help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0463
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/9/2279    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mosley, A. L.
Right arrow Articles by Özcan, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mosley, A. L.
Right arrow Articles by Özcan, S.
Molecular Endocrinology 18 (9): 2279-2290
Copyright © 2004 by The Endocrine Society

Glucose Regulation of Insulin Gene Expression Requires the Recruitment of p300 by the ß-Cell-Specific Transcription Factor Pdx-1

Amber L. Mosley, John A. Corbett and Sabire Özcan

Department of Molecular & Cellular Biochemistry (A.L.M., S.Ö.), Chandler Medical Center, University of Kentucky, Lexington, Kentucky 40536; Edward A. Doisy Department of Biochemistry and Molecular Biology (J.A.C.), Saint Louis University, School of Medicine, St. Louis, Missouri 63104

Address all correspondence and requests for reprints to: Dr. Sabire Özcan, Department of Molecular & Cellular Biochemistry, University of Kentucky, College of Medicine, 800 Rose Street, MN608, Lexington, Kentucky 40536. E-mail: sozcan{at}uky.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Regulation of insulin gene expression in response to increases in blood glucose levels is essential for maintaining normal glucose homeostasis; however, the exact mechanisms by which glucose stimulates insulin gene transcription are not known. We have shown previously that glucose stimulates insulin gene expression by causing the hyperacetylation of histone H4 at the insulin promoter. We demonstrate that the histone acetyltransferase p300 is recruited to the insulin promoter only at high concentrations of glucose via its interaction with the ß-cell-specific transcription factor Pdx-1. Disruption of the function of the endogenous Pdx-1 abolishes the recruitment of p300 to the insulin gene promoter at high concentrations of glucose and results in decreased histone H4 acetylation and insulin gene expression. Furthermore, we demonstrate that the glucose-dependent interaction of Pdx-1 with p300 is regulated by a phosphorylation event that changes the localization of Pdx-1. Based on these data, we conclude that hyperacetylation of histone H4 at the insulin gene promoter in response to high concentrations of glucose depends on the ß-cell-specific transcription factor Pdx-1, which is required for the recruitment of the histone acetyltransferase p300 to the insulin gene promoter.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
INSULIN GENE TRANSCRIPTION in the ß-cells of the pancreas is up-regulated by increases in blood glucose levels. ß-Cell-specific expression and glucose stimulation of the human insulin gene in the pancreas are mediated by upstream sequences within the region –90 to –340 relative to the transcription start site (1, 2, 3, 4). Several transcription factors such as Pdx-1 and MafA (Ripe3b1) have been implicated in glucose regulation of insulin gene expression; however, the exact mechanism(s) by which these transcription factors stimulate insulin gene expression is unknown.

Deletion analysis of the insulin gene promoter indicated that the A3 element, to which Pdx-1 binds, is essential for glucose regulation of insulin gene expression (5, 6, 7). This indicates that Pdx-1 plays a major role in glucose regulation of insulin gene transcription. Pdx-1, a ß-cell-specific homeodomain transcription factor (7, 8, 9, 10, 11, 12), is also essential for pancreas development (13, 14). Homozygous Pdx-1 knockout mice fail to develop a pancreas, whereas heterozygous Pdx-1 mice survive and have a normal pancreas but become glucose intolerant and display impaired insulin production (13, 14, 15). Pdx-1 has been implicated in the glucose regulation of insulin gene transcription in a number of different systems. Psammomys obesus, a rodent model of type II diabetes (16), has 80–90% lower insulin content due to defects in glucose-stimulated insulin gene transcription (17, 18). This decrease in insulin levels in response to glucose appears to be caused by the absence of Pdx-1, whereas a number of other regulators of the insulin gene, including MafA (Ripe3b1), are not affected (18). The NES2Y cell line was isolated from patients with persistent hyperinsulinemic hypoglycemia of infancy (19). These cells lack Pdx-1, and although they express the insulin gene, they fail to up-regulate insulin gene transcription in response to high glucose levels (20). It has also been shown that decreases in Pdx-1 levels in mice using antisense RNA lead to decreased insulin gene transcription (21). In addition to the insulin gene, Pdx-1 has also been implicated in regulation of Glut2, glucokinase, islet amyloid polypeptide, and somatostatin gene expression (11, 12, 22, 23, 24, 25).

Histone acetylation has been shown to play an important role in regulated gene expression, and increases in histone acetylation correlate with increased gene expression (reviewed in Ref. 26). The steady-state level of histone acetylation is maintained by the coordinate action of histone acetyltransferases and histone deacetylases, which mediate activation and repression of gene expression, respectively (26). We have demonstrated recently that glucose regulation of insulin gene expression involves hyperacetylation of histone H4 at the insulin gene promoter. Whereas histone H4 acetylation levels at the insulin promoter are low in the presence of low concentrations of glucose, the histone H4 acetylation levels increase by about 5-fold in response to high concentrations of glucose (27). The ß-cell-specific transcription factor Pdx-1 and the histone acetyltransferase p300 have been shown previously to interact with each other in vivo and in vitro (28). Because this interaction appears to be required for insulin gene transcription (28, 29), in this study we tested whether Pdx-1 and p300 are important for hyperacetylation of histone H4 at the insulin gene promoter in response to glucose.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Glucose Mediates Hyperacetylation of Histone H4 at the Insulin Gene Promoter in Isolated Rat Islets
We have shown previously that high concentrations of glucose lead to hyperacetylation of histone H4 at the insulin gene promoter in the mouse insulinoma (MIN6) cell line, which correlated with increased insulin gene expression (27). To confirm the data obtained using the MIN6 cell line, we have performed the chromatin immunoprecipitation (ChIP) assay using isolated rat islets with antiacetyl histone H3 or H4 antibodies. For this purpose, isolated rat islets were preincubated with 3 mM glucose for 90 min and transferred to 3 or 20 mM glucose for 2 h. As in MIN6 cells, exposure of isolated rat islets to high concentrations of glucose led to about 5-fold increase in histone H4 acetylation, whereas the level of acetylated histone H3 did not significantly change (Fig. 1Go). This is consistent with previous data obtained from MIN6 cells indicating that glucose induces insulin gene transcription by causing hyperacetylation of histone H4 (27).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Glucose Causes Hyperacetylation of Histone H4 at the Insulin Gene Promoter in Isolated Rat Islets

The histone acetylation levels associated with the rat insulin I gene promoter were analyzed in isolated rat islets incubated with 3 or 20 mM glucose for 2 h using the ChIP assay with antiacetyl histone H3 or H4 antibodies. Rabbit IgG was used as negative control (panel A). The quantification of the data is shown as means ± SD, n = 3 (panel B).

