help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0066
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luo, C.-W.
Right arrow Articles by Hsueh, A. J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luo, C.-W.
Right arrow Articles by Hsueh, A. J. W.
Molecular Endocrinology 18 (8): 2085-2096
Copyright © 2004 by The Endocrine Society

Paracrine Regulation of Ovarian Granulosa Cell Differentiation by Stanniocalcin (STC) 1: Mediation through Specific STC1 Receptors

Ching-Wei Luo, Kazuhiro Kawamura, Cynthia Klein and Aaron J. W. Hsueh

Division of Reproductive Biology, Department of Obstetrics and Gynecology, Stanford University School of Medicine, Stanford, California 94305

Address all correspondence and requests for reprints to: Aaron J. W. Hsueh, Department of Obstetrics and Gynecology, Stanford University School of Medicine, Stanford, California 94305-5317. E-mail: aaron.hsueh{at}stanford.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Stanniocalcin (STC) in fish maintains calcium and phosphate homeostasis, whereas mammalian STC1 shows a diverse tissue expression pattern with ovary exhibiting the highest level. Based on the known expression of STC1 in theca/interstitial cells of the ovary, we generated recombinant N-glycosylated STC1 protein and tested its ability to modulate granulosa cell differentiation. In cultured rat granulosa cells obtained from early antral follicles, treatment with STC1 suppressed FSH-stimulated progesterone biosynthesis with minimal effects on estradiol and cAMP production. In mature granulosa cells, treatment with STC1 also suppressed human chorionic gonadotropin-induced progesterone production. The inhibitory effect of STC1 was accompanied by a pronounced suppression of the CYP11A transcripts and the FSH induction of functional LH receptors. In addition, STC1 was found to act downstream of adenyl cyclases in suppressing progesterone biosynthesis. We also tested the regulation of STC1 gene expression by gonadotropins. Treatment with pregnant mare serum gonadotropin decreased STC1 transcript levels in theca cells of maturing follicles, whereas subsequent treatment with human chorionic gonadotropin led to sustained suppression in the corpora lutea. Using radiolabeled recombinant STC1, receptor assays showed specific STC1 binding with a high affinity to granulosa cells. Because STC1 is expressed in ovarian theca/interstitial cells, the present demonstration of receptor binding and the specific actions of STC1 in granulosa cells suggest the existence of a follicular paracrine system in which theca cell-derived STC1 dampens the gonadotropin stimulation of granulosa cell differentiation. The observed STC1 suppression of progesterone, but not estradiol, production further suggests the potential role of this paracrine hormone as a luteinization inhibitor.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OVARIAN FOLLICULAR GROWTH and development is governed by endocrine hormones as well as paracrine factors (1). Pituitary-derived FSH induces granulosa cell differentiation by stimulating steroidogenic enzymes and LH receptor expression in maturing follicles (2). During the preovulatory period, the LH surge induces follicle rupture and subsequent luteinization. In addition to endocrine factors, different follicular cell types communicate through paracrine mechanisms. For example, oocyte-specific factors such as growth differentiation factor (GDF)-9 regulate the differentiation of granulosa cells (3, 4), whereas granulosa cell-derived factors, including the kit-ligand/stem cell factor, regulate oocyte function (5). However, few theca-specific hormones such as androgen have been proven to act as paracrine factors on granulosa cells.

Stanniocalcin (STC) is a glycoprotein hormone first discovered in bony fish. It is mainly secreted by the corpuscles of Stannius and acts on gill, gut, and kidney to maintain calcium and phosphate homeostasis (6, 7, 8). In addition, STC also is expressed in fish gonad (9), but the gonadal functions of STC in fish have not been elucidated. The first mammalian STC ortholog, human STC1, has 61% sequence identity to fish STC and is highly conserved in other mammals (10, 11). Unlike fish STC, in vitro studies indicated that mammalian STC1 preferentially regulates phosphate metabolism (12, 13). In rodents, STC1 mRNA is widely expressed in ovary, prostate, thyroid, bone, and other tissues with ovary showing the highest level (10, 11, 14). Although STC1 mRNA and proteins have been found to be expressed mainly by theca/interstitial cells (15), the role of STC1 in follicular development is unclear.

In searching for theca cell-derived paracrine factors capable of regulating granulosa cell function, we hypothesize that STC1 may act on granulosa cells to regulate follicular development. Here, we generated recombinant STC1 and tested its ability to regulate granulosa cell differentiation induced by gonadotropins. Furthermore, we studied the specific binding of labeled STC1 to granulosa cells and the gonadotropin modulation of STC1 expression. These data demonstrated a paracrine role of STC1 in the regulation of follicular development and the potential role of STC1 as a luteinization inhibitor.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Purification and Characterization of Recombinant Human STC1
To study the possible roles of STC1 on granulosa cell function, we transfected 293T cells with an expression plasmid containing human STC1 cDNA. Conditioned media were collected for subsequent purification of the recombinant protein using Concanavalin A affinity chromatography. Under reducing conditions, purified human STC1 migrated as a band around 30 kDa (Fig. 1AGo, lane 2), whereas before purification there existed a prominent albumin band of 64 kDa in the media (Fig. 1AGo, lane 1). Under nonreducing conditions, the purified STC1 protein migrated as a 60-kDa band (Fig. 1AGo, lane 3), suggesting that the recombinant human STC1 is a disulfide-linked homodimer consistent with previous data (16, 17). After treatment of recombinant STC1 with peptide: N-glycosidase F (PNGase F) to remove N-linked carbohydrate moieties, the STC1 protein migrated faster during electrophoresis, based on either Coomassie blue staining of gels (Fig. 1BGo, lanes 1 and 2) or immunoblotting using the STC1 antibodies (Fig. 1BGo, lanes 3 and 4). These data demonstrated the N-linked glycosylation nature of the recombinant STC1 protein.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Purification and Biochemical Properties of Recombinant Human STC1

A, SDS-PAGE analysis of recombinant human STC1 secreted by transfected 293T cells (lane 1, reducing conditions), and purified human STC1 after Concanavalin A column fractionation (lane 2, reducing conditions; lane 3, nonreducing conditions). Proteins were visualized by Coomassie blue staining. B, Purified STC1 with or without PNGase F treatment was subjected to SDS-PAGE gels under reducing conditions. The gels were stained by Coomassie blue or probed with specific STC1 antibodies.

 
Effects of Recombinant STC1 Treatment on FSH-Stimulated Progesterone, Estradiol, and cAMP Production by Cultured Immature Granulosa Cells
To test possible regulation of granulosa cell function by STC1, cells from small antral follicles were treated with FSH in the presence or absence of STC1. FSH treatment dose-dependently increased progesterone, estradiol, and cAMP production, whereas cotreatment with STC1 (10 nM) significantly decreased FSH-stimulated progesterone production (Fig. 2AGo). At 48 h after treatment, STC1 suppressed FSH-induced progesterone production by 60–70%. In contrast, treatment with STC1 had negligible effect on FSH-induced estradiol biosynthesis (Fig. 2BGo) and a minor effect on cAMP production (Fig. 2CGo). In addition, treatment with STC1 alone had no stimulatory effect on progesterone, estradiol, or cAMP production. To study possible effects of STC1 treatment on cAMP production, granulosa cells were treated with graded doses of forskolin in the presence or absence of STC1 for 30 min before cAMP determination. As shown in Fig. 2DGo, STC1 did not affect the induction of cAMP production by forskolin. However, progesterone production by granulosa cells treated with either forskolin (Fig. 2EGo) or 8-bromo-cAMP (8-Br-cAMP) (Fig. 2FGo) was inhibited by STC1 after 2 d of culture.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Effect of Treatment with STC1 on Progesterone, Estradiol, and cAMP Biosynthesis by Cultured Granulosa Cells from Early Antral Follicles

Immature granulosa cells were cultured for 2 d in McCoy’s 5a medium containing 100 nM androstenedione and different doses of FSH (0.1–30 ng/ml) without ({bullet}) or with 10 nM STC1 ({circ}). Medium concentrations of progesterone (A), estradiol (B), and cAMP (C) were determined. Some cells were treated with graded doses of forskolin without or with 10 nM STC1 for 30 min before determination of media cAMP concentration (D). In addition, some cells were treated with forskolin (E) or 8-Br-cAMP (F) with or without 10 nM STC1 for 2 d before determination of media progesterone levels. Data points represent the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
As shown in Fig. 3AGo, dose-response experiments further indicated that STC1 treatment led to dose-dependent suppression of FSH-stimulated progesterone production in granulosa cells. Significant inhibition was evident at 0.1 nM STC1 with 1 nM STC1 causing maximum suppression. Time-course studies (Fig. 3BGo) further demonstrated that STC1 treatment for 24 h inhibited the FSH stimulation of progesterone production by 45%. At 48 h, FSH-induced progesterone production was suppressed by 60%. Because cell viability was not changed after STC1 treatments as compared with the control, the suppression of progesterone production was not due to a deleterious effect on the cells (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Dose-Dependent Effect and Time-Course of Action of STC1 on Progesterone Production by Cultured Granulosa Cells from Early Antral Follicles

A, Immature granulosa cells from early antral follicles were cultured in medium containing 3 ng/ml FSH and increasing doses of purified STC1 (0.1–10 nM) for 2 d. Progesterone levels in the conditioned media were assayed by RIA. B, Granulosa cells from early antral follicles were treated with 10 ng/ml FSH ({bullet}) or 10 ng/ml FSH together with 10 nM STC1 ({circ}) for different intervals. Media were collected for progesterone assays. Data are shown as the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
Effects of STC1 Treatment on LH/Human Chorionic Gonadotropin (hCG)-Stimulated Progesterone, Estradiol, and cAMP Production by Cultured Mature Granulosa Cells
To study the regulation of mature granulosa cells by STC1, the ability of STC1 to modulate hCG-induced steroidogenesis was assessed. Granulosa cells from diethylstilbestrol (DES)-treated animals were primed with 10 ng/ml FSH for 2 d to induce functional LH receptors. These mature granulosa cells were washed and further treated with hCG or hCG plus STC1. As shown in Fig. 4AGo, STC1 antagonized progesterone production induced by hCG showing a 50% inhibition at 48 h after treatment. In contrast, STC1 had a negligible effect on estradiol biosynthesis (Fig. 4BGo). We also observed suppression of hCG-induced cAMP production by STC1 (Fig. 4CGo).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Effect of Treatment with STC1 on hCG-Stimulated Progesterone, Estradiol, and cAMP Biosynthesis by Cultured Mature Granulosa Cells

Granulosa cells from DES-treated rats were cultured in McCoy’s 5a medium containing 100 nM androstenedione and FSH (10 ng/ml). After FSH priming for 2 d, cells were washed and then recultured for another 2 d in fresh McCoy’s 5a medium containing graded doses of hCG ({bullet}) or hCG with 10 nM STC1 ({circ}). Medium concentrations of progesterone (A), estradiol (B), and cAMP (C) were determined by RIA. Data points represent the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
STC1 Modulation of Granulosa Cell Differentiation by Suppressing FSH Induction of Functional LH Receptors
We further tested the ability of STC1 to regulate FSH-induced LH receptor expression as another index of granulosa cell differentiation. Immature granulosa cells were cultured with FSH or FSH plus STC1 for different intervals and total RNA was extracted for assessing LH receptor expression levels using quantitative real-time PCR. After 48 h of culture, FSH treatment increased LH receptor transcripts by 15-fold, whereas STC1 cotreatment suppressed the FSH induction of LH receptor mRNA levels by 55% (Fig. 5AGo). To estimate LH receptor content, a radioligand-binding assay using 125I-labeled hCG was performed in granulosa cells after 2 d of treatment with FSH or FSH plus STC1. As shown in Fig. 5BGo, STC1 treatment inhibited FSH induction of LH receptors by 50%. The hCG-induced cAMP responsiveness of granulosa cells was also tested after hormonal treatment. Granulosa cells treated with FSH or FSH plus STC1 for 2 d were washed before hCG treatment for 1 h. As shown in Fig. 5CGo, hCG stimulation of cAMP production was suppressed by 30% when cells were primed with FSH plus STC1 as compared with FSH pretreatment alone.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Effect of Treatment with STC1 on the FSH Induction of Functional LH Receptors in Granulosa Cells

A, Granulosa cells from DES-treated rats were cultured in McCoy’s 5a medium containing FSH (10 ng/ml) only or FSH together with 10 nM STC1 for different time intervals. Cells were collected and total RNA was extracted before reverse transcription. LH receptor transcript levels were quantitated by real-time PCR and normalized by ß-actin expression levels. Data were obtained from three independent experiments and are shown as the mean ± SE. B, LH receptor content was measured 2 d after treatment of granulosa cells with FSH or FSH plus STC1. Radioligand-binding assay was performed. C, Testing of functional LH receptors in granulosa cells. Granulosa cells were treated with FSH only or FSH plus STC1 for 2 d. Cells were washed twice and then incubated in fresh medium containing 250 µM 3-isobutyl-1-methylxanthine with or without hCG (10 ng/ml) for 1 h. Media cAMP levels were evaluated by RIA. Data are shown as the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
Regulation of FSH Induction of Steroidogenic Enzymes by STC1
To further study the mechanisms underlying the suppressive effect of STC1 on gonadotropin-induced progesterone production, levels of the steroidogenic enzyme transcripts were analyzed in cultured immature granulosa cells. Quantitative real-time PCR analyses showed that STC1 inhibited FSH-stimulated CYP11A expression by 48% at 48 h after incubation (Fig. 6AGo). Likewise, STC1 cotreatment suppressed FSH-induced steroidogenic acute regulatory protein (StAR) mRNA levels in granulosa cells by 26% (Fig. 6BGo). Also, STC1 cotreatment led to a small but significant (16%) suppression of the FSH induction of 3-ß-hydroxysteroid dehydrogenase (3-ßHSD) expression (Fig. 6CGo).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. Effect of STC1 Treatment on the FSH Induction of Steroidogenic Enzyme Transcripts in Granulosa Cells

Immature granulosa cells were cultured in McCoy’s 5a medium containing FSH (10 ng/ml) only or FSH plus 10 nM STC1 for different intervals. Cells were collected for total RNA extractions. Transcript levels for (A) CYP11A, (B) StAR, and (C) 3-ßHSD were quantitated by real-time PCR and normalized using ß-actin levels. Data are shown as the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
Ovarian STC1 Expression Regulated by Gonadotropins
Because STC1 is capable of suppressing different granulosa cell functions induced by gonadotropins, we tested whether gonadotropins regulate STC1 expression during follicular development. Ovaries from superovulated immature rats treated with pregnant mare serum gonadotropin (PMSG) followed by hCG were collected for total RNA extraction. Changes in STC1 gene expression were estimated using quantitative real-time PCR. As shown in Fig. 7AGo, STC1 mRNA levels were inhibited in a time-dependent manner after PMSG injection. The STC1 transcriptional levels were suppressed by 48 and 80% at 3 and 48 h after PMSG treatment, respectively. Subsequent treatment with hCG to induce ovulation led to a small but gradual increase in ovarian STC1 mRNA levels. We further analyzed STC1 expression in different ovarian compartments by isolating granulosa, theca, and luteal cells before and after gonadotropin treatments. As shown in Fig. 7BGo, STC1 transcript was mainly found in theca, but not granulosa, cells of early antral follicles. After PMSG treatment, theca cell STC1 transcript levels were decreased by 87% in preovulatory follicles. In the corpora lutea at 48 and 96 h after hCG treatment, STC1 mRNA levels remained low.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Gonadotropin Regulation of Ovarian STC1 Expression in Immature Rats

Rats at 26 d of age were treated with PMSG, followed 48 h later with hCG for different intervals. Ovaries (A) or different ovarian cell types (B) were collected for RNA extraction. Granulosa and theca cells were isolated from follicles before and at 48 h after PMSG treatment whereas corpora lutea (CL) were obtained from PMSG-primed rats at 48 and 96 h after hCG treatment. After reverse transcription, STC1 transcript levels were determined by real-time PCR and normalized using ß-actin levels. Data were obtained from triplicate experiments and are shown as the mean ± SD. Asterisk indicates significant difference from control (ANOVA, P < 0.05).

 
STC1 Receptors in Granulosa Cells
Based on the observed STC1 effect on diverse granulosa cell genes, radioligand-binding assays were performed to study the existence and characteristics of putative STC1 receptors. Purified recombinant STC1 was iodinated and incubated with immature granulosa cells obtained from DES-treated rats. Saturation curve analyses using an increasing amount of 125I-STC1 demonstrated the specific binding of STC1 to granulosa cells, showing a dissociation constant of 1.1 nM and a maximal binding capacity of 9.5 ± 1 fmol/106 cells (Fig. 8AGo). Displacement tests showed no competition by human STC2, hCG, and PMSG, thus demonstrating the STC1 receptor specificity in granulosa cells (Fig. 8BGo). Because an earlier study reported binding of the STC1-alkaline phosphatase fusion protein to bovine luteal cells (18), we further assessed the binding of 125I-labeled STC1 to luteal membranes. Fractionated membranes were prepared from ovaries enriched with corpora lutea after treatment of immature rats with PMSG followed by hCG for 4 d. In addition, membranes also were obtained from immature rats treated with DES to stimulate multiple early antral follicles. As shown in Fig. 8CGo, both membrane preparations contained comparable levels of STC1 binding sites.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. Characterization of STC1 Receptors in Granulosa Cells

A, Saturation analysis. Granulosa cells (1 x 106) cells) were incubated with increasing concentrations of 125I-STC1 at room temperature for 6 h. Cells were washed and the amount of total-bound radioactivity ({bullet}) was determined. For the estimation of nonspecific binding ({blacktriangleup}), 1 µM unlabeled STC1 was added. B, Hormonal specificity. Different hormones (human STC1, hCG, PMSG, and human STC2) were used to compete for 125I-STC1 (1 nM) binding to granulosa cells. C, Binding of STC1 to ovarian plasma membrane preparations. Partially purified plasma membranes were prepared from immature rats after DES treatment to stimulate multiple early antral follicles or from immature rats treated with PMSG followed by hCG for 4 d to induce corpus luteum formation. Nonspecific binding in the presence of 1 µM unlabeled STC1 was subtracted from total binding to derive specific binding shown. Data were presented as mean ± SE (n = 3).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The present study demonstrates the paracrine role of theca/interstitial-derived STC1 on granulosa cell function. Treatment of granulosa cells with STC1 decreased gonadotropin stimulation of progesterone production, CYP11A mRNA expression, and LH receptor formation without affecting gonadotropin-induced estradiol secretion. Receptor binding analyses further indicated that the observed STC1 effects on granulosa cells are likely mediated through specific plasma membrane receptors. In addition, gonadotropin treatment suppressed STC1 transcripts in thecal cells, suggesting the induction of granulosa cell differentiation by gonadotropins involves the suppression of the biosynthesis of theca cell-derived inhibitory factor STC1.

We produced functional STC1 proteins in transfected 293T cells. The purified recombinant STC1 protein was shown to be a secreted dimer with monomers of 30 kDa, consistent with earlier findings using ovarian homogenates and cell lines (19, 20). Similar to our finding of N-glycosylated human STC1, earlier studies found human STC1 and native fish STC to be glycosylated (16, 21). Although a STC1 oligomer (big STC1) did derive from a large monomer of 45 kDa found in the conditioned media of cultured bovine theca/interstitial cells (22), this big STC1 appeared not to be glycosylated and its exact biochemical structure is unclear. The primary bioassay for both fish STC and human STC1 has been based on the inhibition of Ca2+ uptake through fish gills (16, 21). Although several alternative assays were designed for mammalian STC1 by measuring 45Ca and 32P fluxes in vitro using duodenal tissues in voltage-clamped Ussing chambers (13, 23) and by assessing the uptake of inorganic phosphate in a human neural crest-derived Paju cell line (23), these assays have not been widely adopted. In the present study, the effects of STC1 in primary cultures of granulosa cells provide a highly accessible bioassay for STC1.

The observed STC1 suppression of progesterone production is associated with decreases in gonadotropin-induced steroidogenic enzyme expression. STC1 cotreatment showed a pronounced suppression on FSH-induced transcripts for CYP11A, which is a rate-limiting enzyme in progesterone biosynthesis (24, 25, 26). Of interest, a theca/interstitial-derived big STC1 recently has been shown to inhibit hCG stimulation of progesterone biosynthesis by cultured bovine luteal cells (18). In addition to effects on ovarian function, STC1, when overexpressed, leads to defects in bone formation in transgenic mice (27, 28), whereas progesterone is known to play a role in the prevention of bone loss (29). Thus, the possible role of progesterone in mediating the STC1 regulation of osteogenesis will require further study.

Although the gonadotropin-induced cAMP/protein kinase A pathway is essential for progesterone biosynthesis, estradiol production, and LH receptor induction, STC1 cotreatment had a pronounced effect on progesterone biosynthesis and LH receptor formation but showed minimal suppression of cAMP and estradiol production. Studies using forskolin and 8-Br-cAMP further suggested that STC1 likely acts downstream of adenyl cyclase because STC1 did not affect forskolin-stimulated cAMP production but suppressed forskolin- and 8-Br-cAMP-stimulated progesterone biosynthesis. It is possible that STC1 acts on pathways downstream of cAMP that are specific for progesterone biosynthesis and LH receptor induction. Further studies may reveal whether STC1 acts on seven-transmembrane receptors or receptors not interacting with G proteins.

Our data showed prominent suppression of STC1 expression in the ovary within several hours of PMSG treatment in immature rats. These findings in immature rats are consistent with an earlier report showing ovarian STC1 expression in newborn mice and continuing high levels in prepubertal animals (15), suggesting that STC1 may have important roles during the early stages of folliculogenesis. Mammalian folliculogenesis starts from the endowment of primordial follicles (30). To date, only few paracrine factors have been characterized during early follicular stages. The expression of STC1 in newborn animals suggests a potential paracrine role for STC1 in early folliculogenesis. Of interest, transgenic mice overexpressing STC1 are subfertile as reflected by reduced litter sizes, and a possible defect in the ovulatory mechanism was suggested (28). However, no evaluation is available of their follicle pool size or ovarian histology. In future studies, it will be interesting to investigate folliculogenesis in STC1 null mice.

Unlike several ovarian factors such as GDF-9 found to suppress both estradiol and progesterone production induced by gonadotropins (4), STC1 only showed inhibition of gonadotropin-induced progesterone biosynthesis with no effect on estradiol production. Ovarian paracrine factors known to differentially inhibit progesterone biosynthesis without affecting estrogen production have been found in follicular fluid and postulated as luteinization inhibitors (31, 32). Thus, STC1, like several bone morphogenetic proteins (33) and endothelin-1 (34), may be a follicular luteinization inhibitor. The observed suppression of STC1 in thecal cells of mature follicles and in the corpora lutea suggests the ability of gonadotropins to decrease the production of this potential luteinization inhibitor. In addition, the suppressive effect of STC1 on the FSH induction of functional LH receptor expression further supports the hypothesized role of STC1 as a luteinization inhibitor.

Although STC1 actions have been tested in diverse tissues and cell types, few reports deal with the characteristics of the putative STC1 receptor. In liver and kidney, STC1 binding was tested using STC1-alkaline phosphatase fusion proteins and showed high affinity to the putative receptor. The STC1 binding sites in liver and kidney were restricted to hepatocytes and nephron cells, respectively. After fractionation, the highest binding in these tissues was located on the inner mitochondrial membrane (35). In contrast, ovarian STC1 binding was found using the same STC1 fusion protein as a probe in the cholesterol/lipid droplets of luteal cells (18). We used the 125I-labeled STC1 ligand for receptor-binding assays and found STC1 receptors in granulosa cells with high specificity and affinity (dissociation constant = 1.1 nM).

We further expressed a stanniocalcin-related protein, STC2, to test the specificity of STC1 receptors in granulosa cells. Human STC2 shares only 30% sequence identity to human STC1, but the key cysteine residues are conserved (36, 37, 38). Although the recombinant STC2 protein, like STC1, is dimeric in nature and capable of regulating progesterone biosynthesis (data not shown), STC2 did not displace 125I-labeled STC1 binding to granulosa cells. Thus, the action of these two paralogs is likely mediated through different receptors. Furthermore, our studies using rat ovarian membranes indicated comparable STC1 receptor content in ovaries containing mainly antral follicles and corpora lutea. However, our observed luteal STC1 receptor content in rat ovary was lower than an earlier study using STC1-alkaline phosphatase fusion protein as the ligand for bovine luteal membrane binding (18). It is unclear whether these discrepancies are the result of tissue preparation, species variation, or the use of fusion protein as the ligand. Nevertheless, our results indicate the existence of membrane-bound STC1 receptors, thereby validating future characterization of these proteins.

The primary function of STC in fish is to maintain calcium homeostasis, thus avoiding the threat of hypercalcemia. The discovery of STC1 expression in terrestrial vertebrates suggests that STC1 could play additional physiological functions. It has been shown that STC1 can stimulate phosphate reabsorption in both small intestine and proximal kidney tubules by modulating sodium-phosphate cotransporter expression (39, 40). Overexpression of STC1 in transgenic mice also demonstrated important roles for STC1 such as the regulation of body weight. In addition, STC1 could be involved in the regulation of mineral absorption during bone formation (27, 28). The present demonstration of STC1 receptors and biological actions in ovarian granulosa cells provides a model for the future understanding of STC1 receptors and their mechanisms of action in diverse tissues.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
Immature female rats (Sprague Dawley) were obtained from Simonsen Laboratories (Gilroy, CA). Animals (22 d old, body weight 53–68 g) were anesthetized using CO2 and killed 72 h after insertion of DES implants (41). For time-course analyses of STC1 mRNA expression using the superovulation model, immature female rats (26 d old) were primed with 15 IU PMSG (Calbiochem, La Jolla, CA) at 0900–1000 h and received an ip injection of 10 IU hCG (Schein Pharmaceuticals, Florham Park, NJ) 48 h later. Rats were killed at different time points, and ovaries were collected for total RNA extraction. All animals were housed under controlled humidity, temperature, and light regimen and fed ad libitum on standard rat chow. Animal care was consistent with institutional and National Institutes of Health (NIH) guidelines.

Reagents and Hormones
McCoy’s 5a medium (modified), L-15 Leibovitz medium, and DMEM-F12 were obtained from Gibco (Gaithersburg, MD). Recombinant human FSH was a gift from NV Organon (Oss, The Netherlands). Purified hCG (CR-129) was supplied by the National Hormone and Pituitary Program (National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD). PNGase F was obtained from New England Biolabs, Inc. (Beverly, MA). Androstenedione, BSA, 3-isobutyl-1-methylxanthine, forskolin, and 8-Br-cAMP were obtained from Sigma Chemical Co. (St. Louis, MO); L-glutamine, penicillin, and streptomycin were purchased from BioWhittaker (Walkersville, MD). Antisera against progesterone and estradiol were raised against progesterone-11-hemisuccinate-BSA and estradiol-17ß-O-carboxymethyl-BSA, respectively (4). Antibodies against cAMP were provided by the National Pituitary and Hormone Program (4).

Expression and Purification of Recombinant Human STC1 and STC2 Proteins
The full-length human STC1 and STC2 cDNAs were amplified by PCR from a human ovary cDNA library (CLONTECH, Palo Alto, CA) and cloned into the pUC18 vector (Invitrogen Life Technologies, Carlsbad, CA). After confirmation of DNA sequences by dideoxy DNA sequencing, the STC1 and STC2 cDNA were subcloned into the pcDNA3.1/Zeo (+) expression vector. The constructed plasmids were purified and transfected into human 293T cells using LipofectAMINE 2000 (Invitrogen Life Technologies). Forty-eight hours after transfection, transfectants were selected by Zeocin-containing medium. Selected cells were cultured to confluence and then incubated for 72 h in serum-free medium (DMEM/ Ham’s F12 media containing 100 µg/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamate). Conditioned media were harvested and filtered after collection. Purification of the recombinant proteins was done at 4 C. The STC1-containing medium was incubated with Concanavalin A-conjugated resins (Amersham Biosciences, Piscataway, NJ) that had been equilibrated in the wash buffer [125 mM NaCl, 20 mM Tris-HCl (pH 7.4)]. The unbound proteins were removed by washing the column with 20 gel volume of wash buffer. Recombinant proteins were eluted with the buffer containing 0.2 M methyl {alpha}-D-glucopyranoside. Human STC2 was isolated using metal chelate chromatography (17). The purified recombinant human STC2 was found to be functional based on its ability to block FSH-stimulated progesterone production (data not shown). Measurement of protein content was performed using the Micro BCA protein assay kit (Pierce Biotechnology, Rockford, IL). Protein purity and characteristics were analyzed by running 12% SDS-PAGE. Western blotting was performed using specific human STC1 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

Preparation and Culture of Granulosa Cells
Granulosa cells were obtained from small antral follicles of DES-treated rats. Ovaries were punctured in L-15 Leibovitz medium. Ovarian debris, oocytes, and small follicles were removed, and the remaining medium containing granulosa cells was collected after low-speed centrifugation at 500 x g for 10 min. Granulosa cells were dispersed by repeated washing and resuspended into the culture medium (McCoy’s 5a supplemented with 10–7 M androstenedione, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin).

Assessment of Steroid and cAMP Production
Granulosa cells (2 x 105 viable cells/ml) from DES-treated rats were cultured in 24-well plates (Corning, Corning, NY) and treated with FSH, forskolin, or 8-Br-cAMP in the presence or absence of increasing concentrations of STC1. After culture, the conditioned media were collected and stored at –80 C until measurement of steroid and cAMP content. For mature granulosa cells, LH receptors were induced by culturing granulosa cells from DES-treated rats for 48 h in McCoy’s medium containing 10–7 M androstenedione and 10 ng/ml of FSH (42, 43). Cells were then washed once and recultured in McCoy’s medium containing 10–7 M androstenedione and graded concentrations of purified hCG in the presence or absence of 10 nM STC1 for another 48 h. Media were collected and stored at –80 C until measurement of steroid and cAMP content was performed. Medium progesterone, estradiol, and cAMP contents were determined using RIA (4).

LH/hCG Receptor Measurement
Highly purified hCG supplied from the National Hormone and Pituitary Program was iodinated in the presence of IODO-BEADs (Pierce Biotechnology) using a modified method developed by Markwell (44). The specific activity and maximum binding capacity of the tracer were approximately 50,000 cpm/ng and 60%, respectively, as determined by radioligand receptor assay (45).

Granulosa cells (2 x105 viable cells/500 µl) were cultured in 5 ml polypropylene Falcon tubes (Becton Dickinson, Franklin Lakes, NJ) with 10 ng/ml FSH in the presence or absence of 10 nM STC1. Cells were maintained at 37 C under 5% CO2 in air. After 48 h of culture, granulosa cells were centrifuged for 30 min at 4 C. The supernatant was decanted, and culture media were replaced with PBS/0.1% BSA containing a saturating dose of 125I-hCG (4 ng/tube) in the absence or presence of excess unlabeled hCG (10 IU hCG/tube). After 18 h incubation at room temperature, cells were washed by ice-cold PBS/0.1% BSA before centrifugation. The radioactivity of the final pellet was determined using a {gamma}-spectrometer. After correction for nonspecific binding, the amount of specifically bound hCG was determined.

Quantitative Real-Time PCR
For assessing the gonadotropin regulation of STC1 mRNA expression, ovaries were collected for total RNA extraction after gonadotropin treatment of immature rats. RNA was extracted from the whole ovary or from isolated follicular compartments and corpora lutea. Individual follicles were punctured to obtain granulosa cells under the Hoffman modulation contrast microscopy (Nikon Inc., Tokyo, Japan), followed by cutting open the follicles and scrapping the remaining granulosa cells from the theca shell. Individual corpus luteum was also isolated after hCG treatment. The purity of granulosa and theca cells was confirmed based on the differential expression of FSH and LH receptor transcripts determined by real-time PCR (relative mRNA levels normalized by ß-actin: granulosa cells before PMSG—FSH receptor, 0.0029; LH receptor, 0.0022; theca cells before PMSG—FSH receptor, 0.0017; LH receptor:, 0.0093; granulosa cells after PMSG—FSH receptor, 0.0046; LH receptor, 0.0359; theca cells after PMSG—FSH receptor, 0.0010; LH receptor, 0.0403).

To study STC1 regulation of granulosa cell genes, cells (2 x 105 cells/ml) from DES-treated animals were incubated with 10 ng/ml FSH in the presence or absence of 10 nM STC1 for different intervals. Cells were washed and collected for subsequent total RNA extraction. RNA was extracted using an RNeasy Mini Kit (QIAGEN Sciences, Valencia, CA). Total RNA (2 µg) from each sample was reverse transcribed for subsequent PCR analysis. After reverse transcription, real-time PCR was performed in 25 µl final volume containing 2 µl of the resulting RT reaction product, 0.5 µM primers, 0.2 µM fluorescently labeled probe (3': 5'-carboxy tetramethylrhodamine; 5': 6'-carboxy fluorescein), and PCR reagent mixtures (QuantiTect Probe PCR Kit, QIAGEN Sciences). Standard curves were generated by serial dilution of each plasmid DNA. The primer pairs and fluorescent probes used were as follows: STC1 forward, ACTGCTACAGCAAGCTCAATGTT; STC1 reverse, GCTTCGGACAAGTCTGTTGTAGTAT; STC1 probe, CCGGAAGCCATCACTGAAGTCATAC. LH receptor forward, ATGGCCATCCTCATCTTCA-CA; LH receptor reverse, TGGCACAAGAATTGACAGGA; LH receptor probe, TTGCCATCTCGGCTGCCTTCAA. CYP11A forward, CCAA-GTTCAACCTCATCCTGA; CYP11A reverse, CGTGTGACTGCAGCCTGCAA; CYP11A probe, TCTTCAACTTCCAGCCT-CTCAAGCA. StAR forward, AGATGAAGTGCTAAGTAAGG-TGGTG; StAR reverse, CCAGTTCTTCATAGAGTCTGTCCAT; StAR probe, TCTAGCAGCACCTCCAGTCGGAACA. 3-ßHSD forward, AGACCATCCTAGATGTCAA-TCTGAA; 3-ßHSD reverse, CAGGATGATCTTCTTGTAGGA-GT; 3-ßHSD probe, TCTACTGCAGCACAGTTGACGTTGC. ß-Actin forward, TC-TGTGTGGATTGGTGGCTCTA; ß-actin reverse, CTGCTTGCTGATCCACATCTG; ß-actin probe, CCTGGCCTCACTGTCCACCTTCC. FSH receptor forward, GTGGTCATCTGT-GGCTGCTA; FSH receptor reverse, TCTTGGTGCGCTTG-ATGAG-3'; FSH receptor probe, CCACATCTACCTCACA-GTGAGGAATCC.

Receptor Binding Assay
Purified STC1 was iodinated using the method described for LH/hCG labeling. Receptor binding assays were conducted using granulosa cells obtained from DES-treated rats or ovarian plasma membrane fractions. For granulosa cell binding, cells (106 cells/tube) were incubated in PBS/0.1% BSA with 125I-STC1 at room temperature for 6 h. Cells were washed twice and the amount of bound radioactivity was determined using a {gamma}-spectrometer. Displacement experiments were performed by adding different hormones together with 125I-STC1 during incubation. For ovarian membrane binding, partially purified ovarian membranes were prepared from rats after DES treatment at 22 d of age for 3 d or from rats treated with PMSG at 26 d of age for 2 d followed by hCG injection for 4 d. Ovaries were collected and minced in the assay buffer (1x TBS supplemented with protease inhibitor cocktail, Roche Diagnostics, Mannheim, Germany). The homogenate was centrifuged at 500 x g for 15 min to remove nuclei and tissue debris. The supernatant containing plasma membranes was centrifuged at 20,000 x g for 30 min and washed with the assay buffer. The protein concentration was measured using a Micro BCA protein assay kit (Pierce Biotechnology). Crude membranes (200 µg/tube) were incubated in the assay buffer containing 0.1% BSA and a saturating dose of 125I-STC1 (3 nM) at room temperature for 6 h. Membranes were centrifuged for 3 min at 20,000 x g and washed twice before counting. For all reactions, nonspecific binding was subtracted based on the competition with 1 µM unlabeled STC1.

Data Analysis
All experimental data are presented as the mean ± SE of triplicate measurements of triplicate cultures. Statistical significance was determined by ANOVA for multiple group comparisons. Significance was accepted at P < 0.05.


    ACKNOWLEDGMENTS
 
We thank Caren Spencer for editorial assistance.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant HD23273.

Abbreviations: 8-Br-cAMP, 8-Bromo-cAMP; DES, diethylstilbestrol; hCG, human chorionic gonadotropin; PNGase F, peptide N-glycosidase F; PMSG, pregnant mare serum gonadotropin; STC, stanniocalcin; StAR, steroidogenic acute regulatory protein; 3-ßHSD, 3-ß-hydroxysteroid dehydrogenase.

Received for publication February 13, 2004. Accepted for publication April 26, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Hsueh AJ, Adashi EY, Jones PB, Welsh Jr TH 1984 Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocr Rev 5:76–127[Abstract/Free Full Text]
  2. Richards JS, Fitzpatrick SL, Clemens JW, Morris JK, Alliston T, Sirois J 1995 Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog Horm Res 50:223–254
  3. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM 1996 Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383:531–535[CrossRef][Medline]
  4. Vitt UA, Hayashi M, Klein C, Hsueh AJ 2000 Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biol Reprod 62:370–377[Abstract/Free Full Text]
  5. Otsuka F, Shimasaki S 2002 A negative feedback system between oocyte bone morphogenetic protein 15 and granulosa cell kit ligand: its role in regulating granulosa cell mitosis. Proc Natl Acad Sci USA 99:8060–8065[Abstract/Free Full Text]
  6. Butkus A, Roche PJ, Fernley RT, Haralambidis J, Penschow JD, Ryan GB, Trahair JF, Tregear GW, Coghlan JP 1987 Purification and cloning of a corpuscles of Stannius protein from Anguilla australis. Mol Cell Endocrinol 54:123–133[CrossRef][Medline]
  7. Lu M, Wagner GF, Renfro JL 1994 Stanniocalcin stim-ulates phosphate reabsorption by flounder renal prox-imal tubule in primary culture. Am J Physiol 267:R1356–R1362
  8. Sundell K, Bjornsson BT, Itoh H, Kawauchi H 1992 Chum salmon (Oncorhynchus keta) stanniocalcin inhibits in vitro intestinal calcium uptake in Atlantic cod (Gadus morhua). J Comp Physiol [B] 162:489–495[Medline]
  9. McCudden CR, Tam WH, Wagner GF 2001 Ovarian stanniocalcin in trout is differentially glycosylated and preferentially expressed in early stage oocytes. Biol Reprod 65:763–770[Abstract/Free Full Text]
  10. Chang AC, Janosi J, Hulsbeek M, de Jong D, Jeffrey KJ, Noble JR, Reddel RR 1995 A novel human cDNA highly homologous to the fish hormone stanniocalcin. Mol Cell Endocrinol 112:241–247[CrossRef][Medline]
  11. Chang AC, Dunham MA, Jeffrey KJ, Reddel RR 1996 Molecular cloning and characterization of mouse stanniocalcin cDNA. Mol Cell Endocrinol 124:185–187[CrossRef][Medline]
  12. Olsen HS, Cepeda MA, Zhang QQ, Rosen CA, Vozzolo BL 1996 Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc Natl Acad Sci USA 93:1792–1796[Abstract/Free Full Text]
  13. Madsen KL, Tavernini MM, Yachimec C, Mendrick DL, Alfonso PJ, Buergin M, Olsen HS, Antonaccio MJ, Thomson AB, Fedorak RN 1998 Stanniocalcin: a novel protein regulating calcium and phosphate transport across mammalian intestine. Am J Physiol 274:G96–G102
  14. Varghese R, Wong CK, Deol H, Wagner GF, DiMattia GE 1998 Comparative analysis of mammalian stanniocalcin genes. Endocrinology 139:4714–4725[Abstract/Free Full Text]
  15. Deol HK, Varghese R, Wagner GF, Dimattia GE 2000 Dynamic regulation of mouse ovarian stanniocalcin expression during gestation and lactation. Endocrinology 141:3412–3421[Abstract/Free Full Text]
  16. Zhang J, Alfonso P, Thotakura NR, Su J, Buergin M, Parmelee D, Collins AW, Oelkuct M, Gaffney S, Gentz S, Radman DP, Wagner GF, Gentz R 1998 Expression, purification, and bioassay of human stanniocalcin from baculovirus-infected insect cells and recombinant CHO cells. Protein Exp Purif 12:390–398[CrossRef][Medline]
  17. Moore EE, Kuestner RE, Conklin DC, Whitmore TE, Downey W, Buddle MM, Adams RL, Bell LA, Thompson DL, Wolf A, Chen L, Stamm MR, Grant FJ, Lok S, Ren H, De Jongh KS 1999 Stanniocalcin 2: characterization of the protein and its localization to human pancreatic {alpha} cells. Horm Metab Res 31:406–414[Medline]
  18. Paciga M, McCudden CR, Londos C, DiMattia GE, Wagner GF 2003 Targeting of big stanniocalcin and its receptor to lipid storage droplets of ovarian steroidogenic cells. J Biol Chem 278:49549–49554[Abstract/Free Full Text]
  19. Worthington RA, Brown L, Jellinek D, Chang AC, Reddel RR, Hambly BD, Barden JA 1999 Expression and localisation of stanniocalcin 1 in rat bladder, kidney and ovary. Electrophoresis 20:2071–2076[CrossRef][Medline]
  20. Jellinek DA, Chang AC, Larsen MR, Wang X, Robinson PJ, Reddel RR 2000 Stanniocalcin 1 and 2 are secreted as phosphoproteins from human fibrosarcoma cells. Biochem J 350:453–461
  21. Wagner GF, Hampong M, Park CM, Copp DH 1986 Purification, characterization, and bioassay of teleocalcin, a glycoprotein from salmon corpuscles of Stannius. Gen Comp Endocrinol 63:481–491[CrossRef][Medline]
  22. Paciga M, Watson AJ, DiMattia GE, Wagner GF 2002 Ovarian stanniocalcin is structurally unique in mammals and its production and release are regulated through the luteinizing hormone receptor. Endocrinology 143:3925–3934[Abstract/Free Full Text]
  23. Zhang K, Lindsberg PJ, Tatlisumak T, Kaste M, Olsen HS, Andersson LC 2000 Stanniocalcin: a molecular guard of neurons during cerebral ischemia. Proc Natl Acad Sci USA 97:3637–3642[Abstract/Free Full Text]
  24. Oonk RB, Parker KL, Gibson JL, Richards JS 1990 Rat cholesterol side-chain cleavage cytochrome P-450 (P-450scc) gene. Structure and regulation by cAMP in vitro. J Biol Chem 265:22392–22401[Abstract/Free Full Text]
  25. Goldring NB, Durica JM, Lifka J, Hedin L, Ratoosh SL, Miller WL, Orly J, Richards JS 1987 Cholesterol side-chain cleavage P450 messenger ribonucleic acid: evidence for hormonal regulation in rat ovarian follicles and constitutive expression in corpora lutea. Endocrinology 120:1942–1950[Abstract/Free Full Text]
  26. Zlotkin T, Farkash Y, Orly J 1986 Cell-specific expression of immunoreactive cholesterol side-chain cleavage cytochrome P-450 during follicular development in the rat ovary. Endocrinology 119:2809–2820[Abstract/Free Full Text]
  27. Filvaroff EH, Guillet S, Zlot C, Bao M, Ingle G, Steinmetz H, Hoeffel J, Bunting S, Ross J, Carano RA, Powell-Braxton L, Wagner GF, Eckert R, Gerritsen ME, French DM 2002 Stanniocalcin 1 alters muscle and bone structure and function in transgenic mice. Endocrinology 143:3681–3690[Abstract/Free Full Text]
  28. Varghese R, Gagliardi AD, Bialek PE, Yee SP, Wagner GF, Dimattia GE 2002 Overexpression of human stanniocalcin affects growth and reproduction in transgenic mice. Endocrinology 143:868–876[Abstract/Free Full Text]
  29. Prior JC 1990 Progesterone as a bone-trophic hormone. Endocr Rev 11:386–398[Abstract/Free Full Text]
  30. McGee EA, Hsueh AJ 2000 Initial and cyclic recruitment of ovarian follicles. Endocr Rev 21:200–214[Abstract/Free Full Text]
  31. Smith MS, Freeman ME, Neill JD 1975 The control of progesterone secretion during the estrous cycle and early pseudopregnancy in the rat: prolactin, gonadotropin and steroid levels associated with rescue of the corpus luteum of pseudopregnancy. Endocrinology 96:219–226[Abstract/Free Full Text]
  32. Falck B 1959 Site of production of oestrogen in the ovary of the rat. Nature 184(Suppl 14):1082
  33. Shimasaki S, Zachow RJ, Li D, Kim H, Iemura S, Ueno N, Sampath K, Chang RJ, Erickson GF 1999 A functional bone morphogenetic protein system in the ovary. Proc Natl Acad Sci USA 96:7282–7287[Abstract/Free Full Text]
  34. Tedeschi C, Hazum E, Kokia E, Ricciarelli E, Adashi EY, Payne DW 1992 Endothelin-1 as a luteinization inhibitor: inhibition of rat granulosa cell progesterone accumulation via selective modulation of key steroidogenic steps affecting both progesterone formation and degradation. Endocrinology 131:2476–2478[Abstract/Free Full Text]
  35. McCudden CR, James KA, Hasilo C, Wagner GF 2002 Characterization of mammalian stanniocalcin receptors. Mitochondrial targeting of ligand and receptor for regulation of cellular metabolism. J Biol Chem 277:45249–45258[Abstract/Free Full Text]
  36. Chang AC, Reddel RR 1998 Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol 141:95–99[CrossRef][Medline]
  37. DiMattia GE, Varghese R, Wagner GF 1998 Molecular cloning and characterization of stanniocalcin-related protein. Mol Cell Endocrinol 146:137–140[CrossRef][Medline]
  38. Ishibashi K, Miyamoto K, Taketani Y, Morita K, Takeda E, Sasaki S, Imai M 1998 Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun 250:252–258[CrossRef][Medline]
  39. Yoshiko Y, Maeda N, Aubin JE 2003 Stanniocalcin 1 stimulates osteoblast differentiation in rat calvaria cell cultures. Endocrinology 144:4134–4143[Abstract/Free Full Text]
  40. Wagner GF, Vozzolo BL, Jaworski E, Haddad M, Kline RL, Olsen HS, Rosen CA, Davidson MB, Renfro JL 1997 Human stanniocalcin inhibits renal phosphate excretion in the rat. J Bone Miner Res 12:165–171[CrossRef][Medline]
  41. Tapanainen JS, Lapolt PS, Perlas E, Hsueh AJ 1993 Induction of ovarian follicle luteinization by recombinant follicle-stimulating hormone. Endocrinology 133:2875–2880[Abstract/Free Full Text]
  42. Wang C, Hsueh AJ, Erickson GF 1981 LH stimulation of estrogen secretion by cultured rat granulosa cells. Mol Cell Endocrinol 24:17–28[CrossRef][Medline]
  43. Welsh Jr TH, Zhuang LZ, Hsueh AJ 1983 Estrogen augmentation of gonadotropin-stimulated progestin biosynthesis in cultured rat granulosa cells. Endocrinology 112:1916–1924[Abstract/Free Full Text]
  44. Markwell MA 1982 A new solid-state reagent to iodinate proteins. I. Conditions for the efficient labeling of antiserum. Anal Biochem 125:427–432[CrossRef][Medline]
  45. Rao MC, Richards JS, Midgley Jr AR, Reichert Jr LE 1977 Regulation of gonadotropin receptors by luteinizing hormone in granulosa cells. Endocrinology 101:512–523[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
Y. S. Lee, K. E. Latham, and C. A. VandeVoort
Effects of in vitro maturation on gene expression in rhesus monkey oocytes
Physiol Genomics, October 8, 2008; 35(2): 145 - 158.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. Raulic, Y. Ramos-Valdes, and G. E DiMattia
Stanniocalcin 2 expression is regulated by hormone signalling and negatively affects breast cancer cell viability in vitro
J. Endocrinol., June 1, 2008; 197(3): 517 - 529.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Zhao, A. De, Z. Hu, J. Li, S. M. Mulders, M. D. Sollewijn Gelpke, E.-K. Duan, and A. J. W. Hsueh
Gonadotropin Stimulation of Ovarian Fractalkine Expression and Fractalkine Augmentation of Progesterone Biosynthesis by Luteinizing Granulosa Cells
Endocrinology, June 1, 2008; 149(6): 2782 - 2789.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
G. Dole, E. E Nilsson, and M. K Skinner
Glial-derived neurotrophic factor promotes ovarian primordial follicle development and cell-cell interactions during folliculogenesis
Reproduction, May 1, 2008; 135(5): 671 - 682.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. J Johnson, J. B Hensley, M. D Kelso, D. G Wallace, and K. W Gaido
Mapping Gene Expression Changes in the Fetal Rat Testis Following Acute Dibutyl Phthalate Exposure Defines a Complex Temporal Cascade of Responding Cell Types
Biol Reprod, December 1, 2007; 77(6): 978 - 989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S.-H. Hsu and C.-W. Luo
Molecular dissection of G protein preference using Gs{alpha} chimeras reveals novel ligand signaling of GPCRs
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1021 - E1029.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. W. Gaido, J. B. Hensley, D. Liu, D. G. Wallace, S. Borghoff, K. J. Johnson, S. J. Hall, and K. Boekelheide
Fetal Mouse Phthalate Exposure Shows that Gonocyte Multinucleation is Not Associated with Decreased Testicular Testosterone
Toxicol. Sci., June 1, 2007; 97(2): 491 - 503.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Chakraborty, H. Brooks, P. Zhang, W. Smith, M. R. McReynolds, J. B. Hoying, R. Bick, L. Truong, B. Poindexter, H. Lan, et al.
Stanniocalcin-1 regulates endothelial gene expression and modulates transendothelial migration of leukocytes
Am J Physiol Renal Physiol, February 1, 2007; 292(2): F895 - F904.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. De, J.-I. Park, K. Kawamura, R. Chen, C. Klein, R. Rauch, S. M. Mulders, M. D. Sollewijn Gelpke, and A. J. W. Hsueh
Intraovarian Tumor Necrosis Factor-Related Weak Inducer of Apoptosis/Fibroblast Growth Factor-Inducible-14 Ligand-Receptor System Limits Ovarian Preovulatory Follicles from Excessive Luteinization
Mol. Endocrinol., October 1, 2006; 20(10): 2528 - 2538.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. Song, F. W. Bazer, G. F. Wagner, and T. E. Spencer
Stanniocalcin (STC) in the Endometrial Glands of the Ovine Uterus: Regulation by Progesterone and Placental Hormones
Biol Reprod, May 1, 2006; 74(5): 913 - 922.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C.-W. Luo, E. M. Dewey, S. Sudo, J. Ewer, S. Y. Hsu, H.-W. Honegger, and A. J. W. Hsueh
Bursicon, the insect cuticle-hardening hormone, is a heterodimeric cystine knot protein that activates G protein-coupled receptor LGR2
PNAS, February 22, 2005; 102(8): 2820 - 2825.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C.-W. Luo, M. D. Pisarska, and A. J. W. Hsueh
Identification of a Stanniocalcin Paralog, Stanniocalcin-2, in Fish and the Paracrine Actions of Stanniocalcin-2 in the Mammalian Ovary
Endocrinology, January 1, 2005; 146(1): 469 - 476.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. D. Gagliardi, E. Y. W. Kuo, S. Raulic, G. F. Wagner, and G. E. DiMattia
Human stanniocalcin-2 exhibits potent growth-suppressive properties in transgenic mice independently of growth hormone and IGFs
Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E92 - E105.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luo, C.-W.
Right arrow Articles by Hsueh, A. J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luo, C.-W.
Right arrow Articles by Hsueh, A. J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals