help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2004-0005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data Files
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ousova, O.
Right arrow Articles by Moisan, M.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ousova, O.
Right arrow Articles by Moisan, M.-P.
Molecular Endocrinology 18 (7): 1687-1696
Copyright © 2004 by The Endocrine Society

Corticosteroid Binding Globulin: A New Target for Cortisol-Driven Obesity

Olga Ousova, Véronique Guyonnet-Duperat, Nathalie Iannuccelli, Jean-Pierre Bidanel, Denis Milan, Carine Genêt, Bastien Llamas, Martine Yerle, Joël Gellin, Patrick Chardon, Agnès Emptoz-Bonneton, Michel Pugeat, Pierre Mormède and Marie-Pierre Moisan

Laboratoire de Neurogénétique et Stress (O.O., V.G.-D., B.L., P.M., M.-P.M.), Institut National de la Recherche Agronomique (INRA), Unité Mixte de Recherche 1243-Institut National de la Santé et de la Recherche Médicale (INSERM) Unité 471, Université Victor Segalen Bordeaux 2, Institut François Magendie, 33077 Bordeaux cédex, France; Laboratoire de Génétique Cellulaire (N.I., D.M., C.G., M.Y., J.G.), Centre de Recherche INRA de Toulouse-Auzeville, 31326 Castanet Tolosan cédex France; Station de Génétique Quantitative et Appliquée (J.-P.B.), INRA, 78352 Jouy-en-Josas cédex France; Laboratoire d’Etude et de Recherche sur les Génomes (P.C.), INRA, 78352 Jouy en Josas cédex, France; and INSERM Equipe de Recherche et d’Innovation Méthodologique 322 (A.E.-B., M.P.), Hopital Debrousse, 69322 Lyon cédex 05, France

Address all correspondence and requests for reprints to: Marie-Pierre Moisan, Laboratoire de Neurogénétique et Stress, Institut National de la Santé et de la Recherche Médicale, Unité 471-Institut National de la Recherche Agronomique, Unité Mixte de Recherche 1243, Université Victor Segalen Bordeaux 2, Institut François Magendie, rue Camille Saint Saëns, 33077 Bordeaux cédex, France. E-mail: moisan{at}bordeaux.inserm.fr.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We present data suggesting that corticosteroid-binding globulin (CBG) may be the causal gene of a previously identified quantitative trait locus (QTL) associated with cortisol levels, fat, and muscle content in a pig intercross. Because Cbg in human and mouse maps in the region orthologous to the pig region containing this QTL, we considered Cbg as an interesting positional candidate gene because CBG plays a major role in cortisol bioavailability. Firstly, we cloned pig Cbg from a bacterial artificial chromosome library and showed by fluorescent in situ hybridization and radiation hybrid mapping that it maps on 7q26 at the peak of the QTL interval. Secondly, we detected in a subset of the pig intercross progeny a highly significant genetic linkage between CBG plasma binding capacity values and the chromosome 7 markers flanking the cortisol-associated QTL. In this population, CBG capacity is correlated positively to fat and negatively to muscle content. Thirdly, CBG capacity was three times higher in Meishan compared with Large White parental breeds and a 7-fold difference was found in Cbg mRNA expression between the two breeds. Overall, the data accumulated in this study point to Cbg gene as a key regulator of cortisol levels and obesity susceptibility.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CORTISOL, A GLUCOCORTICOID hormone, is involved in various important biological processes such as gluconeogenesis, lipid and protein metabolism, antiinflammatory action, and growth (1, 2). It is also a major component of the stress response. After exposure to stressful stimuli, cortisol is rapidly released from the adrenal glands to provide the energy necessary to the behavioral response to stress. By negative feedback control, cortisol levels go back to basal values when the stressful stimulus is controlled by the individual. If not, as in case of chronic stress, sustained high cortisol levels have deleterious effects on the organism (3, 4). Thus, abnormal cortisol levels and more generally the hypothalamic-pituitary-adrenal (HPA) axis are implicated in various pathologies such as obesity (5), constitutive sensitivity to inflammatory and autoimmune reactions (6) aging by the deleterious effects of glucocorticoid hormones on hippocampal neurons (7), or sensitization to drug addiction (8).

Genetic factors participate in the variability observed among individuals in HPA axis activity and reactivity as shown by twin studies (9, 10, 11) and by comparison of strains in mice and rats (12, 13).

In pigs, Mormède et al. (14) showed that the Meishan pig breed has plasma cortisol concentrations twice higher than a control breed derived from Landrace. In addition, Meishan pigs are obese and display a reduced growth rate that may be a consequence of their high cortisol levels. Further studies on the parental breeds confirmed that the Meishan pig has high plasma cortisol concentrations, twice higher than the Large White breed during the active phase of the diurnal cycle, i.e. between 0600 and 1200 h (15). Therefore, we considered the Meishan and Large White pigs as an interesting model to study HPA axis variability and its consequences on health.

We used a QTL genetic mapping analysis, i.e. a no-hypothesis-driven approach, to reveal genes influencing cortisol genetic variability and its relationships with obesity in a Meishan x Large White F2 intercross. A total of 626 piglets (6 wk old) were exposed to a novel environment stress and blood samples were collected before and after the test. Plasma concentrations of cortisol and ACTH of these blood samples were measured to evaluate HPA axis activity and reactivity (16). All these animals were evaluated for carcass composition (17). The same animals were genotyped with 137 microsatellite markers covering the porcine genome. Genetic linkage analysis was performed for each chromosome using a multiple marker maximum likelihood procedure assuming a half-sibling family structure for F2 pigs. A strong QTL on chromosome 7 near the marker S0101 was found associated with basal and post-stress cortisol levels in this intercross explaining 20% of the variance in the F2 population (18). The same region was found to be linked, although more weakly, to several parameters of carcass composition (19).

Goureau et al. (20) have reported on the human and porcine correspondence of chromosome segments using bidirectional chromosome painting. The cortisol-associated QTL flanked by the markers S0101 and Sw764 was localized on the porcine 7q2.4–7q2.6 region. Among the genes localized onto the orthologous human region (Hsap14q), the gene encoding CBG and localized on Hsap14q32.1 (21) retained our attention. Indeed, 90% of plasma cortisol is bound to CBG, which is an {alpha}-glycoprotein synthesized from liver. Because only free cortisol is active, CBG has a major role in cortisol bioavailability. Thus, Cbg was a good functional candidate for our QTL associated to cortisol levels because it had a high probability to map in our QTL region.

Here we report on molecular genetics analysis revealing that corticosteroid binding globulin (Cbg) may be the causal gene of the QTL associated with plasma cortisol levels, fat deposition, and muscle content.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pig Cbg Maps in the Locus Associated with Cortisol Levels
Because Cbg had been cloned in human, monkey, sheep, and mouse (22, 23, 24, 25), we were able to align the various sequences available using the multalin program (26) and to design consensus oligonucleotide primers from exon 2 to obtain a PCR fragment of pig Cbg. After checking the sequence of the PCR fragment for high homology with Cbg from the other species, we used these primers to map pig Cbg using a panel of radiation hybrids (27). We found that pig Cbg maps between the markers S0101 and Sw764 (Fig. 1Go), as does the cortisol-associated QTL.



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 1. Localization of Pig Cbg by Radiation Hybrids Mapping in the Cortisol Associated QTL Interval

The QTL associated with cortisol levels (18 ) is shown in A (evolution of maximum likelihood ratio test along Sscr 7 for plasma cortisol concentrations). Detailed RH map of the QTL interval is shown in B (framework radiation hybrid map of swine chromosome 7 distances are in cR7000).

 
This chromosomal localization was confirmed by fluorescent in situ hybridization (FISH). First, we screened a porcine genomic BAC library by PCR with the primers amplifying pig Cbg exon 2. We obtained a 150-kb clone containing the totality of Cbg genomic sequence. We used this BAC clone as a probe to map pig Cbg by FISH on a metaphase chromosome spread and confirmed that pig Cbg maps on chromosome 7q26 (see the supplemental data published on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org).

CBG Plasma Concentration Is Genetically Linked to the Cortisol Associated QTL
The binding capacity of CBG was measured in the plasma of 81 F2 pigs from the original cross, all offspring of a single F1 (no. 9110045) sire, which presented the highest contrast between the effect of its two QTL alleles. As expected, a high correlation was found between plasma CBG binding capacity and the level of cortisol (r = 0.57; P < 0.01). We evaluated genetic linkage between this new phenotypic measure and the pig chromosome 7 markers. A strong genetic linkage was detected exactly in the same area as for the cortisol QTL (Fig. 2Go). The maximum likelihood was even higher with CBG values (P < 5.10–6) compared with cortisol (P < 5.10–4), strengthening the implication of Cbg in this QTL. The estimated effect of Meishan minus Large White alleles at the likelihood peak for the animal no. 9110045 were: LnCBG, 0.358; LnCortisol basal, 0.444; and LnCortisol post stress, 0.218.



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 2. Genetic Linkage Analysis of CBG Plasma Concentrations on 81 F2 Pigs

LCBG, Log-transformed CBG capacity values; LCORT post stress, Log-transformed post-stress cortisol levels; LCORT basal, Log-transformed basal cortisol levels.

 
CBG Plasma Capacity and Cbg Locus Are Associated with Fat and Muscle Content Traits
Pearson correlation coefficients were calculated between CBG binding capacity values and parameters of carcass composition in the males of this F2 subpopulation (Table 1Go). Significant positive correlations were found between CBG levels and fat, whereas CBG was negatively correlated with muscle content. No significant correlation was found in the same samples between cortisol levels and carcass composition traits.


View this table:
[in this window]
[in a new window]
  		Table 1. Pearson Correlation Coefficients between Carcass Composition Traits, Plasma CBG Capacity, and Total Plasma Control

 
These data encouraged us to undertake additional genetic linkage analysis between carcass composition traits and the locus containing Cbg. A microsatellite marker named CBG-R was developed from the Cbg BAC clone and typed in the F2 progeny of F1 sire nos. 910045 and 910001, the latter being homozygous for the marker S0101. As reported previously (15), a QTL in the Cbg locus area (125–159 cM) was found for several leanness traits (muscle and loin weight). For fatness traits, a QTL at 60 cM was reported on chromosome 7. However, a second locus at 125–160 cM is also present and its significance vs. the 60 cM QTL varies among families. In particular, for two of the six pig families of the program (nos. 910045 and 910001), backfat weight and thickness show a strong linkage with the Cbg locus and none with the 60 cM region. Conversely, family from sire no. 910081 is strongly and uniquely linked to the region at 60 cM. As an example, genetic linkage analysis between the estimated carcass lean content, a trait combining fat and muscle percentage, and the chromosome 7 markers including CBG-R is presented in Fig. 3Go. Linkage analysis for all other carcass composition traits can be found in the supplemental data.



View larger version (31K):
[in this window]
[in a new window]
  		Fig. 3. QTL Mapping for Muscle Content

ECLC, Estimated carcass lean content; HFS model, half full-sibling model for interval mapping analysis. Markers are the same as in Fig. 2Go.

 
Meishan Pigs Have Higher CBG Binding Activity and mRNA Expression than Large White
We compared the binding capacity and affinity constant of CBG between Large White and Meishan parental breeds by radio-binding studies. We detected no sex difference within breeds. Maximal binding capacity was on average three times higher in Meishan compared with Large White pigs. The dissociation constant was 40% higher in Meishan (Table 2Go). To determine how these CBG parameters affect the free concentrations of cortisol in each breed we measured cortisol concentrations in the same plasma samples and then we calculated the free cortisol concentration using the equation as described in Sodergard et al. (28). These cortisol values obtained from blood collected during the day on pigs fed ad libitum were above basal cortisol concentrations measured in previous work (15). There were no sex differences between breeds, but there was a 2-fold difference of total cortisol as found in previous work and 1.85-fold variation in free cortisol concentration.


View this table:
[in this window]
[in a new window]
  		Table 2. Binding Capacity (Bmax) and Dissociation Constant (KD) of CBG for Cortisol and Total ([F] total) and Free ([F] free) Concentrations of Cortisol in Large White and Meishan Breeds

 
To investigate this further, we performed a real-time quantitative RT-PCR to estimate Cbg mRNA expression in the liver of animals from the two breeds. As depicted on Fig. 4Go, normalized Cbg mRNA expression was much higher in Meishan (30.16 ± 9.26) than Large White pig liver (3.89 ± 1.6).



View larger version (25K):
[in this window]
[in a new window]
  		Fig. 4. Real-Time Quantitative RT-PCR of Cbg mRNA Expression in Liver of Large White (LW) and Meishan (MS) Breeds

Cbg mRNA expression was normalized using the expression of three housekeeping genes (HSK) as normalization factor.

 
Sequence Analysis of Pig Cbg
From the BAC clone (383F4), we identified the genomic organization and sequence of pig Cbg cDNA that had not been cloned before (GenBank accession no. AF324155). As in the other species, pig Cbg contains five exons with the ATG codon in exon 2. At the amino acid level, we found 66% and 80% homology between pig CBG and respectively human and sheep CBG. The nucleotide sequence was used to derive oligonucleotides to amplify the five exons of Cbg and bits of introns in the 12 founder pigs and the six F1 sires of the program. On the 1837 bp screened on 24 different chromosomes, 17 polymorphisms were detected, among which four led to amino acid substitutions (Table 3Go). In the Large White breed, four haplotypes were defined with a major one (haplotype 1) found seven times over the 12 chromosomes analyzed. In the Meishan breed, six haplotypes could be inferred from the 10 polymorphic sites. Haplotype 5, 6, and 7 differ only by two or three silent polymorphisms in exon 5 and thus are very similar and the most frequent ones. There is no amino acid substitution present in every haplotype of one breed and absent in the other breed. In other words, none of the four amino acid substitutions could explain globally the difference in CBG capacity or affinity between the two pig breeds. However, we looked at the effect of the S15I and I265V mutations on CBG capacity and affinity using an in vitro transfection assay of plasmids containing the cDNA variants, considering that the causal mutation may be different between families and because S15 and I265 are highly conserved across the eight mammalian species in which Cbg has been cloned. Moreover, S15I and I265V mutations are present in the pig family of F1 sire nos. 910045 and 910001, respectively, both of them showing the highest effect on cortisol and fat traits as mentioned above. No significant effect was detected for any of these two amino acid mutations (shown in the supplemental data).


View this table:
[in this window]
[in a new window]
  		Table 3. Haplotype Analysis of the Six Large White and Six Meishan Parental Animals

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
In this paper we provide evidence in favor of the hypothesis that Cbg is the causal gene of a QTL associated with cortisol levels and carcass composition in the pig.

CBG is a well-conserved {alpha}-glycoprotein in vertebrate species, synthesized by liver and secreted in blood, where it binds cortisol and progesterone with a high affinity (KA ~10 nM–1). The primary role of CBG is to regulate the bioavailability and metabolic clearance of cortisol because only the free hormone is active. Recent studies provide evidence for a larger spectrum of action of CBG. From its molecular structure, CBG belongs to the serine protease inhibitors and substrates (SERPINS) superfamily, and indeed CBG is a substrate of the serine-protease elastase which cleaves CBG near its steroid binding site resulting in the local release of cortisol at sites of inflammation (29, 30). Other evidence comes from the discovery of CBG membrane receptors that would capture the CBG-cortisol complex at specific sites and transport it into the cell where it will then be dissociated (31). Finally CBG may have an intrinsic biological activity as suggested by in vitro studies showing that after the binding of the CBG-cortisol complex to its receptors, cAMP increases within the cell (for a recent review see Ref. 32). Furthermore, in many species, more than 68% of CBG remains in the cortisol-free state under physiological conditions, supporting the hypothesis that CBG may act as a proper hormone (33).

In this study, we obtained a genomic clone of pig Cbg and demonstrated that it maps on chromosome 7q26 very close to marker S0101, at the peak of the maximum likelihood curve obtained by genetic mapping analysis for cortisol values. Moreover, when we calculated the genetic linkage between chromosome 7 markers and CBG binding capacity in the F2 population in which the cortisol QTL had been detected, we obtained a maximum likelihood curve of the same shape and in the same area as for cortisol values. This result was not unexpected because cortisol levels and CBG binding capacities were highly correlated. However, the fact that CBG values show a stronger linkage to marker S0101 than cortisol values strengthens the hypothesis of its implication in the QTL. As expected, biochemical properties of CBG are different between the two breeds. The 2-fold increase in binding capacity seems to overcome the 40% drop in affinity in the Meishan breed because free cortisol concentration is still higher in this breed compared with the Large White breed in our experiment. However, this may vary during the nycthemeral rhythm in particular when total cortisol levels are low. For instance, at a basal total cortisol concentration of 55 nM as detected previously for both breeds at night (15), the calculated free cortisol concentration is four times higher in Large White (9.6 nM) compared with Meishan (2.2 nM) pigs due to the lower CBG binding capacity in Large White pigs. This may explain the higher total cortisol secretion in Meishan compared with Large White pigs because negative feedback control will be increased in the latter during the night preceding the daily surge of cortisol secretion. The overall effect of elevated CBG in the Meishan breed is thus difficult to ascertain, but the fact that the Meishan breed displays signs of hypercorticism (high fat deposits, low muscle content, and a reduced growth) favors the hypothesis that CBG properties in the Meishan lead to increased total and free cortisol concentrations as a global effect.

Most interestingly, we provide evidence suggesting that Cbg gene may be a regulator of fat accumulation and muscle content. Indeed, plasma CBG capacity was found correlated to carcass composition traits in the 39 males tested, positively with fat deposition and negatively with muscle content. The correlation found here suggests that the effect of CBG is strong at least in this subpopulation of F2. No correlation was detected between total cortisol and these carcass composition traits; this may be due to less environmental influences on CBG compared with cortisol values. These data are corroborated by the overlap of the cortisol associated QTL with QTL related to carcass composition traits at the Cbg locus. These results fit well with the acknowledged metabolic role of cortisol on fat deposition and protein catabolism in muscles (34) and show that CBG is a better predictor of carcass composition than cortisol levels. Another line of arguments suggests that CBG is indeed involved in the obesity phenotype: QTL mapping analyses in mouse and rat have pointed to the Cbg locus for obesity-related traits. In a backcross between the mice strains SPRET/Pt and C57BL/6, a QTL for body fat percentage was found around the marker D12Mit27 that is 1 cM from Cbg (35). In rats, a QTL associated with fat weight was detected in a backcross between rats OLETF (a model of type II diabetes) and Brown Norway near markers D6Mit4-D6Mit9 where rat Cbg maps (36). Furthermore, patients with CBG deficiency or low-affinity CBG are obese or overweight (37, 38). Although few CBG-deficient patients have been reported, this is in accordance with recent data showing that low CBG levels are associated with fat accumulation and insulin resistance in a human healthy population (39). Similarly, in the Zucker rat, lower levels of CBG binding capacity were found in the obese rats compared with the lean controls (40). In our model, a high CBG capacity is associated with elevated total cortisol levels, high fat deposition, and low muscle content. The obese chicken strain is another example of an animal model in which obesity is associated with high levels of CBG (41). Thus, depending on the animal model, elevated or decreased CBG is associated with obesity. Because CBG immunoreactivity and corticosterone binding activity have been detected in rat adipocytes (40, 42), it has been suggested that CBG acts as a barrier to glucocorticoid action in adipose tissue. Thus, deficiency or lower affinity of CBG will lead to increased cortisol influence on adipocytes. Indeed, increased proliferation and enhanced differentiation were found in cultured preadipocytes from a patient totally deficient in CBG compared with controls (43). Then, how can we explain that high CBG levels are associated with obesity in Meishan pigs or Obese chicken? it may be that the bigger pool of cortisol-CBG complex circulating in the bloodstream of these individuals can be more readily dissociated near adipose tissue for example by local free fatty acid concentrations. Free fatty acids have been shown to be potent modulators of steroid-protein interaction, reducing corticosterone-CBG binding in immature rats and increasing it in adult rats (44). In this case, CBG acts as a cortisol reservoir, similarly to what occurs at sites of inflammation (30). Therefore, for both deficiency or excess CBG capacity, fat accumulation may be the consequence of a higher local bioavailability in free cortisol. Alternatively, it cannot be ruled out that CBG may act as a proper hormone as hypothesized by various authors (32, 33).

We have not found a functional mutation in the coding region of pig Cbg gene that could explain the difference in CBG expression or affinity between the two breeds. The S15I substitution lies in the signal peptide domain of the CBG precursor; thus, it could have had an effect on CBG maximal binding capacity by an increased secretion rate. This was not confirmed in the in vitro transfection assay and did not fit with the large difference in Cbg mRNA expression observed. The binding site of CBG for cortisol has not been clearly defined but may be located on the Cys249 (45). The substitutions T257M and I265V are close to this site. However, T257M is found equally frequently in both breeds and is not well conserved in evolution. Conversely I265V is well conserved and present only in haplotype 4 of the Large White breed, but we did not detect a dissociation constant difference in the in vitro transfection assay. The G307R mutation does not lie in a known domain of the protein and is present in both breeds. Therefore, the lower cortisol affinity in Meishan remains enigmatic and may be of artifactual origin. Concerning the CBG expression differences, extensive analysis of the promoter, intronic, and intergenic regions of Cbg gene is now required.

The high circulating cortisol levels of the Meishan pig could result from many biological mechanisms involved in cortisol production, bioavailability, and clearance. The fact that our QTL genetic mapping analysis points to CBG as a major factor at the origin of high cortisol levels emphasizes even more the importance of this protein in the regulation of the HPA axis and to its pathophysiological outcomes. In particular, our results show that Cbg may be a better predictor and an interesting new target for understanding obesity susceptibility.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Radiation Hybrid Mapping
Reactions were performed in independent duplicates on IMpRH panel (27). PCR products were analyzed on 2% agarose gels in 1x TBE buffer after staining with ethidium bromide. A third amplification was carried out on clones for which discordant results were obtained. Vectors of amplification results were submitted to IMpRH database accessible at http://imprh.toulouse.inra.fr (46).

FISH Mapping
Metaphase chromosomes were obtained from cultures of peripheral blood lymphocytes cultures. To identify chromosomes, metaphase spreads were G-banded using G-T-G banding technique before hybridization, and pictures of the best metaphases were taken using a video printer as described earlier (47).

In situ hybridization experiments were performed according to Ref. 47 with some of the published modifications (48).

QTL Mapping
Data were first checked for the normality of distributions. The three traits (CBG capacity, basal, and post-stress levels of cortisol) had log-normal distributions and data were transformed into their logarithmic scores before analysis. Details about animals and carcass composition traits can be found in Ref. 19 . QTL mapping was performed using multipoint maximum likelihood techniques. A test statistic defined as the ratio of likelihoods under the hypotheses of one (H1) vs. no (H0) QTL linked to the set of markers considered was computed at each position (each centimorgan) along the chromosome. The chromosome 7 marker map used was that computed from the genotypes of more than 1100 pigs by Bidanel et al. (17). Under H1 hypothesis, a QTL with a gene substitution effect for each sire and dam was fitted to the data. Further details on likelihood computation procedures can be found in (17). Estimates of average substitution effects were computed at the position with the highest likelihood ratio.

Chromosome-wide significance thresholds were determined empirically by simulating the data assuming a polygenic infinitesimal model and a normal distribution of performance traits. A total of 50,000 simulations was performed for each trait. Chromosomal test significance level (Pc) corresponding to a genome-wide test probability (Pg) was obtained using the Bonferroni correction, i.e. as a solution to: Pg = 1 – (1 – Pc)19, which gives Pc = 0.0027 and 0.000054, respectively, for significant (Pg = 0.05) and highly significant levels (Pg = 0.001) (49).

BAC Library Screening and Development of Microsatellite Marker CBG-R
BAC clones were isolated by three-dimensional PCR-based screening of a porcine BAC library as described previously (50). BAC 383F4 containing the pig CBG sequence was recovered using a primer pair designed from the human exon 2 CBG sequence (forward, ACACCTGTCTTCTCTGGCTG; reverse, ACAGGCTGAAGGCAAAGTC). PCRs were run for 35 cycles of 30 sec at 94 C, 30 sec at 56 C, and 30 sec at 72 C, in a 20-µl reaction volume containing 0.2 mM of each deoxynucleotide triphosphate (dNTP), 1.5 mM MgCl2, 8 pM of each primers, 2 U Taq DNA polymerase and reaction buffer (PerkinElmer Applied Biosystems, Foster City, CA).

Development of Microsatellite Marker CBG-R
The 383F4 BAC clone was digested using Sau3A enzyme and subcloned in pGEM vector. After screening with a (CA)10 probe, a subclone containing a microsatellite was selected and sequenced. Two primers were defined (CBGR1/132 5'-TTTGCTATGCTAGGTTCATGGTT-3' and CBGR1/5 5'-AGGGTAAAGGGTCATGAGGTACA-3') to amplify CBGR marker in the following conditions: 35 cycles of 30 sec at 94 C, 30 sec at 58 C, and 30 sec at 72 C, in a 25-µl reaction volume containing 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.25 µM of primers, 50 ng of DNA.

Sequencing
Sequencing reactions were performed using the Prism AmpliTaq FS diChloroRhodamine Dye Terminators kit (ABI, Foster City, CA) on a PerkinElmer 9700 thermocycler, and analyzed on a 3700 automatic sequencer (ABI). Sequences were obtained from PCR, RT-PCR fragments or directly from the BAC clone 383F4. For the haplotype analysis, sequences were obtained from PCR products covering all exons. The sequence of oligonucleotides pairs used for these PCRs were: exon 1, forward 5'-ATTAACCAGCAGGGAAGCTG, reverse 5'-GCAGTCATGGTTTCGTTTTG-3'; exon 2, forward 5'-CCCTGTATGCCTGTCTCCTC-3', reverse 5'-CCTGCTCCAAGAACAAGTCC-3'; exon 3, forward 5'-GTCAAGGTGCCCATGATGTTCC-3', reverse 5'-GCCAGGTGCACCCCTTTCC-3'; exon 4, forward 5'-CCTCACTAAAATATCTAACCAGCA-3', reverse 5'-ACCTACCTTGGATCTTCG-3'; exon 5, forward 5'-TCTGCAATTTGACGAGAAGG-3', reverse 5'-CCTAGGACAACGATCGAACC-3'. All 12 F0 and six F1 animals were tested.

CBG Binding Assay
Blood samples were collected in evacuated heparinized tubes from 6- to 8-wk-old piglets (15 males and 16 females in each breed Large White and Meishan) fed ad libitum. Tubes were kept on ice until centrifugation and plasma aliquots were frozen at –80 C until analysis.

The binding capacity of CBG and its affinity for cortisol were measured at 4 C by a solid phase binding assay using Concanavalin A-Sepharose (51). The equilibrium association constant and the binding capacity of CBG for cortisol were calculated by Scatchard analysis using "bound" as the quantity of cortisol specifically bound to the glycoproteins adsorbed to the gel and "free" as the concentration of cortisol in the aqueous phase.

Cortisol RIA
Plasma concentrations of cortisol were quantified by RIA, as previously described (15). The intra- and interassay coefficients of variation were 7.6% and 12.5%, respectively. Because the low-affinity binding of cortisol to albumin was not measured experimentally in this study, we used the value measured by Barnett et al. (52), i.e. 2.531.

Real-Time RT-PCR
Liver total RNA from three pigs of each breed was extracted with the Trizol kit (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer’s protocol. Real-time quantitative RT-PCR was performed using a Rotor-Gene 2000 (Corbett Research, Sydney, Australia) as described previously (53). Triplicate PCRs were assembled in 0.1 ml strip tubes containing cDNA from 10 ng of total RNA, 0.2 µl 50x Titanium Taq DNA polymerase, 1x Titanium Taq PCR Buffer (CLONTECH Laboratories, Inc., Palo Alto, CA), 1 mM dNTP, 100 mM each of the appropriate primer, 0.5x Sybr Green I (Molecular Probes, Eugene, OR). Preliminary results showed that the RPL19, ß-microglobulin and ß-actin housekeeping genes had the most stable gene expression in pig liver within our experimental conditions. The RT-PCR expression of the target gene is thus presented as a ratio, normalized using the genorm software (54) and the expression of the above-mentioned housekeeping genes. Primers pairs used were: CBG: 154 bp, GenBank accession no. AF324155, forward 5'-CCAGAATGCCCTGCCGAAGAT-3', reverse 5'-GATGAAGGGCCGGTTGAAG-3'; RPL19: 165 bp, accession no. AF435591, forward 5'-AAATCGCCAACGCCAACTC-3', reverse 5'-TGGCAGTACCCTTCCGCTTAC-3'; HPRT1: 267 bp, accession no. AF143818, forward 5'-CCTAATCATTATGCCGAGGAT-3', reverse 5'-ATCGCCCGTTGACTGG-3'; ß-actin 158 bp, accession no. U07786, forward 5'-CCACACGGTGCCCATCTACGA-3', reverse 5'-TGATGTCCCGCACGATCTC-3'; ß-microglobulin 221 bp, accession no. L13854, forward 5'-ACGGAAAGCCAAATTACCTGA-3', reverse 5'-CTTGGGCTTATCGAGAGTCA-3'.

Statistics
Correlation matrices and Student’s t tests were performed using Statistica version 5 software.


   FOOTNOTES
 
Abbreviations: CBG, Corticosteroid-binding globulin; dNTP, deoxynucleotide triphosphate; FISH, fluorescent in situ hybridization; HPA, hypothalamic-pituitary-adrenal; Pc, chromosomal test significance level; Pg, genome-wide test probability; QTL, quantitative trait locus.

Received for publication January 5, 2004. Accepted for publication April 6, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Tempel DL, Leibowitz SF 1994 Adrenal steroid receptors: interactions with brain neuropeptide systems in relation to nutrient intake and metabolism. J Neuroendocrinol 6:479–501[CrossRef][Medline]
  2. Elenkov IJ, Webster EL, Torpy DJ, Chrousos GP 1999 Stress, corticotropin-releasing hormone, glucocorticoids, and the immune/inflammatory response: acute and chronic effects. Ann NY Acad Sci 876:1–11[CrossRef][Medline]
  3. Tsigos C, Chrousos GP 2002 Hypothalamic-pituitary-adrenal axis, neuroendocrine factors and stress. J Psychosom Res 53:865–871[CrossRef][Medline]
  4. McEwen BS, Wingfield JC 2003 The concept of allostasis in biology and biomedicine. Horm Behav 43:2–15[CrossRef][Medline]
  5. Rosmond R, Dallman MF, Bjorntorp P 1998 Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. J Clin Endocrinol Metab 83:1853–1859[Abstract/Free Full Text]
  6. Sternberg E, Gold P 1997 Emotions and disease. From balance of humors to balance of molecule. Nat Med 3:264–267[CrossRef][Medline]
  7. Lupien SJ, de Leon M, de Santi S, Convit A, Tarshish C, Nair NP, Thakur M, McEwen BS, Hauger RL, Meaney MJ 1998 Cortisol levels during human aging predict hippocampal atrophy and memory deficits [Erratum (1998) 4:329]. Nat Neurosci 1:69–73[CrossRef][Medline]
  8. Piazza PV, Le Moal M 1998 The role of stress in drug self-administration. Trends Pharmacol Sci 19:67–74[CrossRef][Medline]
  9. Meikle AW, Stringham JD, Woodward MG, Bishop DT 1988 Heritability of variation of plasma cortisol levels. Metabolism 37:514–517[CrossRef][Medline]
  10. Kirschbaum C, Wust S, Faig HG, Hellhammer DH 1992 Heritability of cortisol responses to human corticotropin-releasing hormone, ergometry, and psychological stress in humans. J Clin Endocrinol Metab 75:1526–1530[Abstract]
  11. Linkowski P, Van Onderbergen A, Kerkhofs M, Bosson D, Mendlewicz J, Van Cauter E 1993 Twin study of the 24-h cortisol profile: evidence for genetic control of the human circadian clock. Am J Physiol 264:E173–E181
  12. Armario A, Gavalda A, Marti J 1995 Comparison of the behavioural and endocrine response to forced swimming stress in five inbred strains of rats. Psychoneuroendocrinology 20:879–890[CrossRef][Medline]
  13. Marissal-Arvy N, Mormede P, Sarrieau A 1999 Strain differences in corticosteroid receptor efficiencies and regulation in Brown Norway and Fischer 344 rats. J Neuroendocrinol 11:267–273[CrossRef][Medline]
  14. Mormède P, Dantzer R, Bluthe R-M, Caritez J-C 1984 Differences in adaptive abilities of three breeds of Chinese pigs. Genet Sel Evol 16:85–102[CrossRef]
  15. Désautés C, Sarrieau A, Caritez JC, Mormède P 1999 Behavior and pituitary-adrenal function in Large White and Meishan pigs. Domest Anim Endocrinol 16:193–205[CrossRef][Medline]
  16. Désautés C, Bidanel JP, Mormède P 1997 Genetic study of behavioral and pituitary-adrenocortical reactivity in response to an environmental challenge in pigs. Physiol Behav 62:337–345[CrossRef][Medline]
  17. Bidanel JP, Milan D, Iannuccelli N, Amigues Y, Boscher MY, Bourgeois F, Caritez JC, Gruand J, Le Roy P, Lagant H, Quintanilla R, Renard C, Gellin J, Ollivier L, Chevalet C 2001 Detection of quantitative trait loci for growth and fatness in pigs. Genet Sel Evol 33:289–309[CrossRef][Medline]
  18. Désautés C, Bidanel JP, Milant D, Iannuccelli N, Amigues Y, Bourgeois F, Caritez JC, Renard C, Chevalet C, Mormede P 2002 Genetic linkage mapping of quantitative trait loci for behavioral and neuroendocrine stress response traits in pigs. J Anim Sci 80:2276–2285[Abstract/Free Full Text]
  19. Milan D, Bidanel JP, Iannuccelli N, Riquet J, Amigues Y, Gruand J, Le Roy P, Renard C, Chevalet C 2002 Detection of quantitative trait loci for carcass composition traits in pigs. Genet Sel Evol 34:705–728[CrossRef][Medline]
  20. Goureau A, Vignoles M, Pinton P, Gellin J, Yerle M 2000 Improvement of comparative map between porcine chromosomes 1 and 7 and human chromosomes 6, 14, and 15 by using human YACs. Mamm Genome 11:796–799[CrossRef][Medline]
  21. Billingsley GD, Walter MA, Hammond GL, Cox DW 1993 Physical mapping of four serpin genes: {alpha} 1-antitrypsin, {alpha} 1-antichymotrypsin, corticosteroid-binding globulin, and protein C inhibitor, within a 280-kb region on chromosome I4q32.1. Am J Hum Genet 52:343–353[Medline]
  22. Hammond GL, Smith CL, Goping IS, Underhill DA, Harley MJ, Reventos J, Musto NA, Gunsalus GL, Bardin CW 1987 Primary structure of human corticosteroid binding globulin, deduced from hepatic and pulmonary cDNAs, exhibits homology with serine protease inhibitors. Proc Natl Acad Sci USA 84:5153–5157[Abstract/Free Full Text]
  23. Hammond GL, Smith CL, Lahteenmaki P, Grolla A, Warmels-Rodenhiser S, Hodgert H, Murai JT, Siiteri PK 1994 Squirrel monkey corticosteroid-binding globulin: primary structure and comparison with the human protein. Endocrinology 134:891–898[Abstract/Free Full Text]
  24. Berdusco ET, Hammond GL, Jacobs RA, Grolla A, Akagi K, Langlois D, Challis JR 1993 Glucocorticoid-induced increase in plasma corticosteroid-binding globulin levels in fetal sheep is associated with increased biosynthesis and alterations in glycosylation. Endocrinology 132:2001–2008[Abstract/Free Full Text]
  25. Orava M, Zhao XF, Leiter E, Hammond GL 1994 Structure and chromosomal location of the gene encoding mouse corticosteroid-binding globulin: strain differences in coding sequence and steroid-binding activity. Gene 144:259–264[CrossRef][Medline]
  26. Corpet F 1988 Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16:10881–10890[Abstract/Free Full Text]
  27. Yerle M, Pinton P, Robic A, Alfonso A, Palvadeau Y, Delcros C, Hawken R, Alexander L, Beattie C, Schook L, Milan D, Gellin J 1998 Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs. Cytogenet Cell Genet 82:182–188[CrossRef][Medline]
  28. Sodergard R, Backstrom T, Shanbhag V, Carstensen H 1982 Calculation of free and bound fractions of testosterone and estradiol-17ß to human plasma proteins at body temperature. J Steroid Biochem 16:801–810[CrossRef][Medline]
  29. Pemberton PA, Stein PE, Pepys MB, Potter JM, Carrell RW 1988 Hormone binding globulins undergo serpin conformational change in inflammation. Nature 336:257–258[CrossRef][Medline]
  30. Hammond GL, Smith CL, Paterson NA, Sibbald WJ 1990 A role for corticosteroid-binding globulin in delivery of cortisol to activated neutrophils. J Clin Endocrinol Metab 71:34–39[Abstract/Free Full Text]
  31. Strel’chyonok OA, Avvakumov GV 1991 Interaction of human CBG with cell membranes. J Steroid Biochem Mol Biol 40:795–803[CrossRef][Medline]
  32. Breuner CW, Orchinik M 2002 Plasma binding proteins as mediators of corticosteroid action in vertebrates. J Endocrinol 175:99–112[Abstract]
  33. Gayrard V, Alvinerie M, Toutain PL 1996 Interspecies variations of corticosteroid-binding globulin parameters. Domest Anim Endocrinol 13:35–45[CrossRef][Medline]
  34. Devenport L, Knehans A, Sundstrom A, Thomas T 1989 Corticosterone’s dual metabolic actions. Life Sci 45:1389–1396[CrossRef][Medline]
  35. Warden CH, Fisler JS, Shoemaker SM, Wen PZ, Svenson KL, Pace MJ, Lusis AJ 1995 Identification of four chromosomal loci determining obesity in a multifactorial mouse model. J Clin Invest 95:1545–1552
  36. Watanabe TK, Okuno S, Oga K, Mizoguchi-Miyakita A, Tsuji A, Yamasaki Y, Hishigaki H, Kanemoto N, Takagi T, Takahashi E, Irie Y, Nakamura Y, Tanigami A 1999 Genetic dissection of "OLETF," a rat model for non-insulin-dependent diabetes mellitus: quantitative trait locus analysis of (OLETF x BN) x OLETF. Genomics 58:233–239[CrossRef][Medline]
  37. Emptoz-Bonneton A, Cousin P, Seguchi K, Avvakumov GV, Bully C, Hammond GL, Pugeat M 2000 Novel human corticosteroid-binding globulin variant with low cortisol-binding affinity. J Clin Endocrinol Metab 85:361–367[Abstract/Free Full Text]
  38. Torpy DJ, Bachmann AW, Grice JE, Fitzgerald SP, Phillips PJ, Whitworth JA, Jackson RV 2001 Familial corticosteroid-binding globulin deficiency due to a novel null mutation: association with fatigue and relative hypotension. J Clin Endocrinol Metab 86:3692–3700[Abstract/Free Full Text]
  39. Fernandez-Real JM, Pugeat M, Grasa M, Broch M, Vendrell J, Brun J, Ricart W 2002 Serum corticosteroid-binding globulin concentration and insulin resistance syndrome: a population study. J Clin Endocrinol Metab 87:4686–4690[Abstract/Free Full Text]
  40. Grasa MM, Cabot C, Fernandez-Lopez JA, Remesar X, Alemany M 2001 Modulation of corticosterone availability to white adipose tissue of lean and obese Zucker rats by corticosteroid-binding globulin. Horm Metab Res 33:407–411[CrossRef][Medline]
  41. Fassler R, Dietrich H, Kromer G, Schwarz S, Brezinschek HP, Wick G 1988 Diminished glucocorticoid tonus in obese strain (OS) chickens with spontaneous autoimmune thyroiditis: increased plasma levels of a physicochemically unaltered corticosteroid-binding globulin but normal total corticosterone plasma concentration and normal glucocorticoid receptor contents in lymphoid tissues. J Steroid Biochem 30:375–379[CrossRef][Medline]
  42. Grasa M, Cabot C, Adan C, Matteis R, Esteve M, Cinti S, Fernandez-Lopez JA, Reemesar X 2001 Corticosteroid-binding globulin synthesis and distribution in rat white adipose tissue. Mol Cell Biochem 228:25–31[CrossRef][Medline]
  43. Joyner JM, Hutley LJ, Bachmann AW, Torpy DJ, Prins JB 2003 Greater replication and differentiation of preadipocytes in inherited corticosteroid-binding globulin deficiency. Am J Physiol Endocrinol Metab 284:E1049–E1054
  44. Haourigui M, Vallette G, Martin ME, Sumida C, Benassayag C, Nunez EA 1994 In vivo effect of free fatty acids on the specific binding of glucocorticosteroids to corticosteroid binding globulin and liver receptors in immature rats. Steroids 59:46–54[CrossRef][Medline]
  45. Dey R, Roychowdhury P 2003 Homology model of human corticosteroid binding globulin: a study of its steroid binding ability and a plausible mechanism of steroid hormone release at the site of inflammation. J Mol Model 9:183–189
  46. Milan D, Hawken R, Cabau C, Leroux S, Genet C, Lahbib Y, Tosser G, Robic A, Hatey F, Alexander L, Beattie C, Schook L, Yerle M, Gellin J 2000 IMpRH server: an RH mapping server available on the web. Bioinformatics 16:558–559[Abstract/Free Full Text]
  47. Yerle M, Galman O, Lahbib-Mansais Y, Gellin J 1992 Localization of the pig luteinizing hormone/choriogonadotropin receptor gene (LHCGR) by radioactive and nonradioactive in situ hybridization. Cytogenet Cell Genet 59:48–51[Medline]
  48. Sun HF, Ernst CW, Yerle M, Pinton P, Rothschild MF, Chardon P, Rogel-Gaillard C, Tuggle CK 1999 Human chromosome 3 and pig chromosome 13 show complete synteny conservation but extensive gene-order differences. Cytogenet Cell Genet 85:273–278[CrossRef][Medline]
  49. Knott SA, Marklund L, Haley CS, Andersson K, Davies W, Ellegren H, Fredholm M, Hansson I, Hoyheim B, Lundstrom K, Moller M, Andersson L 1998 Multiple marker mapping of quantitative trait loci in a cross between outbred wild boar and large white pigs. Genetics 149:1069–1080[Abstract/Free Full Text]
  50. Rogel-Gaillard C, Bourgeaux N, Billault A, Vaiman M, Chardon P 1999 Construction of a swine BAC library: application to the characterization and mapping of porcine type C endoviral elements. Cytogenet Cell Genet 85:205–211[CrossRef][Medline]
  51. Pugeat MM, Chrousos GP, Nisula BC, Loriaux DL, Brandon D, Lipsett MB 1984 Plasma cortisol transport and primate evolution. Endocrinology 115:357–361[Abstract/Free Full Text]
  52. Barnett JL, Cronin GM, Winfield CG 1981 The effects of individual and group penning of pigs on total and free plasma corticosteroids and the maximum corticosteroid binding capacity. Gen Comp Endocrinol 44:219–225[CrossRef][Medline]
  53. Berger P, Girodet PO, Begueret H, Ousova O, Perng DW, Marthan R, Walls AF, Tunon de Lara JM 2003 Tryptase-stimulated human airway smooth muscle cells induce cytokine synthesis and mast cell chemotaxis. FASEB J 17:2139–2141[Abstract/Free Full Text]
  54. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F 2002 Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:RESEARCH0034

NURSA Molecule Pages Link:

Ligands:   Hydrocortisone



This article has been cited by other articles:


Home page
 J ANIM SCIHome page
R. L. Vallejo, C. E. Rexroad III, J. T. Silverstein, L. L. G. Janss, and G. M. Weber
Evidence of major genes affecting stress response in rainbow trout using Bayesian methods of complex segregation analysis
J Anim Sci, November 1, 2009; 87(11): 3490 - 3505.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes CareHome page
M. Manco, J. M. Fernandez-Real, M. E. Valera-Mora, H. Dechaud, G. Nanni, V. Tondolo, M. Calvani, M. Castagneto, M. Pugeat, and G. Mingrone
Massive Weight Loss Decreases Corticosteroid-Binding Globulin Levels and Increases Free Cortisol in Healthy Obese Patients: An adaptive phenomenon?
Diabetes Care, June 1, 2007; 30(6): 1494 - 1500.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
H. N. Kadarmideen and L. L. G. Janss
Population and systems genetics analyses of cortisol in pigs divergently selected for stress
Physiol Genomics, March 14, 2007; 29(1): 57 - 65.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
D. Qi and B. Rodrigues
Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E654 - E667.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
L. C. Solberg, A. E. Baum, N. Ahmadiyeh, K. Shimomura, R. Li, F. W. Turek, J. S. Takahashi, G. A. Churchill, and E. E. Redei
Genetic analysis of the stress-responsive adrenocortical axis
Physiol Genomics, November 21, 2006; 27(3): 362 - 369.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
V. Guyonnet-Duperat, N. Geverink, G. S. Plastow, G. Evans, O. Ousova, C. Croisetiere, A. Foury, E. Richard, P. Mormede, and M.-P. Moisan
Functional Implication of an Arg307Gly Substitution in Corticosteroid-Binding Globulin, a Candidate Gene for a Quantitative Trait Locus Associated With Cortisol Variability and Obesity in Pig
Genetics, August 1, 2006; 173(4): 2143 - 2149.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
N. A. Geverink, A. Foury, G. S. Plastow, M. Gil, M. Gispert, M. Hortos, M. F. i Furnols, G. Gort, M. P. Moisan, and P. Mormede
Cortisol-binding globulin and meat quality in five European lines of pigs
J Anim Sci, January 1, 2006; 84(1): 204 - 211.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data Files
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ousova, O.
Right arrow Articles by Moisan, M.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ousova, O.
Right arrow Articles by Moisan, M.-P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals