help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0017
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rabeler, R.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rabeler, R.
Right arrow Articles by Bauer, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LEVOTHYROXINE
*LIOTHYRONINE
Molecular Endocrinology 18 (6): 1450-1460
Copyright © 2004 by The Endocrine Society

Generation of Thyrotropin-Releasing Hormone Receptor 1-Deficient Mice as an Animal Model of Central Hypothyroidism

Roland Rabeler, Jens Mittag, Lars Geffers, Ulrich Rüther, Michael Leitges, Albert F. Parlow, Theo J. Visser and Karl Bauer

Max-Planck-Institut für experimentelle Endokrinologie (J.M., R.R., L.G., M.L., K.B.), D-30625 Hannover, Germany; Heinrich-Heine Universität (U.R.), D-40225 Düsseldorf, Germany; National Hormone & Peptide Program (A.F.P.), Torrance, California 90509; and Department of Internal Medicine (T.J.V.), Erasmus University Medical School, NL-3000 DR Rotterdam, The Netherlands

Address all correspondence and requests for reprints to: Karl Bauer, Max-Planck-Institut für experimentelle Endokrinologie, Feodor-Lynen-Strasse 7, D-30625 Hannover, Germany. E-mail: karl.bauer{at}mpihan.mpg.de.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
To provide an animal model of central hypothyroidism, mice deficient in the TRH-receptor 1 (TRH-R1) gene were generated by homologous recombination. The pituitaries of TRH-R1–/– mice are devoid of any TRH-binding capacity, demonstrating that TRH-R1 is the only receptor localized on TRH target cells of the pituitary. With the exception of some retardation in growth rate, TRH-R1–/– mice appear normal, but compared with control animals they exhibit a considerable decrease in serum T3, T4, and prolactin (PRL) levels but not in serum TSH levels. In situ hybridization histochemistry and real-time RT-PCR analysis revealed that in adult TRH-R1–/– animals TSHß-mRNA expression is not impaired whereas PRL mRNA and GH mRNA levels are considerably reduced compared with control mice. The numbers of thyrotropes, somatotropes, and lactotropes, however, are not affected by the deletion of the TRH-R1 gene. The mutant mice are fertile, and the dams nourish their pups well, indicating that TRH is not a decisive factor for suckling-induced PRL release. In situ hybridization and quantitative RT-PCR analysis, furthermore, revealed that, as in control animals, pituitary PRL-mRNA expression in TRH-R1–/– is considerably increased during lactation, albeit strongly reduced as compared with lactating control animals.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TRH WAS ISOLATED as the first hypothalamic hypophysiotropic neuropeptide hormone and identified as the tripeptideamide pyro-Glu-His-Pro-NH2 (for review see Refs.1 and 2). As the name implies, this peptide stimulates the secretion of TSH from the anterior pituitary. Subsequent studies in man (3) and with cultured rat pituitary tumor cells (GH3 cells) (4) then demonstrated TRH to be equally effective as a prolactin (PRL) secretagog, whereby PRL release precedes the release of TSH. In addition, TRH is found in many peripheral organs, including the gastrointestinal tract, pancreatic islands, and the reproductive system. In brain, TRH is not only confined to the thyrotropic area of the hypothalamus but widely distributed throughout the central nervous system where it elicits a plethora of effects. A wealth of biochemical, electrophysiological, pharmacological, and behavioral studies strongly suggest that in this tissue TRH may act as a neuromodulator and/or neurotransmitter (for review see Refs.5, 6, 7).

At TRH target sites the peptidergic signal is transduced by two receptors that have been identified so far. TRH receptor 1 (TRH-R1) was originally cloned from a mouse pituitary cDNA library in 1990 (8) whereas TRH-R2 was cloned more recently from a rat brain cDNA library (9, 10). Both receptors belong to the family of G-protein-coupled receptors acting via the inositol phospholipid-calcium-protein kinase C signal transduction pathway. In brain, a distinct and complementary distribution of both receptors has been demonstrated by in situ hybridization histochemistry (11). TRH-R2 mRNA is widely distributed and strongly expressed in brain areas, such as the cerebral and cerebellar cortex, thalamus, medial habenulae, medial geniculate nucleus, pontine nuclei, and reticular formation, that are important for the transmission of somatosensory signals and higher central nervous system functions. In contrast, TRH-R1 mRNA is predominantly expressed in neuroendocrine brain regions (e.g. paraventricular hypothalamic nucleus, arcuate nucleus, anterior hypothalamic nucleus), the autonomic nervous system, and visceral brainstem regions. In the pituitary, only TRH-R1 is expressed; TRH-R2 transcripts are not detectable (11).

Tight regulation of the TRH signal is of paramount importance to control the synthesis and release of TSH and thus plays a pivotal role in the regulation of the hypothalamic-pituitary-thyroid axis. As in tertiary hypothyroidism, which is due to hypothalamic damage or defects, secondary hypothyroidism resulting from pituitary insufficiency leads to the same clinical manifestation, namely insufficient TSH secretion in the presence of low levels of thyroid hormones, a condition collectively designated as central hypothyroidism (12). Moreover, as in other cases of impaired hypothalamic-pituitary signaling [e.g. hypoplasia of somatotropes observed in the GHRH receptor-deficient lit/lit dwarf mice (13) or hypogonadism due to the inactivation of the GnRH gene (14)] disruption of the TRH signaling pathway may conceivably also affect the development of the pituitary. In fact, after administrating TRH to rat dams, stimulation of fetal pituitary and thyroid functions has been observed (15, 16). With embryonic pituitaries in culture it has also been reported that TRH influences rat pituitary cell type differentiation (17). However, embryonic development of pituitary thyrotropes independent of hypothalamic TRH was found in anencephalic human fetus that showed normal TSH levels (18, 19). Consistent with this report, recent studies with TRH-deficient mice mutants also indicated that TRH is not essential for fetal thyrotrope development. Remarkably, however, these studies also indicated that postnatally, TRH is required for normal thyrotrope function (20, 21). To the contrary, in a patient suffering from central hypothyroidism due to inactivating mutations in the TRH-R1 gene (22), TSH levels at birth and the age of 8.9 yr were within normal values. This has been taken as an indication that TRH deficiency is distinguishable from TRH receptor dysfunction (20). So far, unfortunately, there has not been an animal model available to study the effect of TRH-R1 deficiency on pituitary development and maintenance of proper pituitary function. In this study we describe the generation of a mouse mutant deficient in TRH-R1 and report on the effect of this mutation on pituitary function.


    Experimental Animals
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animal procedures were approved by the animal welfare committee of the Medizinische Hochschule Hannover. Mice were kept at a constant temperature (22 C) and light cycle (12-h light, 12-h dark) and were provided with standard laboratory chow and tap water ad libitum. Animals were killed by decapitation, and tissues were isolated quickly, frozen in liquid nitrogen, and stored at –80 C until further processing. Trunk blood was collected and serum was obtained by centrifugation and stored at –80 C.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of TRH-R1 Loss-of-Function Mutant Mice
As depicted in Fig. 1AGo, the targeting vector was designed to delete exon 2 at the transcriptional start site ATG, as well as exon 3, 4, and part of exon 5 corresponding to the complete coding region. These exons were replaced by the ß-galactosidase gene and the neomycin-resistance gene. Of the stably transfected embryonic stem (ES) clones obtained after antibiotic selection, homologous recombinants were identified by Southern analysis. Male chimeras generated by blastula injection were bred with NMRI females with successful germ line transmission. The heterozygotes (TRH-R1+/–) were apparently normal and subsequently gave rise to mice homozygous (TRH-R1–/–) for the mutant TRH-R1 locus with the expected frequency, indicating that the deletion of the TRH-R1 gene did not result in embryonic lethality. After crossing male TRH-R1–/– mice with C57BL/6 females, animals in the F5 generation were used for the experiments.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Generation and Analysis of TRH-R1-Deficient Mice

A, Schematic diagram of the strategy used to target the mouse TRH-R1 locus. The structure of the endogenous murine TRH-R1 gene is shown in the center panel (wild-type allele) and that of the targeting construct is shown above (targeting vector). Thin horizontal lines represent mouse genomic DNA; thick lines represent genomic sequences incorporated into the targeting vector. The translation initiation and stop codons are indicated. Exons are represented by either stippled (untranslated regions), or black (open reading frame) boxes. Open boxes show the Rous sarcoma virus-neo selection cassette and the coding region of the bacterial lacZ gene, with arrows indicating the orientation of transcription. The PGK-tk cassette is illustrated by a dotted line. The disrupted allele is shown at the bottom (targeted allele). The 370-bp BglII-HindIII fragment (open triangle) used to identify the diagnostic 14.6-kb and 11.2-kb EcoR1 fragments (doubleheaded arrows) in genomic Southern blots is also indicated. Abbreviations: B, BglII; H, HindIII; E, EcoRI; S, StuI; pA, polyadenylation site. B, Southern blot analysis of genomic DNA. C, Northern blot analysis of pituitary TRH-R1 transcripts in wild-type, and TRH-R1–/– mice. D, Genotyping results of a multiplex PCR assay performed on genomic DNA.

 
The animals were analyzed by Southern (Fig. 1BGo) and Northern (Fig. 1CGo) blotting and by PCR (Fig. 1DGo) using the primers described in Materials and Methods.

Initial Characterization of TRH-R1–/– Mice
Male and female fertility in the TRH-R1–/– mice appeared to be normal, but litter size was slightly affected; mean litter sizes in 28 wild-type and 26 TRH-R1–/– pregnancies were 7.18 ± 1.81 and 6.07 ± 1.89, respectively. There was no difference in body weight at birth. Irrespective of the genotype of the mothers, the pups of both genotypes developed at a comparable rate up to the age of 16 d. Moreover, when nourished by NMRI foster mothers, there was also no difference in the growth rate of wild-type and TRH-R1–/– pups up to postnatal d 16. Thereafter, however, around the time of weaning at postnatal d 20 and up to the age of 12 wk, the growth of the TRH-R1–/– male (Fig. 2Go) and female animals (data not shown) was clearly reduced compared with wild-type animals. By cross-breeding, the TRH-R1 gene was also deleted in 129/Sv and NMRI mice. The growth rate of these TRH-R1–/– mice was affected comparably to that of C57/B6 mice with the deleted TRH-R1 gene, indicating that this effect is not due to strain differences. A difference in the growth rate could not be observed between wild-type and heterozygous (TRH-R1+/–) animals. In bedded cages with nesting material, TRH-R1–/– mice (12 wk old) were also able to survive exposure to the cold (4 C) for the 3 d tested.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Growth Curves of Wild-Type and TRH-R1–/– Male Mice Nourished by Mothers of the Same Genotype

Eight litters, each with six pups, were used for analysis.

 
Serum Hormone Analysis
As expected and indicated by the retarded growth, TRH-R1–/– mice are hypothyroid (Table 1Go). T4 and T3 serum levels were both reduced by a factor of 3 in adult homozygous TRH-R1–/– mice compared with wild-type animals, whereas the thyroid hormone levels in heterozygotes were not different from those in wild-type mice (data not shown). As in clinical cases of central hypothyroidism, the TSH serum values are not significantly different between wild-type and knockout animals, whereas (in accordance with the literature) the TSH values in male mice were about twice as high as in female animals. In contrast, PRL serum levels were severely affected, especially in female animals. PRL serum values in adult TRH-R1–/– female mice reached only 13% of wild-type PRL levels, whereas in adult TRH-R1–/– males, PRL levels were moderately reduced by 37% compared with wild-type male mice.


View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of Serum Hormones

 
Analysis of TRH-R1 and lacZ Expression in Pituitaries of Mutant and Wild-Type Mice
In addition to the analysis by techniques of molecular biology, deletion of TRH-R1 protein in TRH-R1–/– mice pituitaries could be confirmed by TRH-binding studies (Fig. 3AGo). Specific binding was observed with pituitary membrane preparations from wild-type animals, whereas with the membrane preparations from TRH-R1 knockout animals only unspecific binding of the radiolabeled TRH agonist was detectable. This result demonstrates that TRH-R1 is the only TRH-receptor localized on hypophyseal target cells.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. Pituitary Analysis

A, Binding capacity of [3H]-3Me-TRH to hypophyseal membrane preparations was performed as described in Materials and Methods. Bars indicate the mean ± SD of values obtained from six wild-type pools and three knockout pools, each containing five pituitaries. B, Analysis of TRH-R1 mRNA expression in pituitaries of 12-wk-old male wild-type, TRH-R1+/–, and TRH-R1–/– mice by in situ hybridization histochemistry. C, lacZ staining in pituitaries of 12-wk-old male wild-type, TRH-R1+/–, and TRH-R1–/– mice.

 
For further analysis the expression of TRH-R1 mRNA was studied by in situ hybridization histochemistry. In agreement with the function of TRH as a TSH and PRL secretogog, a considerable number of cells expressing TRH-R1 transcripts were observed in wild-type animals and a comparable expression pattern was found in the heterozygous TRH-R1+/– mice (Fig. 3B). Pituitaries from homozygous TRH-R1–/– animals were completely devoid of any hybridization signal for TRH-R1, underlying the specificity of the hybridization experiments. Conversely, lacZ staining was not found in the pituitaries of wild-type mice but was easily detected in the pituitaries of TRH-R1+/– and TRH-R1–/– animals (Fig. 3CGo). In the pituitaries of the TRH-R1+/– mice the density of the lacZ staining cells compared well with the number of TRH-R1 mRNA-expressing cells as detected by in situ hybridization. Interestingly, there was no difference in the number of pituitary cells expressing lacZ between TRH-R1+/– and TRH-R1–/– mice, indicating that the number of pituitary TRH target cells is not affected by the complete deletion of the TRH-R1 gene.

Analysis of Pituitary Hormone Expression
The mRNA expression for the pituitary hormones TSH, PRL, and GH was analyzed by in situ hybridization histochemistry. In agreement with the unchanged TSH serum levels, the pituitaries of wild-type and TRH-R1–/– mice exhibited comparable TSHß-mRNA expression patterns (Fig. 4Go). In contrast, the intensity of PRL transcript signals was greatly reduced in pituitaries of female (Fig. 4Go) and male (data not shown) animals compared with wild-type animals. However, the number of PRL mRNA expressing cells was not significantly reduced. The same pattern was found for GH mRNA expression (Fig. 4Go). As expected from the hypothyroid condition of the TRH-R1 knockout animals, expression of GH mRNA was significantly reduced in TRH-R1–/– mice compared with control animals, but the number of GH mRNA-expressing cells was not affected.



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 4. Analysis of ß-TSH, PRL, and GH mRNA Expression by in Situ Hybridization Histochemistry Using Pituitaries of 12-wk-old Female Wild-Type and TRH-R1–/– Mice

 
Developmental Analysis
The development of pituitary hormone expression was followed by quantitative real-time PCR (Fig. 5Go). These data were essentially confirmed by Northern blot analysis (data not shown). For TSH we observed a very surprising expression pattern. In control animals at the age of 2 wk, TSHß-mRNA expression was very high compared with later stages of development. Furthermore, TSHß-mRNA expression in the pituitaries of female wild-type mice was higher than in male animals, a significant difference that was not observed in older animals. In addition, at 2 and 4 wk of age, TSHß-mRNA expression was significantly reduced in the TRH-R1 knockouts of both genders. This difference was also not observed in older animals.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5. Quantification of ß-TSH, PRL, and GH mRNA Levels by Real-Time RT-PCR

The ratios of the transcript levels of the hormones and the cyclophilin mRNA levels are presented in arbitrary units. (*, P < 0.05; **, P < 0.005; ***, P < 0.001).

 
As expected, PRL expression was very low at 2 wk and increased progressively with age, more so in female than in male control animals. In the TRH-R1–/– mice of both sexes, PRL expression also increased with age but was significantly reduced compared with control animals. For GH, we also observed the expected age-dependent increase in mRNA levels with higher levels in male compared with female animals. Essentially the same pattern was observed in TRH-R1–/– mice but GH transcript levels were significantly lower than in wild-type animals. This decrease is most likely explained by the hypothyroidism of these animals: when 12-wk-old male TRH-R1 knockout mice were treated for 4 d by injecting daily a supplementary dose of 13 ng T4 per g body weight (to reach thyroid hormone levels of euthyroid animals), the GH mRNA levels significantly increased, whereas PRL levels were not affected and TSHß transcript levels were considerably reduced (data not shown).

PRL Expression during Lactation
Despite the low PRL serum levels and the decreased PRL mRNA levels, female TRH-R1–/– mice became readily pregnant and, as can be seen from the growth curve shown in Fig. 2Go, they obviously nourished their pups well. Analysis by in situ hybridization (Fig. 6Go, upper panel) and by quantitative real-time PCR (Fig. 6Go, lower panel) revealed that in TRH-R1–/– mice as in wild-type animals, pituitary PRL mRNA expression significantly increased during lactation compared with the nonlactating state of these animals. During lactation, an increase by a factor of 1.6 was observed in wild-type animals, and an increase by a factor of 3.3 was found in TRH-R1–/– mice. Nevertheless, in lactating TRH-R1 knockout mice, the PRL-mRNA expression levels were strongly reduced compared with those of lactating control animals.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of PRL mRNA Expression in Pituitaries of Lactating and Nonlactating Wild-Type and TRH-R1-Deficient Mice

Upper panel, Analysis of PRL mRNA expression by in situ hybridization histochemistry. Lower panel, Quantification of PRL transcript levels by real-time RT-PCR. The ratio of PRL and cyclophilin mRNA levels is presented in arbitrary units.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Central hypothyroidism, defined as low plasma total and free T4 concentrations in the presence of normal TSH values, is a rare disorder. The clinical manifestations of central hypothyroidism are usually mild (12). Indeed, the patient recently identified with inactivating mutations in the TRH-R1 gene (22) presented only symptoms of short stature and delayed bone maturation. Plasma T4 values were low and TSH levels were within the normal range, whereas PRL values were significantly below normal. With the exception of his short stature, the patient appeared normal; his clinical history was unremarkable.

Analysis of the mouse mutants, which we generated by targeted disruption of the TRH-R1 gene, revealed the same picture. In adult male and female mutants, total T4 and T3 serum levels were reduced by 60–70%, but the inactivation of the TRH-R1 gene did not affect adult TSH serum levels, neither in the female nor in the male mutants. Only the known sex differences in mice TSH levels (23, 24, 25) were noted. In contrast, the PRL serum levels were significantly reduced in the mutant compared with wild-type animals, moderately in male (by 37%) and drastically (by 87%) in female mutants.

As in the clinical cases of central hypothyroidism (26, 27, 28), in mouse thyrotropic tumors (29) and hypothyroid rat pituitaries (30), the apparently normal TSH levels in the hypothyroid TRH-R1–/– mice are most likely explained by the synthesis of biologically inactive TSH with decreased receptor binding due to the inappropriate glycosylation of TSH (31). It has been established that this defect in glycosylation and biological action can be corrected by TRH treatment (32). It remains to be shown whether the same explanation applies to the differences in the serum TSH levels of male and female mice (23, 24, 25).

As expected from the low thyroid hormone levels, the TRH-R1 knockout mice are clearly growth retarded. This is not surprising because it is well documented that GH transcription and synthesis are strongly reduced in rats rendered hypothyroid by PTU treatment or surgery (33, 34) as well as in congenital hypothyroid animal models such as the hyt/hyt (35), the {alpha}GSU–/– (36), and the Pax8–/– (37) mouse. Furthermore, thyroid hormones in rodents are known to be directly and positively involved in GH gene transcription (38, 39, 40, 41). Indeed, when TRH-R1–/– mice were treated with a supplementary dose of T4 for 4 d, GH transcription was significantly increased.