 
The Histone Acetyltransferase p300 Is Recruited to the Insulin Gene Promoter in a Glucose-Dependent Manner
Because the histone acetyltransferase p300 has previously been implicated in the regulation of the insulin gene (28, 29), we tested the possibility that p300 was involved in the hyperacetylation of histone H4 in response to glucose. To test this idea, we analyzed the recruitment of p300 to the insulin gene promoter in MIN6 cells incubated with low (3 mM) or high (30 mM) glucose for 2 h by using the ChIP assay with antibodies against p300, which do not cross-react with cAMP response element-binding protein (CREB)-binding protein (CBP) (Fig. 2AGo). We found that the histone acetyltransferase p300 was associated with the insulin gene promoter only in the presence of high concentrations of glucose (Fig. 2AGo). Analysis of the same immunoprecipitated and total DNA with primers against the pklr [L-type pyruvate kinase (30)] promoter, which is always acetylated in a glucose-independent manner (data not shown), indicated that p300 was recruited to the pklr promoter independent of the concentration of glucose (Fig. 2AGo). In addition, we confirmed the recruitment of the histone acetyltransferase p300 to the insulin gene promoter at high concentrations of glucose (20 mM) in isolated rat islets (Fig. 2BGo). These data demonstrate that the histone acetyltransferase p300 is recruited to the insulin gene promoter only at high concentrations of glucose.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. The Histone Acetyltransferase p300 Is Recruited to the Insulin Gene Promoter Only in Response to High Concentrations of Glucose

A, The association of the histone acetyltransferase p300 with the mouse insulin I or pklr (L-type pruvate kinase) promoter as control was analyzed by ChIP assay in MIN6 cells incubated with 3 or 30 mM glucose. B, Analysis of p300 recruitment to the rat insulin I promoter in isolated rat islets incubated with 3 or 20 mM glucose.

 
Glucose Regulation of Histone H4 Acetylation at the Insulin Gene Promoter Requires the ß-Cell-Specific Transcription Factor Pdx-1
Previous data indicate that the transcription factor Pdx-1, which is required for glucose regulation of insulin gene expression, is able to interact with the histone acetyltransferase p300 (28). Therefore, we tested whether Pdx-1 plays a role in glucose-mediated hyperacetylation of histone H4 at the insulin gene promoter. For this purpose, MIN6 cells were infected with an adenovirus expressing a dominant negative form of Pdx-1 (Ad-Pdx-1{Delta}1–79), which is able to bind to the insulin gene promoter but is unable to stimulate transcription. This dominant negative Pdx-1 lacks the first 79 amino-terminal amino acids containing the transactivation domain (Fig. 3AGo). The Pdx-1{Delta}1–79 construct was tagged with a triple myc epitope and expressed from the CMV promoter using the pAdTrackCMV vector (31). The expression of this truncated version of Pdx-1 was confirmed by immunoblotting of cell extracts of MIN6 cells infected with Pdx-1{Delta}1–79 adenovirus using myc antibodies (Fig. 3AGo). The dominant negative Pdx-1 protein was able to compete with the endogenous Pdx-1 for binding to the insulin gene promoter. In MIN6 cells expressing the dominant negative Pdx-1, binding of the endogenous Pdx-1 to the insulin gene promoter was completely abolished as demonstrated by ChIP assay with Pdx-1 antibodies that recognize the amino terminus of Pdx-1 that is deleted in Ad-Pdx-1{Delta}1–79 (Fig. 3BGo). ChIP assay analysis of the binding of the dominant negative protein to the insulin gene promoter using myc antibodies (which only detects the Pdx-1{Delta}1–79), indicates that this protein is able to bind on both low and high concentrations of glucose similar to wild-type Pdx-1 (Fig. 3CGo). Consistent with previous data (32), we found that expression of Pdx-1{Delta}1–79 caused a drastic reduction in endogenous Pdx-1 levels by immunoblotting with antibodies specific for the Pdx-1 N terminus (data not shown). Thus, the Pdx-1{Delta}1–79 protein disrupts the function of the endogenous Pdx-1 by reducing its expression level and by competing for binding to the insulin gene promoter.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Pdx-1{Delta}1–79 Competes with Endogenous Pdx-1 for Binding to the Insulin Gene Promoter

Panel A shows the expression of the Pdx-1{Delta}1–79 construct. MIN6 cells infected with GFP control or Pdx-1{Delta}1–79 adenovirus were incubated with 3 or 30 mM glucose and used for ChIP assays with either Pdx-1 amino-terminal (panel B) or myc (panel C) antibodies that recognize only endogenous or Pdx-1{Delta}1–79 protein, respectively. The immunoprecipitated and total DNA were used as templates to amplify the mouse insulin I gene promoter. MW, Molecular mass marker in kilodaltons.

 
To test the effects of the dominant negative Pdx-1 protein on histone acetylation at the insulin gene promoter, MIN6 cells infected with Ad Pdx1-{Delta}1–79 or a green fluorescent protein (GFP) control virus (original vector expressing GFP only) were incubated with low (3 mM) or high (30 mM) glucose for 2 h and then used for ChIP assays with antiacetyl histone H4 antibodies. Comparison of MIN6 cells infected with the control GFP vs. the Ad-Pdx-1{Delta}1–79 virus show that the level of histone H4 acetylation in MIN6 cells overexpressing the dominant negative form of Pdx-1 is diminished at high concentrations of glucose (Fig. 4AGo). Despite the decrease in histone H4 acetylation, as observed in MIN6 cells infected with Ad-Pdx-1{Delta}1–79, the histone H4 acetylation level was still higher than on cells grown on low glucose. This is likely due to the fact that only about 80–85% of the cells were infected and the remaining 15–20% that do not express the dominant negative Pdx-1 protein still display normal hyperacetylation of histone H4 in response to high concentrations of glucose. Statistical analysis of the data obtained from three independent experiments indicates that overexpression of the dominant negative protein Pdx-1{Delta}1–79 causes a significant decrease in histone H4 acetylation (Fig. 4BGo).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. The Dominant Negative Pdx-1{Delta}1–79 Inhibits the Hyperacetylation of Histone H4 and Stimulation of Insulin Gene Expression in Response to High Glucose

A, Quantification of histone H4 acetylation levels at the mouse insulin I gene promoter in MIN6 cells expressing GFP or Pdx-1{Delta}1–79 incubated with 3 or 30 mM glucose using the ChIP assay. Data from three independent experiments are shown (panel B); *, P < 0.01 vs. 30 mM glucose-incubated MIN6 cells infected with GFP (n = 3). C, The level of insulin or ß-actin gene expression in GFP or Pdx-1{Delta}1–79 expressing MIN6 cells was analyzed by RT-PCR. The quantification of two independent RT-PCR experiments is displayed as means ± SD, n =2 (panel D). The analysis of p300 recruitment to the insulin gene promoter was determined using the ChIP assay with p300 antibodies (panel E, n = 3).

 
To verify that decreased histone H4 acetylation due to overexpression of the dominant negative Pdx-1 leads to decreases in insulin gene transcription, the level of insulin mRNA in MIN6 cells, incubated with 3 or 30 mM glucose and infected with GFP or pAd-Pdx-1{Delta}1–79 virus, was analyzed using RT-PCR. As shown in Fig. 4CGo, expression of Pdx-1{Delta}1–79 results in down-regulation of insulin gene expression, which correlates with the observed decrease in histone H4 acetylation at the insulin gene promoter (Fig. 4Go, C and D).

It has been shown previously that the interaction of Pdx-1 with p300 requires the activation domain of Pdx-1 (28). To test the recruitment of p300 to the insulin promoter in MIN6 cells overexpressing Pdx-1{Delta}1–79, the cells were incubated with low or high concentrations of glucose for 2 h and subjected to ChIP assay using p300 antibodies for immunoprecipitation. Consistent with previous data, in MIN6 cells expressing the GFP virus as control, p300 was recruited to the insulin gene promoter only at high concentrations of glucose, whereas MIN6 cells infected with the Pdx-1{Delta}1–79 virus did not show recruitment of p300 to the insulin gene promoter (Fig. 4EGo). Recruitment of p300 to the pklr promoter used as control was not affected by the Pdx-1{Delta}1–79 construct, because pklr is not regulated by Pdx-1. These data indicate that a functional Pdx-1 protein is required to mediate the glucose-regulated hyperacetylation of histone H4 at the insulin gene promoter and for the recruitment of p300 in a glucose-dependent manner.

Pdx-1 Interacts with the Histone Acetyltransferase p300 in a Glucose-Dependent Manner In vivo
Our data indicate that p300 is recruited to the insulin gene promoter in MIN6 cells and isolated rat islets only at high concentrations of glucose (Fig. 2Go) and that a functional Pdx-1 protein is required for the recruitment of p300 (Fig. 4Go). Furthermore, previous data indicate that Pdx-1 is able to interact with p300 in vivo as well as in vitro (28). To test whether the interaction of Pdx-1 with p300 occurs in a glucose-regulated manner, MIN6 cell extracts of 3 or 30 mM glucose-incubated cells were used for coimmunoprecipitation experiments with either Pdx-1 or p300 antibodies (Fig. 5Go). The immunoprecipitation experiment was also carried out with rabbit IgG as control. We found that the histone acetyltransferase p300 coimmunoprecipitates with Pdx-1 and that the interaction of Pdx-1 with p300 is increased on high concentrations of glucose (Fig. 5AGo). Similar data were obtained by using p300 antibodies for immunoprecipitation (Fig. 5CGo). These data show that the interaction of Pdx-1 with p300 is stronger in the presence of high concentrations of glucose.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. Pdx-1 Interacts with p300 in a Glucose-Dependent Manner

Extracts from MIN6 cells incubated with 3 or 30 mM glucose were used to immunoprecipitate Pdx-1 or p300. The obtained precipitates were immunoblotted with either p300 (panels A and D) or Pdx-1 antibodies (panels B and C), respectively. The amount of Pdx-1 (panel B) or p300 (panel D) immunoprecipitated from low and high glucose extracts was roughly equal. Rabbit IgG was used as a negative control for immunoprecipitation. Hc, Heavy chain. Similar data were obtained in two independent experiments (n = 2).

 
The Interaction of Pdx-1 with p300 Occurs Constitutively in MIN6 Cells Treated with Okadaic Acid
To determine whether a phosphorylation event is involved in the glucose-regulated interaction between Pdx-1 and p300, we have treated MIN6 cells with the protein phosphatase inhibitor okadaic acid. MIN6 cells were grown overnight on high glucose media without serum and then switched to media containing 3 mM glucose with or without 0.1 µM okadaic acid, or 30 mM glucose for 5 h. After preparation of cell extracts, coimmunoprecipitation experiments were performed using p300 antibodies or rabbit IgG as control. The obtained immunoprecipitates were separated by 10% SDS-PAGE and used for immunoblotting with Pdx-1 antibodies (Fig. 6AGo). We found that the histone acetylase p300 coimmunoprecipitates with Pdx-1 in the presence of high glucose concentrations as well as under low glucose (3 mM) condition when cells are treated with okadaic acid (Fig. 6AGo). This suggests that a dephosphorylation event on low glucose prevents the interaction of Pdx-1 with p300.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6. Treatment with Okadaic Acid Blocks the Localization of Pdx-1 to Nuclear Periphery and Enhances the Interaction of Pdx-1 with p300 under Low-Glucose Conditions

A, MIN6 cells were incubated overnight with 30 mM glucose media and then switched to media containing 3 mM glucose with or without 0.1 µM okadaic acid, or 30 mM glucose as indicated. Extracts were prepared and used for immunoprecipitation of p300. The p300 immunoprecipitates were used for immunoblotting with Pdx-1 or p300 antibodies. Rabbit IgG was used as a negative control for immunoprecipitation. The fold increase was obtained by quantifying the Pdx-1 bands using the Image Station 2000R (Eastman Kodak, Rochester, NY) and by normalizing to the amount of immunoprecipitated p300. Similar data were obtained in four independent experiments (n = 4), and the fold increase is the average of four independent experiments with a SD less than 20%. B, Analysis of Pdx-1 and p300 subcellular localization on low- or high-glucose-incubated MIN6 cells, using confocal microscopy. MIN6 cells were incubated with 3 mM glucose in the presence or absence of 0.1 µM okadaic acid (OA) or with 30 mM glucose and then fixed in ice-cold methanol (34 ). Immunohistochemical analysis was performed by using primary antibodies against Pdx-1 (anti-Pdx-1) or p300 (anti-p300). Pdx-1 and p300 were visualized with antirabbit Alexa Fluor 488 secondary antibodies (green). Nuclei were stained with 4',6-diamidino-2-phenylindole (blue).

 
Consistent with previous data, immunohistochemical analysis of the localization of Pdx-1 indicates that a major portion of Pdx-1 localizes to nuclear periphery in cells incubated with low glucose, whereas p300 remains localized throughout the nucleus (Fig. 6BGo). On high glucose both Pdx-1 and p300 are localized to the nucleoplasm (Fig. 6BGo). The localization of Pdx-1 to nuclear periphery under low glucose conditions is blocked by treatment with okadaic acid (Fig. 6BGo). These data indicate that the localization of Pdx-1 correlates with its ability to interact with p300. The interaction of Pdx-1 with p300 on low glucose is weak, and a portion of Pdx-1 is localized to nuclear periphery; however, disruption of this localization by treatment with okadaic acid allows Pdx-1 to interact with p300 even on low glucose (Fig. 6Go).

The Temporal Recruitment of the Histone Acetyltransferase p300 Correlates with the Hyperacetylation Histone H4 and Insulin Gene Transcription
To determine the temporal pattern of histone H4 acetylation, the recruitment of p300, and induction of insulin gene transcription, MIN6 cells were first incubated for 16 h on low glucose and then switched to high (30 mM) glucose. The cells were harvested at the indicated time points and used for ChIP assays and RT-PCR. We found that histone H4 acetylation levels at the insulin promoter increase within 30 min of exposure of MIN6 cells to high concentrations of glucose (Fig. 7AGo). The antibody used in our studies recognizes tri- or tetraacetylated histone H4, which can be acetylated at lysine residues K5, K8, K12, and K16. To determine whether specific lysine residues are acetylated in response to glucose, we used antibodies generated against single acetyl residues in histone H4, using the same conditions as described above (Fig. 7BGo). We found that glucose causes hyperacetylation of histone H4 lysine 5, 8, and 12 within 30 min, whereas acetylation of lysine 16 was observed after 1 h exposure to high glucose (Fig. 7BGo). This indicates that the acetylation of the histone H4 single-lysine residues is regulated in time-dependent manner. Analysis of the recruitment of the histone acetyltransferase p300 by ChIP assay (Fig. 7AGo) indicates that it is rapidly recruited to the insulin gene promoter in response to high concentrations of glucose. The increase in p300 recruitment correlates with the rapid acetylation of histone H4 K5, K8, and K12. Increases in insulin mRNA levels follow the hyperacetylation of histone H4 and the recruitment of p300 after exposure to high glucose with maximal expression around 6–8 h.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7. Temporal Analysis of Histone H4 Acetylation Correlates with the Recruitment of the Histone Acetyltransferase p300 to the Insulin Gene Promoter

MIN6 cells were incubated overnight with 3 mM glucose and then shifted to 30 mM glucose. Cells were collected at the indicated time intervals and used for either ChIP assays with the indicated antibodies or for RT-PCR analysis of insulin and ß-actin mRNA levels. The ChIP assay analysis of the temporal recruitment of p300 is compared with histone H4 acetylation and insulin (Ins) and ß-actin (Act) mRNA levels (panel A). The time course of the acetylation of the single-acetyl residues of histone H4 is shown in panel B.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
High blood glucose levels stimulate insulin gene expression in the ß-cells of the pancreas. Although several transcription factors have been implicated in glucose-induced transcription of the insulin gene, the exact molecular mechanisms leading to up-regulation of insulin gene expression are unknown. We have discovered recently that glucose stimulates insulin gene transcription by causing the hyperacetylation of histone H4 at the insulin promoter (27). Because previous data indicate that the transcription factor Pdx-1, a major regulator of insulin gene expression, interacts with the histone acetyltransferase p300 (28), we investigated whether Pdx-1 and p300 are required for hyperacetylation of histone H4 in response to glucose. We demonstrate that the histone acetyltransferase p300 is recruited to the insulin gene promoter only at high concentrations of glucose in both MIN6 cells and isolated rat islets and that this recruitment requires a functional Pdx-1 protein. Furthermore, the temporal pattern of the recruitment of the histone acetyltransferase p300 to the insulin gene promoter correlates with the hyperacetylation of histone H4 and induction of insulin gene transcription.

The recruitment of p300 to the insulin gene promoter and its interaction with the transcription factor Pdx-1 are regulated by glucose and occur mainly at high concentrations of glucose. The regulation of the interaction of Pdx-1 with p300 by glucose appears to involve a phosphorylation event, because inhibition of protein phosphatases by treatment with okadaic acid enhances Pdx-1 interaction with p300 even under low glucose conditions. It has been previously shown that Pdx-1 changes its subcellular localization in response to glucose (33, 34). In the presence of low glucose, Pdx-1 is localized to the nuclear periphery, and it translocates to the nucleoplasm in response to high concentrations of glucose. Treatment of MIN6 cells with okadaic acid blocks the localization of Pdx-1 to nuclear periphery on low glucose (Ref. 34 and Fig. 6BGo) and enhances the interaction of Pdx-1 with p300 (Fig. 6AGo). Based on these data, we propose that at high concentrations of glucose, a phosphorylation event causes the localization of Pdx-1 to the nucleoplasm, which enables its interaction with p300. On low glucose, a dephosphorylation event causes a major portion of Pdx-1 to localize to nuclear periphery where it is unable to interact with p300.

A recent report indicates that Pdx-1 interacts with importin ß 1, which appears to regulate the localization of Pdx-1 (35). However, the regulation of this interaction by glucose has not been investigated. Interestingly, it has been demonstrated that the activation domain of Pdx-1 localizes to nuclear periphery, probably due to its interaction with an unknown retention or anchoring protein (35). Because the activation domain of Pdx-1 is sufficient for its interaction with p300 (28), the interaction of the activation domain with a membrane-anchoring protein on low glucose would make this domain inaccessible for interaction with p300. On high glucose, the interaction of the activation domain with the membrane-anchoring protein would be interrupted due to a phosphorylation event, causing the translocation of Pdx-1 to the nucleoplasm, and the activation domain would be available for interaction with p300. Because Pdx-1 and p300 can interact with each other in vitro, this suggests that phosphorylation of Pdx-1 is not essential for this interaction. We believe that the phosphorylation event is required for translocation of Pdx-1 from nuclear periphery to the nucleoplasm, thereby enabling Pdx-1 to interact with p300.

The histone acetyltransferase p300 has been shown to interact with several transcription factors in a regulated manner and is recruited to the various promoters in response to different stimuli (36, 37). For example, p300 and CBP interact with the transcription factor CREB (CRE-binding protein) only when CREB is activated by protein kinase A phosphorylation in response to increased cAMP levels (38). The histone acetyltransferases, GCN5 and CBP, are recruited to the interferon ß (IFNß) promoter in response to viral induction, which increases IFNß expression (39, 40). The expression of the CATD gene requires the recruitment of p300, CBP, and p300/CBP-associated factor in response to estrogen (41). The finding that glucose stimulates the acetylation of histone H4 K5, K8, and K12 within 30 min after shifting to high glucose (Fig. 7BGo) is consistent with the hypothesis that p300 is likely responsible for the glucose-regulated hyperacetylation of histone H4 because the timing of acetylation correlates with the recruitment of p300 (Fig. 7AGo). These data indicate that the histone acetyltransferase activity of p300 plays an important role in insulin gene regulation. This provides additional evidence to explain the mechanism of insulin gene regulation on high glucose, whereas previous data led to the theory that p300 functions as a scaffold at the insulin promoter to stabilize the interaction between Pdx-1 and NeuroD, which may also play an important role in the regulation (28). Acetylation of the histone H4 lysine residues K5, K8, and K12 at the insulin gene promoter precedes the increase in insulin mRNA levels. Therefore, it is possible that acetylation of specific lysine residues in histone H4 may play a role in the recruitment of the basal transcription complex. Alternatively, acetylation of histone H4 K5, K8, and K12 could be important for the recruitment of a chromatin remodeling complex such as SWI/SNF or for the direct recruitment of TFIID.

The induction of the collagenase gene by mitogens involves several different histone modifications at this promoter. Histone H3 methylation and phosphorylation, in addition to histone H3 and histone H4 acetylation, appears to be required for activation of collagenase gene expression (42). Therefore, increasing histone H3 and histone H4 acetylation at the collagenase promoter by inhibition of histone deacetylases with trichostatin A has no effect on collagenase expression because of the lack of histone H3 methylation and phosphorylation induced by mitogens (42). We have previously shown that treatment of low glucose-grown MIN6 cells with trichostatin A results in elevated levels of histone H4 acetylation, which causes induction of insulin gene expression even in the absence of high concentrations of glucose (27). This indicates that the hyperacetylation of histone H4 in response to high concentrations of glucose is the major mechanism of histone modification at the insulin gene promoter involved in glucose induction.

Our studies, along with previous ones (32, 43), indicate that Pdx-1 itself plays a major role in the regulation of its own expression by an undefined autoregulatory mechanism. Decreases in endogenous Pdx-1 levels in individuals that are heterozygous for the Pro63fsdelC mutation (lacks the activation domain of Pdx-1 and functions as a dominant negative like Pdx-1{Delta}1–79) have been associated with the development of type 2 diabetes mellitus (43). In addition, decreases in Pdx-1 expression levels have been shown to result in diminished insulin gene expression (17, 21), strongly reduced glucose-stimulated insulin secretion (44), and decreased ß cell mass (44). Decreases in Pdx-1 expression levels are also observed in animal models of non-insulin-dependent diabetes mellitus [such as Psammomys obesus (17, 18) and the Otsuka Long-Evans Tokushima Fatty rat (45)] or are caused by diabetogenic stimuli [such as increased fatty acids (46) or glucocorticoids (47)]. Decreases in Pdx-1, p300, and CBP expression have been correlated with decreases in insulin gene transcription and the development of diabetes in a transgenic model of Huntington’s disease (48). Based on our data, we hypothesize that decreases in Pdx-1 expression result in diminished glucose-induced insulin gene transcription by abolishing the recruitment of the histone acetyltransferase p300 and the hyperacetylation of histone H4 at the insulin gene promoter in response to glucose.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Experimental Animals
The isolation of rat islets was conducted according to approved protocols and accepted standards of humane animal care.

Cell Culture
Mouse insulinoma-6 (MIN6) cells of passages 22–30 were cultured in DMEM containing 25 mM glucose, 10% (vol/vol) fetal bovine serum, 1% penicillin/streptomycin, 2 mM glutamine, and 100 µM ß-mercaptoethanol (49). To carry out the glucose regulation experiments, MIN6 cells were grown overnight in DMEM with 25 mM glucose without serum and were washed three times with 1x PBS and transferred to 3 or 30 mM glucose containing media for 2 h unless otherwise indicated.

Isolation of Rat Islets
Islets were isolated from male Sprague Dawley rats (250–300 g) by collagenase digestion as described previously (50) and cultured overnight at 37 C in an atmosphere of 95% air and 5% CO2 in complete CMRL-1066 tissue culture medium (CMRL-1066 containing 2 mmol/liter L-glutamine, 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin). For the glucose regulation experiments, rat islets were washed three times in Krebs-Ringer bicarbonate buffer (KRB: 25 mM HEPES, 115 mM NaCl, 24 mM NaHCO3, 5 mM KCL, 1 mM MgCl2, 2.5 mM CaCl2, and 0.1% BSA, pH 7.4) containing 3 mM D-glucose for 90 min, followed by a 2-h incubation in KRB buffer containing either 3 or 20 mM glucose. The rat islets were washed twice with BSA-free KRB buffer containing either 3 or 20 mM glucose before cross-linking with formaldehyde (1%). After addition of 125 mM glycine, the islets were centrifuged at 2000 x g and washed two times with PBS. The islet pellets were then solubilized in 400 µl sodium dodecyl sulfate (SDS)-lysis buffer [15 mM Tris-HCl, pH 8.0; 10 mM EDTA, 1% SDS, and 1 mM phenylmethylsulfonylfluoride (PMSF)] and stored at –70 C. The ChIP assay with rat islets was carried out as described below. Approximately 100 rat islets per condition were used.

ChIP Assay and PCR
Chromatin isolation was performed as previously published (27, 51). The antibodies used for immunoprecipitation in ChIP assays were antidiacetyl-histone H3, tetraacetyl H4, histone H4-acetyl K5, K8, K12, K16 (Upstate Biotechnology, Inc., Lake Placid, NY); the c-myc (E910) and p300 (N-15) antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The Pdx-1 antibodies used in this study are directed against the N terminus and were kindly provided by Chris Wright (Vanderbilt University, Nashville, TN). All PCRs were performed on a Robocycler Gradient 96 (Stratagene, La Jolla, CA) in a 20-µl reaction volume containing: 50 mM KCl; 10 mM Tris-HCl, pH 8.3; 1.5 mM MgCl; 200 µM deoxynucleotide triphosphates; and 2 µl of primers (2.5 pmol/µl) as described previously (27). The linear range for each primer pair was determined empirically, using different cycle numbers and by real-time PCR using an ABI 7700 (Applied Biosystems, Foster City, CA). The primers used are GAAGGTCTCACCTTCTGG and GGGGGTTACTGGATGCC for the mouse insulin I promoter (from –10 to –281) (27); TCTTGCAGCCCCAGTCCCACACTT and CCTGGAGCCCCACTTAAAGCAGAC (+11 to + 139) for the L-type pyruvate kinase (pklr) promoter (52); and GCTCAGCCAAGGAAAAAGAGG and GTTACTGGGTCTCCACTAGA for the rat insulin I promoter (from –10 to –312). The PCR conditions were 10 min at 95 C and 25 cycles of 1 min at 95 C, 2 min at 58 C, and 1 min at 72 C. Each PCR was performed at least three independent times for each independent sample. The PCR products obtained with the immunoprecipitated DNA were normalized to that of total input DNA. The bands were visualized using a ChemiDoc System Bio-Rad Imager (Bio-Rad Laboratories, Inc., Hercules, CA) and quantified using Quantity One Imaging Software (Bio-Rad) as a function of both band size and band intensity (intensity/mm2). The PCR products obtained had the expected molecular size, and their identity was confirmed by sequencing.

Preparation of Cell Extracts and Coimmunoprecipitation Assay
Whole-cell extracts from MIN6 cells incubated with 3 or 30 mM glucose were prepared as described previously by using 1% Nonidet P-40 for lysis of the cells (53). Extracts for coimmunoprecipitation assays were prepared using the following lysis buffer: 50 mM Tris-Cl, pH 8.0; 20% glycerol; 140 mM NaCl; 0.5% Nonidet P-40; 5 mM MgCl2. 0.2 mM EDTA; 1 mM dithiothreitol; 1 mM PMSF; and protease inhibitors. After removal of cellular debris by centrifugation, the obtained supernatant was diluted with 4 volumes of dilution buffer (50 mM Tris-Cl, pH 7.5; 10% glycerol; 5 mM MgCl2; 0.2 mM EDTA; 1 mM dithiothreitol; 1 mM PMSF; and protease inhibitors). The Pdx-1 and p300 antibodies used for immunoprecipitation were the same as used for the ChIP assays. Immunoprecipitation was carried out overnight at 4 C, followed by incubation with protein A-Sepharose 4 Fast Flow (Amersham Biosciences, Arlington Heights, IL) for 1–2 h. The pellets were washed six times in 1 ml of wash buffer (50 mM Tris-Cl, pH 7.5; 10% glycerol; 100 mM NaCl; 0.1% Nonidet P-40; 1 mM EDTA) and resuspended in 2x SDS sample buffer. Rabbit IgG-Agarose (Sigma Chemical Co., St. Louis, MO) was used as a negative control for nonspecific binding. The antibodies used for immunoblotting are the same as given above for Pdx-1 and p300, and c-myc (9E10, Santa Cruz). Proteins were visualized using the enhanced chemiluminescent detection system (Amersham Biosciences).

RNA Isolation and RT-PCR
Poly A RNA from total RNA was isolated using the GenElute Direct mRNA Miniprep Kit (Sigma) according to the manufacturer’s instructions. The obtained poly A RNA was reverse transcribed using Enhanced avian myeloblastosis virus reverse transcriptase (Sigma). The resulting cDNAs were used as template for PCR with oligonucleotides to amplify the insulin and ß-actin genes. The primers used are CCTGTTGGTGCACTTCCTAC and TGCAGTAGTTCTCCAGCTGC for the mouse insulin I gene (54), and CGTGGGCCGCCCTAGGCAACC and TTGGCCTTAGGGTTCAGGGGGG for the ß-actin gene (55). The primers for the ß-actin gene cross an intron so that contamination with genomic DNA can be detected, which would result in a PCR product of 330 bp vs. 243 bp from the cDNA (55). PCRs (20 µl volume) contained 20 ng cDNA, 300 µM deoxynucleotide triphosphates, 2.5 pmol of appropriate oligonucleotide primers, and 1.5 U of JumpStart AccuTaq LA DNA polymerase (Sigma). PCR amplification conditions were as follows: 5 min at 95 C followed by 26 cycles of 95 C for 30 sec, 58 C for 1 min, and 72 C for 30 sec. The PCR products were separated on 8% nondenaturing polyacrylamide gels and stained with ethidium bromide (Sigma). The bands were visualized as described in ChIP Assay.

Construction of Pdx-1{Delta}1–79 Recombinant Adenovirus
The Ad-Pdx-1{Delta}1–79 adenovirus, which lacks the first 79 amino-terminal amino acids containing the activation domain, was constructed using the AdEasy adenoviral system as described previously (31, 56). To generate the Pdx-1{Delta}1–79 recombinant virus, the mouse Pdx-1 cDNA lacking the first 237 bp was amplified by PCR and subcloned into the pACCMV-myc vector in frame with a triple myc tag as BamHI/SalI fragment. The resultant plasmid was cut with HindIII to relieve Pdx-1{Delta}1–79 fused to myc, which was then subcloned into the HindIII site of the shuttle vector pAdTrack-CMV (31). The obtained plasmid was cotransformed into Escherichia coli BJ 5183 cells with pAdEasy-1 plasmid containing the adenoviral genome. After recombination in bacteria, the obtained plasmid was transformed into E. coli DH5{alpha} cells, and the prepared plasmid DNA was linearized and used to transfect human embryonic kidney (HEK) 293 cells using LipofectAMINE (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer’s instructions. The HEK 293 cell lysate was used for additional viral amplification by several rounds of infection of HEK 293 cells. MIN6 cells were infected with a MOI 80–100 using a 2-h exposure to the adenovirus (56).

Immunohistochemical Analysis
MIN6 cells were grown on acid-washed coverslips. Cells were fixed in methanol and permeabilized in 0.1% Triton as described previously (34). Endogenous Pdx-1 and p300 were visualized with the same antibodies as used for immunoprecipitation, followed by Alexa Fluor 488-conjugated goat antirabbit IgG antibodies (Molecular Probes, Inc., Eugene, OR) as the secondary antibodies. Coverslips were mounted using Vectashield (Vector Laboratories, Inc., Burlingame, CA) containing 4',6-diamidino-2-phenylindole to visualize the cell nuclei. Immunofluorescence microscopy was carried out using a laser scanning confocal microscope (Leica Corp., Deerfield, IL).

Statistical Analysis
Comparison of the histone H4 acetylation and insulin gene expression levels from MIN6 cells grown on 3 or 30 mM glucose was performed using the two-tailed, unpaired Student’s t test. A P value less than 0.05 was considered statistically significant. Data are expressed as means ± SD.


    ACKNOWLEDGMENTS
 
We thank Dr. C. Waechter and Dr. S. Turco and their laboratory members for providing access to their Thermocycler and Imager, respectively. We also thank Drs. J. Miyazaki, R. Stein, D. Steiner, and J. Hutton for the MIN6 cell line; Dr. Chris Wright for the Pdx-1 antibodies; and Dr. Bert Vogelstein for the pAdEasy adenovirus system.


    FOOTNOTES
 
This work was supported in part by grants from the Juvenile Diabetes Research Foundation and the American Diabetes Association (to S.Ö.), National Institutes of Health Grant DK52194 (to J.A.C.), and by a predoctoral fellowship from the American Heart Association Ohio Valley Affiliate (to A.L.M.).

Abbreviations: CBP, CREB-binding protein; ChIP, chromatin immunoprecipitation; CREB, cAMP response element-binding protein; GFP, green fluorescent protein; HEK, human embryonic kidney; KRB, Krebs-Ringer bicarbonate; MIN6, mouse insulinoma 6; PMSF, phenylmethylsulfonylfluoride; SDS, sodium dodecyl sulfate.

Received for publication December 2, 2003. Accepted for publication May 19, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Walker MD, Edlund T, Boulet AM, Rutter WJ 1983 Cell-specific expression controlled by the 5'-flanking region of insulin and chymotrypsin genes. Nature 306:557–561[CrossRef][Medline]
  2. German M, Ashcroft S, Docherty K, Edlund H, Edlund T, Goodison S, Imura H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K, Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R, Steiner D, Tsai M-J, Walker MD 1995 The insulin gene promoter. A simplified nomenclature. Diabetes 44:1002–1004[Medline]
  3. German MS, Wang J 1994 The insulin gene contains multiple transcriptional elements that respond to glucose. Mol Cell Biol 14:4067–4075[Abstract/Free Full Text]
  4. Melloul D, Marshak S, Cerasi E 2002 Regulation of insulin gene transcription. Diabetologia 45:309–326[CrossRef][Medline]
  5. Melloul D, Ben-Neriah Y, Cerasi E 1993 Glucose modulates the binding of an islet-specific factor to a conserved sequence within the rat I and the human insulin promoters. Proc Natl Acad Sci USA 90:3865–3869[Abstract/Free Full Text]
  6. Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD 1994 Transcriptional regulation of the human insulin gene is dependent on the homeodomain protein STF1/IPF1 acting through the CT boxes. Proc Natl Acad Sci USA 91:10465–10469[Abstract/Free Full Text]
  7. Marshak S, Totary H, Cerasi E, Melloul D 1996 Purification of the ß-cell glucose-sensitive factor that transactivates the insulin gene differentially in normal and transformed islet cells. Proc Natl Acad Sci USA 93:15057–15062[Abstract/Free Full Text]
  8. MacFarlane WM, Read ML, Gilligan M, Bujalska I, Docherty K 1994 Glucose modulates the binding activity of the ß-cell transcription factor IUF1 in a phosphorylation-dependent manner. Biochem J 303:625–631
  9. Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CV, Teitelman G 1995 Expression of murine STF-1, a putative insulin gene transcription factor, in ß cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11–18[Abstract]
  10. Ohlsson H, Karlsson K, Edlund T 1993 IPF1, a homeodomain containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  11. Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR 1993 Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275–1283[Abstract]
  12. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145–1156[Medline]
  13. Jonsson J, Carlsson L, Edlund T, Edlund H 1994 Insulin-promoter factor-1 is required for pancreas development in mice. Nature 371:606–609[CrossRef][Medline]
  14. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL, Wright CV 1996 PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983–995[Abstract]
  15. Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H 1998 ß-Cell specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the ß-cell phenotype and maturity onset diabetes. Genes Dev 12:1763–1768[Abstract/Free Full Text]
  16. Gadot M, Leibowitz G, Shafir E, Cerasi E, Gross D, Kaiser N 1994 Hyperproinsulinemia and insulin deficiency in the diabetic Psammomys obesus. Endocrinology 135:610–616[Abstract]
  17. Leibowitz G, Melloul D, Yuli M, Gross DJ, Apelqvist A, Edlund H, Cerasi E, Kaiser N 2001 Defective glucose-regulated insulin gene expression associated with PDX-1 deficiency in the Psammomys obesus model of type 2 diabetes. Diabetes 50:S138–S139
  18. Leibowitz G, Ferber S, Apelqvist A, Edlund H, Gross DJ, Cerasi E, Melloul D, Kaiser N 2001 IPF1/PDX1 deficiency and ß-cell dysfunction in Psammomys obesus, an animal with type 2 diabetes. Diabetes 50:1799–1806[Abstract/Free Full Text]
  19. MacFarlane WM, Chapman JC, Shepherd RM, Hashmi MN, Kamimura N, Cosgrove KE, O’Brien RE, Barnes PD, Hart AW, Docherty HM, Lindley KJ, Aynsley-Green A, James RF, Docherty K, Dunne MJ 1999 Engineering a glucose-responsive human insulin-secreting cell line from islets of Langerhans isolated from a patient with persistent hyperinsulinemic hypoglycemia of infancy. J Biol Chem 274:34059–34066[Abstract/Free Full Text]
  20. Macfarlane WM, Shepherd RM, Cosgrove KE, James RF, Dunne MJ, Docherty K 2000 Glucose modulation of insulin mRNA levels is dependent on transcription factor PDX-1 and occurs independently of changes in intracellular Ca2+. Diabetes 49:418–423[Abstract]
  21. Lottmann H, Vanselow J, Hessabi B, Walther R 2001 The Tet-On system in transgenic mice: inhibition of the mouse pdx-1 gene activity by antisense RNA expression in pancreatic ß-cells. J Mol Med 79:321–328[CrossRef][Medline]
  22. Waeber G, Thompson N, Nicod P, Bonny C 1996 Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol 10:1327–1334[Abstract]
  23. Watada H, Kajimoto Y, Umayahara Y, Matsuoka T, Kaneto H, Fujitani Y, Kamada T, Kawamori R, Yamasaki Y 1996 The human glucokinase gene ß-cell type promoter: an essential role of insulin promoter factor 1/PDX-1 in its activation in HIT-T15 cells. Diabetes 45:1478–1488[Abstract]
  24. Watada H, Kajimoto Y, Kaneto H, Matsuoka T, Fujitani Y, Miyazaki J, Yamasaki Y 1996 Involvement of the homeodomain-containing transcription factor PDX-1 in islet amyloid polypeptide gene transcription. Biochem Biophys Res Commun 229:746–751[CrossRef][Medline]
  25. Bretherton-Watt D, Gore N, Boam DSW 1996 Insulin upstream factor 1 and a novel ubiquitous factor bind to the human islet amyloid polypeptide/amylin gene promoter. Biochem J 313:495–502
  26. Strahl BD, Allis CD 2000 The language of covalent histone modifications. Nature 403:41–45[CrossRef][Medline]
  27. Mosley AL, Özcan S 2003 Glucose regulates insulin gene transcription by hyperacetylation of histone H4. J Biol Chem 278:19660–19666[Abstract/Free Full Text]
  28. Qiu Y, Guo M, Huang S, Stein R 2002 Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA-2, and E47. Mol Cell Biol 22:412–420[Abstract/Free Full Text]
  29. Qiu Y, Sharma A, Stein R 1998 p300 mediates transcriptional stimulation by the basic helix-loop-helix activators of the insulin gene. Mol Cell Biol 18:2957–2964[Abstract/Free Full Text]
  30. Vaulant S, Vasseur-Cognet M, Kahn A 2000 Glucose regulation of gene transcription. J Biol Chem 275:31555–31558[Free Full Text]
  31. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B 1998 A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95:2509–2514[Abstract/Free Full Text]
  32. Peshavaria M, Henderson E, Sharma A, Wright CV, Stein R 1997 Functional characterization of the transactivation properties of the PDX-1 homeodomain protein. Mol Cell Biol 17:3987–3996[Abstract]
  33. Rafiq I, Kennedy HJ, Rutter GA 1998 Glucose-dependent translocation of insulin promoter factor-1 (IPF-1) between the nuclear periphery and the nucleoplasm of single MIN6 ß cells. J Biol Chem 273:23241–23247[Abstract/Free Full Text]
  34. Elrick LJ, Docherty K 2001 Phosphorylation-dependent nucleocytoplasmic shuttling of pancreatic duodenal homeobox-1. Diabetes 50:2244–2252[Abstract/Free Full Text]
  35. Guillemain G, Da Silva Xavier G, Rafiq I, Leturque A, Rutter GA 2004 Importin ß1 mediates the glucose-stimulated nuclear import of pancreatic and duodenal homeobox-1 in pancreatic islet ß-cells (MIN6). Biochem J 378:219–227[CrossRef][Medline]
  36. Chan HM, La Thangue NB 2001 p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114:2363–2373[Abstract/Free Full Text]
  37. Vo N, Goodman RH 2001 CREB-binding protein and p300 in transcriptional regulation. J Biol Chem 276:13505–13508[Free Full Text]
  38. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855–859[CrossRef][Medline]
  39. Agalioti T, Lomvardas S, Parekh B, Yie J, Maniatis T, Thanos D 2000 Ordered recruitment of chromatin modifying and general transcription factors to the IFN-ß promoter. Cell 103:667–678[CrossRef][Medline]
  40. Agalioti T, Chen G, Thanos D 2002 Deciphering the transcriptional histone acetylation code for a human gene. Cell 111:381–392[CrossRef][Medline]
  41. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  42. Martens JHA., Verlaan M, Kalkhoven E, Zantema A 2003 Cascade of distinct histone modifications during collagenase gene activation. Mol Cell Biol 23:1808–1816[Abstract/Free Full Text]
  43. Stoffers DA, Stanojevic V, Habener JF 1998 Insulin promoter factor-1 gene mutation linked to early-onset type 2 diabetes mellitus directs expression of a dominant negative isoprotein. J Clin Invest 102:232–241[Medline]
  44. Brissova M, Shiota M, Nicholson WE, Gannon M, Knobel SM, Piston DW, Wright CV, Powers AC 2002 Reduction in pancreatic transcription factor PDX-1 impairs glucose-stimulated insulin secretion. J Biol Chem 277:11225–11232[Abstract/Free Full Text]
  45. Zhu M, Mizuno A, Noma Y, Murakami T, Kuwajima M, Shima K, Lan MS 2001 Defective morphogenesis and functional maturation in fetal islet-like cell clusters from OLETF rat, a model of NIDDM. Int J Exp Diabetes Res 1:289–298[Medline]
  46. Gremlich S, Bonny C, Waeber G, Thorens B 1997 Fatty acids decrease IDX-1 expression in rat pancreatic islets and reduce GLUT2, glucokinase, insulin, and somatostatin levels. J Biol Chem 272:30261–30269[Abstract/Free Full Text]
  47. Shinozuka Y, Okada M, Oki T, Sagane K, Mizui Y, Tanaka I, Katayama K, Murakami-Murofushi K 2001 Altered expression of HES-1, BETA2/NeuroD, and PDX-1 is involved in impaired insulin synthesis induced by glucocorticoids in HIT-T15 cells. Biochem Biophys Res Commun 287:229–235[CrossRef][Medline]
  48. Thomas MK, Devon ON, Lee JH, Peter A, Schlosser DA, Tenser MS, Habener JF 2001 Development of diabetes mellitus in aging transgenic mice following suppression of pancreatic homeoprotein IDX-1. J Clin Invest 108:319–329[CrossRef][Medline]
  49. Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y, Yamamura K 1990 Establishment of a pancreatic ß cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology 127:126–132[Abstract]
  50. McDaniel ML, Colca JR, Kotagal N, Lacy PE 1983 A subcellular fractionation approach for studying insulin release mechanisms and calcium metabolism in islets of Langerhans. Methods Enzymol 98:182–200[Medline]
  51. Wells J, Farnham PJ 2002 Characterizing transcription factor binding sites using formaldehyde crosslinking and immunoprecipitation. Methods 26:48–56[CrossRef][Medline]
  52. Parrizas M, Maestro MA, Boj SF, Paniagua A, Casamitjana R, Gomis R, Rivera F, Ferrer J 2001 Hepatic nuclear factor 1a directs nucleosomal hyperacetylation to its tissue specific transcriptional targets. Mol Cell Biol 21:3234–3243[Abstract/Free Full Text]
  53. Macfarlane WM, McKinnon CM, Felton-Edkins ZA, Cragg H, James RF, Docherty K 1999 Glucose stimulates translocation of the homeodomain transcription factor PDX1 from the cytoplasm to the nucleus in pancreatic ß-cells. J Biol Chem 274:1011–1016[Abstract/Free Full Text]
  54. Roderigo-Milne H, Hauge-Evans AC, Persaud SJ, Jones PM 2002 Differential expression of insulin genes 1 and 2 in MIN6 cells and pseudoislets. Biochem Biophy Res Commun 296:589–595[CrossRef][Medline]
  55. Rout UK, Armant DR 2002 Expression of genes for alcohol and aldehyde metabolizing enzymes in mouse oocytes and preimplantation embryos. Reprod Toxicol 16:253–258[CrossRef][Medline]
  56. Mosley AL, Özcan S 2003 Adenoviral gene transfer into ß-cell lines. Methods Mol Med 83:73–79[Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
H.-W. Wang, M. Muguira, W.-D. Liu, T. Zhang, C. Chen, R. Aucoin, M. B Breslin, and M. S Lan
Identification of an INSM1-binding site in the insulin promoter: negative regulation of the insulin gene transcription
J. Endocrinol., July 1, 2008; 198(1): 29 - 39.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Eto, V. Kaur, and M. K. Thomas
Regulation of Pancreas Duodenum Homeobox-1 Expression by Early Growth Response-1
J. Biol. Chem., March 2, 2007; 282(9): 5973 - 5983.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Evans-Molina, J. C. Garmey, R. Ketchum, K. L. Brayman, S. Deng, and R. G. Mirmira
Glucose Regulation of Insulin Gene Transcription and Pre-mRNA Processing in Human Islets
Diabetes, March 1, 2007; 56(3): 827 - 835.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. L. Vanderford, S. S. Andrali, and S. Ozcan
Glucose Induces MafA Expression in Pancreatic Beta Cell Lines via the Hexosamine Biosynthetic Pathway
J. Biol. Chem., January 19, 2007; 282(3): 1577 - 1584.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. B. Deramaudt, M. M. Sachdeva, M. P. Wescott, Y. Chen, D. A. Stoffers, and A. K. Rustgi
The PDX1 Homeodomain Transcription Factor Negatively Regulates the Pancreatic Ductal Cell-specific Keratin 19 Promoter
J. Biol. Chem., December 15, 2006; 281(50): 38385 - 38395.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Francis, D. A. Babu, T. G. Deering, S. K. Chakrabarti, J. C. Garmey, C. Evans-Molina, D. G. Taylor, and R. G. Mirmira
Role of Chromatin Accessibility in the Occupancy and Transcription of the Insulin Gene by the Pancreatic and Duodenal Homeobox Factor 1
Mol. Endocrinol., December 1, 2006; 20(12): 3133 - 3145.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. W. Hay and K. Docherty
Comparative Analysis of Insulin Gene Promoters: Implications for Diabetes Research
Diabetes, December 1, 2006; 55(12): 3201 - 3213.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. E Cerf
Transcription factors regulating {beta}-cell function.
Eur. J. Endocrinol., November 1, 2006; 155(5): 671 - 679.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Iguchi, Y. Ikeda, M. Okamura, T. Tanaka, Y. Urashima, H. Ohguchi, S. Takayasu, N. Kojima, S. Iwasaki, R. Ohashi, et al.
SOX6 Attenuates Glucose-stimulated Insulin Secretion by Repressing PDX1 Transcriptional Actvity and Is Down-regulated in Hyperinsulinemic Obese Mice
J. Biol. Chem., November 11, 2005; 280(45): 37669 - 37680.
[Abs