Molecular Endocrinology, doi:10.1210/me.2004-0065
Molecular Endocrinology 18 (8): 2011-2023
Copyright © 2004 by The Endocrine Society
The LATS2/KPM Tumor Suppressor Is a Negative Regulator of the Androgen Receptor
Mark Powzaniuk,
Sheila McElwee-Witmer,
Robert L. Vogel,
Tadashi Hayami,
Su Jane Rutledge,
Fang Chen,
Shun-ichi Harada,
Azriel Schmidt,
Gideon A. Rodan,
Leonard P. Freedman and
Chang Bai
Department of Molecular Endocrinology/Bone Biology, Merck Research Laboratories, West Point, Pennsylvania 19486-0004
Address all correspondence and requests for reprints to: Chang Bai, Ph.D, Department of Molecular Endocrinology, Merck Research Laboratories, West Point, Pennsylvania 19486-0004. E-mail: chang_bai{at}merck.com.
 |
ABSTRACT
|
|---|
The androgen receptor (AR) is a member of the steroid receptor superfamily that plays critical roles in the development and maintenance of the male reproductive system and in prostate cancer. Actions of AR are controlled by interaction with several classes of coregulators. In this study, we have identified LATS2/KPM as a novel AR-interacting protein. Human LATS1 and LATS2 are tumor suppressors that are homologs of Drosophila warts/lats. The interaction surface of LATS2 is mapped to the central region of the protein, whereas the AR ligand binding domain is sufficient for this interaction. LATS2 functions as a modulator of AR by inhibiting androgen-regulated gene expression. The mechanism of LATS2-mediated repression of AR activity appears to involve the inhibition of AR NH2- and COOH-terminal interaction. Chromatin immunoprecipitation assays in human prostate carcinoma cells reveal that LATS2 and AR are present in the protein complex that binds at the promoter and enhancer regions of prostate-specific antigen, and overexpression of LATS2 results in a reduction in androgen-induced expression of endogenous prostate-specific antigen mRNA. Immunohistochemistry shows that LATS2 and AR are localized within the prostate epithelium and that LATS2 expression is lower in human prostate tumor samples than in normal prostate. The results suggest that LATS2 may play a role in AR-mediated transcription and contribute to the development of prostate cancer.
 |
INTRODUCTION
|
|---|
WARTS/LATS IS A RECENTLY identified Drosophila tumor suppressor belonging to a subfamily of protein kinases involved in the regulation of cell cycle progression, cell morphogenesis, and tumor development (1, 2, 3). The warts gene was identified in mutant flies exhibiting a wart-like phenotype (4), whereas the same gene lats (large tumor suppressor) was identified as a recessive overproliferation mutant in cells of genetic mosaic flies (5). In mammals, two homologs of Drosophila lats exist, LATS1 and LATS2/KPM. Human LATS1 and LATS2 are distinct but share a similar degree of homology to Drosophila warts/lats (1, 2, 3). Extensively studied, mice deficient in Lats1 develop soft tissue sarcomas and ovarian stromal cell tumors (6), whereas human LATS1 can rescue all developmental abnormalities in flies (3), indicating that the mammalian homologs of lats also function as tumor suppressors. Furthermore, LATS1 protein has been shown to be phosphorylated and associated with CDC2 at G2/M transition or early mitosis, whereas expression of LATS1 in human tumor cell lines induces apoptosis by up-regulating Bax and Caspase-3 activity (3, 7, 8). These data suggest that LATS1 may control tumorigenesis by inducing apoptosis and/or by negatively regulating the cell cycle.
The function of LATS2, also known as KPM, is less clear. Localized within the nucleus, LATS2 possesses kinase activity and phosphorylates itself in vitro. Using HeLa cells, it was shown that LATS2 protein is specifically phosphorylated during mitosis and is constantly expressed throughout the cell cycle (1). Furthermore, LATS2 is mapped to 13q11-q12, a region shared by other tumor suppressors such as Rb and BRCA2, which frequently exhibits loss of heterozygosity in primary human cancers (2). Recently, it has been reported that LATS2 is involved in cell cycle regulation and cell growth by controlling G2/M and G1/S transition while also down-regulating cyclin E/cyclin-dependent kinase (CDK) 2 activity (9, 10). Interestingly, the Drosophila warts/lats binding protein salvador was shown to regulate both cell cycle exit and apoptosis, and its human homolog was found to be mutated in cancer cell lines (11). Therefore, it has been hypothesized that deletion, mutation, and dysfunction of LATS2 might be involved in cancer development and progression.
The actions of androgens are mediated through the androgen receptor (AR) (12), which plays a critical role in male sexual development and maintenance and in the progression of prostate cancer (13, 14, 15). AR is a ligand-activated transcription factor that belongs to the nuclear receptor (NR) superfamily. Similar to other members of the NR superfamily, AR shares structural homology by possessing a moderately conserved COOH-terminal ligand binding domain (LBD), a highly conserved central DNA binding domain (DBD), and a less conserved NH2-terminal domain (NTD) (16, 17, 18, 19). Transactivation function of AR is mediated by sequences in both the NTD and LBD referred to as activation function 1 and 2 (AF-1 and AF-2), respectively. Recently, it has been shown that the NTD interacts directly with the LBD in a ligand-dependent manner in a mechanism known as NH2- and COOH-terminal (N/C) interaction (20, 21). This N/C interaction appears to stabilize the hormone-receptor complex and is required for full transcription activity of AR. This unique mechanism of AR-mediated transcriptional activation involves the association of AF-2 with two LXXLL-related sequences, FXXLF and WXXLF, in the NTD (22). Interestingly, promoter-specific differences in the requirement for AR N/C interaction have been shown. Agonist-dependent transactivation of prostate-specific antigen (PSA) and probasin promoter regions were shown to require N/C interaction. In contrast, activation of sex-limited protein and mouse mammary tumor virus (MMTV) long-terminal repeat do not support the functional importance of AR N/C interaction (23). Association of androgen insensitivity syndrome with single amino acid mutations that disrupt AR N/C interaction provide evidence that AR N/C interaction is critical for AR function in vivo (24, 25).
Transcriptional activities of AR require the recruitment of coregulatory proteins known as coactivators and corepressors (26, 27, 28, 29). In the past few years, a number of different classes of AR-interacting proteins have been identified. One group of AR-associated proteins (ARA) includes ARA70, which has been shown to enhance ligand-dependent activity of AR (30). In contrast, NCoR (nuclear receptor corepressor) and SMRT (silencing mediator for retinoid acid receptor and thyroid receptor) have been shown to function as AR corepressors by inhibiting ligand-dependent AR transcription activity (13, 31). The best characterized group of coactivators is the p160 family consisting of three family members SRC-1/NCoA-1,GRIP1/TIF2, and pCIP/RAC3/ACTR/AIB1/TRAM-1 (32, 33). Recruited to the promoter by NRs, coactivators affect transcription by modifying activity of the transcriptional initiation complex and/or modifying chromatin structure through the recruitment of cofactors possessing histone acetyltransferase activity. In particular, p160 coactivators interact with cAMP response element binding protein (CREB)-binding protein (CBP), which interacts with the p300/CBP-associated factor (34, 35). Interestingly, members of the p160 family have been reported to be overexpressed in malignant tissues including SRC-1 and GRIP1 in prostate and AIB1 in breast (36, 37). Additionally, megadalton-sized mediator complexes, DRIP/ARC/TRAP (38, 39), function as coregulators of transcription activity by apparently interacting with the global transcriptional machinery including RNA polymerase II.
So far, no connection has been made linking LATS2 to AR signaling or prostate cancer. Here we report the isolation and characterization of LATS2 as a new AR-associated protein. We provide evidence to demonstrate that LATS2 functions as a corepressor by inhibiting AR N/C interaction. In addition, LATS2 modulation of AR has an inhibitory effect on PSA induction, an important AR-target gene. Furthermore, LATS2 protein has been shown to localize with AR in human prostate epithelial cells, and its levels are decreased in human prostate cancer tissues in comparison to normal prostate. Our results imply that LATS2 may modulate AR activity in prostate cancer.
 |
RESULTS
|
|---|
Isolation of LATS2 as an AR Binding Protein
A cDNA fragment encoding amino acids 637895 of rhesus monkey AR (RhAR) LBD was used as bait in a yeast two-hybrid assay to screen a human testis library in the presence of the synthetic AR agonist R1881. Of 3.5 x 106 individual clones screened, eleven independent positive clones were identified as homologous to a known protein, LATS2/KPM (GenBank accession no. AF207547) (1). Sequence analysis revealed three groups of different sized fragments, the longest of which was 2783 bp in length and encoded for amino acid 314 to the stop codon of LATS2. Recovered plasmids were retransformed into yeast to confirm the interaction. The interaction between LATS2 and AR was further quantified by R1881 induced association of LATS2 and AR in ß-galactosidase assays (Fig. 1A
). In the presence of the AR antagonist hydroxyflutamide (OH-FL), AR bait protein failed to interact with LATS2.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1. LATS2 Interacts with AR in a Ligand-Induced Manner
A, ß-Galactosidase activity was measured in yeast expressing the AR-LBD bait protein and the LATS2 protein in the presence of the agonist R1881 (black bar) or the antagonist OH-FL (gray bar). Yeast expressing the GAL4 AD and the AR LBD protein or the GAL4 DBD and the LATS2 protein were used as negative controls. B, Immunoprecipitation was performed in COS-1 cells transfected with pIRES-AR, pcDNA-LATS2, or vector alone and treated in the presence or absence of 50 nM R1881 for 24 h. Anti-V5 antibody was used for immunoprecipitation followed by Western blotting with anti-AR antibody. A rabbit polyclonal anti-ERK antibody was used for immunoprecipitation as a control. C, Mammalian two-hybrid assay was performed in COS-1 cells cotransfected with pG5-Luc, pM-AR/LBD, and pVP16-LATS2. Cells were treated with OH-FL, R1881, or DHT for 24 h before harvesting for luciferase assay. Relative-light-units are shown as averages of triplicates. D, [35S]Methionine-labeled full-length RhAR was incubated with GST, GST-LATS2, and GST-ARA70 coupled to glutathione-Sepharose beads at 4 C for 2 h in the absence or presence of R1881. Beads were washed with binding buffer and bound proteins were then eluted into SDS sample buffer and analyzed by SDS-PAGE followed by autoradiography. ARA70 was used as an AR-binding positive control. Input represents 10% of labeled AR.
|
|
LATS2 Interacts with AR in Mammalian Cells and in Vitro
The in vivo interaction between these two proteins was examined by a coimmunoprecipitation assay of COS-1 cells transfected with AR and epitope-tagged LATS2 (Fig. 1B
). Western blot showed that AR expression levels are not affected by coexpression with LATS2 protein (lanes 5 and 6). V5 antibodies could efficiently immunoprecipitate V5-tagged LATS2 in complex with AR (lane 2). AR associates with LATS2 in a ligand-enhanced manner as much weaker signal was seen when cells were not treated with R1881 (lane 4). AR protein was not detected in immunoprecipitates from cells transfected with vector or in immunoprecipitates from an unrelated ERK antibody (lane 3), confirming the specificity of AR and LATS2 interaction.
The interaction between LATS2 and AR was also confirmed in a mammalian two-hybrid assay using GAL4 DBD-AR and VP16-LATS2 fusion proteins (Fig. 1C
). Because AF2 function of AR is very weak by itself, transfection of GAL4 DBD-AR/LBD and pVP16 vector only caused a marginal basal level activation. Cotransfection of GAL4 DBD-AR/LBD and VP16-LATS2 (amino acids 314-1088) activated the reporter gene 5-fold greater than in cells transfected with GAL4 DBD-AR/LBD and VP16 control. This interaction is agonist dependent because OH-FL failed to stimulate luciferase activity.
To further investigate the interaction between AR and LATS2, we performed glutathione-S-transferase (GST) pull-down assays. Full-length human LATS2 and ARA70 were expressed as GST fusion proteins and incubated with [35S] Met-labeled AR in the presence or absence of R1881. As seen in Fig. 1D
, full-length LATS2 interacted strongly with AR in vitro when compared with ARA70, an AR-binding positive control. This interaction between AR and LATS2 appeared to increase in the presence of ligand, confirming the ligand-induced interaction between these two proteins. Several other nuclear receptors were also tested for LATS2 binding, and the results suggest that a range of interaction exists with no significant binding to vitamin D3 receptor (VDR) and some binding to estrogen receptor (ER) (data not shown).
Mapping of AR and LATS2 Interaction Domains
To define AR domains and LATS2 regions that mediate the protein-protein interaction, GST pull-down experiments were performed with various protein deletions. [35S] Met-labeled full-length AR and various AR domains were tested for binding to GST-LATS2 (Fig. 2A
). Both full-length AR and AR-LBD interacted with LATS2. In contrast, the NTD and DBD of AR exhibited a weaker binding to LATS2, indicating that the AR-LBD interacts strongly with LATS2 and is sufficient to support this binding. To determine which region of LATS2 interacts with AR, a number of LATS2 fragments were produced (Fig. 2B
). LATS2 deletion proteins containing amino acid residues 1799, 1996, and 636835 all interacted with AR, whereas fragments of LATS2 containing the very first 195 amino acids or last 252 amino acids did not (Fig. 2C
). These results indicate that amino acid residues 636835 of LATS2, also found within all of the yeast two-hybrid clones of LATS2 and containing two thirds of the kinase domain, spans the minimal region sufficient for interaction with AR.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2. Domains of Interaction between AR and LATS2
A, [35S]Methionine-labeled RhAR domains including the NTD, DBD, and LBD were incubated with GST and GST-LATS2 coupled to glutathione-Sepharose beads at 4 C for 2 h. Protein-Sepharose was washed with binding buffer and bound proteins were then eluted into SDS sample buffer and analyzed by SDS-PAGE. B, Various LATS2 deletion fragments, LATS2(11088), LATS2(199), LATS2(100195), LATS2(1799), LATS2(1966), LATS2(636835), and LATS2(8361088), were amplified by PCR and cloned into the pGEX-4T2 vector and expressed as GST fusion proteins. C, [35S] Methionine-labeled RhAR was incubated with GST, GST-LATS2, and GST-LATS2 deletions coupled to glutathione-Sepharose beads at 4 C for 2 h. Beads were washed, eluted, and analyzed as in A.
|
|
Effect of LATS2 on AR-Dependent Transactivation
The interaction of LATS2 and AR prompted us to explore the possible roles of LATS2 in regulating AR transcription activity in the human prostate cancer cell line 22Rv1. This prostate cancer cell line does contain a mutation of AR but expresses high levels of transcriptionally functional AR. AR-dependent transcription from the MMTV, probasin, and PSA promoters were tested in 22Rv1 cells transfected with LATS2 or vector control. As seen in Fig. 3A
, AR-dependent transcription from the MMTV, probasin, and PSA promoters were repressed by LATS2. Significantly, with equal amounts of transfected LATS2 plasmid, repression of AR-dependent transcription was greater from the probasin and PSA promoters (90%) when compared with the MMTV promoter (65%) (Fig. 3A
). Western blot, Fig. 3B
, shows that the observed repression of AR-dependent transcription is not due to decreased levels of AR protein. To confirm the repressive effect of LATS2, multiple doses of LATS2 were cotransfected with MMTV reporter and control Renilla luciferase reporter. As seen in Fig. 3C
, ligand-dependent transcription from the MMTV promoter was repressed by LATS2 in a dose-dependent manner after normalizing with Renilla luciferase activity. In contrast, p160 coactivator GRIP1 enhanced transcription from the MMTV promoter. These results indicate that LATS2 acts as a corepressor by repressing AR-dependent transactivation with promoter selectivity favoring the probasin and PSA promoters.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3. LATS2 Represses AR-Dependent Transactivity
A, 22Rv1 cells were cotransfected with pMMTV-Luc or pB-AR-Luc or pGL3-PSA5.85 and pcDNA3.1 or pcDNA-LATS2 in a 1:1 DNA ratio. Eighteen hours after transfection, cells were treated with R1881 for an additional 36 h and harvested for luciferase assay. B, Cell lysates of 22Rv1 cells cotransfected with pMMTV-Luc or pB-AR-Luc or pGL3-PSA5.85 and pcDNA3.1 or pcDNA-LATS2 and treated with 100 nM R1881 for an additional 36 h were analyzed by Western blot. The arrow indicates immunoreactive bands that are detected by the anti-AR antibody. C, 22Rv1 cells were cotransfected with 30 ng pMMTV-Luc and 40 ng pcDNAGRIP1, 80 or 120 ng pcDNA-LATS2, or vector alone and pCMV-Renilla. pcDNA3.1 vector DNA was added to each transfection to keep the DNA amount constant. Eighteen hours after transfection, cells were treated with R1881 for an additional 36 h and harvested for dual-luciferase assay. The firefly luciferase activities were normalized to Renilla. Each data point is the average of four independent transfections.
|
|
LATS2 Inhibits AR N/C Interaction
AR exhibits a ligand-dependent, intermolecular N/C-terminal interaction that appears to be required for full transcriptional activity. To define the mechanism by which LATS2 represses AR, a modified mammalian-two hybrid system was used to test the effect of LATS2 on AR N/C interaction. COS-1 cells were transfected with pM-AR/LBD, pVP16-AR/NTD, pRL-TK, and pG5-Luc along with LATS2 or vector. As seen in Fig. 4A
, LATS2 significantly blocked ligand-dependent AR N/C interaction in COS-1 cells. Similar results were also observed in other cell types (data not shown). This inhibition is specific for interaction between AR N/C terminus, as expression of LATS2 had no effect on transcription controlled by the interaction between p53 and large T antigen (Fig. 4B
). Early reports suggest that agonist-dependent transcription from the PSA and probasin promoters require AR N/C-terminal interaction for full transcriptional activity (23). Our data support this theory of promoter preference because we observed that repression of AR-dependent transcription was significantly greater from the probasin and PSA promoters when compared with the MMTV promoter (Fig. 3A
). These results suggest that inhibition of AR N/C interaction may play a major role in LATS2-mediated modulation on AR activity, and that LAST2 may have selective effects on a subset of androgen-regulated promoters.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4. LATS2 Inhibits AR N/C Interaction
A, AR N/C interaction was measured by performing a modified mammalian two-hybrid assay. COS-1 cells were cotransfected with pG5-Luc, pM-AR/LBD, pVP16-AR/NTD, and pcDNA-LATS2 or vector alone. Cells were treated with DHT for 36 h before harvesting for luciferase assay. B, Transcription assay in COS-1 cells cotransfected with pG5-Luc, pM-p53, pVP16-Tag, and pcDNA-LATS2 or vector alone. The cells were harvested for luciferase assay as in A. C, Mammalian two-hybrid assay was performed in COS-1 cells cotransfected with pG5-Luc, pACT-LATS2, and pM-AR/LBD or pM-AR/LBD-I874A. Cells were treated with R1881 for 36 h before harvesting for luciferase assay. Relative light units are shown as averages of triplicates for each.
|
|
The point mutation I898T in hAR was shown to significantly affect AR N/C interaction but retained its ability to bind to ligand and GRIP1/TIF2 (24). Therefore, we tested the influence of the equivalent point mutant of helix 12 in RhAR (I874A) on LATS2 and AR N/C interaction. Similar to the I898T mutation in human AR, I874A in RhAR almost completely abolished AR N/C interaction (data not shown). Mammalian two-hybrid assays were performed comparing the ability of wild-type AR and I874A AR to bind LATS2. As seen in Fig. 4C
, the point mutant of AR lost its ability to bind LATS2 in a ligand- and dose-dependent manner when compared with wild-type AR. These results indicate that, in addition to controlling AR N/C interaction, amino acid residue I874 of RhAR is also required for interaction with LATS2. Thus, LATS2 may interact with AR LBD surfaces that are shared by the NTD of the AR.
LATS2 Is Recruited to the PSA Gene Promoter and Enhancer
To examine LATS2 endogenous protein, we generated multiple affinity purified rabbit antibodies against LATS2-specific peptides. Western blot analysis detects an endogenous LATS2 protein in HeLa cells as a band with an apparent molecular mass of 125 kDa, which is similar to the protein identified in LATS2 transfected COS-1 cells (Fig. 5A
, lanes 2 and 3) and as previously reported (2). Observing that LATS2 acts as an AR-coregulator to inhibit AR-dependent transcription, we tested whether LATS2 is present in the protein complexes that associate with a native androgen regulatory region of an endogenous gene. Using chromatin immunoprecipitation (ChIP) assays, we tested for the presence of AR and LATS2 on the PSA promoter (ARE I) and enhancer (ARE III) regions. The PSA enhancer is a DNA element in the 4-kb upstream regulatory region of the PSA gene that mediates androgen-dependent transcriptional activation signals from bound transcription factors (40, 41). Soluble chromatins were prepared by formaldehyde cross-linking of LNCaP cells followed by sonication and immunoprecipitation with AR- or LATS2-specific peptide antibody. The association of AR and LATS2 were analyzed using PCR with specific primers corresponding to ARE I and ARE III. As seen in Fig. 5B
, upon androgen induction, AR and LATS2 were recruited to both the PSA promoter and enhancer. The immunoprecipitation and binding of LATS2 to the PSA regulatory region was confirmed with both serum and antigen purified antibodies. A lower level of LATS2 was also found to associate with ARE I and III without the presence of androgen. It is therefore possible that LATS2 is involved in ligand-independent gene regulation. This association of AR and LATS2 to the promoter and enhancer is specific because no significant signal was observed in samples immunoprecipitated with normal rabbit serum (Fig. 3A
). The results indicate that LATS2 transcriptional repression of the PSA promoter may occur via the recruitment of LATS2 to the androgen-responsive region of the PSA gene.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5. Detection of LATS2 Protein and Recruitment of AR and LATS2 to the Regulatory Region of the PSA Gene
A, Cell lysates of HeLa cells and COS-1 cells transfected with pcDNA-LATS2 or vector alone were loaded on a 415% gradient SDS-polyacrylamide gel and separated by electrophoresis followed by transfer to nitrocellulose membrane. After blocking for 1 h in 5% dry milk, the membrane was incubated with the polyclonal antirabbit LATS2 antibody followed by incubation with secondary antirabbit HRP-conjugated antibody. Immunoreactive bands were visualized using ECL reagent, and the arrow indicates specific bands that are detected by the anti-LATS2 antibody. B, ChIP assay of AR and LATS2 recruitment to the PSA promoter (ARE I) and enhancer (ARE III) was performed in LNCaP cells treated with 10 nM DHT. Soluble chromatin was prepared by formaldehyde treatment of the cells followed by sonication and immunoprecipitation of AR and LATS2 bound genomic DNA fragments with AR and LATS2-specific peptide antibodies along with rabbit serum as a control. DNAs were PCR amplified with specific primers corresponding to the PSA promoter and enhancer.
|
|
Induction of Endogenous PSA Is Reduced by LATS2
The biological significance of LATS2 action on AR was further evaluated by examining the effect of over expression of LATS2 on the endogenously expressed PSA gene. A quantitative RT-PCR analysis of PSA mRNA revealed ligand- and dose-dependent induction of PSA in LNCaP cells transfected with vector alone. In contrast, cells transfected with LATS2 exhibited a reproducible and significantly reduced level of PSA induction (Fig. 6
) in agreement with the observation that androgen-dependent transcription from the PSA promoter is repressed by LATS2 in reporter assays (Fig. 3A
) and that LATS2 is recruited to the endogenous PSA regulatory region in ChIP assays (Fig. 5B
). Furthermore, the induction of PSA in LATS2 transfected cells was not dose dependent and remained constant at all ligand doses. Therefore, LATS2 appears to act as a bona fide corepressor by down-regulating AR-target genes, such as PSA.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6. LATS2 Inhibits the Induction of the Androgen-Target Gene PSA
Quantification of PSA gene expression in LNCaP cells was performed by Quantitative RT-PCR analysis. Cells were transfected with pcDNA-LATS2 (black bar) or vector (white bar) using SuperFect reagent and treated with an increasing concentration of AR agonist R1881 for 24 h. Analysis was performed on the MX4000 using the Brilliant Single-Step QRT-PCR kit and PSA primers designed using Primer Express software. All data were normalized with human ribosomal protein, and each data point is an average of three independent transfections. *, P < 0.01.
|
|
LATS2 Is Expressed with the AR in Human Prostate, and Its Expression Is Reduced in Prostate Cancer
Northern blot analysis of human tissues indicates that LATS2 is highly expressed in heart, skeletal muscle, testis, and prostate, many of which are known to express AR (1, 2). To investigate the expression pattern of LATS2 in prostate tissues, immunohistochemistry was performed. As seen in Fig. 7A
-a, AR is localized within the nucleus of cells constituting the epithelium of the human prostate gland. Using consecutive sections, identical localization pattern within the epithelial cells of the prostate was observed for LATS2 (Fig. 7A
-b). These results indicate that LATS2 is expressed in the same cell types as AR in human prostate tissue. The localization of LATS2 and AR within the human prostate supports our theory that LATS2 acts as an AR modulator to repress AR trans-activity.

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 7. Localization of LATS2 with AR and a Decrease in Expression of LATS2 in Human Prostate Cancer
A, Immunohistochemistry was performed on normal human prostate tissue sections. a, Staining with anti-AR antibody reveals localization of AR within the epithelium (arrowheads). b, Strong staining is observed with anti-LATS2 antibody (arrowheads), which reveals colocalization of LATS2 with AR. c, Negative control stained with normal rabbit IgG. B, Staining of normal and prostate tumor samples. a, In the epithelium of normal human prostate, AR expression is confirmed in the cell nucleus. b, Immunohistochemistry of human prostate tumor tissue shows a nuclear distribution of AR. c, LATS2 staining is within the epithelium in normal human prostate tissue (same results in e and g). d, Expression of LATS2 is decreased in human prostate tumor tissue when compared with normal prostate tissue (same results in f and h).
|
|
Immunohistochemistry experiments for LATS2 and AR expression in normal human prostate with that of prostate cancer tissues revealed that LATS2 and AR are colocalized in normal and tumor prostate tissues (Fig. 7B
, ah). AR expression in normal vs. tumor samples remained relatively unchanged or slightly upregulated in the tumors (Fig. 7B
, a and b). In contrast, LATS2 expression in human prostate tumors were significantly lower compared with that in normal prostate tissues (Fig. 7B
, ch). This reduction in expression was found in seven of 10 tumor samples evaluated, whereas in the remaining three LATS2 levels were comparable with that of normal prostate. No significant reduction of LATS2 immunostaining signal was detected in any of the five normal prostate specimens examined. To further quantify the extent of LATS2 reduction in these seven tumors, automated cellular imaging system computer scoring was used to compare the relative intensity of staining of normal vs. tumor prostate samples. Comparing comparable regions, a statistically significant reduction in LATS2 expression was observed in six of the seven tumor samples (P < 0.02, with five of seven P < 0.005). A preliminary evaluation of tumor grade showed no correlation between levels of LATS2 expression and the grade of tumor. These results suggest that down-regulation of the expression of the tumor suppressor LATS2 occurs in prostate malignancy.
 |
DISCUSSION
|
|---|
In this study, we have identified for the first time that LATS2/KPM interacts with the AR and functions as a corepressor to modulate ARs transcription activity in a promoter-dependent manner. We propose that the mechanism of LATS2-mediated repression involves the inhibition of AR N/C interaction. Furthermore, overexpression of LATS2 can repress PSA gene expression in prostate cancer cells and expression of LATS2 is down-regulated in human prostate tumor samples, suggesting that the loss of this tumor suppressor could lead to increased AR activity and contribute to prostate cancer.
We demonstrated that a protein-protein interaction exists between LATS2 and AR and that this association is ligand enhanced. LATS2 significantly inhibited ligand-dependent AR-mediated transcription from the MMTV, probasin, and PSA promoters, even in the presence of high concentrations of ligand. Notably and as previously reported (23), promoter-specific differences in the requirement for AR N/C interaction have been shown. We observed that repression of AR-dependent transcription by LATS2 is promoter-selective preferring the probasin and PSA promoters. This is in agreement with our finding that LATS2 inhibits AR N/C interaction. In contrast, LATS2 does not have significant effects on GRIP1-induced AR AF2 activity (data not shown). Taken together, our results suggest that LATS2 acts as an AR coregulator through a mechanism that includes inhibiting AR N/C interaction.
In the past few years, two well-characterized corepressors, NCoR and SMRT, have been shown to repress AR-dependent transcription activity. Both NCoR and SMRT repress transcription by recruiting histone deacetylases to target genes and through competition with p160 coactivators (13, 31). These corepressors interact with the LBD of NRs within a site that overlaps the p160 binding site. Corepressor nuclear receptor boxes are found in the C-terminal receptor interaction domains of both NCoR and SMRT with a hydrophobic core I/LXXII (31). Interestingly, we found that LATS2 interacts with AR in the presence of ligand but that it does not contain any apparent corepressor nuclear receptor box, suggesting that LATS2 uses a different mechanism than NCoR/SMRT to repress AR. Nevertheless, the mechanism of both LATS2 and SMRT-mediated AR-transcription repression appears to include the inhibition of AR N/C interaction. PAT1/ARA67 was recently identified as another AR repressor but was shown to enhance AR N/C interaction (42). Therefore, an AR corepressor can inhibit AR activity without reducing AR N/C interaction. Because androgen action involves multiple steps, it is possible that LATS2 can modulate AR activity through a variety of mechanisms. Furthermore, it is possible that LATS2 may affect AR differently under certain physiological conditions.
In addition to the ability of LATS2 to act as an AR repressor in transient transcription assays, ChIP assays demonstrated that AR and LATS2 are recruited to the androgen-regulated PSA promoter and enhancer region. Therefore, it appears that LATS2-AR interaction and recruitment to regulatory elements may be used in the regulation of AR-target genes. Interestingly, some level of LATS2 appeared to associate with the androgen-responsive region even without the induction by ligand, suggesting that LATS2 may also control basal levels of gene expression. Levels of PSA are routinely used as a prognostic marker for prostate cancer. Because AR and LATS2 are associated with the PSA regulatory region and agonist-dependent transactivation of PSA promoter regions require N/C interaction, we investigated the effect of LATS2 on PSA agonist induction. We observed that LATS2 caused a significant reduction in levels of liganddependent PSA induction. Our results indicate that LATS2 may have an important role as an AR corepressor on AR-target genes, such as PSA. It has been reported that tumor suppressors p53 and phosphatase and tensin homolog deleted on chromosome 10 (PTEN) are capable of inhibiting AR-dependent transcription from the PSA promoter (43, 44). Furthermore, LATS2 expression can be induced by p53 (45), suggesting that a possible connection exists between p53, PTEN, LATS2, and the regulation of PSA expression. The significance of this possible relationship is currently under investigation.
Somatic mutations of the AR gene have been found in prostate tumors, indicating that AR plays a critical role in the development and progression of prostate cancer (15, 46). It is well documented that androgen withdrawal results in regression of the prostate gland due to increased apoptosis. Therefore, androgen ablation is the primary therapy used for prostate cancer. Over time, however, androgen ablation therapy fails when androgen-independent tumors develop in these patients (47). It is speculated that androgen ablation therapy fails due to AR mutations and alterations of normal AR action due to changes in the expression levels of AR and its coactivators or corepressors (46, 47). We have shown by immunohistochemistry of normal vs. tumor prostate samples that levels of LATS2 protein are reduced in the majority of the prostate tumor samples examined. It was reported that ectopic expression of mouse Lats2 in NIH3T3/v-ras cells suppressed tumor development in nude mice (10). Taken together, these results, as well as our data presented here, suggest that a change in expression of LATS2 protein takes place in malignant transformation of the prostate. Down-regulation of LATS2 may lead to hyperactivation of AR and contribute to the progression of prostate cancer. A larger number of normal and tumor samples will have to be evaluated to confirm our proposed relationship between AR, LATS2, and prostate cancer.
It was recently reported that LATS2 contains kinase activity, but no in vivo or in vitro substrates have yet to be identified (1). Although a physical interaction between LATS2 and AR as well as a biological effect and mechanism have been shown, the question remains as to whether LATS2 can alter AR activity by phosphorylation of AR protein. We performed kinase assays using recombinant AR-LBD, but failed to show that AR is a substrate for LATS2 (data not shown). Thus, the possibility exists that other sites outside the LBD may be phosphorylated by LATS2 or that direct modulation of AR-mediated activity by LATS2 may not necessarily involve phosphorylation of AR. It is possible that the kinase activity of LATS2 modulates the phosphorylation status of other AR-interacting proteins or that LATS2 inhibition of AR N/C interaction and repression of AR-mediated transcription is independent of its kinase activity. Further studies involving the inhibition or activation of LATS2 and/or blocking the interaction between LATS2 and AR will provide further insight into the mechanism of AR-mediated transcription and might present clues for the development of possible treatments for prostate cancer.
 |
MATERIALS AND METHODS
|
|---|
Plasmids and Reagents
A 774-bp fragment coding for amino acids 637895 of RhAR LBD was cloned into the pGBKT7 vector (CLONTECH, Palo Alto, CA) and expressed as a fusion protein with the GAL4 DBD. Full-length LATS2, fragments of LATS2 (encoding amino acids 199, 100195, 1799, 1996, 636835, and 836-1088) and full-length ARA70 (C. Chang, University of Rochester, Rochester, NY) were PCR amplified and cloned into the pcDNA3.1/V5-His expression vector (Invitrogen Life Technologies, Carlsbad, CA) and subsequently subcloned into pGEX-4T2 (Amersham Pharmacia, Piscataway, NJ) to create pcDNA-LATS2, pGEX-LATS2, pGEX-
LATS2, and pGEX-ARA70. Similarly, RhAR-NTD, -DBD, and -LBD were PCR amplified and cloned into pcDNA3.1/V5-His (Invitrogen Life Technologies) to create pcDNA-NTD, pcDNA-DBD, and pcDNA-LBD. Amino acids 637895 of RhAR LBD as well as amino acids 637895 with a I874A point mutation were subcloned into the pM vector (CLONTECH) to generate pM-AR/LBD and pM-AR/LBD(I874A). A 1.6-kb fragment of RhAR NTD (amino acids 1525) and amino acids 314-1088 of LATS2 were cloned into pVP16 (CLONTECH) and pACT (Promega, Madison, WI) to create pVP16-NTD and pACT-LATS2. Full-length Rhesus monkey AR cDNA was cloned into pIRES (CLONTECH) to create pIRES-AR. To generate pB-AR-Luc, the promoter region of the rat probasin gene (Dr. R. Matusik, Vanderbilt University, Nashville, TN) spanning bp 426 to +40 was PCR amplified and subcloned into the HindIII site of pGL3-basic vector. The construct pGL3-PSA5.85 (48) was kindly provided by Dr. H. Chen (University of California, Davis, CA). Antimouse V5 monoclonal antibody (Invitrogen Life Technologies), antirabbit ERK polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), antirabbit AR polyclonal antibody PG-21 (Upstate Biotechnology, Inc., Lake Placid, NY), normal rabbit serum and normal rabbit IgG (Santa Cruz Biotechnology, Inc.) were used. Paraffin-embedded tissue sections were from BioChain Institute (Hayward, CA).
Yeast Two-Hybrid Screening
pGBKT7-AR/LBD was expressed as a fusion protein with the GAL4 DBD in yeast strain AH109 (CLONTECH). A normal human testis cDNA library fused to the GAL4 AD in pACT2 vector was used for screening in the presence of 50 nM R1881 and 2.5 mM 3-aminotriazole (49). Clones that grew were replica plated on selective dropout (SD) minimal medium lacking adenine, tryptophan, leucine, and histidine in the presence of 50 nM R1881, 2.5 mM 3-aminotriazole, and X-
-Gal substrate. DNAs from positive clones were recovered from yeast, amplified in Escherichia coli, sequenced, and compared with known sequences in GenBank. cDNA clones were retransformed into yeast to confirm the interaction. ß-Galactosidase assays were performed as described by the manufacturer (CLONTECH).
Transcription Assays
For androgen receptor N/C-terminal interaction, cells were cultured in phenol red-free DMEM without antibiotics and with 10% charcoal-stripped fetal bovine serum (FBS) medium before and after transfection. Transfections of COS-1 and CV1 cells were carried out using Lipofectamine 2000 (Invitrogen Life Technologies) according to manufacturers protocol with cDNA constructs and pG5-Luc. Eighteen hours after transfection, compounds were added and the cells incubated for 36 h before assay using Promegas Dual Luciferase Assay System and a Wallac Jet 1450 Microbeta Counter (Wallac, Turku, Finland). For AR N/C interaction, 40 ng pG5-Luc, 20 ng pM-AR/LBD, 20ng pVP16AR/NTD, 2 ng Renilla luciferase-thymidine kinase promoter pRL-TK, and 20 or 100 ng pcDNA-LATS2 or pcDNA vector were cotransfected. For RhLBD and LATS2 interaction, 40 ng pG5-Luc, 20 ng pM-AR/LBD or pM-AR/LBD I874A, and 20 ng pACT-LATS2 (amino acids 314-1088) were cotransfected. For AR-dependent transactivity assays, 22Rv1 cells were cotransfected with pMMTV-Luc or pB-AR-Luc or pGL3-PSA5.85, pcDNAGRIP1, pCMV-Renilla and pcDNA3.1 or pcDNA-LATS2. Eighteen hours after transfection, cells were treated with R1881 for an additional 36 h and harvested for luciferase assay. Vector DNA was added to each transfection such that the DNA amount is the same across all the transfection.
GST Pull-Down Assay
Full-length human LATS2 (pGEX-LATS2), full-length human ARA70 (pGEX-ARA70), and various LATS2 deletion fragments, LATS2(11088), LATS2(199), LATS2(100195), LATS2(1799), LATS2(1966), LATS2(636835), and LATS2(8361088) were expressed as GST fusion proteins in the BL21 Escherichia coli strain and purified following the manufacturers instructions (Amersham Pharmacia). Radiolabeled RhAR protein as well as RhAR domain proteins were prepared from the p2.1-AR, pcDNA-NTD, pcDNA-DBD, and pcDNA-LBD plasmids, which were generated by PCR cloning into pCR2.1 and pcDNA3.1/V5-His vectors (Invitrogen Life Technologies). Proteins were labeled using the Quick Coupled T7 TNT in vitro transcription/translation kit (Promega) in the presence of [35S] Met. GST-LATS2 fusion proteins coupled to glutathione-Sepharose beads were incubated with radiolabeled AR proteins at 4 C for 2 h in PBS binding buffer containing 0.5% Triton X-100 and protease inhibitors in the presence or absence of 50 nM R1881. Beads were washed four times with binding buffer; bound proteins were then eluted into sodium dodecyl sulfate (SDS) sample buffer and analyzed by SDS-PAGE followed by autoradiography.
Generation of Polyclonal Anti-LATS2 Antibody
Three antigen peptides for LATS2 were generated (Invitrogen Life Technologies). These LATS2 peptides were used to immunize rabbits (Covance, Denver, PA). Antibodies were then further affinity purified with an antigen peptide column. Antibody from peptide corresponding to amino acids 403421 of human LATS2 gave the best signal characterized by Western blot and ELISA; therefore, it was used in this study.
Immunoprecipitation and Western Blot Analysis
COS-1 cells were maintained in 150 cm dishes in DMEM containing penicillin (25 U/ml), streptomycin (25 U/ml), and 10% FBS and cotransfected with pIRES-AR and pcDNA-LATS2 or pcDNA3.1/V5-His vector (Invitrogen Life Technologies) using FuGENE 6 Transfection Reagent (Roche Molecular Biochemicals, Indianapolis, IN) following the manufacturers protocol. After 18 h, cells were treated with or without 50 nM R1881 for an additional 24 h and protein lysates collected. Immunoprecipitation was carried out as follows. Cells were lysed on ice in Nonidet P-40 (NP-40) buffer containing 150 mM NaCl, 50 mM Tris (pH 7.6), 0.5% NP-40, and supplemented with protease inhibitor cocktail with phenylmethylsulfonyl fluoride and lysates cleared by centrifugation at 15,000 rpm for 30 min at 4 C. After centrifugation, 600 µl of protein lysates were subsequently incubated with 3 µg of antimouse V5 antibody (Invitrogen Life Technologies) or antirabbit ERK polyclonal antibody (Santa Cruz Biotechnology, Inc.) and rocked gently overnight at 4 C. Thirty microliters of a prewashed 1:1 mixture of protein G-agarose and protein A-agarose (Sigma, St. Louis, MO) were added to the lysates and rocked for 2 h at 4 C. After incubation, the beads were washed five times in 150 mM NaCl, 50 mM Tris (pH 7.6), 5 mM EDTA, and 0.05% NP-40, supplemented with protease inhibitor cocktail, and the coimmunoprecipitated proteins were eluted into 2x SDS sample buffer and analyzed by Western blot analysis.
For Western blot analysis, cells were lysed in RIPA buffer containing 150 mM NaCl, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris (pH 7.5), and protease inhibitors and lysates cleared by centrifugation at 15,000 rpm for 15 min at 4 C. Protein samples were loaded on a 415% gradient SDS-polyacrylamide gel (Bio-Rad, Hercules, CA) and separated by electrophoresis followed by transfer to nitrocellulose membrane (Bio-Rad). After blocking for 1 h in 5% dry milk/PBS, membranes were incubated with the polyclonal antirabbit LATS2 antibody or antirabbit AR polyclonal antibody PG-21 (Upstate Biotechnology, Inc.) followed by incubation with secondary antirabbit horseradish peroxidase (HRP)conjugated antibody (Santa Cruz Biotechnology, Inc.). Immunoreactive bands were visualized using ECL reagent (Amersham Pharmacia).
Chromatin Immunoprecipitation
LNCaP cells were cultured in RPMI containing 5% charcoal-dextran-stripped FBS. After 4 d, cells were treated with or without 10 nM dihydrotestosterone (DHT) for 2 h, washed with PBS, and cross-linked with 1% formaldehyde at 37 C for 10 min. Treated cells were washed in ice-cold PBS, pelleted with protease inhibitors, resuspended in lysis buffer [1% SDS, 5 mM EDTA, 50 mM Tris.HCl (pH 8.1)] with protease inhibitors, sonicated four times for 12 sec at submaximal levels (Sonicator 3000; Misonix, Farmingdale, NY), and centrifuged. Supernatants were collected, diluted in dilution buffer [1% Triton X-100, 2 mM EDTA, 20 mM Tris (pH 8.1), 150 mM NaCl] and precleared with dilution buffer containing normal rabbit IgG and salmon sperm DNA/Protein A Agarose for 1 h at 4 C. Immunoprecipitation was carried out overnight a 4 C with AR- and LATS2-specific peptide antibodies or normal rabbit serum. Salmon sperm DNA/protein A agarose was added to the supernatant for an additional 1 h with gentle rotating. Beads were then sequentially washed in low-salt wash buffer, high-salt wash buffer, LiCl wash buffer, Tris-EDTA buffer, and extracted three times in 1% SDS, 0.1 M NaHCO3. After reverse cross-linking by heating at 65 C for 6 h, DNA fragments were then purified with a DNA purification kit (QIAGEN, Valencia, CA) followed by PCR amplification. PSA primer sequences are as follows: promoter/ARE I region: (47/28) 5'-AACCTTCATTCCCCAGGACT, (244/225) 5'-TCTGCCTTTGTCCCCTAGAT (50) and enhancer element/ARE III 5'-CATGTTCACATTAGTACACCTTGCC(4367/4342), 5'-TCTCAGATCCAGGCTTGCTTACTGTC(4077/4052).
Quantitative RT-PCR Analysis
RNA was prepared from LNCaP cells transfected with pcDNA-LATS2 or vector alone. Briefly, LNCaP cells, at 5 x 105 cells/well (six-well plate), were maintained in RPMI containing penicillin (25 U/ml), streptomycin (25 U/ml), and 10% FBS and transfected with pcDNA-LATS2 or pcDNA3.1/V5-His vector using SuperFect Transfection Reagent (QIAGEN) following the manufacturers protocol. Four hours after transfection, the media were replaced with RPMI containing 5% charcoal-dextran-stripped FBS. After 24 h, cells were treated with or without R1881 for an additional 24 h and RNA isolated using Applied Biosystems (Foster City, CA) 6100 Nucleic Acid PrepStation following the manufacturers RNA cell-DNA protocol.
Quantitative RT-PCR was performed on the MX4000 apparatus (Stratagene, La Jolla, CA) using the Brilliant Single-Step QRT-PCR kit (Stratagene) according to the manufacturers instructions. Primers for PSA were designed using Primer Express software (Applied Biosystems). PSA probe CAAGCCTCCCCAGTTCTACTGACCTTTGTC, forward primer GGAAATGACCAGGCCAAGAC, and reverse primer CAACCCTGGACCTCACACCTA were used. All data were normalized with human ribosomal protein (Applied Biosystems) with amplification plots and dissociation curves analyzed on MX4000 (Stratagene) and Excel (Microsoft, Redmond, WA) software.
Immunohistochemisty
For detection of LATS2, paraffin-embedded tissue sections (BioChain Institute) were deparaffinized in xylene, hydrated in graded ethanol, and treated with Dako target retrieval solution (Dako Corp., Carpinteria, CA) following the manufacturers instructions. Slides were then treated with 3% hydrogen peroxidase for 5 min and incubated with primary antibodies for 60 min at 25 C using antirabbit LATS2 polyclonal antibody (Covance), antirabbit AR polyclonal antibody PG-21 (Upstate Biotechnology, Inc.), or normal rabbit IgG (Santa Cruz Biotechnology, Inc.). Antibodies were diluted at 1/200 in an antibody dilution solution (Dako Corp.). After staining, slides were washed once in PBS and incubated with HRP-conjugated antirabbit antibody (Dako Corp.) for 30 min. Slides were then developed in 0.5 mg/ml 3,3'-diaminibenzidine tetrahydrochloride (Vector Laboratories, Burlingame, CA), 50 mM Tris HCl (pH 7.6), and 0.01% hydrogen peroxide. Computer analyses of stained normal vs. prostate tumor samples were performed to quantify labeled intensities (Chromavision Medical Systems, Inc., San Juan Capistrano, CA). Specifically, the slides were scanned, areas outlined, and intensity of chromogen measured using the Integrated Optical Density (IOD) automated cellular imaging system (ACIS) application.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Y. Liu, H. Chen, W. Ray, D. Kimmel, D. Towler, K. Petrukhin, C. Chang, and R. Matusik for reagents and discussions.
 |
FOOTNOTES
|
|---|
Abbreviations: AF, Activation function; AR, androgen receptor; ARA, AR-associated proteins; ARE, androgen response element; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; DBD, DNA binding domain; DHT, dihydrotestosterone; FBS, fetal bovine serum; GRIP, glucocorticoid receptor-interacting protein 1; GST, glutathione-S-transferase; HRP, horseradish peroxidase; lats, large tumor suppressor; LBD, ligand binding domain; MMTV, mouse mammary tumor virus; N/C, NH2- and COOH-terminal interaction; NCoR, nuclear receptor corepressor; NP-40, Nonidet P-40; NR, nuclear receptor; NTD, NH2-terminal domain; OH-FL, hydroxyflutamide; PSA, prostate-specific antigen; RhAR, rhesus monkey AR; SDS, sodium dodecyl sulfate; SMRT, silencing mediator for retinoid acid receptor and thyroid receptor.
Received for publication February 13, 2004.
Accepted for publication April 29, 2004.
 |
REFERENCES
|
|---|
- Hori T, Takaori Kondo A, Kamikubo Y, Uchiyama T 2000 Molecular cloning of a novel human protein kinase, kpm, that is homologous to warts/lats, a Drosophila tumor suppressor. Oncogene 19:31013109[CrossRef][Medline]
- Yabuta N, Fujii T, Copeland NG, Gilbert DJ, Jenkins NA, Nishiguchi H, Endo Y, Toji S, Tanaka H, Nishimune Y, Nojima H 2000 Structure, expression, and chromosome mapping of LATS2, a mammalian homologue of the Drosophila tumor suppressor gene lats/warts. Genomics 63:263270[CrossRef][Medline]
- Tao W, Zhang S, Turenchalk GS, Stewart RA, St John MA, Chen W, Xu T 1999 Human homologue of the Drosophila melanogaster lats tumour suppressor modulates CDC2 activity. Nat Genet 21:177181[CrossRef][Medline]
- Justice RW, Zilian O, Woods DF, Noll M, Bryant PJ 1995 The Drosophila tumor suppressor gene warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and proliferation. Genes Dev 9:534546[Abstract/Free Full Text]
- Xu T, Wang W, Zhang S, Stewart RA, Yu W 1995 Identifying tumor suppressors in genetic mosaics: the Drosophila lats gene encodes a putative protein kinase. Development 121:10531063[Abstract]
- St John MA, Tao W, Fei X, Fukumoto R, Carcangiu ML, Brownstein DG, Parlow AF, McGrath J, Xu T 1999 Mice deficient of Lats1 develop soft-tissue sarcomas, ovarian tumours and pituitary dysfunction. Nat Genet 21:182186[CrossRef][Medline]
- Xia H, Qi H, Li Y, Pei J, Barton J, Blackstad M, Xu T, Tao W 2002 LATS1 tumor suppressor regulates G2/M transition and apoptosis. Oncogene 21:12331241[CrossRef][Medline]
- Yang X, Li DM, Chen W, Xu T 2001 Human homologue of Drosophila lats, LATS1, negatively regulate growth by inducing G(2)/M arrest or apoptosis. Oncogene 20:65166523[CrossRef][Medline]
- Kamikubo Y, Takaori Kondo A, Uchiyama T, Hori T 2003 Inhibition of cell growth by conditional expression of kpm, a human homologue of Drosophila warts/lats tumor suppressor. J Biol Chem 278:1760917614[Abstract/Free Full Text]
- Li Y, Pei J, Xia H, Ke H, Wang H, Tao W 2003 Lats2, a putative tumor suppressor, inhibits G1/S transition. Oncogene 22:43984405[CrossRef][Medline]
- Tapon N, Harvey KF, Bell DW, Wahrer DC, Schiripo TA, Haber DA, Hariharan IK 2002 salvador Promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110:467478[CrossRef][Medline]
- Chang CS, Kokontis J, Liao ST 1988 Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240:324326[Abstract/Free Full Text]
- Liao G, Chen LY, Zhang A, Godavarthy A, Xia F, Ghosh JC, Li H, Chen JD 2003 Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem 278:50525061[Abstract/Free Full Text]
- Quigley CA, De Bellis A, Marschke KB, el Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev 16:271321[CrossRef][Medline]
- Bentel JM, Tilley WD 1996 Androgen receptors in prostate cancer. J Endocrinol 151:111[CrossRef][Medline]
- Brinkmann AO, Faber PW, van Rooij HC, Kuiper GG, Ris C, Klaassen P, van der Korput JA, Voorhorst MM, van Laar JH, Mulder E, Trapman J 1989 The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 34:307310[CrossRef][Medline]
- Laudet V, Hanni C, Coll J, Catzeflis F, Stehelin D 1992 Evolution of the nuclear receptor gene superfamily. EMBO J 11:10031013[Medline]
- Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889895[Abstract/Free Full Text]
- Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
- Langley E, Zhou ZX, Wilson EM 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:2998329990[Abstract/Free Full Text]
- Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:2982129828[Abstract/Free Full Text]
- He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:2298622994[Abstract/Free Full Text]
- He B, Lee LW, Minges JT, Wilson EM 2002 Dependence of selective gene activation on the androgen receptor NH2- and COOH-terminal interaction. J Biol Chem 277:2563124639[Abstract/Free Full Text]
- He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. J Biol Chem 274:3721937225[Abstract/Free Full Text]
- Thompson J, Saatcioglu F, Janne OA, Palvimo JJ 2001 Disrupted amino- and carboxyl-terminal interactions of the androgen receptor are linked to androgen insensitivity. Mol Endocrinol 15:923935[Abstract/Free Full Text]
- Roy AK, Lavrovsky Y, Song CS, Chen S, Jung MH, Velu NK, Bi BY, Chatterjee B 1999 Regulation of androgen action. Vitam Horm 55:309352[Medline]
- Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocr Rev 23:175200[Abstract/Free Full Text]
- McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, OMalley BW 1999 Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69:312[CrossRef][Medline]
- Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121141[Free Full Text]
- Yeh S, Chang C 1996 Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proc Natl Acad Sci USA 93:55175521[Abstract/Free Full Text]
- Cheng S, Brzostek S, Lee SR, Hollenberg AN, Balk SP 2002 Inhibition of the dihydrotestosterone-activated androgen receptor by nuclear receptor corepressor. Mol Endocrinol 16:14921501[Abstract/Free Full Text]
- Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9:140147[CrossRef][Medline]
- Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302313[Abstract/Free Full Text]
- Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, OMalley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194198[CrossRef][Medline]
- Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953959[CrossRef][Medline]
- Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965968[Abstract/Free Full Text]
- Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, Wilson EM 2001 A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy. Cancer Res 61:43154319[Abstract/Free Full Text]
- Rachez C, Freedman LP 2001 Mediator complexes and transcription. Curr Opin Cell Biol 13:274280[CrossRef][Medline]
- Rachez C, Lemon BD, Suldan Z, Bromleigh V, Gamble M, Naar AM, Erdjument-Bromage H, Tempst P, Freedman LP 1999 Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. Nature 398:824828[CrossRef][Medline]
- Huang W, Shostak Y, Tarr P, Sawyers C, Carey M 1999 Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer. J Biol Chem 274:2575625768[Abstract/Free Full Text]
- Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG, Henderson DR 1996 Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem 271:70437051[Abstract/Free Full Text]
- Zhang Y, Yang F, Yeh S, Chang C 2004 ARA67/PAT1 functions as a repressor to suppress androgen receptor transactivation. Mol Biol Cell 24:10441057
- Shenk JL, Fisher CJ, Chen SY, Zhou XF, Tillman K, Shemshedini L 2001 p53 Represses androgen-induced transactivation of prostate-specific antigen by disrupting hAR amino- to carboxyl-terminal interaction. J Biol Chem 276:3847238479[Abstract/Free Full Text]
- Li P, Nicosia SV, Bai W 2001 Antagonism between PTEN/MMAC1/TEP-1 and androgen receptor in growth and apoptosis of prostatic cancer cells. J Biol Chem 276:2044420450[Abstract/Free Full Text]
- Kostic C, Shaw PH 2000 Isolation and characterization of sixteen novel p53 response genes. Oncogene 19:39783987[CrossRef][Medline]
- Huang H, Tindall DJ 2002 The role of the androgen receptor in prostate cancer. Crit Rev Eukaryot Gene Expr 12:193207[CrossRef][Medline]
- Feldman BJ, Feldman D 2001 The development of androgen-independent prostate cancer. Nat Rev Cancer 1:3445[CrossRef][Medline]
- Louie MC, Yang HQ, Ma AH, Xu W, Zou JX, Kung HJ, Chen HW 2003 Androgen-induced recruitment of RNA polymerase II to a nuclear receptor-p160 coactivator complex. Proc Natl Acad Sci USA 100:22262230[Abstract/Free Full Text]
- Bai C, Elledge SJ 1997 Gene identification using the yeast two-hybrid system. Methods Enzymol 283:141156[Medline]
- Shang Y, Myers M, Brown M 2002 Formation of the androgen receptor transcription complex. Mol Cell 9:601610[CrossRef][Medline]
NURSA Molecule Pages Link:
- Nuclear Receptors:
AR
- Coregulators:
LATS2
- Ligands:
Dihydrotestosterone
|
R1881
This article has been cited by other articles:

|
 |

|
 |
 
H. V. Heemers and D. J. Tindall
Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex
Endocr. Rev.,
December 1, 2007;
28(7):
778 - 808.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kitagawa, W. J. Ray, H. Glantschnig, P. V. Nantermet, Y. Yu, C.-T. Leu, S.-i. Harada, S. Kato, and L. P. Freedman
A Regulatory Circuit Mediating Convergence between Nurr1 Transcriptional Regulation and Wnt Signaling
Mol. Cell. Biol.,
November 1, 2007;
27(21):
7486 - 7496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J Burd, L. M Morey, and K. E Knudsen
Androgen receptor corepressors and prostate cancer
Endocr. Relat. Cancer,
December 1, 2006;
13(4):
979 - 994.
[Abstract]
[Full Text]
[PDF]
|
 |
|