help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0487
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bisello, A.
Right arrow Articles by Ferrari, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bisello, A.
Right arrow Articles by Ferrari, S. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*PARATHYROID HORMONE
*Genetics Home Reference
Molecular Endocrinology 18 (6): 1486-1498
Copyright © 2004 by The Endocrine Society

Agonist-Specific Regulation of Parathyroid Hormone (PTH) Receptor Type 2 Activity: Structural and Functional Analysis of PTH- and Tuberoinfundibular Peptide (TIP) 39-Stimulated Desensitization and Internalization

Alessandro Bisello, Danielle Manen, Dominique D. Pierroz, Ted B. Usdin, René Rizzoli and Serge L. Ferrari

Division of Endocrinology and Metabolism (A.B.), Department of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania 15261; Division of Bone Diseases (D.M., D.D.P., R.R., S.L.F.), Department of Rehabilitation and Geriatrics, Geneva University Hospital, 1211 Geneva, Switzerland; and Laboratory of Genetics (T.B.U.), National Institute of Mental Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Serge L. Ferrari, Division of Bone Diseases, Department of Rehabilitation and Geriatrics, Geneva University Hospital, 24 rue Micheli-du-Crest, CH-1211 Geneva 14, Switzerland. E-mail: serge.ferrari{at}medecine.unige.ch.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The human PTH receptor type 2 (PTH2R) is activated by PTH and tuberoinfundibular peptide of 39 residues (TIP39), resulting in cAMP and intracellular Ca signaling. We now report that, despite these similarities, PTH and TIP39 elicit distinct responses from PTH2R. First, TIP39 induced ß-arrestin and protein kinase Cß mobilization and receptor internalization, whereas PTH did not. However, PTH stimulated trafficking of these molecules for a chimeric PTH2R containing the N terminus and third extracellular loop of PTH receptor type 1 (PTH1R). Second, whereas PTH-stimulated cAMP activity was brief and rapidly resensitized, the response to TIP39 was sustained and partly desensitized for a prolonged period. PTH2R desensitization was mediated by ß-arrestin interaction with the C terminus (amino acids 426–457) of PTH2R, whereas ß-arrestin mobilization had a minor influence on PTH2R internalization in response to TIP39, as shown with C terminus deletion mutants and/or dominant negative forms of ß-arrestin and dynamin. These data contrast with PTH1R, at which these dominant negative mutants markedly inhibited receptor internalization. Collectively, these results further highlight how specific interactions within the ligand-receptor bimolecular complex mediate distinct postactivation responses of class II G protein- coupled receptors and provide novel insights into the physiological regulation of PTH2R activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A LARGE BODY of evidence indicates that second messenger synthesis alone is not sufficient to explain the range of cellular responses mediated by G protein-coupled receptors (GPCRs). Upon agonist occupancy, activated GPCRs stimulate recruitment of a variety of intracellular proteins, such as kinases, arrestins, and other adaptor proteins, which dictate the signaling profile (through desensitization of G protein-mediated signaling and activation of additional signaling pathways), cellular trafficking, and fate of ligands and receptor (1). Because of their unique pharmacology, the two known PTH receptors in humans, PTH receptor type 1 (PTH1R) and PTH receptor type 2 (PTH2R), and their cognate agonists are an ideal system by which to explore how different ligands elicit specific postreceptor responses through homologous receptors. PTH1R and PTH2R are members of the class II of GPCRs, which includes receptors for nearly a dozen distantly related peptide hormones (2). Activation of both human PTH1R and PTH2R by PTH results in intracellular cAMP and Ca signaling (3). In addition, PTH2R, but not PTH1R, is activated by tuberoinfundibular peptide of 39 residues (TIP39), a peptide that has limited homology to PTH, only seven residues being identical when the sequences of these two peptides are optimally aligned (4, 5). Conversely, PTH1R specifically recognizes PTHrP, which is inactive on PTH2R. Activation of PTH1R by PTH or PTHrP stimulates recruitment of ß-arrestins, leading to re-ceptor desensitization and endocytosis through a dynamin- and clathrin-dependent pathway (6, 7, 8). Whether PTH2R activity is similarly regulated in response to its agonists is unknown. The PTH2R shares 70% amino acid (aa) sequence homology and 52% identity with PTH1R, but the degree of identity differs notably between their various domains, being highest within the transmembrane domains and as low as 14% within the C-terminal domain. We hypothesized that these structural differences may result in specific and distinct PTH2R postactivation responses to PTH and TIP39.

In this study we show that TIP39, but not PTH, induces protein kinase Cß (PKCß) activation, recruitment of ß-arrestins and receptor endocytosis, and provide a structural basis for these differences. Furthermore, we identified the principal regions of the PTH2R that interact with arrestins and defined their role in desensitization of TIP39-stimulated cAMP signaling. Finally, we present the surprising observation that PTH2R may undergo internalization via PKCß-dependent mechanisms that do not necessarily involve arrestins and dynamin.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cellular Trafficking of PTH2R in Response to PTH and TIP39
The cellular trafficking of PTH2R in response to its agonists TIP39 and PTH(1–34) was evaluated by fluorescence microscopy in living human embryonic kidney (HEK)293 cells transiently expressing PTH2R-green fluorescent protein (GFP) (see Fig. 1AGo, restriction map of PTH2R used for plasmids constructions). Stimulation with 100 nM TIP39 induced endocytosis of PTH2R-GFP within minutes (Fig. 2AGo, a–c). In striking contrast, stimulation with PTH(1–34) (100 nM) did not internalize PTH2R-GFP from the cell surface (Fig. 2AGo, d and e). The same results were observed with either PTH(1–34) or PTH(1–84) up to 1 µM (data not shown). Furthermore, a fluorescent PTH-derived agonist [PTH-rhodamine (6)] bound to the PTH2R on the cell membrane but was not internalized in HEK293 cells stably expressing PTH2R [BP16 cells, (3), Fig. 2BGo, a and b]. In contrast, in HEK293 cells stably expressing PTH1R (C21 cells) (9) and transiently coexpressing PTH2R-GFP, PTH-Rhodamine was rapidly internalized, without mobilizing PTH2R-GFP from the cell surface (Fig. 2BGo, c–e). These results indicate that in cells fully competent to support endocytic events, PTH selectively internalized with PTH1R. Moreover, when HEK-293 cells transiently expressing PTH2R-GFP were exposed to PTH followed by TIP39, receptor endocytosis still occurred in response to the latter (data not shown), indicating that internalization mechanisms were not desensitized by previous exposure to PTH.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Schematic Representation of Mutant PTH2R

A, Restriction maps of PTH1R and PTH2R coding sequences. The seven transmembrane domains are represented as black boxes. The location and orientation of primers used for basic constructions are delineated by arrows (see Materials and Methods for details). B, Schematic structure of chimeric receptors. Black lines represent PTH1R and gray lines represent PTH2R domains. C and D, Sequence alignment of PTH2R and PTH1R IC3 (panel C) and C-terminal cytoplasmic tail (panel D). Residues common to both receptors are in bold. The three overlapping deletions generated in PTH2R IC3 are indicated by brackets, and C-terminal truncations are indicated by arrows. C-terminal serine residues are underlined, and serines that have been mutated to alanines are indicated by a black dot. Alignments were performed using the Multalin program (38 ).

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. PTH2R and Agonists Internalization

A, HEK293 cells transiently expressing PTH2R-GFP (a–e) were incubated with 100 nM TIP39 (b and c) or PTH(1–34) (d and e) and continuously monitored by fluorescence microscopy at 37 C. Stimulation with TIP39 internalized PTH2R-GFP (b and c), whereas PTH(1–34) did not (d and e). B, In HEK293 cells stably expressing PTH2R (BP16 cells, a and b), PTH-rhodamine (10 nM) bound to the cell surface (a) but was not internalized after 20 min (b). In HEK293 cells stably expressing PTH1R (C21 cells) and transiently coexpressing PTH2R-GFP (c and d), PTH-rhodamine also bound on the cell membrane (c). After 20 min, PTH-rhodamine was completely internalized, whereas PTH2R-GFP remained on the cell surface (d). Figures are representative of similar images obtained on at least four separate fields in each of four to eight independent experiments. Magnification, x100. C, Radioligand internalization in HEK293 cells stably expressing PTH2R (BP16 cells) or PTH1R (C21 cells). Cells were incubated for 2 h at 4 C with the radiolabeled agonist [125I]TIP39 or [125I]PTH(1–34), washed, and incubated in culture medium for the indicated times. BP16-TIP39: ({bullet}); BP16-PTH(1–34): ({blacksquare}); C21-PTH(1–34): ({square}). The percentage of specific radioligand internalization was evaluated as described in Materials and Methods. Each point represents the mean ± SE percentage of total cell-associated ligand from triplicate determinations. Similar results were obtained in three additional experiments.

 
To confirm and extend these observations, we then examined the cellular trafficking of radiolabeled agonists (Fig. 2CGo). Internalization of [125I]TIP39 in BP16 cells reached 80% after 1 h, whereas no significant internalization of [125I]PTH was measured in the same cells. Radioiodinated PTH(1–34) instead dissociated very rapidly from the PTH2R (at 37 C): 49 ± 4% of bound ligand dissociated within 1 min, and approximately 70 ± 1% dissociated after 1 h (data not shown). In contrast, [125I]PTH was rapidly and almost completely internalized in cells stably expressing PTH1R (C21 cells), as previously reported (6, 10).

Cellular Trafficking of ß-Arrestins and PKC in Response to PTH and TIP39
The trafficking of ß-arrestins was visualized in HEK293 cells expressing PTH2R and either ß-arrestin1-GFP or ß-arrestin2-GFP. Exposure to 100 nM TIP39 induced rapid recruitment of ß-arrestins from the cytoplasm to the cell surface, followed by relocalization to cytoplasmic vesicles (Fig. 3Go, a–c, and f–h). In contrast, neither PTH(1–34) nor PTH(1–84) at concentrations up to 1 µM promoted ß-arrestin-GFP mobilization (Fig. 3Go, d, e, i, and j). Similar to the observations with PTH2R-GFP, recruitment of ß-arrestin2-GFP in BP16 cells previously exposed to PTH remained fully responsive to TIP39 (data not shown), indicating that PTH did not desensitize or antagonize TIP39 effects on arrestins.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3. PTH2R-Mediated Cellular Trafficking of ß-Arrestins

HEK293 cells stably expressing PTH2R (BP16 cells) and transiently expressing ß-arrestin2-GFP (a–e) or ß-arrestin1-GFP (f–j), were incubated with 100 nM TIP39 (b, c, g, and h) or PTH(1–34) (d, e, i, and j) and continuously monitored by fluorescence microscopy at 37 C. In resting cells, ß-arrestin2-GFP (a) and ß-arrestin1-GFP (f) were uniformly distributed in the cytoplasm. TIP39 recruited arrestin-GFP to the cell membrane after 3 min (b and g), followed by relocalization on endocytic vesicles after 20 min (c and h; arrow indicates an endosome magnified in inset). In contrast, PTH(1–34) did not mobilize ß-arrestin2- or -1-GFP (d, e, i, and j).

 
In addition to arrestins, PKC also plays a prominent role in PTH1R internalization (6, 7). To examine PTH2R-mediated activation of PKC in response to agonists, translocation of cytoplasmic PKCß-GFP to the cell membrane (11) was monitored by fluorescence microscopy. PTH(1–34) did not induce detectable translocation of PKCß-GFP in cells expressing PTH2R, although it did so in PTH1R-expressing cells (Fig. 4AGo, a, b, and d). In contrast, TIP39 stimulated PKCß translocation in PTH2R-expressing cells (Fig. 4AGo, c). In both cases, PKCß activation specifically occurred through a cAMP-independent signaling pathway, as shown by the lack of effect of forskolin (10 µM for up to 40 min) on PKCß-GFP distribution. As expected, phorbol 12-myristate 13-acetate (PMA) induced a massive redistribution of PKCß-GFP to the membrane (data not shown).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. PTH2R-Mediated Intracellular Signaling

A, PKC activation. In cells expressing PTH2R together with PKCß-GFP (a–c), PTH(1–34) (100 nM) did not translocate PKC, whereas further stimulation with TIP39 (100 nM) recruited PKCß to cell membrane (c). Similarly, PTH(1–34) stimulated translocation of PKCß-GFP in cells expressing PTH1R (d). B, Desenzitization of PTH2R-mediated cAMP. The time course of cAMP desensitization was evaluated in HEK293 cells transiently expressing PTH2R. Maximal cAMP accumulation after acute stimulation is shown at time zero. To evaluate residual cAMP accumulation (plain lines), cells were exposed to 100 nM PTH(1–34) ({blacksquare}) or TIP39 ({bullet}) for 30 min, and then washed three times with PBS. At different times (2 min, 30 min, 1 h, and 2 h), cAMP accumulation was measured in the presence of IBMX as described in Materials and Methods. To evaluate desensitization, cAMP accumulation was measured after rechallenge with 100 nM agonist (dotted lines), [PTH(1–34) ({square}); TIP39 ({circ})] in the presence of IBMX at times indicated (2 min, 30 min, 1 h, and 2 h). ***, P < 0.0001 for the difference in both residual and rechallenged cAMP accumulation between PTH and TIP39 (two-factor ANOVA). C, Heterologous desensitization of agonist-stimulated cAMP by PKC activation. Cells transiently transfected with PTH2R were pretreated (dotted line) with PMA (1 µM during 10 min) or without (plain line) and incubated with increasing concentrations of either TIP39 (left panel) or PTH(1–34) (right panel) in the presence of IBMX. **, P < 0.01 for cAMP inhibition in PMA-treated cells vs. untreated.

 
Desensitization of cAMP Signaling in Response to Agonists
We have previously reported that PTH1R-mediated recruitment of ß-arrestin2 is an important mechanism for desensitization of cAMP signaling in response to PTH (6, 10). Therefore, we examined the profile of cAMP signaling in response to PTH2R agonists. The maximal cAMP accumulation after 30 min stimulation with PTH or TIP39 (100 nM) was similar (Table 1Go, legend), as previously reported (12). Residual cAMP accumulation (in presence of a phosphodiesterase inhibitor) decreased to 50% of the maximum within minutes after washout of the TIP39-containing medium, followed by a slower, progressive phase of declining cAMP accumulation to 30–40% after 2 h (Fig. 4BGo). During this period, cAMP accumulation after rechallenge with TIP39 remained significantly desensitized (Fig. 4BGo). Consistent with PTH rapid dissociation from PTH2R (above), residual cAMP accumulation returned to baseline levels immediately after washout of the PTH-containing medium, and rechallenge with PTH induced a maximal cAMP response within 30 min (Fig. 4BGo). Thus, the percentage desensitization 2 h after exposure to PTH or TIP39 was 17.4 ± 8.4% and 69.8 ± 8.0%, respectively (n = 4 separate experiments in triplicates, P = 0.0001).


View this table:
[in this window]
[in a new window]
 
Table 1. Ligand Binding Affinity and Ligand-Stimulated cAMP Accumulation in HEK-293 Cells Expressing Wild-Type and Mutants PTH2R

 
Overexpression of ß-arrestin2 in PTH1R-expressing cells has been shown to inhibit PTH-stimulated cAMP signaling (10). To directly demonstrate the role of ß-arrestin2 in desensitization of TIP39-stimulated cAMP signaling, HEK 293 cells were transiently cotransfected with PTH2R and ß-arrestin2-GFP (0.4 µg DNA construct each). Compared with cells coexpressing empty vector-GFP, maximal cAMP accumulation in response to TIP39 (100 nM, 15 min) was 35% lower in cells overexpressing ß-arrestin2-GFP (1719 ± 171 vs. 2718 ± 173 cpm/well, respectively; means ± SEM from two independent experiments in triplicate, P < 0.05).

Given our observations suggesting that TIP39, but not PTH, activates PKC, we next examined the effect of heterologous PKC activation on cAMP response to PTH2R agonists. Pretreatment with PMA (1 µM for 10 min) caused a significant 30% decrease of cAMP accumulation in response to TIP39 and a marginal decrease in response to PTH (Fig. 4CGo). In contrast, activation of PKA with forskolin (1 µM for 10 min) had no effect on either TIP39- or PTH-stimulated cAMP activity (data not shown).

Collectively, these results suggest that activation of both ß-arrestins and PKC plays a role in TIP-39-induced desensitization of cAMP signaling.

Structural Requirements for Ligand-Selective PTH2R Endocytosis and Recruitment of ß-Arrestins
We previously reported that specific interactions with agonists occurring at the PTH1R extracellular domains are responsible for stabilizing a receptor conformation with high affinity for ß-arrestins (13). Accordingly, to investigate the PTH2R structural determinants for the agonist-selective recruitment of ß-arrestins, we studied a chimeric receptor in which the first 171 aa (N-terminal and first transmembrane domains) and third extracellular loop (EC3, residues 384–395) of PTH2R had been replaced by the first 214 aa of PTH1R and the homologous PTH1R EC3 domain (residues 429–440) [(N1-R2-(EC3)1] (Fig. 1BGo and Ref.14). Despite a 10-fold apparent decrease in affinity for TIP39, the EC50 and maximal cAMP accumulation of N1-R2-(EC3)1 in response to both TIP39 and PTH were comparable to those of the wild-type PTH2R (Table 1Go). In HEK-293 cells expressing N1-R2-(EC3)1, both PTH and TIP39 promoted ß-arrestin2-GFP mobilization (Fig. 5AGo, a–e). In addition, both PTH and TIP39 stimulated PKCß-GFP translocation in these cells (supplemental Fig. 1Go, d and e, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Consistent with the activation of both ß-arrestins and PKCß, both PTH(1–34) and TIP39 stimulated N1-R2-(EC3)1-GFP internalization (Fig. 5BGo, a and b). PTH-rhodamine bound to the chimeric receptor was rapidly and almost completely internalized (Fig. 5CGo, a and b). Moreover, this chimeric receptor mediated internalization of radiolabeled TIP39 and PTH similar to wild-type PTH2R and PTH1R, respectively (Fig. 5DGo).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 5. Cellular Trafficking in Cells Expressing Chimeric PTH2/1 Receptors

A, HEK-293 cells transiently coexpressing ß-arrestin2-GFP and either N1-R2-(EC3)1 (a–e) or R2-(IC3)1-C1 (f–j) chimeric receptors were continuously monitored by fluorescence microscopy at 37 C. In untreated cells, ß-arrestin2-GFP was uniformly localized in the cytoplasm (a and f). Treatment with PTH (100 nM) induced rapid recruitment of ß-arrestin2-GFP to the cell membrane in cells expressing N1-R2-(EC3)1 (b and c), but not R2-(IC3)1-C1 (g and h). Treatment with TIP39 (100 nM) induced redistribution of ß-arrestin2-GFP in cells expressing either chimeric receptor (d, e, i, and j). B, In HEK-293 cells transiently expressing GFP-tagged chimeric receptors, PTH (100 nM) induced endocytosis of N1-R2-(EC3)1-GFP (a) but not R2-(IC3)1-C1 (c), whereas TIP39 (100 nM) induced endocytosis of both chimeric receptors (b and d). C, In HEK-293 cells transiently expressing N1-R2-(EC3)1 or R2-(IC3)1-C1 and incubated with PTH-rhodamine (10 nM), PTH-Rho was internalized in cells expressing N1-R2-(EC3)1 (a and b) but not in cells expressing R2-(IC3)1-C1 (c and d). Figures are representative of three independent experiments. Magnification, x100. D, HEK-293 cells transiently expressing either PTH1R or PTH2R or N1-R2-(EC3)1, as indicated, were incubated for 2 h at 4 C with [125I]TIP39 100 nM (open bars) or [125I]PTH(1–34) 100 nM (closed bars), washed, and incubated in fetal calf serum-supplemented DMEM. The percentage of specific radioligand internalization after 45 min was evaluated as reported (6 10 ). NS, No significant specific binding of [125I]TIP39 to PTH1R was measured. Each bar represents the mean ± SE percentage of total cell-associated radioligand from triplicate determinations. Similar results were obtained in three additional experiments.

 
Considering the role of PTH1R intracellular domains on directly mediating interaction with arrestins (6, 10, 15), chimeric receptors in which the third intracellular loop (IC3) and/or the entire C terminus of PTH2R were replaced by homologous regions of PTH1R [R2-C1 and R2-(IC3)1-C1] were also examined (Fig. 1BGo). Both chimeric receptors were adequately expressed, and cAMP responses to both PTH and TIP39 were similar to those of wild-type PTH2R (Table 1Go). The results for R2-(IC3)1-C1 are shown in Fig. 5Go and were identical to those obtained with R2-C1 containing only the C terminus of PTH1R (data not shown). Similar to PTH2R, R2-(IC3)1-C1 did not mediate ß-arrestin2-GFP or PKCß-GFP mobilization in response to PTH(1–34) (Fig. 5AGo, f–h; and supplemental Fig. 1Go, b and c), but did so in response to TIP39 (Fig. 5AGo, i and j). Moreover, whereas R2-(IC3)1-C1-GFP markedly internalized in response to TIP39 (Fig. 5BGo, d), no significant receptor endocytosis occurred in response to PTH (Fig. 5BGo, c). Furthermore, PTH-rhodamine bound, but did not internalize, in cells expressing this chimera (Fig. 5CGo, c and d).

In summary, these results indicate that specific interactions between agonists and PTH receptors’ extracellular domains mediate distinct postactivation responses to PTH and TIP39.

PTH2R Structural Requirements for ß-Arrestin-Mediated Regulation of cAMP Signaling
To further determine the structural features of PTH2R required for ß-arrestin recruitment and regulation of cAMP signaling in response to TIP39, a series of receptor mutants carrying deletions and/or point mutations in the C-terminal cytoplasmic domain and/or IC3 was generated (Fig. 1Go, C and D; and Table 1Go). These regions have been shown previously to be critical for the interaction of PTH1R with ß-arrestins and desensitization of cAMP signaling (6, 7, 10). Juxtamembrane truncation of the receptor C terminus (TR426) markedly inhibited cell surface expression of the mutant receptor and its cAMP response to both agonists, thereby precluding the use of this mutant for further studies. Cell surface expression and affinity for TIP39 were adequate for all other receptor mutants (Table 1Go). However, deletion mutants of IC3 had significantly reduced maximal cAMP responses to both agonists (Table 1Go), indicating an important role of IC3 in PTH2R coupling to Gs. Conversely, cAMP accumulation in response to TIP, but not PTH, gradually increased with PTH2R mutants carrying C-terminal deletions at residue 457 and 443 (TR457 and TR443), and increased further with substitution of four serine residues in the proximal C terminus of TR457 with alanine (S429, 432,445,450A, resulting in TR457S>A) (Table 1Go), suggesting that the proximal C terminus may specifically regulate TIP39-stimulated cAMP signaling.

Next, the trafficking of ß-arrestin2 and the mutant receptors was investigated in living HEK-293 cells. TR443 resulted in a marked inhibition of ß-arrestin2-GFP recruitment in response to TIP39 (Fig. 6AGo, a and b), whereas a more distal deletion (TR457) had less prominent effects (Fig. 6AGo, c and d). In cells expressing TR457S>A, ß-arrestin2-GFP trafficking in response to TIP39 was also virtually abolished (Fig. 6AGo, e and f). Of note, substitution of these four serine residues alone in PTH2R with an otherwise intact C terminus did not affect the pattern of arrestins trafficking (data not shown). In spite of some clear alterations in ß-arrestin trafficking, endocytosis of C-terminal mutant PTH2R-GFP was maintained in response to TIP39 (Fig. 6AGo, g–l), in parallel to PKCß-GFP activation by these mutants (supplemental Fig. 1Go, f and g). Moreover, none of the mutations in the C terminus of PTH2R prevented internalization of [125I]TIP39 (Fig. 6BGo).



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 6. Cellular Trafficking in Cells Expressing PTH2R C-Terminal Deletion Mutants

A, HEK-293 cells transiently coexpressing the indicated PTH2R mutants and ß-arrestin2-GFP (a–f), or expressing mutant PTH2R-GFP alone (g–l), were incubated with TIP39 (100 nM) and continuously monitored by fluorescence microscopy at 37 C, as described in Materials and Methods. ß-Arrestin2-GFP mobilization was abolished in cells expressing the C-terminal deletion mutant TR443 (Fig. 6AGo, a and b) but was still detectable with a more distal deletion (TR457) (Fig. 6AGo, c and d). In cells expressing TR457S>A, ß-arrestin2-GFP mobilization was no more detectable (Fig. 6AGo, e and f). TIP39-stimulated internalization of GFP-tagged receptors was detectable with all PTH2R mutants (Fig. 6AGo, g–i). Figures are representative of three to five independent experiments. Magnification, x100. B, HEK-293 cells transiently expressing the indicated receptors were incubated for 2 h at 4 C with 125I-TIP39, washed, and incubated in fetal calf serum-supplemented DMEM. The percentage of specific radioligand internalization after 45 min was evaluated as reported (6 10 ). Each bar represents the mean ± SE percentage of total cell-associated radioligand from triplicate determinations. Similar results were obtained in three additional experiments. C, HEK-293 cells transiently expressing PTH1R (closed bars), PTH2R (open bars), or TR457 (hatched bars) and coexpressing either dominant-negative ß-arrestin(319–418) or [K44A]dynamin were incubated for 2 h at 4 C with [125I]PTH (closed bars) or [125I-TIP39 (open or hatched bars) and washed, and internalization was evaluated after 45 min. Each bar represents the mean ± SE percentage of total cell-associated TIP39 from triplicate determinations. Similar results were obtained in three additional experiments at both 15 min and 45 min after washout.

 
Given these observations, we examined the effects of ß-arrestin(319–418) and [K44A]-dynamin, i.e. dominant negative forms of these molecules (16, 17), on radioligand internalization. In contrast to their drastic inhibition of [125I]PTH internalization by PTH1R (Fig. 6CGo), the dominant negative constructs only marginally decreased internalization of [125I]TIP39 by both wild-type PTH2R and its TR457 mutant (Fig. 6CGo).

In contrast to C-terminal deletions, overlapping deletions of IC3 (D341–349, D346–355, and D353–360) did not inhibit membrane recruitment of ß-arrestin2-GFP by TIP39 (supplemental Fig. 2Go; published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). However, deletion of the distal (C-terminal) region of IC3 (D353–360) reduced later clustering of ß-arrestin2-GFP on cytoplasmic vesicles, indicating that this sequence may be involved in stabilizing receptor interaction with arrestins during endocytosis. Moreover, all IC3 deletion mutants mediated PKC ß-GFP translocation in response to TIP39 (supplemental Fig. 1Go, h–j), and these mutants internalized, as shown by fluorescence microscopy of mutant receptors-GFP (supplemental Fig. 2Go) and by internalization of radiolabeled TIP39 (data not shown).

To further demonstrate the role of PTH2R C terminus on arrestins-mediated desensitization of cAMP signaling, we examined the kinetics of TIP- and PTH-stimulated cAMP production (in absence of phosphodiesterase inhibitors) in cells expressing closely related PTH2R mutants, TR457 and TR457S>A. As shown in Fig. 7Go, the initial rate of TIP39-stimulated cAMP production was greater with TR457S>A compared with TR457 or wild-type PTH2R, consistent with the absence of ß-arrestin recruitment with the former. After 5 min however, cAMP accumulation markedly slowed down and was parallel with the two mutant receptors, whereas it significantly declined in cells expressing wild-type PTH2R (–42% after 15 min). These observations suggest that a second phase of inhibition of cAMP signaling occurs independently of ß-arrestins and may be directly related to PKC activation and ligand-receptor endocytosis. In contrast, the cAMP profile in response to PTH did not significantly differ between the three receptors, clearly indicating that residues in the PTH2R C terminus mediating interaction with ß-arrestins are involved in the specific regulation of TIP39-stimulated cAMP signaling.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. Kinetics of Agonist-Stimulated cAMP Signaling PTH2R C-Terminal Deletion Mutants

HEK-293 cells were transiently transfected with either wild-type PTH2Rc ({diamondsuit}), mutant TR457 ({square}), or TR457S>A ({triangleup}) and incubated with 100 nM of either PTH(1–34) (panel A) or TIP39 (panel B). The time course of cAMP synthesis was determined as described in detail in Materials and Methods. ***, P < 0.0001 for the difference between TR457S>A and TR457 and WT (two-factor ANOVA).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A large body of evidence indicates that signal transduction alone is not sufficient to explain the range of cellular responses mediated by GPCRs. Upon occupancy, GPCRs stimulate recruitment of a variety of intracellular proteins, such as kinases, arrestins and adaptor proteins, which dictate the signaling profile, cellular trafficking, and fate of ligands and receptor (1). Recent structure-function studies indicate that G protein activation and receptor endocytosis may be dissociated and depend upon distinct conformational states. This has been shown in different ways for the PTH type 1 (8, 13, 18), ß2-Adrenergic (19), angiotensin type 1 (20), 5-hydroxytryptamine-2A (21), endothelin (22), and cholecystokinin (23) receptors. Collectively, these observations highlight the importance of examining the specific molecular events after GPCR activation and the relationship between receptor occupancy, regulation of signaling, and endocytosis.

The objective of this study was to characterize the mechanisms of desensitization and endocytosis of the PTH2R and thereby further define structure-function relationships in the PTH2R. This is a particularly interesting receptor in that it recognizes and is activated by two distinct natural ligands, PTH and TIP39. Although these two hormones have little sequence identity (only seven residues are identical when sequences are optimally aligned), they are both capable of activating acute signaling responses through the PTH2R (3, 24). It has been reported that the two ligands acquire a pronounced similarity in secondary structures in the presence of membrane mimetics (such as micelles). Thus it was proposed that the complex between PTH2R and either agonist has an overall similar topology (25, 26). This appears to be a common feature within class II of GPCRs, which includes, among others, receptors for calcitonin, secretin, and the two PTHR subtypes. These observations notwithstanding, this study demonstrates unique postactivation responses of the PTH2R upon occupancy by PTH or TIP39. Additionally, our work highlights important differences (as well as similarities) in the molecular events and the domains in the PTHR subtypes that are responsible for the regulation of cAMP signaling, interaction with ß-arrestins, and receptor internalization.

The TIP39/PTH2R System
Engagement of the PTH2R by TIP39 resulted in a pattern of molecular events consistent with most of the other GPCRs. After signal transduction, the TIP39-occupied receptor recruited PKCß and ß-arrestins to the cell membrane and internalized. Sequential deletions of PTH2R C terminus and/or Ser to Ala substitutions in the proximal C terminus (aa 429, 432, 445, and 450) clearly defined the region between residues 426 and 457 as a critical site of interaction between PTH2R and arrestins. Moreover, although deletion of the distal region of IC3 (D353–360) did not impair the ability of the receptor to recruit ß-arrestins to the cell membrane, the redistribution of ß-arrestin to intracellular vesicles did not occur, suggesting that IC3 contributes to stabilizing interactions with arrestins during trafficking. By comparison, the interaction of the PTH1R with ß-arrestin in response to PTH or PTHrP also involves both the C-terminal tail and IC3, but the relative contribution of these domains is opposite in that IC3 provides the primary interaction sites whereas the C-terminal domain confers stability to the complex during intracellular trafficking (10).

A distinct feature of PTH2R is the observation that every PTH2R deletion mutant, either in the C terminus or IC3, internalized efficiently upon activation by TIP39, irrespective of its ability to interact with arrestins. Furthermore, overexpression of dominant negative forms of either ß-arrestin or dynamin only minimally affected internalization of wild-type or TR457 PTH2R, showing that other mechanisms may play a prominent role in the endocytosis of TIP39-occupied PTH2R. A few other GPCRs, notably metabotropic glutamate receptor (27) and protease-activated receptor-1 (28), have been shown to be largely insensitive to inhibition of arrestin and dynamin function. Our data suggest that PKC activation may actually be sufficient for PTH2R internalization and at least partly explain differences in PTH2R internalization in response to TIP39 vs. PTH. It is important, however, to emphasize that the normal response of PTH2R to TIP39 is characterized by internalization together with ß-arrestin. Because the latter does not seem to be necessary for endocytosis itself, we speculate that the formation of this complex may have further biological functions, as previously shown for other GPCRs (1). Among these functions, we demonstrated a clear role of arrestins on regulating TIP39-stimulated cAMP production and desensitization. The mechanistic basis for residual cAMP levels in response to TIP39, however, is not completely clear. One could speculate that, similar to their limited role in PTH2Rc (compared with PTH1Rc) internalization, ß-arrestin-mediated targeting of phosphodiesterases to the plasma membrane (29) might also differ between the two receptor types. Additional mechanisms, such as receptor down-regulation by lysosomal targeting and/or slow recycling to the cell surface (30), might also be involved in prolonged desensitization of PTH2R-mediated signaling in response to TIP39.

The PTH/PTH2R System
Despite similar stimulation of intracellular cAMP signaling, the interaction of PTH with the PTH2R resulted in profoundly different effects compared with TIP39. Unlike TIP39, PTH(1–34) did not trigger PKCß and ß-arrestin recruitment, PTH2R desensitization, and receptor internalization. Therefore, a certain dissociation between receptor activation and internalization occurs for the PTH/PTH2R system. The effect of PTH on the PTH2R is completely different from that on the PTH1R, where it promotes phospholipase C/PKC activation, arrestin trafficking, receptor endocytosis, and desensitization of both Gs- and Gq-signaling (6, 7, 10, 31). Therefore, we questioned whether these differences could be explained by structural diversity in the receptors at sites involved either in arrestin or in ligand binding. To this end we generated two chimeric receptors, in which selected intracellular or extracellular domains were exchanged. One of these chimeric receptors [R2-(IC3)1-C1] contained the C-terminal tail and IC3 of the PTH1R, which are known to be important for the interaction of ß-arrestins with PTH-occupied PTH1R (8, 10, 13). With this chimeric receptor, the actions of PTH and TIP39 were undistinguishable from those on the wild-type PTH2R (i.e. only TIP39 activated PKC, arrestins, and internalization). This confirms that, despite a poor sequence homology, the cytoplasmic domains of PTH1R and PTH2R are both fully competent to interact with arrestins when receptors are occupied by the proper agonist (i.e. PTH for the PTH1R and TIP39 for the PTH2R). These observations also suggest that extracellular interactions mediate these ligand-selective processes. Indeed, when the N-terminal extracellular domain and the IC3 of PTH2R were exchanged with the homologous regions of PTH1R [N1-R2-(EC3)1], both PTH and TIP39 were able to induce PKCß and arrestin trafficking and ligand-receptor endocytosis. These data demonstrate that specific interactions between ligand and receptor are responsible for conformational changes that promote arrestin binding and subsequent desensitization of signaling. These conclusions are in agreement with our previous findings that interactions between the first residue of PTHrP and the region of transmembrane VI and the EC3 of PTH1R mediate selective stabilization of active or desensitized receptor conformations (13).

The differences we observed in the postactivation processes and cAMP signaling profiles of the PTH2R in response to PTH or TIP39 obviously raise the intriguing question of whether the two agonists might have different physiological activities through the PTH2R. Tissue distribution and physiology of PTH2R differ greatly from those of PTH1R. Whereas the latter is widely expressed and present at high levels in kidney and bone, where it controls bone and mineral homeostasis, the PTH2R is most abundant in the brain and pancreas and is also expressed in the placenta, testis, and vascular endothelium (31, 32, 33). The actions of the PTH2R/TIP39 system in the central nervous system (where PTH is virtually absent) appear to be related to nociception and the release of several hypothalamic-releasing factors (CRH, vasopressin, and GnRH among others) (34, 35). In contrast, the function of PTH2R in peripheral tissues remains unclear, and the presence of TIP39 in the circulation has not yet been demonstrated. Nevertheless, the PTH2R seems to mediate vasodilation in isolated perfused kidneys, where both TIP39 and PTH are present. Our findings possibly suggest that in peripheral tissues, PTH and TIP39 may play distinct physiological roles. Alternatively, the rather unusual behavior of PTH at the PTH2R compared with most GPCR agonists might indicate that PTH is actually not a physiological agonist of PTH2R.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Peptide Synthesis and Radioligand Preparation
The syntheses, purification, and characterization of [Nle(8, 18),Tyr(34)]bPTH(1–34)NH2 (PTH(1–34)), and [Nle(8, 18),Lys(13)(N{epsilon}-5-carboxymethylrhodamine),L-2-Nal(23),Arg(26, 27),Tyr(34)]bPTH(1–34)NH2 (rhodamine-PTH), were carried out as previously described (6). The pure products were characterized by analytical HPLC, electron-spray mass spectrometry, and aa analysis. Human TIP39 was purchased from Anaspec, Inc. (San Jose, CA). Radioiodination and HPLC purification of PTH(1–34) and TIP39 were carried out by standard iodogen method and C-18 column, respectively (6).

Cell Culture and Transient Expression of the Various Constructs
HEK-293 cells and their derivatives stably expressing PTH1R and PTH2R (C21 and BP16, respectively) (3, 9) were grown in DMEM supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, and 10% fetal calf serum. For cAMP accumulation, and radioligand binding and internalization assays, cells were seeded in 24-well tissue culture clusters at a density of 105 cells per well and assayed 48 h later. For experiments requiring transient expression, cells were transfected 24 h after plating, using 0.4 µg DNA, 1 µl Fugene (Roche, Rotkreuz, Switzerland) and 30 µl Optimem (GIBCO, Basel, Switzerland) per well and assayed after 24 h. For fluorescence microscopy experiments, cells were seeded in glass dishes (3-cm diameter bottom), and transfections were performed as described above. When receptors were coexpressed with dominant negative forms of ß-arrestin2 or dynamin, 0.2 µg of receptor cDNA and 0.5 µg of either empty vector (pcDNA3), ß-arrestin1(319–418) (16) or [K44A]-dynamin (17) and 1.5 µl Fugene in 30 µl Optimem were used.

Radioreceptor Binding and Internalization Assays
Radioreceptor binding and internalization assays were carried out as reported previously (10) using HPLC-purified radioiodinated compounds. Binding affinities [dissociation constant (Kd)] of each receptor were calculated from Scatchard analysis of radioreceptor binding assays (using radioiodinated TIP39 as tracer and unlabeled TIP39 for competition), as described previously (10, 13). To measure the distribution of PTH over time, cells were incubated with radioiodinated PTH (~0.1 nM) for 2 h at 4 C. Cells were then washed twice with cold PBS and incubated in DMEM-10% fetal bovine serum at 37 C. At the indicated time points, the medium was collected to measure the amount of radioligand spontaneously released from the receptor. The amount of radioligand bound to cell membrane receptors was evaluated by two washes with 50 mM glycine-150 mM NaCl at pH 3 (to release radioligand from receptor), and the amount of internalized radioligand was measured after cell lysis with 0.1 M NaOH. Results are expressed as the percentage of the total cell-associated radiolabeled PTH(1–34).

Ligand-stimulated cAMP formation was determined in subconfluent cell cultures in the presence of 1 mM of the phosphodiesterase inhibitor 3-isobutyl-1-methylxantine (IBMX) as previously described (10). Briefly, ligand-stimulated cAMP accumulation was measured in cells preincubated for 15 min with IBMX (1 mM) and subsequently exposed 15 min at 37 C to various concentrations of the appropriate ligand. To evaluate desensitization of cAMP signaling, cells were preincubated 30 min with agonist, washed three times with PBS, and rechallenged with PTH(1–34) or TIP39 (100 nM) at times indicated in the figures. The percentage of desensitization was calculated using the formula: [1 – (rechallenge – residual)/acute] x 100 (13, 36). Alternatively, cAMP production was measured in the absence of IBMX, by stopping the reaction using HCl (0.1 N) and measuring cellular cAMP by RIA using the direct cAMP enzyme immunoassay kit (Sigma, Buchs, Switzerland).

Plasmid Constructions
Cloning, ligations, transformations in Escherichia coli XL1 blue strain, and DNA minipreparations were carried out according to Sambrook et al. (37). Plasmid DNA was prepared using QIAGEN kits (Basel, Switzerland). PCRs were performed using pFU DNA Polymerase (Stratagene, Basel, Switzerland). The temperature-cycling protocol was: 94 C for 1 min, 55 C for 40 sec, and 72 C for 4 min for 35 cycles. The reactions were concluded by a 10-min elongation at 72 C. Oligonucleotides were purchased from MWG-Biotech GmbH (Ebersberg, Germany). All reagents were of the highest purity available from laboratory suppliers.

The coding sequences of human PTH1R and PTH2R cDNA were amplified with forward primers (SD22 and SD24, respectively; see Fig. 1AGo) encoding a 5'-HindIII site followed by a consensus Kozak, and reverse primers, respectively: SD23 encoding a 5'-EcoRI site and SD25 encoding a 5'-XhoI site (Fig. 1AGo). The PCR products digested by HindIII and EcoRI, or by HindIII and XhoI, were cloned in pZeoSV2(+) (Invitrogen, Basel, Switzerland). All subsequent mutants and chimeras of the receptors were derived from these two plasmids.

Truncated PTH2R receptors were constructed using PCR amplification. The oligo SD02 (bp 1111–1132) was used as forward primer, and the oligos SD21 (bp 1279–1259), SD96 (bp 1329–1309), and SD76 (bp 1473–1453) were used as reverse primers to generate PCR fragments. The oligos SD21, SD96, and SD76 contain an additional XhoI site in their 5'-end. We replaced the SapI–XhoI fragment of PTH2R by the PCR fragments digested by SapI and XhoI, to obtain plasmids TR426, TR443, and TR457 (Fig. 1DGo).

We replaced the four proximal serine residues (S429, S434, S445, and S450) of the cytoplasmic tail in TR457 with alanine using the QuikChange site-directed mutagenesis kit (Stratagene) and the appropriate oligonucleotides primers and following the recommendations of the manufacturer. The resulting plasmid was named TR457S>A.

To create deletions in the IC3 of PTH2R (Fig. 1CGo), we amplified the DNA fragments located upstream and downstream of the sequence to be removed, using two sets of primers. The DNA template was PTH2R. To create D(341–349), we used SD08 (bp 751–771) paired with SD107 (bp 1021–1000), and SD106 (bp 1048–1068) paired with SD25. Primers SD107 and SD106 contain a SpeI site in their 5'-end. The PCR fragment (SD08; SD107) was digested by BamH1 and SpeI, and the PCR fragment (SD106; SD23) was digested by SpeI and XhoI. The fragments were ligated together and inserted into the PTH2R to replace the wild-type restriction fragment BamH1–XhoI.

To generate D(346–355), we used SD08 paired with SD109 (bp 1035–1015) and SD108 (bp 1066–1088) paired with SD25. Primers SD109 and SD108 contain a BglII site in their 5'-end. The PCR fragment (SD08; SD109) was digested by BamH1 and BglII, and the PCR fragment (SD108; SD23) was digested by BglII and XhoI. The fragments were ligated together and inserted into the PTH2R to replace the wild-type restriction fragment BamH1–XhoI. The third deletion, D(353–360), was done using the QuikChange kit, and the appropriate oligonucleotides primers removing DNA sequence comprised between bp 1357 and bp 1080.

To generate C-terminal R2-C1 receptor chimera, we first amplify the PTH1R C terminus with primers SD03 (AATGGCGAGGTACAAGCTGAG) and BGH reverse primer (complementary to vector DNA sequence) and cut the product by RsaI and ApaI. We then amplified a PTH2R fragment with SD02 and SD06 (CTCTGCCTGTACCTCTCCATTGCA), in which a RsaI site has been incorporated. The second PCR product was digested with SapI and RsaI. Both fragments were ligated together into PTH2R, cut by SapI and ApaI. Indeed in PTH2R-C1, the first 419 aa of PTH2R have been fused to the last 127 aa of PTH1R (Fig. 1BGo).

To generate the double chimera, R2-(IC3)1-C1, we performed site-directed mutagenesis using the QuikChange kit (Stratagene). We performed three rounds of mutagenesis using PTH2R-C1 as first template. We first changed aa VGH (aa 350–352) into GCRC, then K356 in Q, and finally IW (aa 344–345) in LR.

The N-terminal chimera N1-R2-(EC3)1 has been previously described [P2 -N3LPrP, (14)].

The plasmid encoding rat ß-arrestin1 tagged with GFP (ß-arrestin1-GFP; ß-arrestin coding sequence in pEGFP-N1) was kindly provided by Dr. Alexander Oksche (Forschungsinstitut für Moleculare Pharmacologie, Berlin, Germany). The plasmid encoding rat ß-arrestin2-GFP was a generous gift of Dr. Marc Caron (Duke University, Durham, NC). To get both arrestins tagged with the same variant of GFP and cloned in the same vector, we amplified the coding sequence of ß-arrestin2 with forward primer encoding a 5'HindIII site followed by a consensus Kozak sequence and reverse primer encoding a 5'-SacII site. The PCR product digested by HindIII and SacII was cloned in pEGFP-N1. The resulting plasmid was named ß-arr2-GFP. PKCß-GFP was purchased from CLONTECH (Basel, Switzerland). All the others GFP-tagged constructions were produced by amplifying the coding region without stop codon and inserted it into the pcDNA3.1/V5/His-Topo plasmid (Invitrogen, Basel, Switzerland). We selected the clones in which the insert had the correct orientation, cut out the insert from the resulting plasmid by digestion with HindIII and SacII, and ligated it to pEGFP-N1 vector (CLONTECH) opened by HindIII and SacII digestion. DNA sequence analysis of each construct confirmed the absence of PCR-introduced mutations.


    ACKNOWLEDGMENTS
 
We thank Drs. Jeffrey Benovic (Thomas Jefferson University, Philadelphia, PA), Orson Moe (University of Texas Southwestern Medical Center, Dallas, TX), Marc Caron (Duke University, Durham, NC), and Alexander Oksche (Berlin University, Berlin, Germany) for kindly providing cDNAs for ß-arrestin1(319–418), [K44A]dynamin, ß-arrestin2-GFP and ß-arrestin1-GFP, respectively. We thank Madeleine Lachize, Fanny Cavat, and Raphaël Miguet for excellent technical help.


    FOOTNOTES
 
A.B. and D.M. contributed equally to this work and should both be considered first authors.

This work was supported by grants from the Swiss National Science Foundation (Fond National Suisse Professorship Grant 631-62937.00 to S.L.F.) and from the National Institutes of Health (Grant DK-62078 to A.B.).

Abbreviations: aa, Amino acids; EC3, third extracellular loop; GFP, green fluorescent protein; GPCRs, G protein coupled receptors; HEK, human embryonic kidney; IC3, third intracellular loop; IBMX: 3-isobutyl-1-methyxanthine; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; PTH1R, PTH type 1 receptor; PTH2R, PTH type 2 receptor; TIP39, tuberoinfundibular peptide of 39 residues.

Received for publication December 18, 2003. Accepted for publication February 18, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Luttrell LM, Lefkowitz RJ 2002 The role of ß-arrestins in the termination and transduction of G-protein-coupled receptor signals. J Cell Sci 115:455–465[Abstract/Free Full Text]
  2. Segre G, Goldring S 1993 Receptors for secretin, calcitonin, parathyroid hormone (PTH)/PTH-related peptide, vasoactive intestinal peptide, glucagon-like peptide 1, growth hormone-releasing hormone, and glucagon belong to a newly discovered G-protein-linked receptor family. Trends Endocrinol Metab 4:309–314[Medline]
  3. Behar V, Pines M, Nakamoto C, Greenberg Z, Bisello A, Stueckle SM, Bessalle R, Usdin TB, Chorev M, Rosen-blatt M, Suva LJ 1996 The human PTH2 receptor: binding and signal transduction properties of the stably expressed recombinant receptor. Endocrinology 137:2748–2757[Abstract]
  4. Usdin TB, Hoare SR, Wang T, Mezey E, Kowalak JA 1999 TIP39: a new neuropeptide and PTH2-receptor agonist from hypothalamus. Nat Neurosci 2:941–943[CrossRef][Medline]
  5. Usdin TB, Gruber C, Bonner TI 1995 Identification and functional expression of a receptor selectively recognizing parathyroid hormone, the PTH2 receptor. J Biol Chem 270:15455–15458[Abstract/Free Full Text]
  6. Ferrari SL, Behar V, Chorev M, Rosenblatt M, Bisello A 1999 Endocytosis of ligand-human parathyroid hormone receptor 1 complexes is protein kinase C-dependent and involves ß-arrestin2. Real-time monitoring by fluorescence microscopy. J Biol Chem 274:29968–29975[Abstract/Free Full Text]
  7. Castro M, Dicker F, Vilardaga JP, Krasel C, Bernhardt M, Lohse MJ 2002 Dual regulation of the parathyroid hormone (PTH)/PTH-related peptide receptor signaling by protein kinase C and ß-arrestins. Endocrinology 143:3854–3865[Abstract/Free Full Text]
  8. Vilardaga JP, Frank M, Krasel C, Dees C, Nissenson RA, Lohse MJ 2001 Differential conformational requirements for activation of G proteins and the regulatory proteins arrestin and G protein-coupled receptor kinase in the G protein-coupled receptor for parathyroid hormone (PTH)/PTH-related protein. J Biol Chem 276:33435–33443[Abstract/Free Full Text]
  9. Pines M, Adams AE, Stueckle S, Bessalle R, Rashti-Behar V, Chorev M, Rosenblatt M, Suva LJ 1994 Generation and characterization of human kidney cell lines stably expressing recombinant human PTH/PTHrP receptor: lack of interaction with a C-terminal human PTH peptide. Endocrinology 135:1713–1716[Abstract]
  10. Ferrari SL, Bisello A 2001 Cellular distribution of constitutively active mutant parathyroid hormone (PTH)/PTH-related protein receptors and regulation of cyclic adenosine 3',5'-monophosphate signaling by ß-arrestin2. Mol Endocrinol 15:149–163[Abstract/Free Full Text]
  11. Feng X, Zhang J, Barak LS, Meyer T, Caron MG, Hannun YA 1998 Visualization of dynamic trafficking of a protein kinase C ßII/green fluorescent protein conjugate reveals differences in G protein-coupled receptor activation and desensitization. J Biol Chem 273:10755–10762[Abstract/Free Full Text]
  12. Usdin TB, Bonner TI, Hoare SR 2002 The parathyroid hormone 2 (PTH2) receptor. Receptors Channels 8:211–218[CrossRef][Medline]
  13. Bisello A, Chorev M, Rosenblatt M, Monticelli L, Mierke DF, Ferrari SL 2002 Selective ligand-induced stabilization of active and desensitized parathyroid hormone type 1 receptor conformations. J Biol Chem 277:38524–38530[Abstract/Free Full Text]
  14. Clark JA, Bonner TI, Kim AS, Usdin TB 1998 Multiple regions of ligand discrimination revealed by analysis of chimeric parathyroid hormone 2 (PTH2) and PTH/PTH-related peptide (PTHrP) receptors. Mol Endocrinol 12:193–206[Abstract/Free Full Text]
  15. Vilardaga JP, Krasel C, Chauvin S, Bambino T, Lohse MJ, Nissenson RA 2002 Internalization determinants of the parathyroid hormone receptor differentially regulate ß-arrestin/receptor association. J Biol Chem 277:8121–8129[Abstract/Free Full Text]
  16. Krupnick JG, Benovic JL 1998 The role of receptor kinases and arrestins in G protein-coupled receptor regulation. Annu Rev Pharmacol Toxicol 38:289–319[CrossRef][Medline]
  17. Damke H, Baba T, Warnock DE, Schmid SL 1994 Induction of mutant dynamin specifically blocks endocytic coated vesicle formation. J Cell Biol 127:915–934[Abstract/Free Full Text]
  18. Sneddon WB, Syme CA, Bisello A, Magyar CE, Rochdi MD, Parent JL, Weinman EJ, Abou-Samra AB, Friedman PA 2003 Activation-independent parathyroid hormone receptor internalization is regulated by NHERF1 (EBP50). J Biol Chem 278:43787–43796[Abstract/Free Full Text]
  19. Cheung AH, Dixon RA, Hill WS, Sigal IS, Strader CD 1990 Separation of the structural requirements for agonist-promoted activation and sequestration of the ß-adrenergic receptor. Mol Pharmacol 37:775–779[Abstract]
  20. Hunyady L, Bor M, Balla T, Catt KJ 1994 Identification of a cytoplasmic Ser-Thr-Leu motif that determines agonist-induced internalization of the AT1 angiotensin receptor. J Biol Chem 269:31378–31382[Abstract/Free Full Text]
  21. Willins DL, Berry SA, Alsayegh L, Blackstrom JR, Sanders-Bush E, Friedman L, Roth BL 1999 Clozapine and other 5-hydroxytryptamine-2A receptor antagonists alter the subcellular distribution of 5-hydroxytryptamine-2A receptors in vitro and in vivo. Neuroscience 91:599–606[CrossRef][Medline]
  22. Bhowmick N, Narayan P, Puett D 1998 The endothelin subtype A receptor undergoes agonist- and antagonist-mediated internalization in the absence of signaling. Endocrinology 139:3185–3192[Abstract/Free Full Text]
  23. Roettger BF, Ghanekar D, Rao R, Toledo C, Yingling J, Pinon D, Miller LJ 1997 Antagonist-stimulated internalization of the G protein-coupled cholecystokinin receptor. Mol Pharmacol 51:357–362[Abstract/Free Full Text]
  24. Usdin TB 2000 The PTH2 receptor and TIP39: a new peptide-receptor system. Trends Pharmacol Sci 21:128–130[CrossRef][Medline]
  25. Piserchio A, Usdin T, Mierke DF 2000 Structure of tuberoinfundibular peptide of 39 residues. J Biol Chem 275:27284–27290[Abstract/Free Full Text]
  26. Rolz C, Pellegrini M, Mierke DF 1999 Molecular characterization of the receptor-ligand complex for parathyroid hormone. Biochemistry 38:6397–6405[CrossRef][Medline]
  27. Dale LB, Bhattacharya M, Seachrist JL, Anborgh PH, Ferguson SS 2001 Agonist-stimulated and tonic internalization of metabotropic glutamate receptor 1a in human embryonic kidney 293 cells: agonist-stimulated endocytosis is ß-arrestin1 isoform-specific. Mol Pharmacol 60:1243–1253[Abstract/Free Full Text]
  28. Paing MM, Stutts AB, Kohout TA, Lefkowitz RJ, Trejo J 2002 ß -Arrestins regulate protease-activated receptor-1 desensitization but not internalization or down-regulation. J Biol Chem 277:1292–1300[Abstract/Free Full Text]
  29. Perry SJ, Baillie GS, Kohout TA, McPhee I, Magiera MM, Ang KL, Miller WE, McLean AJ, Conti M, Houslay MD, Lefkowitz RJ 2002 Targeting of cyclic AMP degradation to ß 2-adrenergic receptors by ß-arrestins. Science 298:834–836[Abstract/Free Full Text]
  30. Raiborg C, Rusten TE, Stenmark H 2003 Protein sorting into multivesicular endosomes. Curr Opin Cell Biol 15:446–455[CrossRef][Medline]
  31. Dicker F, Quitterer U, Winstel R, Honold K, Lohse MJ 1999 Phosphorylation-independent inhibition of parathyroid hormone receptor signaling by G protein-coupled receptor kinases. Proc Natl Acad Sci USA 96:5476–5481[Abstract/Free Full Text]
  32. Huang Z, Chen Y, Pratt S, Chen TH, Bambino T, Nissenson RA, Shoback DM 1996 The N-terminal region of the third intracellular loop of the parathyroid hormone (PTH)/PTH-related peptide receptor is critical for coupling to cAMP and inositol phosphate/Ca2+ signal transduction pathways. J Biol Chem 271:33382–33389[Abstract/Free Full Text]
  33. Eichinger A, Fiaschi-Taesch N, Massfelder T, Fritsch S, Barthelmebs M, Helwig JJ 2002 Transcript expression of the tuberoinfundibular peptide (TIP)39/PTH2 receptor system and non-PTH1 receptor-mediated tonic effects of TIP39 and other PTH2 receptor ligands in renal vessels. Endocrinology 143:3036–3043[Abstract/Free Full Text]
  34. Ward HL, Small CJ, Murphy KG, Kennedy AR, Ghatei MA, Bloom SR 2001 The actions of tuberoinfundibular peptide on the hypothalamo-pituitary axes. Endocrinology 142:3451–3456[Abstract/Free Full Text]
  35. Sugimura Y, Murase T, Ishizaki S, Tachikawa K, Arima H, Miura Y, Usdin TB, Oiso Y 2003 Centrally administered tuberoinfundibular peptide of 39 residues inhibits arginine vasopressin release in conscious rats. Endocrinology 144:2791–2796[Abstract/Free Full Text]
  36. Riccobene TA, Omann GM, Linderman JJ 1999 Modeling activation and desensitization of G-protein coupled receptors provides insight into ligand efficacy. J Theor Biol 200:207–222[CrossRef][Medline]
  37. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
  38. Corpet F 1988 Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16:10881–10890[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
R. Lu, Y. Li, Y. Zhang, Y. Chen, A. D. Shields, D. G. Winder, T. Angelotti, K. Jiao, L. E. Limbird, Y. Zhou, et al.
Epitope-tagged Receptor Knock-in Mice Reveal That Differential Desensitization of {alpha}2-Adrenergic Responses Is because of Ligand-selective Internalization
J. Biol. Chem., May 8, 2009; 284(19): 13233 - 13243.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Jorgensen, V. Kubale, M. Vrecl, T. W. Schwartz, and C. E. Elling
Oxyntomodulin Differentially Affects Glucagon-Like Peptide-1 Receptor beta-Arrestin Recruitment and Signaling through G{alpha}
J. Pharmacol. Exp. Ther., July 1, 2007; 322(1): 148 - 154.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Rey, D. Manen, R. Rizzoli, J. Caverzasio, and S. L. Ferrari
Proline-rich Motifs in the Parathyroid Hormone (PTH)/PTH-related Protein Receptor C Terminus Mediate Scaffolding of c-Src with beta-Arrestin2 for ERK1/2 Activation
J. Biol. Chem., December 15, 2006; 281(50): 38181 - 38188.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. Jorgensen, L. Martini, T. W. Schwartz, and C. E. Elling
Characterization of Glucagon-Like Peptide-1 Receptor {beta}-Arrestin 2 Interaction: A High-Affinity Receptor Phenotype
Mol. Endocrinol., March 1, 2005; 19(3): 812 - 823.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bisello, A.
Right arrow Articles by Ferrari, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bisello, A.
Right arrow Articles by Ferrari, S. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*PARATHYROID HORMONE
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals