| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular & Cellular Biochemistry (A.L.M., S.Ö.), Chandler Medical Center, University of Kentucky, Lexington, Kentucky 40536; Edward A. Doisy Department of Biochemistry and Molecular Biology (J.A.C.), Saint Louis University, School of Medicine, St. Louis, Missouri 63104
Address all correspondence and requests for reprints to: Dr. Sabire Özcan, Department of Molecular & Cellular Biochemistry, University of Kentucky, College of Medicine, 800 Rose Street, MN608, Lexington, Kentucky 40536. E-mail: sozcan{at}uky.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Deletion analysis of the insulin gene promoter indicated that the A3 element, to which Pdx-1 binds, is essential for glucose regulation of insulin gene expression (5, 6, 7). This indicates that Pdx-1 plays a major role in glucose regulation of insulin gene transcription. Pdx-1, a ß-cell-specific homeodomain transcription factor (7, 8, 9, 10, 11, 12), is also essential for pancreas development (13, 14). Homozygous Pdx-1 knockout mice fail to develop a pancreas, whereas heterozygous Pdx-1 mice survive and have a normal pancreas but become glucose intolerant and display impaired insulin production (13, 14, 15). Pdx-1 has been implicated in the glucose regulation of insulin gene transcription in a number of different systems. Psammomys obesus, a rodent model of type II diabetes (16), has 8090% lower insulin content due to defects in glucose-stimulated insulin gene transcription (17, 18). This decrease in insulin levels in response to glucose appears to be caused by the absence of Pdx-1, whereas a number of other regulators of the insulin gene, including MafA (Ripe3b1), are not affected (18). The NES2Y cell line was isolated from patients with persistent hyperinsulinemic hypoglycemia of infancy (19). These cells lack Pdx-1, and although they express the insulin gene, they fail to up-regulate insulin gene transcription in response to high glucose levels (20). It has also been shown that decreases in Pdx-1 levels in mice using antisense RNA lead to decreased insulin gene transcription (21). In addition to the insulin gene, Pdx-1 has also been implicated in regulation of Glut2, glucokinase, islet amyloid polypeptide, and somatostatin gene expression (11, 12, 22, 23, 24, 25).
Histone acetylation has been shown to play an important role in regulated gene expression, and increases in histone acetylation correlate with increased gene expression (reviewed in Ref. 26). The steady-state level of histone acetylation is maintained by the coordinate action of histone acetyltransferases and histone deacetylases, which mediate activation and repression of gene expression, respectively (26). We have demonstrated recently that glucose regulation of insulin gene expression involves hyperacetylation of histone H4 at the insulin gene promoter. Whereas histone H4 acetylation levels at the insulin promoter are low in the presence of low concentrations of glucose, the histone H4 acetylation levels increase by about 5-fold in response to high concentrations of glucose (27). The ß-cell-specific transcription factor Pdx-1 and the histone acetyltransferase p300 have been shown previously to interact with each other in vivo and in vitro (28). Because this interaction appears to be required for insulin gene transcription (28, 29), in this study we tested whether Pdx-1 and p300 are important for hyperacetylation of histone H4 at the insulin gene promoter in response to glucose.
| RESULTS |
|---|
|
|
|---|
|
|
179), which is able to bind to the insulin gene promoter but is unable to stimulate transcription. This dominant negative Pdx-1 lacks the first 79 amino-terminal amino acids containing the transactivation domain (Fig. 3A
179 construct was tagged with a triple myc epitope and expressed from the CMV promoter using the pAdTrackCMV vector (31). The expression of this truncated version of Pdx-1 was confirmed by immunoblotting of cell extracts of MIN6 cells infected with Pdx-1
179 adenovirus using myc antibodies (Fig. 3A
179 (Fig. 3B
179), indicates that this protein is able to bind on both low and high concentrations of glucose similar to wild-type Pdx-1 (Fig. 3C
179 caused a drastic reduction in endogenous Pdx-1 levels by immunoblotting with antibodies specific for the Pdx-1 N terminus (data not shown). Thus, the Pdx-1
179 protein disrupts the function of the endogenous Pdx-1 by reducing its expression level and by competing for binding to the insulin gene promoter.
|
179 or a green fluorescent protein (GFP) control virus (original vector expressing GFP only) were incubated with low (3 mM) or high (30 mM) glucose for 2 h and then used for ChIP assays with antiacetyl histone H4 antibodies. Comparison of MIN6 cells infected with the control GFP vs. the Ad-Pdx-1
179 virus show that the level of histone H4 acetylation in MIN6 cells overexpressing the dominant negative form of Pdx-1 is diminished at high concentrations of glucose (Fig. 4A
179, the histone H4 acetylation level was still higher than on cells grown on low glucose. This is likely due to the fact that only about 8085% of the cells were infected and the remaining 1520% that do not express the dominant negative Pdx-1 protein still display normal hyperacetylation of histone H4 in response to high concentrations of glucose. Statistical analysis of the data obtained from three independent experiments indicates that overexpression of the dominant negative protein Pdx-1
179 causes a significant decrease in histone H4 acetylation (Fig. 4B
|
179 virus, was analyzed using RT-PCR. As shown in Fig. 4C
179 results in down-regulation of insulin gene expression, which correlates with the observed decrease in histone H4 acetylation at the insulin gene promoter (Fig. 4
It has been shown previously that the interaction of Pdx-1 with p300 requires the activation domain of Pdx-1 (28). To test the recruitment of p300 to the insulin promoter in MIN6 cells overexpressing Pdx-1
179, the cells were incubated with low or high concentrations of glucose for 2 h and subjected to ChIP assay using p300 antibodies for immunoprecipitation. Consistent with previous data, in MIN6 cells expressing the GFP virus as control, p300 was recruited to the insulin gene promoter only at high concentrations of glucose, whereas MIN6 cells infected with the Pdx-1
179 virus did not show recruitment of p300 to the insulin gene promoter (Fig. 4E
). Recruitment of p300 to the pklr promoter used as control was not affected by the Pdx-1
179 construct, because pklr is not regulated by Pdx-1. These data indicate that a functional Pdx-1 protein is required to mediate the glucose-regulated hyperacetylation of histone H4 at the insulin gene promoter and for the recruitment of p300 in a glucose-dependent manner.
Pdx-1 Interacts with the Histone Acetyltransferase p300 in a Glucose-Dependent Manner In vivo
Our data indicate that p300 is recruited to the insulin gene promoter in MIN6 cells and isolated rat islets only at high concentrations of glucose (Fig. 2
) and that a functional Pdx-1 protein is required for the recruitment of p300 (Fig. 4
). Furthermore, previous data indicate that Pdx-1 is able to interact with p300 in vivo as well as in vitro (28). To test whether the interaction of Pdx-1 with p300 occurs in a glucose-regulated manner, MIN6 cell extracts of 3 or 30 mM glucose-incubated cells were used for coimmunoprecipitation experiments with either Pdx-1 or p300 antibodies (Fig. 5
). The immunoprecipitation experiment was also carried out with rabbit IgG as control. We found that the histone acetyltransferase p300 coimmunoprecipitates with Pdx-1 and that the interaction of Pdx-1 with p300 is increased on high concentrations of glucose (Fig. 5A
). Similar data were obtained by using p300 antibodies for immunoprecipitation (Fig. 5C
). These data show that the interaction of Pdx-1 with p300 is stronger in the presence of high concentrations of glucose.
|
|
The Temporal Recruitment of the Histone Acetyltransferase p300 Correlates with the Hyperacetylation Histone H4 and Insulin Gene Transcription
To determine the temporal pattern of histone H4 acetylation, the recruitment of p300, and induction of insulin gene transcription, MIN6 cells were first incubated for 16 h on low glucose and then switched to high (30 mM) glucose. The cells were harvested at the indicated time points and used for ChIP assays and RT-PCR. We found that histone H4 acetylation levels at the insulin promoter increase within 30 min of exposure of MIN6 cells to high concentrations of glucose (Fig. 7A
). The antibody used in our studies recognizes tri- or tetraacetylated histone H4, which can be acetylated at lysine residues K5, K8, K12, and K16. To determine whether specific lysine residues are acetylated in response to glucose, we used antibodies generated against single acetyl residues in histone H4, using the same conditions as described above (Fig. 7B
). We found that glucose causes hyperacetylation of histone H4 lysine 5, 8, and 12 within 30 min, whereas acetylation of lysine 16 was observed after 1 h exposure to high glucose (Fig. 7B
). This indicates that the acetylation of the histone H4 single-lysine residues is regulated in time-dependent manner. Analysis of the recruitment of the histone acetyltransferase p300 by ChIP assay (Fig. 7A
) indicates that it is rapidly recruited to the insulin gene promoter in response to high concentrations of glucose. The increase in p300 recruitment correlates with the rapid acetylation of histone H4 K5, K8, and K12. Increases in insulin mRNA levels follow the hyperacetylation of histone H4 and the recruitment of p300 after exposure to high glucose with maximal expression around 68 h.
|
| DISCUSSION |
|---|
|
|
|---|
The recruitment of p300 to the insulin gene promoter and its interaction with the transcription factor Pdx-1 are regulated by glucose and occur mainly at high concentrations of glucose. The regulation of the interaction of Pdx-1 with p300 by glucose appears to involve a phosphorylation event, because inhibition of protein phosphatases by treatment with okadaic acid enhances Pdx-1 interaction with p300 even under low glucose conditions. It has been previously shown that Pdx-1 changes its subcellular localization in response to glucose (33, 34). In the presence of low glucose, Pdx-1 is localized to the nuclear periphery, and it translocates to the nucleoplasm in response to high concentrations of glucose. Treatment of MIN6 cells with okadaic acid blocks the localization of Pdx-1 to nuclear periphery on low glucose (Ref. 34 and Fig. 6B
) and enhances the interaction of Pdx-1 with p300 (Fig. 6A
). Based on these data, we propose that at high concentrations of glucose, a phosphorylation event causes the localization of Pdx-1 to the nucleoplasm, which enables its interaction with p300. On low glucose, a dephosphorylation event causes a major portion of Pdx-1 to localize to nuclear periphery where it is unable to interact with p300.
A recent report indicates that Pdx-1 interacts with importin ß 1, which appears to regulate the localization of Pdx-1 (35). However, the regulation of this interaction by glucose has not been investigated. Interestingly, it has been demonstrated that the activation domain of Pdx-1 localizes to nuclear periphery, probably due to its interaction with an unknown retention or anchoring protein (35). Because the activation domain of Pdx-1 is sufficient for its interaction with p300 (28), the interaction of the activation domain with a membrane-anchoring protein on low glucose would make this domain inaccessible for interaction with p300. On high glucose, the interaction of the activation domain with the membrane-anchoring protein would be interrupted due to a phosphorylation event, causing the translocation of Pdx-1 to the nucleoplasm, and the activation domain would be available for interaction with p300. Because Pdx-1 and p300 can interact with each other in vitro, this suggests that phosphorylation of Pdx-1 is not essential for this interaction. We believe that the phosphorylation event is required for translocation of Pdx-1 from nuclear periphery to the nucleoplasm, thereby enabling Pdx-1 to interact with p300.
The histone acetyltransferase p300 has been shown to interact with several transcription factors in a regulated manner and is recruited to the various promoters in response to different stimuli (36, 37). For example, p300 and CBP interact with the transcription factor CREB (CRE-binding protein) only when CREB is activated by protein kinase A phosphorylation in response to increased cAMP levels (38). The histone acetyltransferases, GCN5 and CBP, are recruited to the interferon ß (IFNß) promoter in response to viral induction, which increases IFNß expression (39, 40). The expression of the CATD gene requires the recruitment of p300, CBP, and p300/CBP-associated factor in response to estrogen (41). The finding that glucose stimulates the acetylation of histone H4 K5, K8, and K12 within 30 min after shifting to high glucose (Fig. 7B
) is consistent with the hypothesis that p300 is likely responsible for the glucose-regulated hyperacetylation of histone H4 because the timing of acetylation correlates with the recruitment of p300 (Fig. 7A
). These data indicate that the histone acetyltransferase activity of p300 plays an important role in insulin gene regulation. This provides additional evidence to explain the mechanism of insulin gene regulation on high glucose, whereas previous data led to the theory that p300 functions as a scaffold at the insulin promoter to stabilize the interaction between Pdx-1 and NeuroD, which may also play an important role in the regulation (28). Acetylation of the histone H4 lysine residues K5, K8, and K12 at the insulin gene promoter precedes the increase in insulin mRNA levels. Therefore, it is possible that acetylation of specific lysine residues in histone H4 may play a role in the recruitment of the basal transcription complex. Alternatively, acetylation of histone H4 K5, K8, and K12 could be important for the recruitment of a chromatin remodeling complex such as SWI/SNF or for the direct recruitment of TFIID.
The induction of the collagenase gene by mitogens involves several different histone modifications at this promoter. Histone H3 methylation and phosphorylation, in addition to histone H3 and histone H4 acetylation, appears to be required for activation of collagenase gene expression (42). Therefore, increasing histone H3 and histone H4 acetylation at the collagenase promoter by inhibition of histone deacetylases with trichostatin A has no effect on collagenase expression because of the lack of histone H3 methylation and phosphorylation induced by mitogens (42). We have previously shown that treatment of low glucose-grown MIN6 cells with trichostatin A results in elevated levels of histone H4 acetylation, which causes induction of insulin gene expression even in the absence of high concentrations of glucose (27). This indicates that the hyperacetylation of histone H4 in response to high concentrations of glucose is the major mechanism of histone modification at the insulin gene promoter involved in glucose induction.
Our studies, along with previous ones (32, 43), indicate that Pdx-1 itself plays a major role in the regulation of its own expression by an undefined autoregulatory mechanism. Decreases in endogenous Pdx-1 levels in individuals that are heterozygous for the Pro63fsdelC mutation (lacks the activation domain of Pdx-1 and functions as a dominant negative like Pdx-1
179) have been associated with the development of type 2 diabetes mellitus (43). In addition, decreases in Pdx-1 expression levels have been shown to result in diminished insulin gene expression (17, 21), strongly reduced glucose-stimulated insulin secretion (44), and decreased ß cell mass (44). Decreases in Pdx-1 expression levels are also observed in animal models of non-insulin-dependent diabetes mellitus [such as Psammomys obesus (17, 18) and the Otsuka Long-Evans Tokushima Fatty rat (45)] or are caused by diabetogenic stimuli [such as increased fatty acids (46) or glucocorticoids (47)]. Decreases in Pdx-1, p300, and CBP expression have been correlated with decreases in insulin gene transcription and the development of diabetes in a transgenic model of Huntingtons disease (48). Based on our data, we hypothesize that decreases in Pdx-1 expression result in diminished glucose-induced insulin gene transcription by abolishing the recruitment of the histone acetyltransferase p300 and the hyperacetylation of histone H4 at the insulin gene promoter in response to glucose.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture
Mouse insulinoma-6 (MIN6) cells of passages 2230 were cultured in DMEM containing 25 mM glucose, 10% (vol/vol) fetal bovine serum, 1% penicillin/streptomycin, 2 mM glutamine, and 100 µM ß-mercaptoethanol (49). To carry out the glucose regulation experiments, MIN6 cells were grown overnight in DMEM with 25 mM glucose without serum and were washed three times with 1x PBS and transferred to 3 or 30 mM glucose containing media for 2 h unless otherwise indicated.
Isolation of Rat Islets
Islets were isolated from male Sprague Dawley rats (250300 g) by collagenase digestion as described previously (50) and cultured overnight at 37 C in an atmosphere of 95% air and 5% CO2 in complete CMRL-1066 tissue culture medium (CMRL-1066 containing 2 mmol/liter L-glutamine, 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin). For the glucose regulation experiments, rat islets were washed three times in Krebs-Ringer bicarbonate buffer (KRB: 25 mM HEPES, 115 mM NaCl, 24 mM NaHCO3, 5 mM KCL, 1 mM MgCl2, 2.5 mM CaCl2, and 0.1% BSA, pH 7.4) containing 3 mM D-glucose for 90 min, followed by a 2-h incubation in KRB buffer containing either 3 or 20 mM glucose. The rat islets were washed twice with BSA-free KRB buffer containing either 3 or 20 mM glucose before cross-linking with formaldehyde (1%). After addition of 125 mM glycine, the islets were centrifuged at 2000 x g and washed two times with PBS. The islet pellets were then solubilized in 400 µl sodium dodecyl sulfate (SDS)-lysis buffer [15 mM Tris-HCl, pH 8.0; 10 mM EDTA, 1% SDS, and 1 mM phenylmethylsulfonylfluoride (PMSF)] and stored at 70 C. The ChIP assay with rat islets was carried out as described below. Approximately 100 rat islets per condition were used.
ChIP Assay and PCR
Chromatin isolation was performed as previously published (27, 51). The antibodies used for immunoprecipitation in ChIP assays were antidiacetyl-histone H3, tetraacetyl H4, histone H4-acetyl K5, K8, K12, K16 (Upstate Biotechnology, Inc., Lake Placid, NY); the c-myc (E910) and p300 (N-15) antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The Pdx-1 antibodies used in this study are directed against the N terminus and were kindly provided by Chris Wright (Vanderbilt University, Nashville, TN). All PCRs were performed on a Robocycler Gradient 96 (Stratagene, La Jolla, CA) in a 20-µl reaction volume containing: 50 mM KCl; 10 mM Tris-HCl, pH 8.3; 1.5 mM MgCl; 200 µM deoxynucleotide triphosphates; and 2 µl of primers (2.5 pmol/µl) as described previously (27). The linear range for each primer pair was determined empirically, using different cycle numbers and by real-time PCR using an ABI 7700 (Applied Biosystems, Foster City, CA). The primers used are GAAGGTCTCACCTTCTGG and GGGGGTTACTGGATGCC for the mouse insulin I promoter (from 10 to 281) (27); TCTTGCAGCCCCAGTCCCACACTT and CCTGGAGCCCCACTTAAAGCAGAC (+11 to + 139) for the L-type pyruvate kinase (pklr) promoter (52); and GCTCAGCCAAGGAAAAAGAGG and GTTACTGGGTCTCCACTAGA for the rat insulin I promoter (from 10 to 312). The PCR conditions were 10 min at 95 C and 25 cycles of 1 min at 95 C, 2 min at 58 C, and 1 min at 72 C. Each PCR was performed at least three independent times for each independent sample. The PCR products obtained with the immunoprecipitated DNA were normalized to that of total input DNA. The bands were visualized using a ChemiDoc System Bio-Rad Imager (Bio-Rad Laboratories, Inc., Hercules, CA) and quantified using Quantity One Imaging Software (Bio-Rad) as a function of both band size and band intensity (intensity/mm2). The PCR products obtained had the expected molecular size, and their identity was confirmed by sequencing.
Preparation of Cell Extracts and Coimmunoprecipitation Assay
Whole-cell extracts from MIN6 cells incubated with 3 or 30 mM glucose were prepared as described previously by using 1% Nonidet P-40 for lysis of the cells (53). Extracts for coimmunoprecipitation assays were prepared using the following lysis buffer: 50 mM Tris-Cl, pH 8.0; 20% glycerol; 140 mM NaCl; 0.5% Nonidet P-40; 5 mM MgCl2. 0.2 mM EDTA; 1 mM dithiothreitol; 1 mM PMSF; and protease inhibitors. After removal of cellular debris by centrifugation, the obtained supernatant was diluted with 4 volumes of dilution buffer (50 mM Tris-Cl, pH 7.5; 10% glycerol; 5 mM MgCl2; 0.2 mM EDTA; 1 mM dithiothreitol; 1 mM PMSF; and protease inhibitors). The Pdx-1 and p300 antibodies used for immunoprecipitation were the same as used for the ChIP assays. Immunoprecipitation was carried out overnight at 4 C, followed by incubation with protein A-Sepharose 4 Fast Flow (Amersham Biosciences, Arlington Heights, IL) for 12 h. The pellets were washed six times in 1 ml of wash buffer (50 mM Tris-Cl, pH 7.5; 10% glycerol; 100 mM NaCl; 0.1% Nonidet P-40; 1 mM EDTA) and resuspended in 2x SDS sample buffer. Rabbit IgG-Agarose (Sigma Chemical Co., St. Louis, MO) was used as a negative control for nonspecific binding. The antibodies used for immunoblotting are the same as given above for Pdx-1 and p300, and c-myc (9E10, Santa Cruz). Proteins were visualized using the enhanced chemiluminescent detection system (Amersham Biosciences).
RNA Isolation and RT-PCR
Poly A RNA from total RNA was isolated using the GenElute Direct mRNA Miniprep Kit (Sigma) according to the manufacturers instructions. The obtained poly A RNA was reverse transcribed using Enhanced avian myeloblastosis virus reverse transcriptase (Sigma). The resulting cDNAs were used as template for PCR with oligonucleotides to amplify the insulin and ß-actin genes. The primers used are CCTGTTGGTGCACTTCCTAC and TGCAGTAGTTCTCCAGCTGC for the mouse insulin I gene (54), and CGTGGGCCGCCCTAGGCAACC and TTGGCCTTAGGGTTCAGGGGGG for the ß-actin gene (55). The primers for the ß-actin gene cross an intron so that contamination with genomic DNA can be detected, which would result in a PCR product of 330 bp vs. 243 bp from the cDNA (55). PCRs (20 µl volume) contained 20 ng cDNA, 300 µM deoxynucleotide triphosphates, 2.5 pmol of appropriate oligonucleotide primers, and 1.5 U of JumpStart AccuTaq LA DNA polymerase (Sigma). PCR amplification conditions were as follows: 5 min at 95 C followed by 26 cycles of 95 C for 30 sec, 58 C for 1 min, and 72 C for 30 sec. The PCR products were separated on 8% nondenaturing polyacrylamide gels and stained with ethidium bromide (Sigma). The bands were visualized as described in ChIP Assay.
Construction of Pdx-1
179 Recombinant Adenovirus
The Ad-Pdx-1
179 adenovirus, which lacks the first 79 amino-terminal amino acids containing the activation domain, was constructed using the AdEasy adenoviral system as described previously (31, 56). To generate the Pdx-1
179 recombinant virus, the mouse Pdx-1 cDNA lacking the first 237 bp was amplified by PCR and subcloned into the pACCMV-myc vector in frame with a triple myc tag as BamHI/SalI fragment. The resultant plasmid was cut with HindIII to relieve Pdx-1
179 fused to myc, which was then subcloned into the HindIII site of the shuttle vector pAdTrack-CMV (31). The obtained plasmid was cotransformed into Escherichia coli BJ 5183 cells with pAdEasy-1 plasmid containing the adenoviral genome. After recombination in bacteria, the obtained plasmid was transformed into E. coli DH5
cells, and the prepared plasmid DNA was linearized and used to transfect human embryonic kidney (HEK) 293 cells using LipofectAMINE (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturers instructions. The HEK 293 cell lysate was used for additional viral amplification by several rounds of infection of HEK 293 cells. MIN6 cells were infected with a MOI 80100 using a 2-h exposure to the adenovirus (56).
Immunohistochemical Analysis
MIN6 cells were grown on acid-washed coverslips. Cells were fixed in methanol and permeabilized in 0.1% Triton as described previously (34). Endogenous Pdx-1 and p300 were visualized with the same antibodies as used for immunoprecipitation, followed by Alexa Fluor 488-conjugated goat antirabbit IgG antibodies (Molecular Probes, Inc., Eugene, OR) as the secondary antibodies. Coverslips were mounted using Vectashield (Vector Laboratories, Inc., Burlingame, CA) containing 4',6-diamidino-2-phenylindole to visualize the cell nuclei. Immunofluorescence microscopy was carried out using a laser scanning confocal microscope (Leica Corp., Deerfield, IL).
Statistical Analysis
Comparison of the histone H4 acetylation and insulin gene expression levels from MIN6 cells grown on 3 or 30 mM glucose was performed using the two-tailed, unpaired Students t test. A P value less than 0.05 was considered statistically significant. Data are expressed as means ± SD.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: CBP, CREB-binding protein; ChIP, chromatin immunoprecipitation; CREB, cAMP response element-binding protein; GFP, green fluorescent protein; HEK, human embryonic kidney; KRB, Krebs-Ringer bicarbonate; MIN6, mouse insulinoma 6; PMSF, phenylmethylsulfonylfluoride; SDS, sodium dodecyl sulfate.
Received for publication December 2, 2003. Accepted for publication May 19, 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Cha-Molstad, G. Saxena, J. Chen, and A. Shalev Glucose-stimulated Expression of Txnip Is Mediated by Carbohydrate Response Element-binding Protein, p300, and Histone H4 Acetylation in Pancreatic Beta Cells J. Biol. Chem., June 19, 2009; 284(25): 16898 - 16905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Boucher, M. Simoneau, and H. Edlund The Homeodomain-Interacting Protein Kinase 2 Regulates Insulin Promoter Factor-1/Pancreatic Duodenal Homeobox-1 Transcriptional Activity Endocrinology, January 1, 2009; 150(1): 87 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-W. Wang, M. Muguira, W.-D. Liu, T. Zhang, C. Chen, R. Aucoin, M. B Breslin, and M. S Lan Identification of an INSM1-binding site in the insulin promoter: negative regulation of the insulin gene transcription J. Endocrinol., July 1, 2008; 198(1): 29 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Eto, V. Kaur, and M. K. Thomas Regulation of Pancreas Duodenum Homeobox-1 Expression by Early Growth Response-1 J. Biol. Chem., March 2, 2007; 282(9): 5973 - 5983. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Evans-Molina, J. C. Garmey, R. Ketchum, K. L. Brayman, S. Deng, and R. G. Mirmira Glucose Regulation of Insulin Gene Transcription and Pre-mRNA Processing in Human Islets Diabetes, March 1, 2007; 56(3): 827 - 835. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Vanderford, S. S. Andrali, and S. Ozcan Glucose Induces MafA Expression in Pancreatic Beta Cell Lines via the Hexosamine Biosynthetic Pathway J. Biol. Chem., January 19, 2007; 282(3): 1577 - 1584. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Deramaudt, M. M. Sachdeva, M. P. Wescott, Y. Chen, D. A. Stoffers, and A. K. Rustgi The PDX1 Homeodomain Transcription Factor Negatively Regulates the Pancreatic Ductal Cell-specific Keratin 19 Promoter J. Biol. Chem., December 15, 2006; 281(50): 38385 - 38395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Francis, D. A. Babu, T. G. Deering, S. K. Chakrabarti, J. C. Garmey, C. Evans-Molina, D. G. Taylor, and R. G. Mirmira Role of Chromatin Accessibility in the Occupancy and Transcription of the Insulin Gene by the Pancreatic and Duodenal Homeobox Factor 1 Mol. Endocrinol., December 1, 2006; 20(12): 3133 - 3145. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Hay and K. Docherty Comparative Analysis of Insulin Gene Promoters: Implications for Diabetes Research Diabetes, December 1, 2006; 55(12): 3201 - 3213. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E Cerf Transcription factors regulating {beta}-cell function. Eur. J. Endocrinol., November 1, 2006; 155(5): 671 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iguchi, Y. Ikeda, M. Okamura, T. Tanaka, Y. Urashima, H. Ohguchi, S. Takayasu, N. Kojima, S. Iwasaki, R. Ohashi, et al. SOX6 Attenuates Glucose-stimulated Insulin Secretion by Repressing PDX1 Transcriptional Actvity and Is Down-regulated in Hyperinsulinemic Obese Mice J. Biol. Chem., November 11, 2005; 280(45): 37669 - 37680. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H Lee, J. L Volinic, C. Banz, K.-M. Yao, and M. K Thomas Interactions with p300 enhance transcriptional activation by the PDZ-domain coactivator Bridge-1 J. Endocrinol., November 1, 2005; 187(2): 283 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iype, J. Francis, J. C. Garmey, J. C. Schisler, R. Nesher, G. C. Weir, T. C. Becker, C. B. Newgard, S. C. Griffen, and R. G. Mirmira Mechanism of insulin Gene Regulation by the Pancreatic Transcription Factor Pdx-1: APPLICATION OF PRE-mRNA ANALYSIS AND CHROMATIN IMMUNOPRECIPITATION TO ASSESS FORMATION OF FUNCTIONAL TRANSCRIPTIONAL COMPLEXES J. Biol. Chem., April 29, 2005; 280(17): 16798 - 16807. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kaneto, T.-a. Matsuoka, Y. Nakatani, T. Miyatsuka, M. Matsuhisa, M. Hori, and Y. Yamasaki A Crucial Role of MafA as a Novel Therapeutic Target for Diabetes J. Biol. Chem., April 15, 2005; 280(15): 15047 - 15052. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Mosley and S. Ozcan The Pancreatic Duodenal Homeobox-1 Protein (Pdx-1) Interacts with Histone Deacetylases Hdac-1 and Hdac-2 on Low Levels of Glucose J. Biol. Chem., December 24, 2004; 279(52): 54241 - 54247. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |