| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Reproductive Biology, Department of Obstetrics and Gynecology, Stanford University School of Medicine, Stanford, California 94305
Address all correspondence and requests for reprints to: Aaron J. W. Hsueh, Department of Obstetrics and Gynecology, Stanford University School of Medicine, Stanford, California 94305-5317. E-mail: aaron.hsueh{at}stanford.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Stanniocalcin (STC) is a glycoprotein hormone first discovered in bony fish. It is mainly secreted by the corpuscles of Stannius and acts on gill, gut, and kidney to maintain calcium and phosphate homeostasis (6, 7, 8). In addition, STC also is expressed in fish gonad (9), but the gonadal functions of STC in fish have not been elucidated. The first mammalian STC ortholog, human STC1, has 61% sequence identity to fish STC and is highly conserved in other mammals (10, 11). Unlike fish STC, in vitro studies indicated that mammalian STC1 preferentially regulates phosphate metabolism (12, 13). In rodents, STC1 mRNA is widely expressed in ovary, prostate, thyroid, bone, and other tissues with ovary showing the highest level (10, 11, 14). Although STC1 mRNA and proteins have been found to be expressed mainly by theca/interstitial cells (15), the role of STC1 in follicular development is unclear.
In searching for theca cell-derived paracrine factors capable of regulating granulosa cell function, we hypothesize that STC1 may act on granulosa cells to regulate follicular development. Here, we generated recombinant STC1 and tested its ability to regulate granulosa cell differentiation induced by gonadotropins. Furthermore, we studied the specific binding of labeled STC1 to granulosa cells and the gonadotropin modulation of STC1 expression. These data demonstrated a paracrine role of STC1 in the regulation of follicular development and the potential role of STC1 as a luteinization inhibitor.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, lane 2), whereas before purification there existed a prominent albumin band of 64 kDa in the media (Fig. 1A, lane 1). Under nonreducing conditions, the purified STC1 protein migrated as a 60-kDa band (Fig. 1A, lane 3), suggesting that the recombinant human STC1 is a disulfide-linked homodimer consistent with previous data (16, 17). After treatment of recombinant STC1 with peptide: N-glycosidase F (PNGase F) to remove N-linked carbohydrate moieties, the STC1 protein migrated faster during electrophoresis, based on either Coomassie blue staining of gels (Fig. 1B, lanes 1 and 2) or immunoblotting using the STC1 antibodies (Fig. 1B, lanes 3 and 4). These data demonstrated the N-linked glycosylation nature of the recombinant STC1 protein.
|
). At 48 h after treatment, STC1 suppressed FSH-induced progesterone production by 60–70%. In contrast, treatment with STC1 had negligible effect on FSH-induced estradiol biosynthesis (Fig. 2B) and a minor effect on cAMP production (Fig. 2C). In addition, treatment with STC1 alone had no stimulatory effect on progesterone, estradiol, or cAMP production. To study possible effects of STC1 treatment on cAMP production, granulosa cells were treated with graded doses of forskolin in the presence or absence of STC1 for 30 min before cAMP determination. As shown in Fig. 2D, STC1 did not affect the induction of cAMP production by forskolin. However, progesterone production by granulosa cells treated with either forskolin (Fig. 2E) or 8-bromo-cAMP (8-Br-cAMP) (Fig. 2F) was inhibited by STC1 after 2 d of culture.
|
, dose-response experiments further indicated that STC1 treatment led to dose-dependent suppression of FSH-stimulated progesterone production in granulosa cells. Significant inhibition was evident at 0.1 nM STC1 with 1 nM STC1 causing maximum suppression. Time-course studies (Fig. 3B) further demonstrated that STC1 treatment for 24 h inhibited the FSH stimulation of progesterone production by 45%. At 48 h, FSH-induced progesterone production was suppressed by 60%. Because cell viability was not changed after STC1 treatments as compared with the control, the suppression of progesterone production was not due to a deleterious effect on the cells (data not shown).
|
, STC1 antagonized progesterone production induced by hCG showing a 50% inhibition at 48 h after treatment. In contrast, STC1 had a negligible effect on estradiol biosynthesis (Fig. 4B). We also observed suppression of hCG-induced cAMP production by STC1 (Fig. 4C).
|
). To estimate LH receptor content, a radioligand-binding assay using 125I-labeled hCG was performed in granulosa cells after 2 d of treatment with FSH or FSH plus STC1. As shown in Fig. 5B, STC1 treatment inhibited FSH induction of LH receptors by 50%. The hCG-induced cAMP responsiveness of granulosa cells was also tested after hormonal treatment. Granulosa cells treated with FSH or FSH plus STC1 for 2 d were washed before hCG treatment for 1 h. As shown in Fig. 5C, hCG stimulation of cAMP production was suppressed by 30% when cells were primed with FSH plus STC1 as compared with FSH pretreatment alone.
|
). Likewise, STC1 cotreatment suppressed FSH-induced steroidogenic acute regulatory protein (StAR) mRNA levels in granulosa cells by 26% (Fig. 6B). Also, STC1 cotreatment led to a small but significant (16%) suppression of the FSH induction of 3-ß-hydroxysteroid dehydrogenase (3-ßHSD) expression (Fig. 6C).
|
, STC1 mRNA levels were inhibited in a time-dependent manner after PMSG injection. The STC1 transcriptional levels were suppressed by 48 and 80% at 3 and 48 h after PMSG treatment, respectively. Subsequent treatment with hCG to induce ovulation led to a small but gradual increase in ovarian STC1 mRNA levels. We further analyzed STC1 expression in different ovarian compartments by isolating granulosa, theca, and luteal cells before and after gonadotropin treatments. As shown in Fig. 7B, STC1 transcript was mainly found in theca, but not granulosa, cells of early antral follicles. After PMSG treatment, theca cell STC1 transcript levels were decreased by 87% in preovulatory follicles. In the corpora lutea at 48 and 96 h after hCG treatment, STC1 mRNA levels remained low.
|
). Displacement tests showed no competition by human STC2, hCG, and PMSG, thus demonstrating the STC1 receptor specificity in granulosa cells (Fig. 8B). Because an earlier study reported binding of the STC1-alkaline phosphatase fusion protein to bovine luteal cells (18), we further assessed the binding of 125I-labeled STC1 to luteal membranes. Fractionated membranes were prepared from ovaries enriched with corpora lutea after treatment of immature rats with PMSG followed by hCG for 4 d. In addition, membranes also were obtained from immature rats treated with DES to stimulate multiple early antral follicles. As shown in Fig. 8C, both membrane preparations contained comparable levels of STC1 binding sites.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
We produced functional STC1 proteins in transfected 293T cells. The purified recombinant STC1 protein was shown to be a secreted dimer with monomers of 30 kDa, consistent with earlier findings using ovarian homogenates and cell lines (19, 20). Similar to our finding of N-glycosylated human STC1, earlier studies found human STC1 and native fish STC to be glycosylated (16, 21). Although a STC1 oligomer (big STC1) did derive from a large monomer of 45 kDa found in the conditioned media of cultured bovine theca/interstitial cells (22), this big STC1 appeared not to be glycosylated and its exact biochemical structure is unclear. The primary bioassay for both fish STC and human STC1 has been based on the inhibition of Ca2+ uptake through fish gills (16, 21). Although several alternative assays were designed for mammalian STC1 by measuring 45Ca and 32P fluxes in vitro using duodenal tissues in voltage-clamped Ussing chambers (13, 23) and by assessing the uptake of inorganic phosphate in a human neural crest-derived Paju cell line (23), these assays have not been widely adopted. In the present study, the effects of STC1 in primary cultures of granulosa cells provide a highly accessible bioassay for STC1.
The observed STC1 suppression of progesterone production is associated with decreases in gonadotropin-induced steroidogenic enzyme expression. STC1 cotreatment showed a pronounced suppression on FSH-induced transcripts for CYP11A, which is a rate-limiting enzyme in progesterone biosynthesis (24, 25, 26). Of interest, a theca/interstitial-derived big STC1 recently has been shown to inhibit hCG stimulation of progesterone biosynthesis by cultured bovine luteal cells (18). In addition to effects on ovarian function, STC1, when overexpressed, leads to defects in bone formation in transgenic mice (27, 28), whereas progesterone is known to play a role in the prevention of bone loss (29). Thus, the possible role of progesterone in mediating the STC1 regulation of osteogenesis will require further study.
Although the gonadotropin-induced cAMP/protein kinase A pathway is essential for progesterone biosynthesis, estradiol production, and LH receptor induction, STC1 cotreatment had a pronounced effect on progesterone biosynthesis and LH receptor formation but showed minimal suppression of cAMP and estradiol production. Studies using forskolin and 8-Br-cAMP further suggested that STC1 likely acts downstream of adenyl cyclase because STC1 did not affect forskolin-stimulated cAMP production but suppressed forskolin- and 8-Br-cAMP-stimulated progesterone biosynthesis. It is possible that STC1 acts on pathways downstream of cAMP that are specific for progesterone biosynthesis and LH receptor induction. Further studies may reveal whether STC1 acts on seven-transmembrane receptors or receptors not interacting with G proteins.
Our data showed prominent suppression of STC1 expression in the ovary within several hours of PMSG treatment in immature rats. These findings in immature rats are consistent with an earlier report showing ovarian STC1 expression in newborn mice and continuing high levels in prepubertal animals (15), suggesting that STC1 may have important roles during the early stages of folliculogenesis. Mammalian folliculogenesis starts from the endowment of primordial follicles (30). To date, only few paracrine factors have been characterized during early follicular stages. The expression of STC1 in newborn animals suggests a potential paracrine role for STC1 in early folliculogenesis. Of interest, transgenic mice overexpressing STC1 are subfertile as reflected by reduced litter sizes, and a possible defect in the ovulatory mechanism was suggested (28). However, no evaluation is available of their follicle pool size or ovarian histology. In future studies, it will be interesting to investigate folliculogenesis in STC1 null mice.
Unlike several ovarian factors such as GDF-9 found to suppress both estradiol and progesterone production induced by gonadotropins (4), STC1 only showed inhibition of gonadotropin-induced progesterone biosynthesis with no effect on estradiol production. Ovarian paracrine factors known to differentially inhibit progesterone biosynthesis without affecting estrogen production have been found in follicular fluid and postulated as luteinization inhibitors (31, 32). Thus, STC1, like several bone morphogenetic proteins (33) and endothelin-1 (34), may be a follicular luteinization inhibitor. The observed suppression of STC1 in thecal cells of mature follicles and in the corpora lutea suggests the ability of gonadotropins to decrease the production of this potential luteinization inhibitor. In addition, the suppressive effect of STC1 on the FSH induction of functional LH receptor expression further supports the hypothesized role of STC1 as a luteinization inhibitor.
Although STC1 actions have been tested in diverse tissues and cell types, few reports deal with the characteristics of the putative STC1 receptor. In liver and kidney, STC1 binding was tested using STC1-alkaline phosphatase fusion proteins and showed high affinity to the putative receptor. The STC1 binding sites in liver and kidney were restricted to hepatocytes and nephron cells, respectively. After fractionation, the highest binding in these tissues was located on the inner mitochondrial membrane (35). In contrast, ovarian STC1 binding was found using the same STC1 fusion protein as a probe in the cholesterol/lipid droplets of luteal cells (18). We used the 125I-labeled STC1 ligand for receptor-binding assays and found STC1 receptors in granulosa cells with high specificity and affinity (dissociation constant = 1.1 nM).
We further expressed a stanniocalcin-related protein, STC2, to test the specificity of STC1 receptors in granulosa cells. Human STC2 shares only 30% sequence identity to human STC1, but the key cysteine residues are conserved (36, 37, 38). Although the recombinant STC2 protein, like STC1, is dimeric in nature and capable of regulating progesterone biosynthesis (data not shown), STC2 did not displace 125I-labeled STC1 binding to granulosa cells. Thus, the action of these two paralogs is likely mediated through different receptors. Furthermore, our studies using rat ovarian membranes indicated comparable STC1 receptor content in ovaries containing mainly antral follicles and corpora lutea. However, our observed luteal STC1 receptor content in rat ovary was lower than an earlier study using STC1-alkaline phosphatase fusion protein as the ligand for bovine luteal membrane binding (18). It is unclear whether these discrepancies are the result of tissue preparation, species variation, or the use of fusion protein as the ligand. Nevertheless, our results indicate the existence of membrane-bound STC1 receptors, thereby validating future characterization of these proteins.
The primary function of STC in fish is to maintain calcium homeostasis, thus avoiding the threat of hypercalcemia. The discovery of STC1 expression in terrestrial vertebrates suggests that STC1 could play additional physiological functions. It has been shown that STC1 can stimulate phosphate reabsorption in both small intestine and proximal kidney tubules by modulating sodium-phosphate cotransporter expression (39, 40). Overexpression of STC1 in transgenic mice also demonstrated important roles for STC1 such as the regulation of body weight. In addition, STC1 could be involved in the regulation of mineral absorption during bone formation (27, 28). The present demonstration of STC1 receptors and biological actions in ovarian granulosa cells provides a model for the future understanding of STC1 receptors and their mechanisms of action in diverse tissues.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Reagents and Hormones
McCoy’s 5a medium (modified), L-15 Leibovitz medium, and DMEM-F12 were obtained from Gibco (Gaithersburg, MD). Recombinant human FSH was a gift from NV Organon (Oss, The Netherlands). Purified hCG (CR-129) was supplied by the National Hormone and Pituitary Program (National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD). PNGase F was obtained from New England Biolabs, Inc. (Beverly, MA). Androstenedione, BSA, 3-isobutyl-1-methylxanthine, forskolin, and 8-Br-cAMP were obtained from Sigma Chemical Co. (St. Louis, MO); L-glutamine, penicillin, and streptomycin were purchased from BioWhittaker (Walkersville, MD). Antisera against progesterone and estradiol were raised against progesterone-11-hemisuccinate-BSA and estradiol-17ß-O-carboxymethyl-BSA, respectively (4). Antibodies against cAMP were provided by the National Pituitary and Hormone Program (4).
Expression and Purification of Recombinant Human STC1 and STC2 Proteins
The full-length human STC1 and STC2 cDNAs were amplified by PCR from a human ovary cDNA library (CLONTECH, Palo Alto, CA) and cloned into the pUC18 vector (Invitrogen Life Technologies, Carlsbad, CA). After confirmation of DNA sequences by dideoxy DNA sequencing, the STC1 and STC2 cDNA were subcloned into the pcDNA3.1/Zeo (+) expression vector. The constructed plasmids were purified and transfected into human 293T cells using LipofectAMINE 2000 (Invitrogen Life Technologies). Forty-eight hours after transfection, transfectants were selected by Zeocin-containing medium. Selected cells were cultured to confluence and then incubated for 72 h in serum-free medium (DMEM/ Ham’s F12 media containing 100 µg/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamate). Conditioned media were harvested and filtered after collection. Purification of the recombinant proteins was done at 4 C. The STC1-containing medium was incubated with Concanavalin A-conjugated resins (Amersham Biosciences, Piscataway, NJ) that had been equilibrated in the wash buffer [125 mM NaCl, 20 mM Tris-HCl (pH 7.4)]. The unbound proteins were removed by washing the column with 20 gel volume of wash buffer. Recombinant proteins were eluted with the buffer containing 0.2 M methyl 
-D-glucopyranoside. Human STC2 was isolated using metal chelate chromatography (17). The purified recombinant human STC2 was found to be functional based on its ability to block FSH-stimulated progesterone production (data not shown). Measurement of protein content was performed using the Micro BCA protein assay kit (Pierce Biotechnology, Rockford, IL). Protein purity and characteristics were analyzed by running 12% SDS-PAGE. Western blotting was performed using specific human STC1 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
Preparation and Culture of Granulosa Cells
Granulosa cells were obtained from small antral follicles of DES-treated rats. Ovaries were punctured in L-15 Leibovitz medium. Ovarian debris, oocytes, and small follicles were removed, and the remaining medium containing granulosa cells was collected after low-speed centrifugation at 500 x g for 10 min. Granulosa cells were dispersed by repeated washing and resuspended into the culture medium (McCoy’s 5a supplemented with 10–7 M androstenedione, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin).
Assessment of Steroid and cAMP Production
Granulosa cells (2 x 105 viable cells/ml) from DES-treated rats were cultured in 24-well plates (Corning, Corning, NY) and treated with FSH, forskolin, or 8-Br-cAMP in the presence or absence of increasing concentrations of STC1. After culture, the conditioned media were collected and stored at –80 C until measurement of steroid and cAMP content. For mature granulosa cells, LH receptors were induced by culturing granulosa cells from DES-treated rats for 48 h in McCoy’s medium containing 10–7 M androstenedione and 10 ng/ml of FSH (42, 43). Cells were then washed once and recultured in McCoy’s medium containing 10–7 M androstenedione and graded concentrations of purified hCG in the presence or absence of 10 nM STC1 for another 48 h. Media were collected and stored at –80 C until measurement of steroid and cAMP content was performed. Medium progesterone, estradiol, and cAMP contents were determined using RIA (4).
LH/hCG Receptor Measurement
Highly purified hCG supplied from the National Hormone and Pituitary Program was iodinated in the presence of IODO-BEADs (Pierce Biotechnology) using a modified method developed by Markwell (44). The specific activity and maximum binding capacity of the tracer were approximately 50,000 cpm/ng and 60%, respectively, as determined by radioligand receptor assay (45).
Granulosa cells (2 x105 viable cells/500 µl) were cultured in 5 ml polypropylene Falcon tubes (Becton Dickinson, Franklin Lakes, NJ) with 10 ng/ml FSH in the presence or absence of 10 nM STC1. Cells were maintained at 37 C under 5% CO2 in air. After 48 h of culture, granulosa cells were centrifuged for 30 min at 4 C. The supernatant was decanted, and culture media were replaced with PBS/0.1% BSA containing a saturating dose of 125I-hCG (4 ng/tube) in the absence or presence of excess unlabeled hCG (10 IU hCG/tube). After 18 h incubation at room temperature, cells were washed by ice-cold PBS/0.1% BSA before centrifugation. The radioactivity of the final pellet was determined using a 
-spectrometer. After correction for nonspecific binding, the amount of specifically bound hCG was determined.
Quantitative Real-Time PCR
For assessing the gonadotropin regulation of STC1 mRNA expression, ovaries were collected for total RNA extraction after gonadotropin treatment of immature rats. RNA was extracted from the whole ovary or from isolated follicular compartments and corpora lutea. Individual follicles were punctured to obtain granulosa cells under the Hoffman modulation contrast microscopy (Nikon Inc., Tokyo, Japan), followed by cutting open the follicles and scrapping the remaining granulosa cells from the theca shell. Individual corpus luteum was also isolated after hCG treatment. The purity of granulosa and theca cells was confirmed based on the differential expression of FSH and LH receptor transcripts determined by real-time PCR (relative mRNA levels normalized by ß-actin: granulosa cells before PMSG—FSH receptor, 0.0029; LH receptor, 0.0022; theca cells before PMSG—FSH receptor, 0.0017; LH receptor:, 0.0093; granulosa cells after PMSG—FSH receptor, 0.0046; LH receptor, 0.0359; theca cells after PMSG—FSH receptor, 0.0010; LH receptor, 0.0403).
To study STC1 regulation of granulosa cell genes, cells (2 x 105 cells/ml) from DES-treated animals were incubated with 10 ng/ml FSH in the presence or absence of 10 nM STC1 for different intervals. Cells were washed and collected for subsequent total RNA extraction. RNA was extracted using an RNeasy Mini Kit (QIAGEN Sciences, Valencia, CA). Total RNA (2 µg) from each sample was reverse transcribed for subsequent PCR analysis. After reverse transcription, real-time PCR was performed in 25 µl final volume containing 2 µl of the resulting RT reaction product, 0.5 µM primers, 0.2 µM fluorescently labeled probe (3': 5'-carboxy tetramethylrhodamine; 5': 6'-carboxy fluorescein), and PCR reagent mixtures (QuantiTect Probe PCR Kit, QIAGEN Sciences). Standard curves were generated by serial dilution of each plasmid DNA. The primer pairs and fluorescent probes used were as follows: STC1 forward, ACTGCTACAGCAAGCTCAATGTT; STC1 reverse, GCTTCGGACAAGTCTGTTGTAGTAT; STC1 probe, CCGGAAGCCATCACTGAAGTCATAC. LH receptor forward, ATGGCCATCCTCATCTTCA-CA; LH receptor reverse, TGGCACAAGAATTGACAGGA; LH receptor probe, TTGCCATCTCGGCTGCCTTCAA. CYP11A forward, CCAA-GTTCAACCTCATCCTGA; CYP11A reverse, CGTGTGACTGCAGCCTGCAA; CYP11A probe, TCTTCAACTTCCAGCCT-CTCAAGCA. StAR forward, AGATGAAGTGCTAAGTAAGG-TGGTG; StAR reverse, CCAGTTCTTCATAGAGTCTGTCCAT; StAR probe, TCTAGCAGCACCTCCAGTCGGAACA. 3-ßHSD forward, AGACCATCCTAGATGTCAA-TCTGAA; 3-ßHSD reverse, CAGGATGATCTTCTTGTAGGA-GT; 3-ßHSD probe, TCTACTGCAGCACAGTTGACGTTGC. ß-Actin forward, TC-TGTGTGGATTGGTGGCTCTA; ß-actin reverse, CTGCTTGCTGATCCACATCTG; ß-actin probe, CCTGGCCTCACTGTCCACCTTCC. FSH receptor forward, GTGGTCATCTGT-GGCTGCTA; FSH receptor reverse, TCTTGGTGCGCTTG-ATGAG-3'; FSH receptor probe, CCACATCTACCTCACA-GTGAGGAATCC.
Receptor Binding Assay
Purified STC1 was iodinated using the method described for LH/hCG labeling. Receptor binding assays were conducted using granulosa cells obtained from DES-treated rats or ovarian plasma membrane fractions. For granulosa cell binding, cells (106 cells/tube) were incubated in PBS/0.1% BSA with 125I-STC1 at room temperature for 6 h. Cells were washed twice and the amount of bound radioactivity was determined using a -spectrometer. Displacement experiments were performed by adding different hormones together with 125I-STC1 during incubation. For ovarian membrane binding, partially purified ovarian membranes were prepared from rats after DES treatment at 22 d of age for 3 d or from rats treated with PMSG at 26 d of age for 2 d followed by hCG injection for 4 d. Ovaries were collected and minced in the assay buffer (1x TBS supplemented with protease inhibitor cocktail, Roche Diagnostics, Mannheim, Germany). The homogenate was centrifuged at 500 x g for 15 min to remove nuclei and tissue debris. The supernatant containing plasma membranes was centrifuged at 20,000 x g for 30 min and washed with the assay buffer. The protein concentration was measured using a Micro BCA protein assay kit (Pierce Biotechnology). Crude membranes (200 µg/tube) were incubated in the assay buffer containing 0.1% BSA and a saturating dose of 125I-STC1 (3 nM) at room temperature for 6 h. Membranes were centrifuged for 3 min at 20,000 x g and washed twice before counting. For all reactions, nonspecific binding was subtracted based on the competition with 1 µM unlabeled STC1.
Data Analysis
All experimental data are presented as the mean ± SE of triplicate measurements of triplicate cultures. Statistical significance was determined by ANOVA for multiple group comparisons. Significance was accepted at P < 0.05.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Abbreviations: 8-Br-cAMP, 8-Bromo-cAMP; DES, diethylstilbestrol; hCG, human chorionic gonadotropin; PNGase F, peptide N-glycosidase F; PMSG, pregnant mare serum gonadotropin; STC, stanniocalcin; StAR, steroidogenic acute regulatory protein; 3-ßHSD, 3-ß-hydroxysteroid dehydrogenase.
Received for publication February 13, 2004. Accepted for publication April 26, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
cells. Horm Metab Res 31:406–414[Medline]
This article has been cited by other articles:
 |
|
 |
|
  S. Raulic, Y. Ramos-Valdes, and G. E DiMattia Stanniocalcin 2 expression is regulated by hormone signalling and negatively affects breast cancer cell viability in vitro J. Endocrinol., June 1, 2008; 197(3): 517 - 529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Zhao, A. De, Z. Hu, J. Li, S. M. Mulders, M. D. Sollewijn Gelpke, E.-K. Duan, and A. J. W. Hsueh Gonadotropin Stimulation of Ovarian Fractalkine Expression and Fractalkine Augmentation of Progesterone Biosynthesis by Luteinizing Granulosa Cells Endocrinology, June 1, 2008; 149(6): 2782 - 2789. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Dole, E. E Nilsson, and M. K Skinner Glial-derived neurotrophic factor promotes ovarian primordial follicle development and cell-cell interactions during folliculogenesis Reproduction, May 1, 2008; 135(5): 671 - 682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J Johnson, J. B Hensley, M. D Kelso, D. G Wallace, and K. W Gaido Mapping Gene Expression Changes in the Fetal Rat Testis Following Acute Dibutyl Phthalate Exposure Defines a Complex Temporal Cascade of Responding Cell Types Biol Reprod, December 1, 2007; 77(6): 978 - 989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-H. Hsu and C.-W. Luo Molecular dissection of G protein preference using Gs{alpha} chimeras reveals novel ligand signaling of GPCRs Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1021 - E1029. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. Gaido, J. B. Hensley, D. Liu, D. G. Wallace, S. Borghoff, K. J. Johnson, S. J. Hall, and K. Boekelheide Fetal Mouse Phthalate Exposure Shows that Gonocyte Multinucleation is Not Associated with Decreased Testicular Testosterone Toxicol. Sci., June 1, 2007; 97(2): 491 - 503. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Chakraborty, H. Brooks, P. Zhang, W. Smith, M. R. McReynolds, J. B. Hoying, R. Bick, L. Truong, B. Poindexter, H. Lan, et al. Stanniocalcin-1 regulates endothelial gene expression and modulates transendothelial migration of leukocytes Am J Physiol Renal Physiol, February 1, 2007; 292(2): F895 - F904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. De, J.-I. Park, K. Kawamura, R. Chen, C. Klein, R. Rauch, S. M. Mulders, M. D. Sollewijn Gelpke, and A. J. W. Hsueh Intraovarian Tumor Necrosis Factor-Related Weak Inducer of Apoptosis/Fibroblast Growth Factor-Inducible-14 Ligand-Receptor System Limits Ovarian Preovulatory Follicles from Excessive Luteinization Mol. Endocrinol., October 1, 2006; 20(10): 2528 - 2538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Song, F. W. Bazer, G. F. Wagner, and T. E. Spencer Stanniocalcin (STC) in the Endometrial Glands of the Ovine Uterus: Regulation by Progesterone and Placental Hormones Biol Reprod, May 1, 2006; 74(5): 913 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-W. Luo, E. M. Dewey, S. Sudo, J. Ewer, S. Y. Hsu, H.-W. Honegger, and A. J. W. Hsueh Bursicon, the insect cuticle-hardening hormone, is a heterodimeric cystine knot protein that activates G protein-coupled receptor LGR2 PNAS, February 22, 2005; 102(8): 2820 - 2825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-W. Luo, M. D. Pisarska, and A. J. W. Hsueh Identification of a Stanniocalcin Paralog, Stanniocalcin-2, in Fish and the Paracrine Actions of Stanniocalcin-2 in the Mammalian Ovary Endocrinology, January 1, 2005; 146(1): 469 - 476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Gagliardi, E. Y. W. Kuo, S. Raulic, G. F. Wagner, and G. E. DiMattia Human stanniocalcin-2 exhibits potent growth-suppressive properties in transgenic mice independently of growth hormone and IGFs Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E92 - E105. [Abstract] [Full Text] [PDF]
|
|
| |||||||||
) or with 10 nM STC1 (
). Medium concentrations of progesterone (A), estradiol (B), and cAMP (C) were determined. Some cells were treated with graded doses of forskolin without or with 10 nM STC1 for 30 min before determination of media cAMP concentration (D). In addition, some cells were treated with forskolin (E) or 8-Br-cAMP (F) with or without 10 nM STC1 for 2 d before determination of media progesterone levels. Data points represent the mean ± SE (n = 3). Asterisk indicates significant difference from control (ANOVA, P < 0.05).
), 1 µM unlabeled STC1 was added. B, Hormonal specificity. Different hormones (human STC1, hCG, PMSG, and human STC2) were used to compete for 125I-STC1 (1 nM) binding to granulosa cells. C, Binding of STC1 to ovarian plasma membrane preparations. Partially purified plasma membranes were prepared from immature rats after DES treatment to stimulate multiple early antral follicles or from immature rats treated with PMSG followed by hCG for 4 d to induce corpus luteum formation. Nonspecific binding in the presence of 1 µM unlabeled STC1 was subtracted from total binding to derive specific binding shown. Data were presented as mean ± SE (n = 3).