help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2004-0098
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adamski, J.
Right arrow Articles by Benveniste, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adamski, J.
Right arrow Articles by Benveniste, E. N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Molecular Endocrinology 18 (8): 1963-1974
Copyright © 2004 by The Endocrine Society

17ß-Estradiol Inhibits Class II Major Histocompatibility Complex (MHC) Expression: Influence on Histone Modifications and CBP Recruitment to the Class II MHC Promoter

Jill Adamski, Zhendong Ma, Susan Nozell and Etty N. Benveniste

Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 35294

Address all correspondence and requests for reprints to: Dr. Etty N. Benveniste, Department of Cell Biology, University of Alabama at Birmingham, 1530 3rd Avenue South, MCLM 395, Birmingham, Alabama 35294-0005. E-mail: tika{at}uab.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Major histocompatibility complex (MHC) class II proteins are important for the initiation of immune responses and are essential for specific recognition of foreign antigens by the immune system. Regulation of class II MHC expression primarily occurs at the transcriptional level. The class II transactivator protein is the master regulator that is essential for both constitutive and interferon-{gamma}-inducible class II MHC expression. Estrogen [17ß-estradiol (17ß-E2)] has been shown to have immunomodulatory effects. In this study, we show that 17ß-E2 down-regulates interferon-{gamma} inducible class II MHC protein levels on brain endothelial cells, as well as other cell types (astrocytes, fibrosacroma cells, macrophages). The inhibitory effects of 17ß-E2 on class II MHC expression are not due to changes in class II transactivator mRNA or protein levels, rather, 17ß-E2 mediates inhibition at the level of class II MHC gene expression. We demonstrate that 17ß-E2 attenuates H3 and H4 histone acetylation and cAMP response element binding protein-binding protein association with the class II MHC promoter, suggesting that 17ß-E2 inhibits class II MHC expression by a novel mechanism involving modification of the histone acetylation status of the class II MHC promoter.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE CLASS II MAJOR histocompatibility complex (MHC) molecules are transmembrane glycoproteins that consist of {alpha} and ß chains, which associate through noncovalent interactions. Class II MHC can be expressed by both professional and nonprofessional antigen-presenting cells (APCs). Professional APCs (e.g. dendritic cells, macrophages, and B cells) constitutively express low levels of class II MHC proteins and when stimulated with interferon (IFN)-{gamma}, class II expression is increased. Nonprofessional APCs do not normally express class II MHC unless they are treated with IFN-{gamma}. Class II MHC proteins play a major role in the induction of specific immune responses by presenting fragments of exogenous antigen to CD4+ T-helper cells, which results in their activation and differentiation (for review, see Ref. 1).

To prevent inappropriate activation of T cells, which could then lead to autoimmune-mediated destruction of normal tissue, there must be stringent regulation of class II MHC expression. Regulation of class II MHC gene expression occurs primarily at the transcriptional level. There are several conserved cis-acting regions located in the promoter of class II MHC genes called W (Z, S, or H), X (X1 and X2), and Y elements (for review, see Refs. 1 and 2). These elements are occupied by several trans-acting factors that are constitutively and ubiquitously expressed. The W and X1 boxes are bound by trimeric complexes known as the regulatory factor X (RFX) factor that is composed of RFXANK/RFXB, RFX5, and RFXAP proteins. As a trimer, these DNA-binding proteins are important for providing a platform for protein-protein interactions at the class II MHC promoter. The X2 element is occupied by the cAMP response element binding protein (CREB) protein, and the Y box is bound by the nuclear factor-Y protein. Both CREB and nuclear factor-Y enhance class II MHC gene transcription. The presence of these trans-acting factors are necessary, but not sufficient, for transcription of class II MHC. For both constitutive and IFN-{gamma}-induced class II MHC expression, the class II transactivator (CIITA) protein must associate with the class II promoter. CIITA is a non-DNA binding protein that interacts with the constitutive trans-acting factors as well as the basal transcription machinery. CIITA is considered to be the master regulator of class II expression, and in general, the level of CIITA expression in a cell directly correlates to the level of class II MHC expression (for review, see Ref. 3). Investigators have recently shown that the association of CIITA with the class II MHC promoter correlates with H3 and H4 acetylation (4, 5). Acetylation of histones results in an open chromatin conformation that often results in gene transcription (for review, see Ref. 6).

The CREB-binding protein (CBP) is an important transcriptional coactivator. CBP functions as an integrator that bridges transcription factors with the basal transcription machinery (7). In addition, CBP is a histone acetyltransferase (HAT) that is capable of acetylating all four core histones (8, 9). CBP is an important cofactor for activating transcription of class II MHC genes; CBP binds to CIITA and these two proteins act synergistically to increase class II MHC transcription (10, 11). CBP likely functions as an integrator, bridging multiple factors including CIITA and CREB, with the basal transcription machinery. Furthermore, CBP could also function as a HAT on the class II MHC promoter, which may be important for activation of transcription.

Several compounds have been shown to inhibit class II MHC expression, and most of these attenuate expression by inhibiting CIITA transcription (for review, see Ref. 12). TGF-ß, IL-4, and IL-10 are cytokines with immunosuppressive properties that inhibit class II MHC at the level of CIITA transcription (13, 14). In addition, many human pathogens down-regulate class II MHC as a mechanism of evading the immune system. Mycobacterium tuberculosis, Toxoplasm gondii, and multiple viral pathogens have been shown to inhibit CIITA expression (15, 16 ; for review, see Ref. 17). Statins, pharmacologic inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A reductase, have recently been identified as compounds that decrease class II expression and promote a Th2 cytokine profile. Statins also suppress class II MHC expression by inhibiting CIITA transcription (18).

Estrogen is a steroid hormone that has been shown to have immunomodulatory effects (19, 20, 21, 22). 17ß-Estradiol (17ß-E2) signals through two nuclear receptors [estrogen receptor (ER) {alpha} and ERß] to mediate genomic effects; however, 17ß-E2 is also known to mediate rapid nongenomic events through mechanisms that have yet to be conclusively elucidated (for review, see Ref. 23). In the case of genomic signaling, the ER can recruit and interact with a variety of cofactors on the promoter. Which factors are recruited will depend on the complement of cofactors present in the cell, the specific ligand bound to the ER, other trans-acting factors located on the promoter, and even the sequence of the estrogen response element (24, 25, 26). Although estrogen signaling usually results in activation of transcription (27, 28, 29, 30), there are several reports demonstrating that estrogen can mediate transcriptional repression as well (31, 32, 33, 34).

More than two thirds of individuals in the United States with autoimmune diseases are women (for review, see Ref. 35). Studies suggest that low levels of circulating estrogen are proinflammatory, whereas high levels are antiinflammatory. During pregnancy, many women who suffer from cell-mediated autoimmune diseases [e.g. multiple sclerosis (MS) and rheumatoid arthritis] experience significant remission that is most pronounced in the third trimester when estrogen levels are highest. However, after parturition, when circulating estrogen levels plummet, the autoimmune disease rapidly returns to a pre-pregnancy, or in some cases, a more severe activity level (36, 37).

There are two reports, dating back to the early 1990s, in which investigators show estrogen-mediated down-regulation of class II MHC expression on epithelial cells and leukocytes (38, 39). In addition, it has been repeatedly shown in several different models that estrogen treatment of rodents receiving tissue transplants leads to better graft function and survival, accompanied by a significant reduction, and in some instances, complete abolishment of class II MHC expression on the allograft vasculature (40, 41, 42).

Because estrogen can mediate down-regulation of class II MHC, and aberrant expression of class II MHC is suspected to be one of the factors leading to autoimmune disease, there is likely a correlation between the high levels of circulating estrogen during pregnancy and reduced levels of autoimmune disease activity due to a decrease in the level of class II MHC expression. Our study shows that 17ß-E2 inhibits IFN-{gamma}-induced class II MHC expression on endothelial cells, astrocytes and macrophages, in a manner that is independent of CIITA expression. 17ß-E2 attenuates acetylation of H3 and H4 histones in the class II MHC promoter, suggesting the inhibitory effect of 17ß-E2 is at the level of class II MHC transcription. Finally, we provide evidence that 17ß-E2 interferes with CBP recruitment to the class II MHC promoter, thus providing a mechanism by which 17ß-E2 treatment can inhibit histone acetylation.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
IFN-{gamma} Induces Class II MHC Expression on Brain Endothelial Cells
Class II MHC proteins are not constitutively expressed on the brain endothelial cell line IBE, but after stimulation with IFN-{gamma}, we find that class II MHC protein levels are highly up-regulated on the cell surface (Fig. 1AGo). Ribonuclease protection assays (RPAs) were performed to determine the kinetics of class II MHC (IE-ß) and CIITA mRNA expression. IE-ß mRNA was detected 6–8 h after IFN-{gamma} stimulation and persisted beyond 36 h (Fig. 1BGo). CIITA mRNA was observed at 4 h post IFN-{gamma} treatment and also persisted past 36 h (Fig. 1CGo). These data show that IBE cells are highly inducible by IFN-{gamma} to express class II MHC mRNA and protein and CIITA mRNA.



View larger version (37K):
[in this window]
[in a new window]
  		Fig. 1. IFN-{gamma} Induces Class II MHC and CIITA Expression in IBE Cells

IBE cells were treated in the absence or presence of IFN-{gamma} (4 U/ml) for 36 h, stained with either anti-class II MHC antibody or an isotype control, and then analyzed by FACS (A). IBE cells were either incubated in serum-free media (Untx) or with 4 U/ml of IFN-{gamma} for the specified time points. Total cellular RNA was collected and assessed for IE-ß (B) or CIITA (C) mRNA expression using RPA. GAPDH, a housekeeping gene, was used as a loading control. Representative of at least three experiments. PE, Phycoerythrin.

 
17ß-E2 Inhibits IFN-{gamma} Induction of Class II MHC Protein Expression in IBE Cells
The effect of 17ß-E2 on IFN-{gamma} inducibility of class II MHC protein was examined. First, we examined whether the IBE cells express ERs. As shown in Fig. 2AGo, IBE cells express ER{alpha} and two isoforms of ERß. 17ß-E2 alone does not influence class II MHC expression on IBE cells (data not shown); however, simultaneous treatment with 17ß-E2 and IFN-{gamma} resulted in greater than 50% inhibition of class II MHC protein expression when compared with cells treated with IFN-{gamma} alone (Fig. 2Go, B and C). Dose-response studies were performed which indicated that 17ß-E2 doses at, or above, 1 µM were most effective at inhibiting class II MHC expression (data not shown). Kinetic experiments demonstrated that the greatest inhibition of class II MHC expression occurred when 17ß-E2 and IFN-{gamma} were added simultaneously; however, up to 6 h of pretreatment with 17ß-E2 or 4 h of posttreatment with 17ß-E2 after IFN-{gamma} stimulation still resulted in greater than 40% inhibition of class II MHC protein expression (data not shown). Simultaneous treatment of IBE cells with 17{alpha}-E2, the inactive isomer of 17ß-E2, and IFN-{gamma} resulted in no significant inhibition of class II MHC expression (Fig. 2CGo). These data indicate that the biologically active form of estradiol, 17ß-E2, inhibits IFN-{gamma}-induced class II MHC expression.



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 2. 17ß-E2 Inhibits IFN-{gamma} Induced Class II MHC Protein Expression in IBE Cells

IBE cells were lysed, and total cell lysate was analyzed by immunoblotting for ER{alpha} and ERß protein expression (A). IBE cells were either incubated in serum-free media (Untx), stimulated with 4 U/ml of IFN-{gamma}, or simultaneously treated with IFN-{gamma} plus 1 µM of E2 for 36 h. Class II MHC protein expression was measured using FACS analysis (B). IFN-{gamma}-induced class II MHC expression is shown as 100%, and the effects of 17ß-E2 or 17{alpha}-E2 are expressed as percentages of the IFN-{gamma}-induced class II MHC expression. Mean ± SD of four experiments. *, P < 0.002 compared with IFN-{gamma} alone (C).

 
17ß-E2 Inhibits IFN-{gamma} Induction of IE-ß mRNA Expression But Does Not Modulate CIITA mRNA Expression
No constitutive expression of IE-ß mRNA was observed in IBE cells (Fig. 3AGo), and 17ß-E2 alone had no effect on IE-ß levels (data not shown). 17ß-E2 inhibited IFN-{gamma}-induced IE-ß mRNA expression by approximately 50% (Fig. 3Go, A and B). 17{alpha}-E2 had no effect on IFN-{gamma}-induced IE-ß mRNA levels (data not shown). Stimulation of IBE cells with IFN-{gamma} resulted in a 12-fold induction of CIITA mRNA as determined by RPA (Fig. 3Go, C and D). Treatment with IFN-{gamma} and 17ß-E2 did not have any significant effect on the level of steady-state CIITA mRNA expression (Fig. 3Go, C and D). This finding is in agreement with a recent published report showing that estrogen does not inhibit IFN-{gamma}-induced CIITA mRNA levels as determined by RT-PCR (43). Together, these data indicate that 17ß-E2 inhibits IFN-{gamma}-induced IE-ß mRNA expression, but not that of CIITA.



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 3. 17ß-E2 Inhibits IFN-{gamma} Induced IE-ß mRNA Expression But Does Not Inhibit IFN-{gamma} Induced CIITA mRNA Expression

IBE cells were either incubated in serum-free media (Untx), stimulated with 4 U/ml of IFN-{gamma}, or simultaneously treated with IFN-{gamma} plus 1 µM of 17ß-E2 for 24 h to assess IE-ß mRNA levels (A) or for 12 h to assess CIITA mRNA levels (C). IE-ß and CIITA mRNA levels were analyzed by RPA. GAPDH mRNA levels were measured for loading control. The fold induction shown in A and C is from the depicted figure. The mean ± SD of three experiments for IE-ß fold induction is shown in (B) and CIITA fold induction is shown in (D). *, P < 0.005 compared with IFN-{gamma} alone.

 
To confirm that 17ß-E2 does not influence CIITA transcription, we generated IBE cell lines that stably express human CIITA. Overexpression of the CIITA protein results in constitutive class II MHC expression in the absence of IFN-{gamma} stimulation (13). In those clones that express low levels of human CIITA, we find moderate expression of class II MHC proteins, and when these clones are treated with 17ß-E2, but not 17{alpha}-E2, class II MHC protein expression is inhibited (Table 1Go). 17ß-E2 treatment did not have any effect on the CIITA expression vector as shown by analysis of human CIITA RNA levels using RPA (Fig. 4Go). These data further support the suggestion that 17ß-E2 inhibits class II MHC expression in a manner independent of CIITA.


View this table:
[in this window]
[in a new window]
  		Table 1. Class II MHC Expression in IBE Cells Stably Transfected with Human CIITA Construct

 


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 4. 17ß-E2 Does Not Affect Expression of Human CIITA mRNA in CIITA Stably Transfected IBE Cells

Stably transfected IBE cells (clone 6) were incubated in either serum-free media (Media), or with 1 µM of 17ß-E2 for 12 h to assess CIITA mRNA levels. CIITA mRNA levels were analyzed by RPA. GAPDH mRNA levels were measured as a loading control. Representative of two experiments. No statistical difference was found between the two conditions (media vs. 17ß-E2).

 
17ß-E2 Inhibits IFN-{gamma} Induction of Class II MHC in Multiple Cell Types
To demonstrate that the effect of 17ß-E2 on IFN-{gamma}-induced class II MHC expression is not restricted to a certain cell type or species, we analyzed several cell lines: RAW264.7, a murine macrophage cell line; HT1080, a human fibrosarcoma cell line; and CRT-MG, a human astroglioma cell line. We found that 17ß-E2 significantly inhibited IFN-{gamma}-induced class II MHC protein expression in all cell lines tested (Fig. 5AGo). The effect of 17ß-E2 on IFN-{gamma} induction of HLA-DR{alpha} and CIITA RNA was assessed in the CRT-MG cells. We find that IFN-{gamma}-induced human leukocyte antigen (HLA)-DR{alpha} mRNA levels are inhibited by 17ß-E2 (Fig. 5BGo); however, steady-state CIITA mRNA levels are not affected by 17ß-E2 treatment (Fig. 5CGo). TGF-ß, a known inhibitor of both CIITA and class II MHC (13), was used as a control (Fig. 5Go, B and C). Similar results were observed in the RAW and HT1080 cell lines (data not shown). These results demonstrate that 17ß-E2 inhibition of IFN-{gamma}-induced class II MHC expression occurs in a variety of cell types.



View larger version (52K):
[in this window]
[in a new window]
  		Fig. 5. 17ß-E2 Inhibits IFN-{gamma} Induced Class II MHC, But Not CIITA Expression in Other Cell Types

Cells were incubated in serum-free media, with either 4 U/ml of murine IFN-{gamma} (RAW) or 250 U/ml of human IFN-{gamma} (HT1080 and CRT), or simultaneously with 17ß-E2 plus IFN-{gamma} for 36 h. Class II MHC protein expression was assessed by FACS analysis. 17ß-E2 mediated inhibition of class II MHC protein levels is shown as a percentage of IFN-{gamma}-induced class II MHC protein. Mean ± SD of three experiments. *, P < 0.01 compared with IFN-{gamma} alone (A). CRT cells were either incubated in serum-free media (Untx), 250 U/ml of human IFN-{gamma}, or simultaneously treated with IFN-{gamma} plus 1 µM of 17ß-E2 or 10 ng/ml of TGF-ß for 24 h to assess class II MHC mRNA levels. (B). A representative experiment is shown, and the mean ± SD of three experiments is depicted in the accompanying bar graph. *, P < 0.005 compared with IFN-{gamma} alone. Cells were stimulated as above for 12 h to assess CIITA mRNA levels (C). GAPDH mRNA levels were measured for loading control. CRT cells were either incubated in serum-free medium alone (Untx), with 250 U/ml of IFN-{gamma}, or simultaneously treated with IFN-{gamma} plus 1 µM of 17ß-E2 for 16 or 24 h. Cell lysates were collected and analyzed by immunoblotting for CIITA protein expression (D). Immunoblotting for actin was performed to ensure equal loading.

 
It is possible that 17ß-E2 may be inhibiting CIITA protein expression in IBE and other cell types, but in experiments performed using the human CRT cell line, we did not detect any inhibition of IFN-{gamma}-induced CIITA protein levels by 17ß-E2 (Fig. 5DGo). Unfortunately, we were unable to reliably detect CIITA protein expression in the IBE cells, even though we used three different commercially available murine CIITA antibodies. These data indicate that 17ß-E2 inhibits class II MHC expression in a CIITA-posttranslational or -independent manner because we find no decrease in CIITA mRNA/protein levels after 17ß-E2 treatment, but we do see a decrease in class II MHC mRNA.

17ß-E2 Does Not Globally Inhibit IFN-{gamma} Signaling
To determine whether the inhibitory effect of 17ß-E2 on IFN-{gamma}-induced class II MHC was due to global cellular inhibition of IFN-{gamma} signaling, we analyzed the effect of 17ß-E2 on IFN-{gamma} activation of Signal Transducer and Activator of Transcription (STAT)-1{alpha}. STAT-1{alpha} is tyrosine phosphorylated subsequent to IFN-{gamma} ligation of the IFN-{gamma} receptor (for review, see Ref. 44). 17ß-E2 had no effect on IFN-{gamma}-induced STAT-1{alpha} tyrosine phosphorylation as determined by immunoblotting (Fig. 6AGo). In addition, we also examined the effect of 17ß-E2 on IFN-{gamma}-induced interferon regulatory factor-1 (IRF-1) expression. IFN-{gamma} induced a 19-fold increase in IRF-1 mRNA, and neither a 4-h pretreatment nor simultaneous treatment with 17ß-E2 had any inhibitory effect on IFN-{gamma}-induced IRF-1 mRNA levels (Fig. 6BGo). These data show that 17ß-E2 does not globally inhibit IFN-{gamma} signaling and suggests that the inhibition is specific for IFN-{gamma}-induced class II MHC expression.



View larger version (43K):
[in this window]
[in a new window]
  		Fig. 6. 17ß-E2 Does Not Inhibit IFN-{gamma} Activation of STAT-1{alpha} nor IFN-{gamma} Induction of IRF-1 mRNA Expression

IBE cells were incubated in serum-free media (Untx), with 4 U/ml of IFN-{gamma}, with 17ß-E2 (1 µM), pretreated with 1 µM of 17ß-E2 for 4 h and then stimulated with IFN-{gamma}, or simultaneously treated with IFN-{gamma} plus 17ß-E2. Total treatment time with IFN-{gamma} was 30 min. A, Cell lysates were collected and subjected to SDS-PAGE for immunoblotting. Blots were probed with a Y701-phospho-STAT-1{alpha} antibody, stripped, and reprobed with antibody to total STAT-1{alpha}. B, IBE cells were treated as described in 6A. RNA was collected and analyzed for IRF-1 and GAPDH mRNA expression using RPA. GAPDH, a housekeeping gene, was used for normalization. There was no statistical difference between IFN-{gamma} treatment alone or in combination with 17ß-E2. Representative of at least three experiments.

 
Histone Acetylation of the Class II MHC Promoter Is Inhibited by 17ß-E2
Association of CIITA with the class II MHC promoter and transcription of the class II MHC gene is correlated with H3 and H4 histone acetylation (4, 5). Histone acetylation is associated with opening of the chromatin structure and with activation of transcription (6). We used chromatin immunoprecipitation (ChIP) followed by PCR with primers specific for the murine class II MHC promoter to determine the effect of 17ß-E2 on histone acetylation. Untreated IBE cells had low levels of constitutive histone H3 and H4 acetylation (Fig. 7AGo, lane 1). Treatment with IFN-{gamma} led to increased acetylation of H3 and H4 (lane 2), whereas stimulation with 17ß-E2 alone had little to no effect on the levels of H3 and H4 acetylation (lane 3). However, when 17ß-E2 and IFN-{gamma} were combined, IFN-{gamma}-induced hyper-acetylation of H3 and H4 was almost completely inhibited (Fig. 7AGo, lane 4). Inclusion of 17{alpha}-E2 with IFN-{gamma} did not influence H3 and H4 hyper-acetylation (lane 5).



View larger version (37K):
[in this window]
[in a new window]
  		Fig. 7. 17ß-E2 Inhibits Histone Acetylation of the Class II MHC Promoter

IBE cells were either incubated in serum-free media (Untx), stimulated with 4 U/ml of IFN-{gamma}, with 1 µM of 17ß-E2, or simultaneously treated with IFN-{gamma} plus 1 µM of 17ß-E2 or 17{alpha}-E2 for 7 h (A). Alternatively, IBE cells stably transfected with a CIITA expression vector (clone 6) were incubated in serum-free media (Media) or 17ß-E2 for 7 h (B). ChIP assays, using antibodies specific for acetylated H3 or H4 histones, were performed followed by PCR. Input chromatin was subjected to PCR to control for variations in immunoprecipitation starting material. Normal polyclonal rabbit IgG was used as a negative immunoprecipitation control for nonspecific binding. Representative of at least three experiments.

 
A similar study was performed using IBE clone 6 (stably transfected with a CIITA expression vector) that constitutively expresses class II MHC in the absence of IFN-{gamma} stimulation. As expected, we find strong constitutive H3 and H4 acetylation in these cells (Fig. 7BGo, lane 1). When the clones are treated with 17ß-E2, there is a substantial reduction in the acetylation status of both H3 and H4 histones, particularly H3 (Fig. 7BGo, lane 2). Together, the data from wild-type IBE cells and CIITA stably transfected cells indicate that 17ß-E2 inhibits class II MHC expression by interfering with histone acetylation.

17ß-E2 Inhibits CBP Association with the Class II MHC Promoter
Previous studies have shown that CBP interacts with CIITA to synergistically activate transcription of class II MHC genes (10). We used ChIP assays to determine whether 17ß-E2 had any effect on CBP association with the class II MHC promoter. Untreated IBE cells showed low levels of CBP association with the promoter (Fig. 8AGo, lane 1), whereas treatment with IFN-{gamma} led to increased CBP recruitment (lane 2). Incubation with 17ß-E2 alone reduced the constitutive level of CBP associated with the promoter (lane 3), and when 17ß-E2 and IFN-{gamma} were combined, IFN-{gamma}-induced CBP association with the class II MHC promoter was substantially inhibited (Fig. 8AGo, lane 4).



View larger version (48K):
[in this window]
[in a new window]
  		Fig. 8. 17ß-E2 Inhibits CBP Association with the Class II Promoter

IBE cells were either incubated in serum-free media (Untx), stimulated with 4 U/ml of IFN-{gamma}, with 1 µM of 17ß-E2, or simultaneously treated with IFN-{gamma} plus 17ß-E2 for 4.5 h (A). IBE cells stably transfected with a CIITA expression vector (clone 6) were incubated in serum-free media (Media) or 17ß-E2 for 4.5 h (B). ChIP assays, using an antibody specific for CBP, were performed followed by PCR. Input chromatin was subjected to PCR to control for variations in immunoprecipitation starting material. Representative of at least three experiments.

 
This experiment was repeated using IBE clone 6. High levels of CBP were constitutively associated with the class II MHC promoter (Fig. 8BGo, lane 1). After treatment with 17ß-E2, there was a marked reduction of CBP on the promoter (lane 2). These results demonstrate that 17ß-E2 signaling interferes with CBP association with the class II MHC promoter, and thereby provides a mechanism by which 17ß-E2 inhibits H3 and H4 histone acetylation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Our study shows that 17ß-E2 inhibits IFN-{gamma}-induced class II MHC expression on endothelial cells as well as other cell types. Interestingly, we find that 17ß-E2 does not inhibit IFN-{gamma}-induced class II MHC expression at the level of CIITA transcription; the stage inhibited by almost all other compounds that inhibit class II expression (for review, see Ref. 12). The inhibition is not due to global attenuation of IFN-{gamma} signaling, as other important functions mediated by this cytokine, STAT-1{alpha} activation and IRF-1 expression, remain intact in the presence of 17ß-E2. Finally, we show that 17ß-E2 can attenuate both IFN-{gamma}-induced and constitutive acetylation of H3 and H4 histones located in the class II MHC promoter, which is likely due to concomitant inhibition of CBP binding to the promoter. These results lead us to propose that 17ß-E2 inhibition of class II expression occurs by reducing the level of CBP associated with the promoter, resulting in decreased histone acetylation and ultimately inhibition of class II transcription.

Regulation of class II MHC expression occurs primarily at the transcriptional level by the CIITA (1, 2). Most inhibitors of class II MHC expression, for example, IL-4, IL-10, and TGF-ß, block transcription of CIITA RNA and therefore prevent activation of downstream events on the class II MHC promoter (12). Although we find that 17ß-E2 inhibits IFN-{gamma}-induced class II MHC expression at a comparable level (40–60%) to other inhibitors (14), 17ß-E2 has no effect on IFN-{gamma}-induced CIITA mRNA or protein expression. Data from CIITA RPA experiments and studies using IBE cells stably transfected with a CIITA expression construct support our assertion that 17ß-E2 does not inhibit at the level of CIITA transcription (Table 1Go, Fig. 4Go). Our findings are in agreement with the results of a recently published report showing that 17ß-E2 does not inhibit IFN-{gamma}-induced CIITA mRNA expression in MCF-7 cells (43). 17ß-E2 appears to mediate its inhibitory effects on class II MHC at a point beyond CIITA translation as shown by immunoblotting for CIITA protein (Fig. 5DGo). It is possible that the inhibitory mechanism of 17ß-E2 involves posttranslational modifications of the CIITA protein. Several published reports have identified posttranslational modifications of CIITA that alter the transactivating function or nuclear localization of this important regulator. Phosphorylation of CIITA protein has been shown to inhibit its transactivating activity, whereas, acetylation of CIITA protein enhances nuclear localization of CIITA, which in turn leads to an increase in class II MHC expression (45, 46).

Although we do not know the precise inhibitory pathway of 17ß-E2, we do have evidence for an inhibitory mechanism of class II MHC expression. Investigators have shown that the association of CIITA with the class II MHC promoter is directly correlated with histone acetylation, and that histone acetylation is necessary for class II MHC transcription (4, 5, 47). In the IBE cells, we find that there is an increase in H3 and H4 acetylation on the class II MHC promoter after stimulation with IFN-{gamma}. Acetylation of histones changes the electrostatic interactions between histones and DNA that results in DNA/histone structural conformations that promote transcription. Conversely, deacetylation of histones induces conformations that are correlated with inhibition of transcription (6, 48). We found that 17ß-E2, but not biologically inactive 17{alpha}-E2, inhibits IFN-{gamma}-induced H3 and H4 acetylation. In addition, constitutive H3 and H4 acetylation in the IBE cells overexpressing CIITA is also inhibited by 17ß-E2. By decreasing the amount of histone acetylation, it is likely that 17ß-E2 inhibits class II MHC expression by interfering with chromatin remodeling and perhaps with the recruitment of important transcription factors. In this regard, we find that the association of CBP, an important HAT, with the class II MHC promoter is also markedly decreased in the presence of 17ß-E2. It is likely that 17ß-E2 mediated inhibition of histone acetylation is due to reduced levels of CBP present at the class II MHC promoter. Although it has been reported that CIITA contains some HAT activity (49), 17ß-E2 does not significantly inhibit CIITA association with the class II MHC promoter (43). Therefore, the decrease in histone acetylation found in the presence of 17ß-E2 is most likely due to interference of CBP rather than CIITA binding to the class II MHC promoter.

In their recent paper, Tzortzakaki et al. (43), showed that CIITA synergizes with members of the p160 coactivator family (steroid receptor coactivator-1) to up-regulate class II MHC expression. They found that 17ß-E2 treatment inhibited IFN-{gamma}-induced class II MHC expression, and that the mechanism of inhibition may in part be due to squelching of p160 proteins. However, ChIP assays showed only a small reduction of steroid receptor coactivator-1 binding at the class II MHC promoter in the presence of 17ß-E2. These investigators also determined that 17ß-E2 treatment interfered with assembly of the basal transcription machinery on the class II MHC promoter. Notably, there were reduced levels of TATA-box binding protein and RNA polymerase II in the presence of estrogen (43). Perhaps the disruption of the preinitiation complex formation is due to a closed chromatin conformation, which is a result of decreased CBP association with the promoter and subsequent hypoacetylation of histones in the presence of 17ß-E2, as shown by our results.

Despite many clinical studies and a multitude of anecdotal reports regarding remission of cell-mediated autoimmunity during pregnancy, surprisingly little is known about the mechanism of pregnancy-induced remission. Obvious candidates to mediate this effect are estrogens because circulating levels of these hormones soar during pregnancy. In recent clinical trials, patients with MS were treated with pregnancy levels of estrogen in an attempt to mimic the state of disease remission often associated with pregnancy. Patients treated with high levels of estrogen achieved the same degree of disease amelioration that is found with other, more conventional, treatments for MS such as IFN-ß and glatiramer acetate therapy (50, 51). Because estrogen can mediate down-regulation of class II MHC, and aberrant expression of class II MHC is suspected to be one of the factors leading to autoimmune disease, there is likely a correlation between high levels of circulating estrogen during pregnancy and reduced levels of autoimmune disease activity due to a decrease in the level of class II MHC expression. We and others (38, 39, 40, 41, 42) have shown that estrogen can down-regulate expression of class II MHC. In this report, we show that 17ß-E2 acts to inhibit class II expression at a point after translation of CIITA protein. This finding is somewhat unexpected because most compounds inhibit class II MHC expression at the level of CIITA transcription. 17ß-E2 targets the class II MHC promoter by decreasing CBP association with the class II MHC promoter, which results in reduced histone acetylation and ultimately leads to inhibition of class II MHC transcription. By determining the mechanisms used by estrogens to inhibit class II MHC expression, we will be one step closer to finding alternate, and perhaps safer, methods of treating cell-mediated autoimmunity.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Cell Lines and Reagents
The Immortomouse brain endothelial (IBE) cell line was derived from H-2Kb-tsA58 transgenic mice. Briefly, the Immortomouse transgenic rodents express a temperature-sensitive simian virus 40 (SV40) large T antigen driven by the H-2Kb promoter (52). At permissive temperatures, the simian virus 40 T antigen imparts an immortal phenotype to the brain endothelial cells, allowing them to be passaged many times in culture. IBE cells were maintained in flasks coated with gelatin at 33 C in Ham’s F12 media supplemented with 10% fetal bovine serum (FBS), 2 U/ml of murine IFN-{gamma}, 4 mM L-glutamine, and 2.5 µg/ml amphotericin-B. For all experiments, IFN-{gamma} was withheld from culture media for at least one passage before plating the cells for use.

The CRT human astroglioma cell line was grown in RPMI 1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin as previously described (53). The HT1080 human fibrosarcoma and RAW264.7 murine macrophage cell lines were maintained in DMEM supplemented with 10% FBS, 2 mM Lglutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin as described previously (54).

17ß- and 17{alpha}-E2 were purchased from Sigma (St. Louis, MO). Recombinant murine IFN-{gamma} was purchased from Endogen (Woburn, MA). Human recombinant IFN-{gamma} was a generous gift from Biogen (Cambridge, MA). PE-conjugated rat IgG antimouse class II MHC antibody (clone NIMR-4) was purchased from Southern Biotechnology Associates (Birmingham, AL), rabbit anti-ER{alpha} (clone MC-20), rabbit anti-ERß (clone H-150), mouse anti-human CIITA antibody (clone 7–1H), and rabbit anti-CBP (clone A22) antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and RPE-conjugated mouse antihuman HLA DP+DQ+DR antibodies (clone WR18) was purchased from Serotec Ltd. (Oxford, UK). Antibodies to STAT-1{alpha}, phosphotyrosine-701-STAT-1{alpha}, acetylated histone 3 (H3), and acetylated histone 4 (H4) were purchased from Upstate Biotechnology (Lake Placid, NY).

Immunoblotting
IBE cells were lysed using lysis buffer plus proteinase inhibitors [50 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 1 mM NaF, 1 mM sodium orthovanadate, 25 µg/ml aprotinin, 25 µg/ml leupeptin and 1 mM phenylmethylsulfonyl fluoride (PMSF)-20]. Fifty micrograms of total cell lysate were subjected to 8% SDS-PAGE. Proteins were then transferred to a nitrocellulose membrane and probed with antibody directed against either ER{alpha} or ERß proteins (1:200 dilution). Enhanced chemiluminescence was used for detection of bound antibody.

CRT cells were plated at 3.5 x 106 cells per 100-mm dish and allowed to grow for 12–16 h in media containing 10% FBS. Fresh serum-free media were then added and the cells either left untreated, stimulated with 250 U/ml of IFN-{gamma} alone or in combination with 1 µM of 17ß-E2 for 16 or 24 h. CRT cells were lysed using lysis buffer plus proteinase inhibitors. One hundred micrograms of total cell lysate were subjected to 8% SDS-PAGE. Proteins were then transferred to a nitrocellulose membrane and probed with antibody directed against human CIITA (1:100 dilution). Enhanced chemiluminescence was used for the detection of bound antibody.

Fluorescence-Activated Cell Sorting (FACS)
Cells were plated at 5.0 x 105 cells/well into six-well plates and allowed to grow for 12–16 h in media supplemented with 10% FBS. Serum-containing media were aspirated, and 2 ml of fresh serum-free media were added to each well. The cells were then treated with 4 U/ml of murine IFN-{gamma} or 250 U/ml of human IFN-{gamma} alone or in combination with 1 µM 17ß- or 17{alpha}-E2 for 36–48 h. Cells were trypsinized and stained for class II MHC antigens as previously described (53). Negative controls were stained with an isotype matched control antibody.

RNA Isolation, Riboprobes, and RPA
Total cellular RNA was isolated from confluent monolayers of cells that were treated with IFN-{gamma} alone or in combination with 1 µM 17ß- or 17{alpha}-E2 for 24 h to assay for class II MHC, 12 h to assay for CIITA, and 0.5 h to assay for IRF-1 mRNA.

A pGEM-4Z vector containing a fragment of the mouse CIITA cDNA corresponding to bp 2724–3152 was linearized with PuvI. In vitro transcription of this fragment with T7 polymerase generates a 627-bp antisense RNA probe (55). A pT7T3 vector containing murine H2-IE-ß cDNA (I.M.A.G.E. clone ID: 1262900) was purchased from ATCC (Manassas, VA). The vector was linearized with XmnI and in vitro transcription of this construct with T3 polymerase yielded a 338-bp antisense RNA probe, which encompasses bp 829-1119 of the IE-ß cDNA. A fragment of murine IRF-1 cDNA corresponding to bp 1–314 was inserted into a pGEM-4Z vector and linearized with EcoRI. In vitro transcription of this fragment with T7 polymerase generates a 367-bp anti-sense RNA probe. A pGEM-4Z vector containing a fragment of the mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA, corresponding to bp 223–434 was linearized with NcoI and used to generate a 145-bp antisense RNA probe.

A pGEM-T plasmid containing a 626-bp fragment corresponding to 2908–3545 bp of the human CIITA cDNA was linearized by AvaII and used to generate an antisense RNA probe 498 nucleotides in length (53). The DR{alpha} 120 plasmid, which contains the HLA-DR{alpha} cDNA (no. 57392, from ATCC), was digested with BamHI and RsaI, subcloned into the BamHI/HincII polylinker site of pGEM-4Z, linearized by BamHI, and a 454-nucleotide antisense RNA probe was synthesized from this construct as previously described (56). A pAMP-1 vector containing a fragment of the human GAPDH cDNA corresponding to 43–531 bp was linearized with NcoI. In vitro transcription of this linearized plasmid with T7 RNA polymerase generates a 290-bp antisense RNA probe (53).

RPAs were conducted with the RPA III kit from Ambion (Austin, TX) according to the manufacturer’s instructions and as previously described (55). Briefly, 30 µg of RNA were hybridized with CIITA, class II MHC, IRF-1, and GAPDH riboprobes (3.0 x 104 cpm) at 42 C overnight in 20 µl of hybridization buffer. The hybridization mixture was then treated with ribonuclease A/T1 at 37 C for 30 min, analyzed by 5% denaturing PAGE, and the gels were exposed to a phosphorimaging cassette (Molecular Dynamics, Sunnyvale, CA). The protected fragments for murine CIITA, IE-ß, IRF-1, and GAPDH riboprobes are 429, 290, 314, and 87 nucleotides in length, respectively. The protected fragment size for human CIITA, HLA-DR{alpha}, and GAPDH are 452, 413, and 230 nucleotides, respectively. Quantification of the protected RNA fragments was performed by scanning with the Phosphorimager (Molecular Dynamics) and analyzing with the ImageQuant version 1.2 program from Molecular Dynamics. Values for CIITA, IE-ß, and IRF-1 mRNA expression were normalized to GAPDH mRNA levels for each experimental condition.

Stable Transfection of Human CIITA
CIITA stable transfectants were created by transfecting IBE cells with the pcDNA3 expression vector containing N-terminal Flag-tagged cDNA of human CIITA under the control of a cytomegalovirus promoter (13, 47, 57) (a generous gift from Dr. J. P.-Y. Ting, The University of North Carolina at Chapel Hill, Chapel Hill, NC) using the FuGENE 6 method according to the manufacturer (Roche Diagnostics Corp., Indianapolis, IN). IBE cells stably transfected with the pcDNA3 plasmid only were generated for use as a negative control. Cells were selected in G418 sulfate (400 µg/ml); they were screened for CIITA expression directly by immunoblotting for CIITA protein and indirectly by FACS analysis for class II MHC expression.

ChIP Assay
IBE cells were plated at 5.0 x 106 cells per 150-mm dish and allowed to grow for 12–16 h in media containing 10% FBS. Serum-containing media were aspirated, and 15 ml of fresh serum-free media were added to each plate. IBE cells were either left untreated, stimulated with 4 U/ml of IFN-{gamma}, 1 µM of 17ß-E2, or IFN-{gamma} plus 17ß-E2 or 17{alpha}-E2 for either 4.5 h (CBP ChIP) or 7 h (histone acetylation ChIP). IBE cells stably transfected with CIITA were incubated in the absence or presence of 1 µM of 17ß-E2 for either 4.5 h (CBP ChIP) or 7 h (histone acetylation ChIP). After treatment, cells were trypsinized, washed one time in 10% FBS containing media to inactivate the trypsin, and then washed two times in cold PBS. Next, cells were resuspended in a hypotonic buffer containing protease inhibitors (10 mM HEPES, 1.5 MgCl2, 10 mM KCl, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20) and incubated on ice for 10 min. A final concentration of 0.5% Nonidet P-40 was added to the suspension to release cell nuclei by lysing the plasma membrane. Nuclei were washed in cold PBS one time, resuspended in 1% paraformaldehyde, and incubated at room temperature for 15 min to cross-link chromatin. Nuclei were then washed two times with cold TE buffer containing protease inhibitors (10 mM Tris-HCl, 1 mM EDTA, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20). Nuclei were resuspended in 2 ml of TE buffer and cross-linked chromatin was sheared by sonication to an average size of 500-bp fragments. Samples were then centrifuged at 14,000 rpm, 4 C, for 15 min to remove nuclear debris. Supernatant was collected and chromatin concentrations measured.

One hundred nanograms of chromatin were added to RIPA buffer containing protease inhibitors (50 mM Tris-HCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20) and precleared with salmon sperm DNA/protein A agarose beads purchased from Upstate Biotechnology (Lake Placid, NY). Next, cross-linked chromatin was immunoprecipitated using 5 µg of antibody against acetylated H3 or H4, CBP, or 5 µg of normal rabbit IgG control. The antibody/chromatin solution was mixed gently on a rotator for at least 16 h at 4 C. To collect antibody and chromatin complexes, salmon sperm DNA/protein A agarose beads were added and the solution was again gently rotated at 4 C for 2 h. Immune complex-bound beads were washed and the cross-linked chromatin eluted from the beads. To remove cross-links from precipitated chromatin, NaCl was added at a final concentration of 200 µM to the eluate, and the mixture was incubated for at least 12 h at 65 C. Next, EDTA (pH 8.0) and Tris-HCl (pH 6.5) (final concentrations 10 mM and 40 mM, respectively) and 15 mg/ml proteinase K was added to the eluate and placed in a shaker at 37 C for 2 h. DNA was recovered with phenol:chloroform:isoamyl (25:24:1) extraction and ethanol precipitation and then resuspended in nuclease-free water.

PCR was performed on 2% of input and 40% of immunoprecipitated DNA using primers specific for the mouse H2-IEß promoter: forward 5'-3' AAACAACCCAAAGCAAAACC and reverse 5'-3' TCAGCATCAAAGGAGTCCAG. Based on previous experiments of saturation kinetics, it was determined that PCR should be carried out for 32 cycles (data not shown). The amplified 283-bp PCR product was separated on a 2% agarose gel containing ethidium bromide and visualized using UV light.

Statistical Analysis
Levels of significance for comparisons between samples were determined using Student’s t test distribution.


   ACKNOWLEDGMENTS
 
We thank Dr. J. P.-Y. Ting (University of North Carolina at Chapel Hill, Chapel Hill, NC) for the human CIITA expression construct.


   FOOTNOTES
 
This work was supported in part by National Institutes of Health (NIH) Grants NS-39954 and NS-36765 (to E.N.B.). J.A. was supported in part by the Medical Scientist Training Program at the University of Alabama at Birmingham, and is currently supported by the NIH Predoctoral Fellowship T32 AR-07450. S.N. is supported by the NIH Postdoctoral Fellowship T32 AI-07493.

Abbreviations: APC, Antigen-presenting cell; ChIP, chromatin immunoprecipitation; CBP, CREB binding protein; CIITA, class II transactivator; CREB, cAMP response ele-ment binding protein; ER, estrogen receptor; 17ß-E2, 17ß-estradiol; FACS, fluorescence-activated cell sorting; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HAT, histone acetyltransferase; HLA, human leukocyte antigen; IBE, brain endothelial cell line; IFN, interferon; IRF-1, interferon regulatory factor-1; MHC, major histocompatibility complex; MS, multiple sclerosis; PMSF, phenylmethylsulfonyl fluoride; RFX, regulatory factor X; RPAs, ribonuclease protection assays; STAT, Signal Transducer and Activator of Transcription.

Received for publication March 9, 2004. Accepted for publication May 3, 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Rohn WM, Lee Y-J, Benveniste EN 1996 Regulation of class II MHC expression. Crit Rev Immunol 16:311–330[Medline]
  2. Abdulkadir SA, Ono SJ 1995 How are class II MHC genes turned on and off? FASEB J 9:1429–1435[Abstract]
  3. Ting JP-Y, Trowsdale J 2002 Genetic control of MHC class II expression. Cell 109(Suppl):S21–S33
  4. Beresford GW, Boss JM 2001 CIITA coordinates multiple histone acetylation modifications at the HLA-DRA promoter. Nat Immunol 2:652–657[CrossRef][Medline]
  5. Masternak K, Peyraud N, Krawczyk M, Barras E, Reith W 2003 Chromatin remodeling and extragenic transcription at the MHC class II locus control region. Nat Immunol 4:132–137[CrossRef][Medline]
  6. Struhl K 1998 Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12:599–606[Free Full Text]
  7. Chan HM, La Thangue NB 2001 p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363–2373[Abstract/Free Full Text]
  8. Bannister AJ, Kouzarides T 1996 The CBP co-activator is a histone acetyltransferase. Nature 384:641–643[CrossRef][Medline]
  9. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  10. Fontes JD, Kanazawa S, Jean D, Peterlin BM 1999 Interactions between the class II transactivator and CREB binding protein increase transcription of major histocompatibility complex class II genes. Mol Cell Biol 19:941–947[Abstract/Free Full Text]
  11. Kretsovali A, Agalioti T, Spilianakis C, Tzortzakaki E, Merika M, Papamatheakis J 1998 Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol Cell Biol 18:6777–6783[Abstract/Free Full Text]
  12. Reith W, Mach B 2001 The bare lymphocyte syndrome and the regulation of MHC expression. Annu Rev Immunol 19:331–373[CrossRef][Medline]
  13. Lee Y-J, Han Y, Lu H-T, Nguyen V, Qin H, Howe PH, Hocevar BA, Boss JM, Ransohoff RM, Benveniste EN 1997 TGF-ß suppresses IFN-{gamma} induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J Immunol 158:2065–2075[Abstract]
  14. O’Keefe GM, Nguyen VT, Benveniste EN 1999 Class II transactivator and class II MHC gene expression in microglia: modulation by the cytokines TGF-ß, IL-4, IL-13, and IL-10. Eur J Immunol 29:1275–1285[CrossRef][Medline]
  15. Pai RK, Convery M, Hamilton TA, Boom WH, Harding CV 2003 Inhibition of IFN-{gamma}-induced class II transactivator expression by a 19-kDa lipoprotein from Mycobacterium tuberculosis: a potential mechanism for immune evasion. J Immunol 171:175–184[Abstract/Free Full Text]
  16. Lüder CGK, Lang C, Giraldo-Velasquez M, Algner M, Gerdes J, Gross U 2003 Toxoplasma gondii inhibits MHC class II expression in neural antigen-presenting cells by down-regulating the class II transactivator CIITA. J Neurovirol 134:12–24
  17. Hegde NR, Chevalier MS, Johnson DC 2003 Viral inhibition of MHC class II antigen presentation. Trends Immunol 24:278–285[CrossRef][Medline]
  18. Youssef S, Stüve O, Patarroyo JC, Ruiz PJ, Radosevich JL, Hur EM, Bravo M, Mitchell DJ, Sobel RA, Steinman L, Zamvil SS 2002 The HMG-CoA reductase inhibitor, atorvastatin, promotes a Th2 bias and reverses paralysis in central nervous system autoimmune disease. Nature 420:78–84[CrossRef][Medline]
  19. Bruce-Keller AJ, Keeling JL, Keeler JN, Huang FF, Camondola S, Mattson M 2000 Antiinflammatory effects of estrogen on microglial activation. Endocrinology 141:3646–3656[Abstract/Free Full Text]
  20. Ito A, Bebo Jr BF, Matejuk A, Zamora A, Silverman M, Fyfe-Johnson A, Offner H 2001 Estrogen treatment down-regulates TNF-{alpha} production and reduces the severity of experimental autoimmune encephalomyelitis in cytokine knockout mice. J Immunol 167:542–552[Abstract/Free Full Text]
  21. Lockshin MD 2001 Sex ratio and rheumatic disease. J Appl Physiol 91:2366–2373[Abstract/Free Full Text]
  22. Knöferl MW, Angele MK, Schwacha MG, Bland KI, Chaudry IH 2002 Preservation of splenic immune functions by female sex hormones after trauma-hemorrhage. Crit Care Med 30:888–893[CrossRef][Medline]
  23. Hall JM, Couse JF, Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 276:36869–36872[Free Full Text]
  24. Hall JM, McDonnell DP, Korach KS 2002 Allosteric regulation of estrogen receptor structure, function, and coactivator recruitment by different estrogen response elements. Mol Endocrinol 16:469–486[Abstract/Free Full Text]
  25. Fan JDND, Wagner BL, McDonnell DP 1996 Identification of the sequences within the human complement 3 promoter required for estrogen responsiveness provides insight into the mechanism of tamoxifen mixed agonist activity. Mol Endocrinol 10:1605–1616[Abstract/Free Full Text]
  26. Yang NN, Venugopalan M, Hardikar S, Glasebrook A 1996 Identification of an estrogen response element activated by metabolites of 17ß-estradiol and raloxifene. Science 273:1222–1225[Abstract]
  27. Inadera H 2003 Estrogen-induced genes, WISP-2 and pS2, respond divergently to protein kinase pathway. Biochem Biophys Res Commun 309:272–278[CrossRef][Medline]
  28. Stirone C, Chu Y, Sunday L, Duckles SP, Krause DN 2003 17ß-Estradiol increases endothelial nitric oxide synthase mRNA copy number in cerebral blood vessels: quantification by real-time polymerase chain reaction. Eur J Pharmacol 478:35–38[CrossRef][Medline]
  29. Dabrosin C, Margetts PJ, Gauldie J 2003 Estradiol increases extracellular levels of vascular endothelial growth factor in vivo in murine mammary cancer. Int J Cancer 107:535–540[CrossRef][Medline]
  30. Cho H, Katzenellenbogen BS 1993 Synergistic activation of estrogen receptor-mediated transcription by estradiol and protein kinase activators. Mol Endocrinol 7:441–452[Abstract/Free Full Text]
  31. Kanda N, Watanabe S 2003 17ß-Estradiol inhibits MCP-1 production in human keratinocytes. J Invest Dermatol 120:1058–1066[CrossRef][Medline]
  32. Homma H, Kurachi H, Nishio Y, Takeda T, Yamamoto T, Adachi K, Morishige K, Ohmichi M, Matsuzawa Y, Murata Y 2000 Estrogen suppresses transcription of lipoprotein lipase gene. J Biol Chem 275:11404–11411[Abstract/Free Full Text]
  33. McMurray RW, Ndebele K, Hardy KJ, Jenkins JK 2001 17-ß-Estradiol suppresses IL-2 and IL-2 receptor. Cytokine 14:324–333[CrossRef][Medline]
  34. Jones DR, Schmidt RJ, Pickard RT, Foxworthy PS, Eacho PI 2002 Estrogen receptor-mediated repression of human hepatic lipase gene transcription. J Lipid Res 43:383–391[Abstract/Free Full Text]
  35. Whitacre CC, Reingold SC, O’Looney PA; and the Task Force on Gender, MS, and Autoimmunity 1999 A gender gap in autoimmunity. Science 283:1277–1278[Free Full Text]
  36. Confavreux C, Hutchinson M, Hours MM, Cortinovis-Tourniaire P, Moreau T 1998 Rate of pregnancy-related relapse in multiple sclerosis. N Engl J Med 339:285–291[Abstract/Free Full Text]
  37. Whitacre CC 2001 Sex differences in autoimmune disease. Nat Immunol 2:777–780[CrossRef][Medline]
  38. Tabibzadeh SS, Sivarajah A, Carpenter D, Ohlsson-Wilhelm BM, Satyaswaroop PG 1990 Modulation of HLA-DR expression in epithelial cells by interleukin 1 and estradiol-17ß. J Clin Endocrinol Metab 71:740–747[Abstract/Free Full Text]
  39. Debout C, Lefroit-Joliy M, Neveu T, Izard J 1991 17ß Estradiol affects the expression of guinea pig blood leukocyte MHC antigens. J Steroid Biochem Mol Biol 38:695–701[CrossRef][Medline]
  40. Lou H, Kodama T, Zhao YJ, Maurice P, Wang YN, Katz N, Foegh ML 1996 Inhibition of transplant coronary arteriosclerosis in rabbits by chronic estradiol treatment is associated with abolition of MHC class II antigen expression. Circulation 94:3355–3361[Abstract/Free Full Text]
  41. Saito S, Foegh ML, Motomura N, Lou H, Kent K, Ramwell PW 1998 Estradiol inhibits allograft-inducible major histocompatibility complex class II antigen expression and transplant arteriosclerosis in the absence of immunosuppression. Transplantation 66:1424–1431[CrossRef][Medline]
  42. Saito S, Motomura N, Lou H, Ramwell PW, Foegh ML 1997 Specific effects of estrogen on growth factor and major histocompatibility complex class II antigen expression in rat aortic allograft. J Thorac Cardiovasc Surg 114:803–810[Abstract/Free Full Text]
  43. Tzortzakaki E, Spilianakis C, Zika E, Kretsovali A, Papamatheakis J 2003 Steroid receptor coactivator SRC-1 links the steroid and interferon {gamma} response pathways. Mol Endocrinol 17:2509–2518[Abstract/Free Full Text]
  44. Stark GR, Kerr IM, Williams BR, Silverman RH, Schreiber RD 1998 How cells respond to interferons. Annu Rev Biochem 67:227–264[CrossRef][Medline]
  45. Li G, Harton JA, Zhu X, Ting JP 2001 Downregulation of CIITA function by protein kinase a (PKA)-mediated phosphorylation: mechanism of prostaglandin E, cyclic AMP, and PKA inhibition of class II major histocompatibility complex expression in monocytic lines. Mol Cell Biol 21:4626–4635[Abstract/Free Full Text]
  46. Spilianakis C, Papamatheakis J, Kretsovali A 2000 Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol Cell Biol 20:8489–8498[Abstract/Free Full Text]
  47. Zika E, Greer SF, Zhu X-S, Ting JP-Y 2003 Histone deacetylase 1/mSin3A disrupts {gamma} interferon-induced CIITA function and major histocompatibility complex class II enhanceosome formation. Mol Cell Biol 23:3091–3102[Abstract/Free Full Text]
  48. Kuo M-H, Allis CD 1998 Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20:615–626[CrossRef][Medline]
  49. Raval A, Howcroft TK, Weissman JD, Kirshner S, Zhu XS, Yokoyama K, Ting J, Singer DS 2001 Transcriptional coactivator, CIITA, is an acetyltransferase that bypasses a promoter requirement for TAFII250. Mol Cell 7:105–115[CrossRef][Medline]
  50. Sicotte NL, Liva SM, Klutch R, Pfeiffer P, Bouvier S, Odesa S, Wu TC, Voskuhl RR 2002 Treatment of multiple sclerosis with the pregnancy hormone estriol. Ann Neurol 52:421–428[CrossRef][Medline]
  51. Soldan SS, Retuerto AIA, Sicotte NL, Voskuhl RR 2003 Immune modulation in multiple sclerosis patients treated with the pregnancy hormone estriol. J Immunol 171:6267–6274[Abstract/Free Full Text]
  52. Jat PS, Noble MD, Ataliotis P, Tanaka Y, Yannoutsos N, Larsen L, Kioussis D 1991 Direct derivation of conditionally immortal cell lines from an H-2Kb-tsA58 transgenic mouse. Proc Natl Acad Sci USA 88:5096–6100[Abstract/Free Full Text]
  53. Van Wagoner NJ, O’Keefe GM, Benveniste EN 1998 Kinase inhibitors abrogate IFN-{gamma}-induced class II transactivator and class II MHC gene expression in astroglioma cell lines. J Neuroimmunol 85:174–185[CrossRef][Medline]
  54. Nguyen VT, Benveniste EN 2000 Involvement of STAT-1{alpha} and ets family members in interferon-{gamma} induction of CD40 transcription in macrophages/microglia. J Biol Chem 271:23674–23684
  55. Dong Y, Tang L, Letterio JJ, Benveniste EN 2001 The Smad3 protein is involved in TGF-ß inhibition of class II transactivator and class II MHC expression. J Immunol 167:311–319[Abstract/Free Full Text]
  56. Lee Y-J, Benveniste EN 1996 STAT-1{alpha} expression is involved in IFN-{gamma} induction of the class II transactivator and class II MHC genes. J Immunol 157:1559–1568[Abstract]
  57. Kretsovali A, Spilianakis C, Dimakopoulos A, Makatounakis T, Papamatheakis J 2001 Self-association of class II transactivator correlates with its intracellular localization and transactivation. J Biol Chem 276:32191–32197[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Ligands:   17β-Estradiol



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
O. I. Koues, R. K. Dudley, A. D. Truax, D. Gerhardt, K. P. Bhat, S. McNeal, and S. F. Greer
Regulation of Acetylation at the Major Histocompatibility Complex Class II Proximal Promoter by the 19S Proteasomal ATPase Sug1
Mol. Cell. Biol., October 1, 2008; 28(19): 5837 - 5850.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
M. Ivanga, Y. Labrie, E. Calvo, P. Belleau, C. Martel, V. Luu-The, J. Morissette, F. Labrie, and F. Durocher
Temporal analysis of E2 transcriptional induction of PTP and MKP and downregulation of IGF-I pathway key components in the mouse uterus
Physiol Genomics, March 14, 2007; 29(1): 13 - 23.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
S. A. Oldford, J. D. Robb, D. Codner, V. Gadag, P. H. Watson, and S. Drover
Tumor cell expression of HLA-DM associates with a Th1 profile and predicts improved survival in breast carcinoma patients
Int. Immunol., November 1, 2006; 18(11): 1591 - 1602.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Z. T. Ruiz-Cortes, S. Kimmins, L. Monaco, K. H. Burns, P. Sassone-Corsi, and B. D. Murphy
Estrogen Mediates Phosphorylation of Histone H3 in Ovarian Follicle and Mammary Epithelial Tumor Cells via the Mitotic Kinase, Aurora B
Mol. Endocrinol., December 1, 2005; 19(12): 2991 - 3000.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. C. Lambert, E. M. Curran, B. M. Judy, G. N. Milligan, D. B. Lubahn, and D. M. Estes
Estrogen Receptor {alpha} (ER{alpha}) Deficiency in Macrophages Results in Increased Stimulation of CD4+ T Cells while 17{beta}-Estradiol Acts through ER{alpha} to Increase IL-4 and GATA-3 Expression in CD4+ T Cells Independent of Antigen Presentation
J. Immunol., November 1, 2005; 175(9): 5716 - 5723.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
J. Adamski and E. N. Benveniste
17{beta}-Estradiol Activation of the c-Jun N-Terminal Kinase Pathway Leads to Down-Regulation of Class II Major Histocompatibility Complex Expression
Mol. Endocrinol., January 1, 2005; 19(1): 113 - 124.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adamski, J.
Right arrow Articles by Benveniste, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adamski, J.
Right arrow Articles by Benveniste, E. N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals