| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Internal Medicine and Pharmacology (P.J., L.Z., K.L.P.), University of Texas Southwestern Medical Center, Dallas, Texas 75390-8857; Department of Fine Morphology (Y.I.), Yokohama City University Graduate School of Medicine, Yokohama 236-0004, Japan; Department of Molecular Genetics (S.P.J., R.R.B.), M. D. Anderson Cancer Center, Houston, Texas 77030; Departments of Endocrinology and Cell Biology (D.G.d.R.), Utrecht University Faculty of Biology and University Medical Center, Padualaan, Utrecht 3584 CH, The Netherlands; and Department of Internal Medicine (A.P.N.T.), Erasmus University, Rotterdam 3000 DR, The Netherlands
Address all correspondence and requests for reprints to: Dr. Keith L. Parker, University of Texas Southwestern Medical Center, Room J6.106, Dallas, Texas 75390-8857. E-mail: keith.parker{at}utsouthwestern.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and aromatase KO mice. Collectively, these studies establish definitively that SF-1 expression in the gonads is essential for normal reproductive development and function. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
SF-1’s roles in specific gonadal cell types have not been fully defined. Promoter analyses in transfected cells and transgenic mice suggest that SF-1 directly regulates gonadal expression of multiple genes that are essential for reproduction. To date, however, the regression of gonads just as sexual differentiation would normally occur has made it impossible to show that SF-1 directly regulates these genes in vivo. Moreover, a 46 XX human subject with adrenal insufficiency caused by a loss-of-function mutation of SF-1 had apparently normal ovaries on magnetic resonance imaging, raising doubts about the requirement for SF-1 in human ovarian development (10). Finally, recent reports have suggested that the closely related orphan nuclear receptor LRH-1—rather than SF-1—is the critical regulator of transcription in granulosa cells (11, 12, 13), although this remains the subject of ongoing debate (14).
To begin to explore specific in vivo roles of SF-1 in discrete gonadal cell lineages, we have used the Cre-loxP system to inactivate SF-1 in a cell-selective manner at a relatively early stage of gonadal development. Our results provide a novel genetic model of primary hypogonadism and establish definitively that gonadal expression of SF-1 is essential for normal reproductive development.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). Coupled with our previous analyses (15), these results suggest that the Amhr2-Cre allele predominantly targets Cre expression to the Leydig cell lineage in the testes. In the adult ovaries (Fig. 1), granulosa cells within the follicles were the only cells that expressed ß-galactosidase. This expression persisted in a subset of cells in the corpora lutea, consistent with the respective contributions of granulosa and theca cells.
|
At birth, male and female gonad-specific SF-1 KO mice had external genitalia that were indistinguishable and resembled those of WT females (data not shown). However, both male and female gonad-specific SF-1 KO mice were sterile and exhibited no postnatal sexual maturation. The male gonad-specific SF-1 KO mice had markedly hypoplastic testes and internal genital structures, and rather than descending fully to the normal position, their testes remained at the level of the bladder within the abdominal cavity (Fig. 2). These findings argue that production by the testes of hormones that mediate testes descent and virilize the Wolffian ducts in utero is impaired. In contrast, we found no structures derived from the Müllerian ducts (e.g. oviducts or uterus, data not shown), suggesting that the testes can still make AMH.
|
Histological analyses confirmed the marked testes abnormalities seen in Fig. 2
. Although the seminiferous tubules do not express the Amhr2-Cre allele at high levels (Fig. 1), they nonetheless exhibited marked structural abnormalities in adult gonad-specific SF-1 KO mice. The lumens of the seminiferous tubules failed to open and spermatogonia never developed into mature sperm (Fig. 3). The failure of the lumens to open presumably reflects a defect in Sertoli cell secretion of fluid, a process that is known to be androgen dependent (19). Consistent with this, preliminary analyses of adult gonad-specific SF-1 KO males showed that their plasma testosterone levels were indistinguishable from those of prepubertal WT males (Jeyasuria, P., unpublished observation). In the interstitial region around the seminiferous tubules, the testes contained presumptive Leydig cells (Fig. 3), suggesting that the absence of SF-1 expression in Leydig cells does not cause their death. Although we cannot exclude nonspecific effects due to the intraabdominal location of the testes, it is plausible that the impaired germ cell maturation and luminal opening result indirectly from impaired Leydig cell function due to the absence of SF-1.
|
). Similar hemorrhagic cysts are seen in mice with gene knockouts of estrogen receptor (20) and aromatase (21), raising the possibility that the granulosa cell-specific KO of SF-1 in the ovaries interferes with estrogen production. Further studies will be needed to define at a molecular level the specific defects in the ovaries that are associated with the granulosa cell-specific KO of SF-1.
Testes Abnormalities in Gonad-Specific SF-1 KO Mice Precede Impaired Testes Descent
It is well recognized that impaired testes descent, or cryptorchidism, impairs spermatogenesis, resulting in decreased testes size and infertility (22). We reasoned that examining the embryonic testes before the time that they normally descend would allow us to differentiate between direct effects of impaired SF-1 expression and secondary effects of cryptorchidism. In the normal process of testes differentiation, the testes form testes cords, containing fetal Sertoli cells and primordial germ cells, surrounded by the interstitial region containing Leydig cells. The Sertoli cells produce AMH, which mediates regression of the Müllerian ducts, whereas the Leydig cells make testosterone and insulin-like peptide 3 (Insl3). Testosterone virilizes the internal and external genitalia and also contributes to the later stages of testes descent, whereas Insl3 is essential for earlier stages of testes descent (23, 24).
To define potential primary effects of the gonad-specific KO of SF-1, we examined their testes at two stages of development (Fig. 4). At E14.5, both the WT and SF-1 KO testes were located adjacent to the kidneys, but the KO testes were much smaller and did not contain distinct testes cords. At E16.5, the SF-1 KO testes again were smaller than the WT testes but had organized into testicular cords. The delayed organization of the testes cords suggests that the normal events in the differentiation of the testes are delayed in mice lacking SF-1 in Leydig cells. Collectively, these developmental studies argue strongly that the abrogation of SF-1 expression in Leydig cells impairs testes development independent of cryptorchidism.
|
). At E16.5, the ovaries and internal genital structures were again indistinguishable in WT and SF-1 KO mice. Thus, the marked structural abnormalities observed in the adult ovaries of gonad-specific SF-1 KO mice very likely reflect impaired SF-1 expression during the postnatal period rather than changes that occur in utero.
Gonad-Specific KO of SF-1 Decreases Testes Expression of Putative SF-1 Target Genes that Mediate Male Sex Differentiation
The impaired testes descent in gonad-specific SF-1 KO mice (Fig. 2) suggests that their biosynthesis of testosterone and/or Insl3 is diminished, whereas regression of the Müllerian ducts suggests that AMH biosynthesis is preserved. To examine directly the expression of key mediators of sex differentiation, we used specific antisera to examine their expression. At E14.5 (Fig. 5), fetal Leydig cells in the interstitial region of the WT testes expressed the cholesterol side-chain cleavage enzyme (Cyp11a), which catalyzes the first reaction in testosterone production, whereas Cyp11a expression was absent in gonad-specific SF-1 KO mice. Although the SF-1 KO testes did not contain distinct testes cords at E14.5 (Fig. 4), Sertoli cells of both WT and SF-1 KO testes expressed AMH. Consistent with the analyses with the Cre reporter allele, Sertoli cells of both WT and SF-1 KO testes expressed SF-1 (indicated by the weaker signal within the testes cords), whereas stronger expression of SF-1 was seen in Leydig cells of WT but not SF-1 KO testes.
|
). Thus, gonad-specific KO of SF-1 is associated with normal Sertoli cell expression of AMH but markedly decreased expression by Leydig cells of two other SF-1 target genes. These studies reveal a selective impairment of SF-1-mediated transcription of target genes in Leydig cells but not Sertoli cells, thus demonstrating essential roles of SF-1 in expression of two early components of the steroidogenic complex in vivo.
Gonad-Specific KO of SF-1 Is Associated with Decreased Cell Proliferation in Somatic Cells of the Testes
The decreased size of the testes in gonad-specific SF-1 KO mice might reflect either decreased cell proliferation or increased cell death. To examine the effect of the Leydig cell-specific KO of SF-1 on cell proliferation, we performed bromodeoxyuridine (BrdU)-labeling experiments as described in Materials and Methods. As described (27), somatic cells in the embryonic testes proliferate at a considerably higher rate than do those in embryonic ovaries (Fig. 6). In contrast, somatic cells in male mice with Leydig cell-specific KO of SF-1 exhibited significantly less proliferation than did the WT testes (P < 0.05), with proliferation comparable to that seen in the WT and gonad-specific SF-1 KO ovaries. These findings indicate that the decreased size of the embryonic testes in the gonad-specific SF-1 KO mice results at least partly from decreased proliferation of somatic cells in utero. In contrast, proliferation of germ cells was comparable in all embryos examined.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Initial analyses of Amhr2 expression indicated that it is expressed not only in the Müllerian ducts but also in Sertoli cells in the testes and granulosa cells in the ovaries (28). A subsequent report noted that Amhr2 also was expressed in Leydig cells (29). Of note, these sites of Amhr2 expression in the gonads parallel those where SF-1 is expressed, and SF-1 activates the Amhr2 promoter in transient transfection experiments via a SF-1-responsive element (30, 31). The R26R reporter allele employed here is particularly useful for lineage tracing because ß-galactosidase expression persists even if Cre expression driven by the Amhr2 promoter ceases when the SF-1 allele is inactivated. Based on analyses of ß-galactosidase expression shown in Fig. 1, the predominant sites of gonadal expression of the Amhr2-Cre knock-in allele are Leydig cells in the testes and granulosa cells in the ovaries.
The SF-1 inactivation mediated by Amhr2-Cre causes a developmental delay in utero in males and impaired postnatal gonadal function in both sexes but does not cause complete loss of the gonads. The conditional targeting strategy used here presumably maintains SF-1 expression throughout the indifferent gonad stage, which may allow the gonads to escape apoptotic degeneration. Alternatively, the loss of testes in the original SF-1 KO mice may result from the selective lack of SF-1 in pre-Sertoli or Sertoli cells during early stages of testis differentiation; in this case, studies that examine the phenotype of Sertoli cell-specific SF-1 KO mice should provide novel insights into the molecular basis for testes regression.
Our data argue strongly that SF-1 in Leydig cells is essential for expression of Cyp11a and StAR, providing the first evidence that SF-1 is essential for the expression of these target genes in vivo. Previous transgenic studies with AMH suggested that SF-1 was important, but not essential, for AMH expression by Sertoli cells during gonadal development (32). Although further studies are needed to extend these observations, we anticipate that many, if not most, gonadal genes regulated by SF-1 in transient transfection assays are bona fide target genes that it regulates directly in vivo. Of note, still undefined by our studies is the direct role of SF-1 in regulating the expression of Insl3, which stimulates gubernacular development to mediate early stages of testes descent. Because the testes in Insl3 KO mice remain at their initial position adjacent to the kidneys (23, 24), the partial descent of the testes to the level of the bladder in gonad-specific SF-1 KO mice suggests that they retain at least some capacity to make Insl3.
Impaired Leydig cell function has been described in several KO mouse models, including those lacking the transcription factor Arx (33), those deficient in the type a receptor for platelet-derived growth factor (34), and those lacking desert hedgehog (35). A common feature of these models is decreased expression of SF-1 accompanied by impaired differentiation of fetal Leydig cells and decreased proliferation in the testes. Consistent with this, our results (Fig. 6) demonstrate impaired proliferation in the gonad-specific SF-1 KO testes, but not ovaries. Despite this, however, presumptive Leydig cells are found in the interstitial region of the adult gonad-specific SF-1 KO testes (Fig. 3), showing that Leydig cells can survive in the absence of SF-1. Studies in these other systems, together with our results, place SF-1 downstream of these signaling events in a developmental program that mediates male sex differentiation, and an important goal for future studies is to determine whether these genes activate SF-1 expression directly.
An unresolved issue in the ovary has been the relative roles of SF-1 and the highly related orphan nuclear receptor LRH-1 (officially designated Nr5a2). Although initial studies suggested that SF-1 was expressed in granulosa cells (36), subsequent studies proposed that the major regulator of transcription in granulosa cells was LRH-1 (11, 12, 13), with SF-1 predominantly regulating gonadal function in theca/interstitial cells. The severe reproductive phenotype seen in female gonad-specific SF-1 KO mice—presumably reflecting impaired SF-1 expression in granulosa cells rather than theca cells (Fig. 1)—argues strongly for important roles of SF-1 in estrogen production by granulosa cells in vivo. Similar conclusions were recently reached in studies that examined levels of SF-1 protein—rather than transcripts—in the granulosa cells (14). Although studies involving tissue-specific KO of LRH-1 are needed, it is plausible that both members of the Nr5 family play important, nonredundant roles in granulosa cells within ovarian follicles.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Mice were genotyped by PCR assays using the primer sets detailed below. Full details about the primers and conditions for PCR genotyping are available from the authors upon request. The sex of the embryos was determined using primers for Zfy: forward (CCTATTGCATGGACAGCAGCTTATG) and reverse (GACTAGACATGTCTTAACATCTGTCC). The WT and N SF-1 alleles were detected using primers as described (5): SF-1 forward (TGACTAGCAACCACCTTGCC), SF-1 reverse (ACAAGCATTACACGTGCACC), and SF-1 Neo (AGGTGAGATGACAGGAGATC). The F SF-1 allele was detected using the primers: Flox SF-1 Neo (TGAGATGACAGGAGATTCTGC), forward loxP (CCAGGAAGACAACTTCTCCGT), and reverse loxP (TGTCTCAGGGAGACCATGAG). PCR products were resolved by agarose gel electrophoresis and product sizes were determined relative to size markers.
Examination of Cre Expression Directed by the Amhr2-Cre Allele
The R26R reporter allele was used to examine sites of Cre expression directed by Amhr2-Cre. Adult mice carrying the Amhr2-Cre and R26R alleles were anesthetized and perfused with buffered 4% paraformaldehyde. Tissues were then removed, immediately frozen in OCT, and stored at –80 C. The tissues were sectioned at 15 µm with a cryostat and mounted and dried overnight at room temperature. Sections were postfixed in 4% paraformaldehyde for 2 min on ice and then washed with PBS, followed by histochemical detection of ß-galactosidase using solutions purchased from Specialty Media (Phillipsburg, NJ) according to the supplier’s protocols. Tissues were counterstained with hematoxylin/eosin (ovaries) or eosin (testes), and photomicrographs were taken with a Nikon Optiphot microscope with a digital capture camera (Microscopy Documentation System 290, Eastman Kodak, New Haven, CT). Images were directly downloaded to a Macintosh computer and contrast and color were adjusted with Photoshop 7 (Adobe Systems Inc., San Jose, CA).
Analyses of Adult Gonad-Specific SF-1 KO Mice
To examine the anatomy of the internal genitalia and testes, male mice at 8 wk of age and female mice at 6 wk of age were terminally anesthetized, and the abdominal cavity was opened to display the relevant structures for photography. For analyses of histology, adult male and female mice were anesthetized and perfused transcardially with buffered 4% paraformaldehyde. Tissues were then removed and fixed in Bouin’s solution overnight and then dehydrated through a series of alcohol washes followed by xylene, and then paraffin at 60 C. The tissues were embedded in paraffin and sectioned to 7 µm with a microtome, and then mounted on coated slides (Superfrost Plus, Fisher, Pittsburgh, PA) and dried overnight at 37 C. Slides were stained with hematoxylin/eosin using standard methods.
Developmental Analyses of Gonad-Specific SF-1 KO Mice
Male and female mice with the genotypes described above were paired at 1800 h, and females with a vaginal plug on the next morning were considered as E0.5. At the indicated stages, dams were anesthetized and embryos were harvested by Caesarian section, sectioned transversely at the level of the diaphragm, and the caudal halves were fixed in Bouin’s solution overnight and then processed as described above. The embryos were mounted in paraffin and serial 7-µm sagittal sections were prepared. Sections were stained with hematoxylin-eosin or used for immunohistochemical analyses. The amnion of each embryo was used to prepare genomic DNA for genotyping by PCR as described above.
For immunohistochemistry, sections were dewaxed and rehydrated. Sections from E14.5 embryos were also subjected to antigen retrieval by microwaving on full power for 5 min in 10 mM citrate buffer (pH 6.0). Endogenous peroxidase was blocked using 3% (vol/vol) hydrogen peroxidase in PBS for 5 min. Sections were incubated with primary antibodies diluted appropriately with blocking solution overnight at 4 C. For E14.5 samples, the primary antibodies included goat anti-AMH (sc-6886, Santa Cruz Biotechnology, Inc., Santa Cruz, CA; 1:5000 dilution), rabbit anti-Cyp11a (AB1244, Chemicon International, Inc., Temecula, CA; 1:5000 dilution), and rabbit antibovine SF-1 (a generous gift from K. Morohashi, National Institute for Basic Biology, Okazaki, Japan; 1:2000 dilution). For E16.5 samples, the primary antibodies included anti-StAR (a generous gift from B. Hales, University of Illinois at Chicago, Chicago, IL; 1:2000 dilution) and anti-AMH (a generous gift from D. McLaughlin and P. Donahoe, Duke University Medical Center, Durham, NC; 1:200 dilution). Reactions were developed with biotinylated secondary antibodies, and the Vectastain ABC Elite kit (Vector Laboratories, Burlingame, CA) according to the recommended protocol. Negative controls were prepared by substituting the primary antibody with normal goat or rabbit IgG and by omitting the primary and/or the secondary antibody. Negative control staining remained at background levels.
To analyze proliferation in the gonads from WT and gonad-specific SF-1 KO mice, pregnant mothers were injected with BrdU (B-500, Sigma, St. Louis, MO; 50 mg/kg body weight) at E12.5 and embryos were harvested by caesarian section 1 h later as described (27). Embryos were fixed overnight in 4% paraformaldehyde, embedded, and sectioned as described above. The BrdU-labeled DNA was visualized with a 1:500 dilution of a monoclonal antibody against BrdU (Bu20a, Dako Corp., Carpinteria, CA). For each field, labeled nuclei were counted in serial sections in an area spanning a width of 150 mm and extending 35 mm from the top of the coelomic epithelium into the gonad. The numbers of fields counted/number of gonads examined for each data set were: (36/2) for WT-XY; (30/2) for KO-XY; (44/3) for WT-XX; (28/2) for KO-XX. Counts of BrdU-labeled nuclei within the set area were determined for total cells, somatic cells, and germ cells. Germ cells were identified by their large round nuclei and the somatic cell counts were obtained by subtracting the germ cell counts from the total cell counts. P values were obtained from two sample t tests assuming equal variances for comparison of WT-XY values to KO-XY values, for comparison of WT-XY values to WT-XX values, for comparison of WT-XX values to KO-XX values, and for comparison of WT-XX values to KO-XY values. Error bars show SD.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Abbreviations: AMH, Anti-Müllerian hormone; Amhr2, AMH type 2 receptor; BrdU, bromodeoxyuridine; Cyp11a, cholesterol side-chain cleavage enzyme; E, embryonic day; F, floxed; KO, knockout; N, null; SF-1, steroidogenic factor 1; StAR, steroidogenic acute regulatory protein; WT, wild-type.
Received for publication October 16, 2003. Accepted for publication April 19, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
mediates testis cord organization and fetal Leydig cell development in the XY gonad. Genes Dev 17:800–810NURSA Molecule Pages Link:
This article has been cited by other articles:
 |
|
 |
|
  S. A. Pangas, X. Li, L. Umans, A. Zwijsen, D. Huylebroeck, C. Gutierrez, D. Wang, J. F. Martin, S. P. Jamin, R. R. Behringer, et al. Conditional Deletion of Smad1 and Smad5 in Somatic Cells of Male and Female Gonads Leads to Metastatic Tumor Development in Mice Mol. Cell. Biol., January 1, 2008; 28(1): 248 - 257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Philibert, D. Zenaty, L. Lin, S. Soskin, F. Audran, J. Leger, J. C. Achermann, and C. Sultan Mutational analysis of steroidogenic factor 1 (NR5a1) in 24 boys with bilateral anorchia: a French collaborative study Hum. Reprod., December 1, 2007; 22(12): 3255 - 3261. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Andreu-Vieyra, R. Chen, and M. M. Matzuk Effects of Granulosa Cell-Specific Deletion of Rb in Inha-{alpha} Null Female Mice Endocrinology, August 1, 2007; 148(8): 3837 - 3849. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Labelle-Dumais, J.-F. Pare, L. Belanger, R. Farookhi, and D. Dufort Impaired Progesterone Production in Nr5a2+/ Mice Leads to a Reduction in Female Reproductive Function Biol Reprod, August 1, 2007; 77(2): 217 - 225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sher, N. Yivgi-Ohana, and J. Orly Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Lin, P. Philibert, B. Ferraz-de-Souza, D. Kelberman, T. Homfray, A. Albanese, V. Molini, N. J. Sebire, S. Einaudi, G. S. Conway, et al. Heterozygous Missense Mutations in Steroidogenic Factor 1 (SF1/Ad4BP, NR5A1) Are Associated with 46,XY Disorders of Sex Development with Normal Adrenal Function J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 991 - 999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws Ovarian follicle development and transgenic mouse models Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Pangas, X. Li, E. J. Robertson, and M. M. Matzuk Premature Luteinization and Cumulus Cell Defects in Ovarian-Specific Smad4 Knockout Mice Mol. Endocrinol., June 1, 2006; 20(6): 1406 - 1422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Weck and K. E. Mayo Switching of NR5A Proteins Associated with the Inhibin {alpha}-Subunit Gene Promoter after Activation of the Gene in Granulosa Cells Mol. Endocrinol., May 1, 2006; 20(5): 1090 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function Endocrinology, March 1, 2006; 147(3): 1322 - 1332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Roy and M. M Matzuk Deconstructing mammalian reproduction: using knockouts to define fertility pathways Reproduction, February 1, 2006; 131(2): 207 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Robert, L. J. Martin, and J. J. Tremblay The Orphan Nuclear Receptor NR4A1 Regulates Insulin-Like 3 Gene Transcription in Leydig Cells Biol Reprod, February 1, 2006; 74(2): 322 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Genetically Modified Animals in Endocrinology Endocr. Rev., December 1, 2005; 26(7): 985 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. TREMBLAY and N. M. ROBERT Role of Nuclear Receptors in INSL3 Gene Transcription in Leydig Cells Ann. N.Y. Acad. Sci., December 1, 2005; 1061(1): 183 - 189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. Park, J. J. Meeks, G. Raverot, L. E. Pfaff, J. Weiss, G. D. Hammer, and J. L. Jameson Nuclear receptors Sf1 and Dax1 function cooperatively to mediate somatic cell differentiation during testis development Development, May 15, 2005; 132(10): 2415 - 2423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Y. Park and J. L. Jameson Minireview: Transcriptional Regulation of Gonadal Development and Differentiation Endocrinology, March 1, 2005; 146(3): 1035 - 1042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Wilson, P. Jeyasuria, K. L. Parker, and P. Koopman The Transcription Factors Steroidogenic Factor-1 and SOX9 Regulate Expression of Vanin-1 during Mouse Testis Development J. Biol. Chem., February 18, 2005; 280(7): 5917 - 5923. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-J. Lan, X. Xu, and A. J. Cooney Differential Oocyte-Specific Expression of Cre Recombinase Activity in GDF-9-iCre, Zp3cre, and Msx2Cre Transgenic Mice Biol Reprod, November 1, 2004; 71(5): 1469 - 1474. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||