Whereas our data are in perfect agreement with those of the patient with inactivating mutations of the TRH-R1 gene and also fit well with the clinical data in most cases of central hypothyroidism, there are major differences when compared with TRH–/– mouse mutants. Despite a decrease (by 35%) in the number of thyrotropes, a decrease (by 65%) in pituitary TSH content and even a reduction in TSHß and TSH{alpha}-mRNA expression levels (to 79.1 ± 0.7% and 71.8 ± 5%, respectively; as assessed by Northern blot analysis), the TSH serum levels in TRH–/– mice were highly increased (by 83%) compared with wild-type controls (20, 21).

These increased TSH levels in TRH–/– mice were unexpected because TSH levels were reduced in mice in which TRH deficiency was acutely induced by hypothalamic destruction (electrolesion and knife-cut deafferentation) (42, 43). Corresponding to this, we observed in young TRH-R1–/– mice a strong reduction in TSH transcript levels. This decrease was most pronounced at the age of 2 wk when the serum T4 and T3 levels reach peak values (44) and the hypothalamic-hypophyseal communication system is finally established (45, 46). At this stage of development, however, the institution of the pituitary-thyroid feedback regulatory system still proceeds, a process characterized by a decrease in TSH response to TRH and by an increase in TSH sensitivity to T3 suppression (45). In accordance with these data, we observed that the reduction in TSH transcript levels in TRH-R1–/– mice diminishes with increasing age and at the age of 12 wk, the TSH transcript levels of TRH-R1–/– mice matches those of control animals. Thus, once firmly established in adult animals, the pituitary-thyroid regulatory system may conceivably operate, to a large extent, autonomously as the principal thyrostat as long as the conditions remain constant. During development and for the adjustment to altered conditions (e.g. adaptation to cold environment), however, hypothalamic TRH is required as the important central modulator for the dynamic regulation of TSH and thus thyroid hormone secretion.

As revealed by in situ hybridization histochemistry, the deletion of the TRH-R1 gene in adult TRH-R1–/– mice had no obvious effect on the number of TSHß-mRNA expressing cells or on the number of PRL-mRNA expressing cells. Thus, TRH-R1 is apparently required neither for the development nor the maintenance of both TRH target cells in the pituitary. Again, this is a significant difference to the TRH–/– mice in which TRH seems to be important for postnatal maintenance of TSH immunopositive cells although not required for the proliferation or differentiation of embryonic pituitary thyrotropes. Surprisingly, however, the number of PRL-producing cells is not reduced in TRH–/– mice (20, 21). When compared with other mouse mutants with defects in the hypothalamic-hypophyseal signaling system, it is interesting to note that in adult CRF and CRF-R1 knockout mice, the ACTH-producing cells are also not affected (47, 48), whereas GHRH-receptor-deficient lit/lit (13) and GnRH-deficient (hypogonadal, hpg) mice (14, 49) exhibit hypoplasia of somatotropes and gonadotropes, respectively.

With regard to GH and PRL expression levels, differences between TRH–/– and TRH-R1–/– mice are also quite evident. Despite their hypothyroidism, the serum GH levels of TRH–/– mice are not different from control values, whereas in the TRH-R1–/– animals the expression of GH mRNA is significantly reduced. Even more surprising is the fact that in TRH–/– mice, neither the serum PRL levels nor the PRL expression patterns differ from those of wild-type animals although TRH is known as a potent and robust PRL secretagog in all species tested in vivo and in vitro (3, 4, 50). As expected from these and other published data, the PRL mRNA expression levels and the serum PRL values are drastically reduced in TRH-R1–/– mice. The low expression levels are not unexpected because, unlike thyrotropes, lactotropes lack a feedback-regulatory system by a target hormone, and thus they cannot compensate via autoregulatory mechanisms.

Despite the low PRL levels, neither reproduction nor lactation was severely impaired in TRH-R1–/– mice. Although PRL levels are reduced in TRH-R1–/– compared with control mice, there is apparently enough PRL produced to promote in mammary alveoli the synthesis and secretion of milk proteins in sufficient amounts (for review see Refs.50, 51, 52). Furthermore, the fact that TRH-R1–/– mice nourish their pups well does not support the concept that suckling-induced PRL release is essentially mediated by TRH, a much debated issue for which supporting and contradictory experimental results have been reported (for review see Refs.51 and 53).

In summary, our results obtained from the analysis of TRH-R1–/– mice fit well with the clinical data in cases of central hypothyroidism, and they are in full agreement with the data reported from the patient with inactivating mutations of the TRH-R1 gene. Surprisingly, however, there are striking differences when TRH-R1–/– and TRH–/– mice are compared, indicating that tertiary hypothyroidism due to TRH deficiency might be distinguishable from secondary hypothyroidism due to pituitary TRH-receptor dysfunction. This notion is supported by some clinical reports (54) on patients with presumed hypothalamic hypothyroidism, although there are no patients in which isolated TRH deficiency has been defined. Because TRH is not only expressed in the thyrotropic paraventricular nucleus of the hypothalamus, but also in other hypothalamic brain areas, one explanation for the discrepancy might be that the deficiency of the signaling peptide TRH within the hypothalamus may affect other neuroendocrine communication systems, e.g. via the synthesis and/or release of somatostatin, GHRH, dopamine, and other factors. If this interpretation is correct, it will be very interesting to study with these mouse mutants the precise mechanisms underlying the different patterns of pituitary hormone secretion.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of the Targeting Replacement Vector and Generation of TRH-R1 Knockout Mice
Genomic clones spanning the entire mouse TRH-R1 gene were isolated by screening a BAC mouse genomic library (129/SvJ, Genome Systems Inc., St. Louis, MO) with probes derived from rat TRH-R1 cDNA specific for the second and fifth exon. The clones were characterized in detail by standard molecular biology techniques.

A 4.6-kb HindIII-HindIII DNA fragment including the first and part of the second exon and a 3.1-kb EcoRI-EcoRI DNA fragment including part of the fifth exon were subcloned into pBluescript KSII+ (Stratagene Europe, Amsterdam, The Netherlands). To enrich for homologous recombination events, the herpes simplex virus thymidine kinase gene was introduced. The flanking sequences and the negative selection cassette were further subcloned into the pGNA plasmid. The replacement vector finally contained 7.7 kb of homologous genomic DNA in which the complete coding region of the TRH-R1 gene was removed and replaced by a lacZ and Rous sarcoma virus-Neo cassette.

After electroporation, R1-ES cells (55) were selected by adding G418 (200 µg/ml) and gancyclovir (2 µM) to the medium. Homologous recombinant cell clones were identified by Southern blot analysis as described below. These ES cells were thus injected into 3.5-d-old NMRI blastocysts that were subsequently implanted into pseudopregnant recipients. The resulting chimeras were mated with NMRI females, and germline transmission of the mutant allele was identified by Southern blot analysis.

Genotype Determination
For DNA preparations, ES cells or mouse tails were incubated overnight at 60 C in extraction buffer (50 mM Tris-HCl, pH 8.0; 100 mM NaCl; 100 mM EDTA; 1% sodium dodecyl sulfate; 50 µg/ml Proteinase K).

Southern blot.
DNA (10 µg) was digested with EcoRI, size separated on a 0.8% agarose gel, and then capillary transferred to a nylon membrane (Hybond N, Amersham Bioscience, Braunschweig, Germany). The membranes were hybridized with {alpha} 32P-labeled 370 bp BglII-HindIII fragment specific for a region upstream of the first exon of the TRH-R1 gene that was not included in the targeting vector, and then washed twice at 60 C and once at 65 C in 20 mM sodium phosphate (pH 7.2) containing 1% sodium dodecyl sulfate. The signals were analyzed using a Fujix BAS 1000 phospho-imager (Fuji Photo Film Co., Ltd., Düsseldorf, Germany).

PCR.
Standard PCR assays were performed in 10 µl with 15 pmol of primer A and B and 5 pmol of primer C (A: TGAGTGTGGCTTGATTGG; B: GTGCTGTTGAAGCATCTG; C: GACTGTCCTGGCCGTAAC).

TRH Binding Assay
Five mouse pituitaries per genotype were homogenized in 500 µl sodium phosphate buffer (10 mM; pH 7.4) containing 0.04% NaN3. To inactivate TRH-degrading enzymes the homogenate was supplemented with 5 µM N-Cbz-Gly-Pro-diazomethyl ketone and 5 µM pyro-Glu-diazomethyl ketone and incubated on ice for 30 min. The homogenate was centrifuged for 10 min at 50,000 x g and the pellet was then washed by rehomogenization and recentrifugation in 1 ml phosphate buffer. After resuspension in 200 µl buffer, 90 µl of the membrane homogenate were incubated for 4 h at 4 C with 10 µl [3H]-3Me-TRH (32 nCi; 0.4 pmol) in 45 mM Tris-HCl, 0.5 mM MgCl2, pH 7.4. For the determination of unspecific binding, this incubation mixture was supplemented with 40 pmol unlabeled TRH. Ice-cold sodium phosphate buffer (5 ml) was then added, and the assay mixture was filtered through Whatman GF-C glass fiber disks. The filters were successively washed three times with ice-cold phosphate buffer and then transferred to scintillation vials. After addition of 1 ml sodium citrate buffer (100 mM; pH 2.5) and incubation at RT for 20 min (to release the membrane-bound tracer), 10 ml scintillation cocktail were added before radioactivity was measured by a scintillation counter.

Northern Blot
For each experimental group pituitary samples from more than 10 animals were pooled and homogenized. Polyadenylated (poly-A) RNA was isolated using oligo(deoxythymidine) Dynabeads (Deutsche DynAl, Hamburg, Germany) as suggested by the supplier. RNA samples were size fractionated on a denaturing formaldehyde-agarose gel, capillary transferred to Hybond XL membrane (Amersham Bioscience), and analyzed under high stringency conditions. The probe for TRH-R1 (GenBank accession no. NM_013696) was generated by PCR using cDNA from mouse pituitaries. The cDNA probe was labeled with [{alpha}-32P]deoxy-CTP using random primers. Hybridization was carried out at 42 C in UltraHyb solution (Ambion, Inc., Austin, TX). After extensive washing to final stringencies of 0.2x SSPE [0.15 M NaCl, 0.01 M sodium phosphate, and 1 mM EDTA (pH 7.4)]/0.3% sodium dodecyl sulfate for 30 min at 59 C, signals were detected by exposure to x-ray film.

Real-Time PCR
Polyadenylated (poly-A) RNA was isolated from mouse pituitaries as described above. cDNA was generated with the Invitrogen Thermoscript RT-PCR System (Invitrogen, San Diego, CA) and digested with RNAse as suggested by the supplier. Quantitative real-time PCR was performed by using the iCycler iQ Multi-Color Real-time PCR Detection System and the iQ SYBR Green Supermix (Bio-Rad, Munich, Germany). Cyclophilin was used as housekeeping gene for normalization. The following primers were chosen to generate the PCR fragment:

Cyclophilin: GCAAGGATGGCAAGGATTGA and agcaattctgcctggatagc

ßTSH: CCGCACCATGTTACTCCTTA and gttctgacagcctcgtgtat

PRL: GCAGTCACCATGACCATGAA and agattggcagaggctgaaca

GH: CGCTTCTCGCTGCTGCTCAT and gtccgaggtgccgaacatca

In Vitro Transcription
Radioactive- or digoxigenin-labeled RNA probes were generated from cDNA subclones in Bluescript SKII+ plasmids or pGEM-plasmids (Promega, Mannheim, Germany). In vitro transcription was carried out according to standard protocols with [35S]UTP and [35S]CTP as labeled nucleotides (nt) (56) or by using a DIG RNA Labeling Kit (Boehringer, Mannheim, Germany). Probes were generated from cDNA fragments corresponding to nt 190–445 (GenBank accession no. M10902) of ßTSH, nt 248–445 (GenBank accession no. U62779) of GH, nt 1566–1749 (GenBank accession no. J00769) of PRL and nt 245–488 (GenBank accession no. M94384) of TRH-R1. cRNA probes were diluted in hybridization buffer (50% formamide; 10% dextran sulfate; 0.6 M NaCl; 10 mM Tris-HCl, pH 7.4; 1x Denhardt’s solution; 100 µg/ml sonicated salmon sperm DNA; 1 mM EDTA; and 10 mM dithiothreitol) to a final concentration of 5 x 104 cpm/µl for radioactive- and 5 ng/µl for digoxygenin-labeled probes.

In Situ Hybridization
After the animals were decapitated, pituitaries were removed rapidly, embedded in Tissue-Tek medium (Sakura Finetek, Torrance, CA) and frozen on dry ice. Sections (16 µm) were cut on a cryostat (Leica, Bentheim, Germany), thaw mounted on silane-treated slides, and stored at –80 C until further processing. In situ hybridization histochemistry was carried out as described previously (57). Briefly, frozen sections were fixed in a 4% phosphate-buffered paraformaldehyde solution (pH 7.4) for 1 h at RT, rinsed with PBS, and treated with 0.4% phosphate-buffered Triton X-100 solution for 10 min. After washing with PBS and water, tissue sections were incubated in 0.1 M triethanolamine (pH 8) containing 0.25% (vol/vol) acetic anhydride for 10 min. After acetylation, sections were rinsed several times with PBS, dehydrated by successive washing with increasing ethanol concentrations, and air dried.

After application of the labeled cRNA probes, sections were coverslipped and incubated in a humid chamber at 58 C for 16 h. After hybridization, coverslips were removed in 2x standard saline citrate (SSC: 0.3 M NaCl; 0.03 M sodium citrate, pH 7.0). The sections were then treated with RNAse A (20 µg/ml) and RNAse T1 (1 U/ml) at 37 C for 30 min. Successive washes followed at RT in 1x, 0.5x, and 0.2x SSC for 20 min each and in 0.2x SSC at 65 C for 1 h. For digoxygenin-labeled probes, sections were rinsed with P1 (100 mM Tris; 150 mM NaCl, pH 7.5) and then incubated for 2 h in blocking solution provided by the manufacturer of the kit. After incubation overnight with antidigoxigenin antibody conjugated with alkaline phosphatase (1:500 dilution; Boehringer) the tissue sections were washed with P1. Staining proceeded for 2–16 h in substrate solution containing nitroblue tetrazolium chloride (340 µg/ml; Biomol, Hamburg, Germany), X-Phosphate (5-bromo-4-chloro-3-indolyl phosphate, 175 µg/ml; Biomol), 100 mM Tris, 100 mM NaCl, and 50 mM MgCl2, pH 9.0.

For radioactive-labeled probes the tissue was dehydrated and exposed to Biomax MR Film (Eastman Kodak, Rochester, NY) for 48 h. For microscopic analysis, sections were dipped in Kodak NTB2 nuclear emulsion and stored at 4 C. After exposure for 10 d, autoradiograms were developed in Kodak D19 for 4 min and fixed in Kodak Rapid Fix for 4 min. The sections were then photographed under dark-field illuminations.

lacZ Staining
Frozen sections were fixed for 5 min in a 0.2% phosphate-buffered glutaraldehyde solution (pH 7.4) containing 5 mM EGTA and 2 mM MgCl2. ß-Galactosidase activity was detected with 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside (X-gal) under standard conditions, optionally followed by counterstaining with Nuclear Fast Red (Vector Laboratories, LINARIS GmbH, Wertheim-Bettinger, Germany).

Hormone Measurements
Serum T4 and T3 were determined by RIA as described in detail previously (44). The serum pituitary hormone levels were determined by the highly sensitive double-antibody method described recently (58) using the reagents provided by A. F. Parlow and the NIDDK National Hormone and Pituitary Program. For the TSH assay, highly purified rat TSH (AFP 11542B) was used as iodinated ligand, guinea pig antimouse TSH (AFP98991) was used as primary antibody, and mouse TSH (AFP51718MP) was used as reference preparation. For PRL, mouse PRL (AFP10777D) was used for iodination, rabbit antimouse PRL (AFP131078) was used as antiserum, and mouse PRL (AFP6476C) was used as reference preparation.


    ACKNOWLEDGMENTS
 
We thank Dr. H. Heuer for helpful suggestions and critical discussions; Dr. H. Le Mouellic, Institut Pasteur, Paris, France for the pGNA plasmid; Dr. A. Nagy, Mount Sinai Hospital, Toronto, Canada for ES cells; V. Ashe for linguistic help and typing the manuscript; M. Kraus and B. Weinhold for technical assistance; and H. O. Bader and N. Naujokat for animal care.


    FOOTNOTES
 
R.R., J.M., and L.G. contributed equally to this work and should all be considered as first authors.

Abbreviations: ES, Embryonic stem; nt, nucleotides; PRL, prolactin; RT, room temperature; TRH-R, TRH receptor.

Received for publication January 15, 2004. Accepted for publication February 20, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 Experimental Animals
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Guillemin R 1978 Peptides in the brain: the new endocrinology of the neuron. Science 202:390–402[Free Full Text]
  2. Schally AV 1978 Aspects of hypothalamic regulation of the pituitary gland. Science 202:18–28[Free Full Text]
  3. Jacobs LS, Snyder PJ, Wilber JF, Utiger RD, Daughaday WH 1971 Increased serum prolactin after administration of synthetic thyrotropin releasing hormone (TRH) in man. J Clin Endocrinol Metab 33:996–998[Abstract/Free Full Text]
  4. Tashjian Jr AH, Barowsky NJ, Jensen DK 1971 Thyrotropin releasing hormone: direct evidence for stimulation of prolactin production by pituitary cells in culture. Biochem Biophys Res Commun 43:516–523[CrossRef][Medline]
  5. Yarbrough GG 1979 On the neuropharmacology of thyrotropin releasing hormone (TRH). Prog Neurobiol 12:291–312[CrossRef][Medline]
  6. Morley JE 1981 Neuroendocrine control of thyrotropin secretion. Endocr Rev 2:396–436[Abstract/Free Full Text]
  7. Horita A 1998 An update on the CNS actions of TRH and its analogs. Life Sci 62:1443–1448[CrossRef][Medline]
  8. Straub RE, Frech GC, Joho RH, Gershengorn MC 1990 Expression cloning of a cDNA encoding the mouse pituitary thyrotropin-releasing hormone receptor. Proc Natl Acad Sci USA 87:9514–9518[Abstract/Free Full Text]
  9. Cao J, O’Donnell D, Vu H, Payza K, Pou C, Godbout C, Jakob A, Pelletier M, Lembo P, Ahmad S, Walker P 1998 Cloning and characterization of a cDNA encoding a novel subtype of rat thyrotropin-releasing hormone receptor. J Biol Chem 273:32281–32287[Abstract/Free Full Text]
  10. Itadani H, Nakamura T, Itoh J, Iwaasa H, Kanatani A, Borkowski J, Ihara M, Ohta M 1998 Cloning and characterization of a new subtype of thyrotropin-releasing hormone receptors. Biochem Biophys Res Commun 250:68–71[CrossRef][Medline]
  11. Heuer H, Schaefer MK-H, O’Donnell D, Walker P, Bauer K 2000 Expression of thyrotropin-releasing hormone receptor 2 (TRH-R2) in the central nervous system of rats. J Comp Neurol 428:319–336[CrossRef][Medline]
  12. Martino E, Bartalena L, Faglia G, Pinchera A 1996 Central hypothyroidism. In: Braverman LE, Utiger RD, eds. The thyroid. Philadelphia: Lippincott-Raven; 779–791
  13. Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, Rosenfeld MG 1993 Molecular basis of the little mouse phenotype and implications for cell type-specific growth. Nature 364:208–213[CrossRef][Medline]
  14. Mason AJ, Hayflick JS, Zoeller RT, Young III WS, Phillips HS, Nikolics K, Seeburg PH 1986 A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science 234:1366–1371[Abstract/Free Full Text]
  15. Kojima A, Hershman JM 1974 Effects of thyrotropin-releasing hormone (TRH) in maternal, fetal and newborn rats. Endocrinology 94:1133–1138[Abstract/Free Full Text]
  16. D’Angelo SA, Wall NR 1972 Maternal-fetal endocrine interrelations: effects of synthetic thyrotrophin releasing hormone (TRH) on the fetal pituitary-thyroid system of the rat. Neuroendocrinology 9:197–206[Medline]
  17. Heritier AG, Dubois PM 1993 Influence of thyroliberin on the rat pituitary cell type differentiation: an in vitro study. Endocrinology 132:634–639[Abstract/Free Full Text]
  18. Kaplan SL, Grumbach MM, Aubert ML 1976 The ontogenesis of pituitary hormones and hypothalamic factors in the human fetus: maturation of central nervous system regulation of anterior pituitary function. Recent Prog Horm Res 32:161–243
  19. Grasso S, Filetti S, Mazzone D, Pezzino V, Vigo R, Vigneri R 1980 Thyroid-pituitary function in eight anencephalic infants. Acta Endocrinol (Copenh) 93:396–401[Abstract/Free Full Text]
  20. Yamada M, Saga Y, Shibusawa N, Hirato J, Murakami M, Iwasaki T, Hashimoto K, Satoh T, Wakabayashi K, Taketo MM, Mori M 1997 Tertiary hypothyroidism and hyperglycemia in mice with targeted disruption of the thyrotropin-releasing hormone gene. Proc Natl Acad Sci USA 94:10862–10867[Abstract/Free Full Text]
  21. Shibusawa N, Yamada M, Hirato J, Monden T, Satoh T, Mori M 2000 Requirement of thyrotropin-releasing hormone for the postnatal functions of pituitary thyrotrophs: ontogeny study of congenital tertiary hypothyroidism in mice. Mol Endocrinol 14:137–146[Abstract/Free Full Text]
  22. Collu R, Tang J, Castagne J, Lagace G, Masson N, Huot C, Deal C, Delvin E, Faccenda E, Eidne KA, Van Vliet G 1997 A novel mechanism for isolated central hypothyroidism: inactivating mutations in the thyrotropin-releasing hormone receptor gene. J Clin Endocrinol Metab 82:1561–1565[Abstract/Free Full Text]
  23. Visser TJ, van Haasteren GA, Linkels E, Kaptein E, van Toor H, de Greef WJ 1996 Gender-specific changes in thyroid hormone-glucuronidating enzymes in rat liver during short-term fasting and long-term food restriction. Eur J Endocrinol 135:489–497[Abstract/Free Full Text]
  24. Zhu XG, Kaneshige M, Parlow AF, Chen E, Hunziker RD, McDonald MP, Cheng SY 1999 Expression of the mutant thyroid hormone receptor PV in the pituitary of transgenic mice leads to weight reduction. Thyroid 9:1137–1145[Medline]
  25. Santini F, Hurd RE, Lee B, Chopra IJ 1994 Sex-related differences in iodothyronine metabolism in the rat: evidence for differential regulation among various tissues. Metabolism 43:793–797[CrossRef][Medline]
  26. Faglia G, Bitensky L, Pinchera A, Ferrari C, Paracchi A, Beck-Peccoz P, Ambrosi B, Spada A 1979 Thyrotropin secretion in patients with central hypothyroidism: evidence for reduced biological activity of immunoreactive thyrotropin. J Clin Endocrinol Metab 48:989–998[Abstract/Free Full Text]
  27. Spitz IM, Le Roith D, Hirsch H, Carayon P, Pekonen F, Liel Y, Sobel R, Chorer Z, Weintraub B 1981 Increased high-molecular-weight thyrotropin with impaired biologic activity in a euthyroid man. N Engl J Med 304:278–282[Medline]
  28. Beck-Peccoz P, Amr S, Menezes-Ferreira MM, Faglia G, Weintraub BD 1985 Decreased receptor binding of biologically inactive thyrotropin in central hypothyroidism. Effect of treatment with thyrotropin-releasing hormone. N Engl J Med 312:1085–1090[Abstract]
  29. Pekonen F, Carayon P, Amr S, Weintraub BD 1981 Heterogeneous forms of thyroid-stimulating hormone in mouse thyrotropic tumor and serum: differences in receptor-binding and adenylate cyclase-stimulating activity. Horm Metab Res 13:617–620[Medline]
  30. Taylor T, Weintraub BD 1985 Thyrotropin (TSH)-releasing hormone regulation of TSH subunit biosynthesis and glycosylation in normal and hypothyroid rat pituitaries. Endocrinology 116:1968–1976[Abstract/Free Full Text]
  31. Weintraub BD, Stannard BS, Meyers L 1983 Glycosylation of thyroid-stimulating hormone in pituitary tumor cells: influence of high mannose oligosaccharide units on subunit aggregation, combination, and intracellular degradation. Endocrinology 112:1331–1345[Abstract/Free Full Text]
  32. Weintraub BD, Gesundheit N, Taylor T, Gyves PW 1989 Effect of TRH on TSH glycosylation and biological action. Ann NY Acad Sci 553:205–213[Medline]
  33. Mirell CJ, Yanagisawa M, Lau R, Pekary AE, Chin WW, Hershman JM 1987 Influence of thyroidal status on pituitary content of thyrotropin ß- and {alpha}-subunit, growth hormone, and prolactin messenger ribonucleic acids. Mol Endocrinol 1:408–412[Abstract/Free Full Text]
  34. Samuels MH, Wierman ME, Wang C, Ridgway EC 1989 The effect of altered thyroid status on pituitary hormone messenger ribonucleic acid concentrations in the rat. Endocrinology 124:2277–2282[Abstract/Free Full Text]
  35. Biesiada E, Adams PM, Shanklin DR, Bloom GS, Stein SA 1996 Biology of the congenitally hypothyroid hyt/hyt mouse. Adv Neuroimmunol 6:309–346[Medline]
  36. Stahl JH, Kendall SK, Brinkmeier ML, Greco TL, Watkins-Chow DE, Campos-Barros A, Lloyd RV, Camper SA 1999 Thyroid hormone is essential for pituitary somatotropes and lactotropes. Endocrinology 140:1884–1892[Abstract/Free Full Text]
  37. Friedrichsen S, Christ S, Heuer H, Schaefer MK, Parlow AF, Visser TJ, Bauer K 2004 Expression of pituitary hormones in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 145:1276–1283[Abstract/Free Full Text]
  38. Glass CK, Franco R, Weinberger C, Albert VR, Evans RM, Rosenfeld MG 1987 A c-erb-A binding site in rat growth hormone gene mediates trans-activation by thyroid hormone. Nature 329:738–741[CrossRef][Medline]
  39. Das P, Meyer L, Seyfert HM, Brockmann G, Schwerin M 1996 Structure of the growth hormone-encoding gene and its promoter in mice. Gene 169:209–213[CrossRef][Medline]
  40. Brent GA, Larsen PR, Harney JW, Koenig RJ, Moore DD 1989 Functional characterization of the rat growth hormone promoter elements required for induction by thyroid hormone with and without a co-transfected ß type thyroid hormone receptor. J Biol Chem 264:178–182[Abstract/Free Full Text]
  41. Schaufele F, West BL, Baxter JD 1992 Synergistic activation of the rat growth hormone promoter by Pit-1 and the thyroid hormone receptor. Mol Endocrinol 6:656–665[Abstract/Free Full Text]
  42. Aizawa T, Kobayashi M, Komiya I, Hiramatsu K, Sato A, Yamada T 1984 Increased sensitivity of the thyrotroph to thyrotropin-releasing hormones in rats with hypothalamic hypothyroidism. Endocrinology 114:8–13[Abstract/Free Full Text]
  43. Mori M, Yamada M, Kobayashi S 1988 Role of the hypothalamic TRH in the regulation of its own receptors in rat anterior pituitaries. Neuroendocrinology 48:153–159[Medline]
  44. Friedrichsen S, Christ S, Heuer H, Schafer MK, Mansouri A, Bauer K, Visser TJ 2003 Regulation of iodothyronine deiodinases in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 144:777–784[Abstract/Free Full Text]
  45. Fisher DA, Dussault JH, Sack J, Chopra IJ 1976 Ontogenesis of hypothalamic-pituitary-thyroid function and metabolism in man, sheep, and rat. Recent Prog Horm Res 33:59–116
  46. Strbak V, Greer MA 1979 Acute effects of hypothalamic ablation on plasma thyrotropin and prolactin concentrations in the suckling rat: evidence that early postnatal pituitary-thyroid regulation is independent of hypothalamic control. Endocrinology 105:488–489[Abstract/Free Full Text]
  47. Muglia L, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373:427–432[CrossRef][Medline]
  48. Timpl P, Spanagel R, Sillaber I, Kresse A, Reul JM, Stalla GK, Blanquet V, Steckler T, Holsboer F, Wurst W 1998 Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nat Genet 19:162–166[CrossRef][Medline]
  49. Krieger DT, Perlow MJ, Gibson MJ, Davies TF, Zimmerman EA, Ferin M, Charlton HM 1982 Brain grafts reverse hypogonadism of gonadotropin releasing hormone deficiency. Nature 298:468–471[CrossRef][Medline]
  50. Lamberts SW, Macleod RM 1990 Regulation of prolactin secretion at the level of the lactotroph. Physiol Rev 70:279–318[Free Full Text]
  51. Ben-Jonathan N 1985 Dopamine: a prolactin-inhibiting hormone. Endocr Rev 6:564–589[Abstract/Free Full Text]
  52. Leong DA, Frawley LS, Neill JD 1983 Neuroendocrine control of prolactin secretion. Annu Rev Physiol 45:109–127[CrossRef][Medline]
  53. Neill JD 1988 Prolactin secretion and its control. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press; 564–589
  54. Illig R, Krawczynska H, Torresani T, Prader A 1975 Elevated plasma TSH and hypothyroidism in children with hypothalamic hypopituitarism. J Clin Endocrinol Metab 41:722–728[Abstract/Free Full Text]
  55. Nagy A, Rossant J, Nagy R, Abramow-Newerly W, Roder JC 1993 Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci USA 90:8424–8428[Abstract/Free Full Text]
  56. Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR 1984 Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 12:7035–7056[Abstract/Free Full Text]
  57. Schaefer M, Day R 1995 In situ hybridization techniques to study processing enzyme expression at the cellular level. Methods Neurosci 23:16–44[CrossRef]
  58. Schneider MJ, Fiering SN, Pallud SE, Parlow AF, St Germain DL, Galton VA 2001 Targeted disruption of the type 2 selenodeiodinase gene (DIO2) results in a phenotype of pituitary resistance to T4. Mol Endocrinol 15:2137–2148[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. Mittag, S. Friedrichsen, A. Strube, H. Heuer, and K. Bauer
Analysis of Hypertrophic Thyrotrophs in Pituitaries of Athyroid Pax8-/- Mice
Endocrinology, September 1, 2009; 150(9): 4443 - 4449.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Parmentier, S. Kolbaev, B. P. Klyuch, D. Vandael, J.-S. Lin, O. Selbach, H. L. Haas, and O. A. Sergeeva
Excitation of Histaminergic Tuberomamillary Neurons by Thyrotropin-Releasing Hormone
J. Neurosci., April 8, 2009; 29(14): 4471 - 4483.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee
What Can We Learn from Rodents about Prolactin in Humans?
Endocr. Rev., February 1, 2008; 29(1): 1 - 41.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Hernandez, M. E. Martinez, X.-H. Liao, J. Van Sande, S. Refetoff, V. A. Galton, and D. L. St. Germain
Type 3 Deiodinase Deficiency Results in Functional Abnormalities at Multiple Levels of the Thyroid Axis
Endocrinology, December 1, 2007; 148(12): 5680 - 5687.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Zeng, B. A. Schimpf, A. D. Rohde, M. N. Pavlova, A. Gragerov, and J. E. Bergmann
Thyrotropin-Releasing Hormone Receptor 1-Deficient Mice Display Increased Depression and Anxiety-Like Behavior
Mol. Endocrinol., November 1, 2007; 21(11): 2795 - 2804.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. W. Jones, G. J. Song, E. K. Greuber, and P. M. Hinkle
Phosphorylation of the Endogenous Thyrotropin-releasing Hormone Receptor in Pituitary GH3 Cells and Pituitary Tissue Revealed by Phosphosite-specific Antibodies
J. Biol. Chem., April 27, 2007; 282(17): 12893 - 12906.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Ao, V. L. W. Go, N. Toy, T. Li, Y. Wang, M. K. Song, J. R. Reeve Jr., Y. Liu, and H. Yang
Brainstem Thyrotropin-Releasing Hormone Regulates Food Intake through Vagal-Dependent Cholinergic Stimulation of Ghrelin Secretion
Endocrinology, December 1, 2006; 147(12): 6004 - 6010.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Yamada, N. Shibusawa, S. Ishii, K. Horiguchi, R. Umezawa, K. Hashimoto, T. Monden, T. Satoh, J. Hirato, and M. Mori
Prolactin Secretion in Mice with Thyrotropin-Releasing Hormone Deficiency
Endocrinology, May 1, 2006; 147(5): 2591 - 2596.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. W. Jones and P. M. Hinkle
{beta}-Arrestin Mediates Desensitization and Internalization but Does Not Affect Dephosphorylation of the Thyrotropin-releasing Hormone Receptor
J. Biol. Chem., November 18, 2005; 280(46): 38346 - 38354.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rabeler, R.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rabeler, R.
Right arrow Articles by Bauer, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LEVOTHYROXINE
*LIOTHYRONINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals