen on dry ice. Sections (16 µm) were cut on a cryostat (Leica, Bentheim, Germany), thaw mounted on silane-treated slides, and stored at 80 C until further processing. In situ hybridization histochemistry was carried out as described previously (57). Briefly, frozen sections were fixed in a 4% phosphate-buffered paraformaldehyde solution (pH 7.4) for 1 h at RT, rinsed with PBS, and treated with 0.4% phosphate-buffered Triton X-100 solution for 10 min. After washing with PBS and water, tissue sections were incubated in 0.1 M triethanolamine (pH 8) containing 0.25% (vol/vol) acetic anhydride for 10 min. After acetylation, sections were rinsed several times with PBS, dehydrated by successive washing with increasing ethanol concentrations, and air dried.
After application of the labeled cRNA probes, sections were coverslipped and incubated in a humid chamber at 58 C for 16 h. After hybridization, coverslips were removed in 2x standard saline citrate (SSC: 0.3 M NaCl; 0.03 M sodium citrate, pH 7.0). The sections were then treated with RNAse A (20 µg/ml) and RNAse T1 (1 U/ml) at 37 C for 30 min. Successive washes followed at RT in 1x, 0.5x, and 0.2x SSC for 20 min each and in 0.2x SSC at 65 C for 1 h. For digoxygenin-labeled probes, sections were rinsed with P1 (100 mM Tris; 150 mM NaCl, pH 7.5) and then incubated for 2 h in blocking solution provided by the manufacturer of the kit. After incubation overnight with antidigoxigenin antibody conjugated with alkaline phosphatase (1:500 dilution; Boehringer) the tissue sections were washed with P1. Staining proceeded for 216 h in substrate solution containing nitroblue tetrazolium chloride (340 µg/ml; Biomol, Hamburg, Germany), X-Phosphate (5-bromo-4-chloro-3-indolyl phosphate, 175 µg/ml; Biomol), 100 mM Tris, 100 mM NaCl, and 50 mM MgCl2, pH 9.0.
For radioactive-labeled probes the tissue was dehydrated and exposed to Biomax MR Film (Eastman Kodak, Rochester, NY) for 48 h. For microscopic analysis, sections were dipped in Kodak NTB2 nuclear emulsion and stored at 4 C. After exposure for 10 d, autoradiograms were developed in Kodak D19 for 4 min and fixed in Kodak Rapid Fix for 4 min. The sections were then photographed under dark-field illuminations.
lacZ Staining
Frozen sections were fixed for 5 min in a 0.2% phosphate-buffered glutaraldehyde solution (pH 7.4) containing 5 mM EGTA and 2 mM MgCl2. ß-Galactosidase activity was detected with 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside (X-gal) under standard conditions, optionally followed by counterstaining with Nuclear Fast Red (Vector Laboratories, LINARIS GmbH, Wertheim-Bettinger, Germany).
Hormone Measurements
Serum T4 and T3 were determined by RIA as described in detail previously (44). The serum pituitary hormone levels were determined by the highly sensitive double-antibody method described recently (58) using the reagents provided by A. F. Parlow and the NIDDK National Hormone and Pituitary Program. For the TSH assay, highly purified rat TSH (AFP 11542B) was used as iodinated ligand, guinea pig antimouse TSH (AFP98991) was used as primary antibody, and mouse TSH (AFP51718MP) was used as reference preparation. For PRL, mouse PRL (AFP10777D) was used for iodination, rabbit antimouse PRL (AFP131078) was used as antiserum, and mouse PRL (AFP6476C) was used as reference preparation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: ES, Embryonic stem; nt, nucleotides; PRL, prolactin; RT, room temperature; TRH-R, TRH receptor.
Received for publication January 15, 2004. Accepted for publication February 20, 2004.
| REFERENCES |
|---|
|
|
|---|
-subunit, growth hormone, and prolactin messenger ribonucleic acids. Mol Endocrinol 1:408412This article has been cited by other articles:
![]() |
R. Parmentier, S. Kolbaev, B. P. Klyuch, D. Vandael, J.-S. Lin, O. Selbach, H. L. Haas, and O. A. Sergeeva Excitation of Histaminergic Tuberomamillary Neurons by Thyrotropin-Releasing Hormone J. Neurosci., April 8, 2009; 29(14): 4471 - 4483. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee What Can We Learn from Rodents about Prolactin in Humans? Endocr. Rev., February 1, 2008; 29(1): 1 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hernandez, M. E. Martinez, X.-H. Liao, J. Van Sande, S. Refetoff, V. A. Galton, and D. L. St. Germain Type 3 Deiodinase Deficiency Results in Functional Abnormalities at Multiple Levels of the Thyroid Axis Endocrinology, December 1, 2007; 148(12): 5680 - 5687. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, B. A. Schimpf, A. D. Rohde, M. N. Pavlova, A. Gragerov, and J. E. Bergmann Thyrotropin-Releasing Hormone Receptor 1-Deficient Mice Display Increased Depression and Anxiety-Like Behavior Mol. Endocrinol., November 1, 2007; 21(11): 2795 - 2804. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Jones, G. J. Song, E. K. Greuber, and P. M. Hinkle Phosphorylation of the Endogenous Thyrotropin-releasing Hormone Receptor in Pituitary GH3 Cells and Pituitary Tissue Revealed by Phosphosite-specific Antibodies J. Biol. Chem., April 27, 2007; 282(17): 12893 - 12906. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ao, V. L. W. Go, N. Toy, T. Li, Y. Wang, M. K. Song, J. R. Reeve Jr., Y. Liu, and H. Yang Brainstem Thyrotropin-Releasing Hormone Regulates Food Intake through Vagal-Dependent Cholinergic Stimulation of Ghrelin Secretion Endocrinology, December 1, 2006; 147(12): 6004 - 6010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yamada, N. Shibusawa, S. Ishii, K. Horiguchi, R. Umezawa, K. Hashimoto, T. Monden, T. Satoh, J. Hirato, and M. Mori Prolactin Secretion in Mice with Thyrotropin-Releasing Hormone Deficiency Endocrinology, May 1, 2006; 147(5): 2591 - 2596. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Jones and P. M. Hinkle {beta}-Arrestin Mediates Desensitization and Internalization but Does Not Affect Dephosphorylation of the Thyrotropin-releasing Hormone Receptor J. Biol. Chem., November 18, 2005; 280(46): 38346 - 38354. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |