| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 35294
Address all correspondence and requests for reprints to: Dr. Etty N. Benveniste, Department of Cell Biology, University of Alabama at Birmingham, 1530 3rd Avenue, South, McCallum 395, Birmingham, Alabama 35294-0005. E-mail: tika{at}uab.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
(IFN-
), to induce CIITA expression and subsequent class II MHC expression (for review see Ref. 2). CIITA is a non-DNA-binding protein that interacts with several transcription factors that are constitutively bound to the class II MHC promoter [regulatory factor-X, cAMP response element binding protein (CREB), and nuclear factor Y], as well as the basal transcription machinery. CIITA is known as the master regulator of class II MHC expression, and both constitutive as well as IFN-
-induced class II MHC expression require that the CIITA protein be associated with the class II MHC promoter before transcription can occur (for review see Ref. 3). The CREB-binding protein (CBP) functions as a transcriptional integrator that bridges transcription factors with the basal transcription machinery (4). CBP is also a histone acetyltransferase (HAT) that can acetylate the four core histones (5, 6). Investigators have shown that CBP binds to CIITA and that, together, these two proteins act synergistically to increase class II MHC transcription (7, 8). Recent work has also shown that CIITA association with the class II MHC promoter correlates with H3 and H4 histone acetylation (9, 10). Acetylation of histones results in an "open" chromatin conformation that often results in gene transcription (for review see Ref. 11).
Estrogen is a steroid hormone that can influence multiple immunological processes (12, 13, 14, 15). In general, low concentrations of estrogen tend to have proinflammatory effects on the immune system, whereas high concentrations promote antiinflammatory events. Estrogen has regulatory effects on a wide variety of immunological compounds such as IL-6, TNF-
, TGF-ß, endothelial nitric oxide synthase (NOS), and class II MHC (16, 17, 18, 19, 20). Two nuclear receptors for estrogen (ER) have been identified, ER
and ERß (21). The classical estrogen-signaling pathway is mediated by ligated and dimerized ER binding to specific estrogen response elements (EREs) located in the promoters of estrogen-responsive genes. The ER can recruit and interact with a variety of cofactors on the promoter to influence gene expression (21, 22). Multiple antiestrogenic compounds, known as selective ER modulators, have been identified that can modify or block the classical nuclear signaling pathway (23, 24). Tamoxifen (TAM) is a compound that can have both agonist and antagonist effects on the ER depending on the cell type and promoter context. For example, TAM has antagonist effects on mammary tissue so it can be used to treat estrogen-responsive breast cancer (25). However, TAM has agonist activities on uterine tissues and can potentially induce cancerous changes in these tissues (26). ICI 182,780 (ICI), on the other hand, is considered to be a pure antiestrogen with respect to the classical nuclear signaling pathway. This compound not only blocks ER-mediated transcriptional events, but also induces ER degradation (24).
ERs can also associate with promoters in an ERE-independent manner. Rather than binding directly to the DNA, ligated ER can tether to other transcription factors through protein-protein interactions. These interactions have been identified between ER and activator protein 1 (AP-1), specificity protein 1, small mothers against decapentaplegic-4, and other transcription factors (22, 27, 28, 29). Estrogen is also known to mediate rapid nongenomic events by activating many different secondary signaling cascades (for review see Refs. 30 and 31). These events are too rapid, on the order of minutes, to be mediated by the classical nuclear signaling pathway (32). Estrogen can activate the MAPK pathways, protein kinase A (PKA), NOS, phosphoinositide-3 kinase (PI3K), and cyclooxygenase (COX) as well as multiple other signaling pathways, ion fluxes, and modifications of other proteins (for review see Refs. 30 and 31). However, the mechanisms by which estrogen activates these processes have yet to be conclusively elucidated (for review see Ref. 22). Although the antiestrogens TAM and ICI generally antagonize the effects of estrogen, these compounds can also activate some of the same rapid nongenomic events that are mediated by estrogen (26, 33). In general, estrogen signaling usually results in activation of transcription (19, 34, 35, 36); however, there are several reports demonstrating that estrogen can mediate transcriptional repression as well (37, 38, 39, 40).
The MAPK pathways are mediated by a family of serine/threonine kinases that amplify and integrate many different extracellular stimuli and direct signaling pathways that modify gene transcription and cellular responses accordingly (for review see Ref. 41). There are three major MAPK signaling pathways: ERK 1/2, p38 kinases, and the c-Jun N-terminal kinases (JNKs)/stress-activated protein kinases (for review see Ref. 41). The JNK signaling pathway is activated primarily by cytokines and cellular stress (for review see Ref. 42). However, estrogen, as well as antiestrogens, have been shown to activate the JNK-signaling cascade (25, 43, 44). The JNK protein becomes activated after it is phosphorylated at a specific tyr-pro-thr motif. Activated JNK, in turn, phosphorylates and subsequently activates the c-Jun and ATF-2 transcription factors (for review see Ref. 42), which belong to the family of AP-1 proteins. These proteins bind to specific elements in the promoters of genes and can either activate or repress transcription (43, 44).
In a previous report, we demonstrated that 17ß-estradiol (E2) stimulation results in down-regulation of both constitutive and IFN-
-induced class II MHC expression (20). This down-regulation was not associated with decreased CIITA mRNA or protein levels; rather, we found that inhibition was associated with changes on the class II MHC promoter. Notably, E2 stimulation resulted in hypoacetylation of H3 and H4 histones and decreased CBP recruitment to the promoter (20). These E2-mediated promoter events are likely responsible for the decreased transcription of the class II MHC gene. In this study, we find that blocking the classical estrogen-signaling pathway with the antiestrogens TAM and ICI does not prevent E2-mediated inhibition of class II MHC expression. Rather, TAM and ICI mimic E2 and also down-regulate class II MHC expression without influencing the level of CIITA expression. These findings suggest that E2 is mediating its effects through a nonclassical signaling pathway. Using multiple pharmacological inhibitors, we determined that E2, TAM, and ICI are activating the JNK MAPK pathway, which results in transcriptional inhibition of class II MHC expression. Through chromatin immunoprecipitation (ChIP) assays, we demonstrate that blocking the JNK pathway leads to a complete reversal of E2-mediated hypoacetylation of H3 and H4 histones and restores CBP levels on the class II MHC promoter. In addition, we show that ATF-2 is recruited to the class II MHC promoter in the presence of E2, and that this association is completely blocked by inhibiting the JNK-signaling pathway. Finally, our results demonstrate that E2 stimulation results in both ER
and ERß association with the class II MHC promoter. This association is not diminished by blocking the JNK pathway and therefore is likely independent of this signaling cascade. Together, these data demonstrate that E2 activation of the JNK-signaling pathway is crucial for E2-mediated down-regulation of class II MHC expression.
| RESULTS |
|---|
|
|
|---|
, we find that class II MHC protein expression is highly up-regulated on the cell surface (Fig. 1A
results in greater than 50% inhibition of class II MHC protein expression when compared with cells treated with IFN-
alone (Fig. 1A
and the antiestrogens TAM or ICI results in approximately a 30% decrease in IFN-
-induced class II MHC protein expression when compared with IFN-
treatment alone (Fig. 1A
induced class II MHC protein expression in IBE cells (Fig. 1A
-induced class II MHC expression. Rather, both TAM and ICI mimic E2 inhibition of class II MHC expression, and, when these compounds are combined with E2, they do not prevent E2-mediated down-regulation of class II MHC expression.
|
class II MHC mRNA expression by approximately 50%, and this inhibition is not reversed by the antiestrogens TAM and ICI (Fig. 1B
-induced class II MHC mRNA expression (Fig. 1B
-induced CIITA mRNA expression (Fig. 1C
IBE cells stably transfected with a CIITA expression construct constitutively express class II MHC protein, thereby bypassing the need for IFN-
stimulation to up-regulate class II MHC expression [described elsewhere (20)]. We have previously demonstrated that E2 inhibits class II MHC expression in IBE-CIITA cells by approximately 3040%, without any decrease in transcriptional activity of the CIITA construct (20). Experiments performed in IBE-CIITA cells show that TAM and ICI inhibit constitutive class II MHC protein expression to the same degree as E2 (Fig. 1D
). When E2 is combined with TAM or ICI, we find a slight augmentation of class II MHC protein inhibition. These results show that rather than blocking the inhibitory effect of E2, the antiestrogens TAM and ICI mimic E2 inhibition of constitutive class II MHC expression. This suggests that E2, as well as TAM and ICI, signal in a manner other than the classical nuclear signaling pathway.
JNK Inhibitors Block E2-Mediated Down-Regulation of Class II MHC Protein in IBE Cells Constitutively Expressing CIITA
E2 can activate the MAPK and other signaling pathways through nongenomic mechanisms (30, 31). Pharmacological inhibitors of the MAPK pathways were used to determine whether E2 was mediating its inhibitory effect on class II MHC expression through the MAPK pathways. A 24-h treatment of IBE-CIITA cells with E2 results in approximately a 3040% decrease in class II MHC protein levels on the cell surface (Fig. 2
, A and B). Pretreatment of IBE-CIITA cells with pharmacological MAPK kinase 1/2 or ERK 1/2 inhibitors (PD98059 or U0126, respectively) or with a pharmacological p38 inhibitor (SB202190) does not affect the E2-inhibitory effect on class II MHC protein expression (Fig. 2A
). However, pretreatment with the JNK inhibitors, JNKi II or curcumin, completely reverses the E2 inhibition of class II MHC expression (Fig. 2B
). Dose-response studies of JNKi II and curcumin demonstrate that a 10 µM dose of each compound is the most effective for completely reversing the effect of E2 on class II MHC expression with minimal effects on cell viability (data not shown). Similar results are observed when the JNK inhibitors are used on wild-type IBE cells that are treated with IFN-
and E2 (data not shown), i.e. a reversal of the inhibitory effect of E2. Additional experiments were performed using PKA, PI3K, NOS, COX, and G protein-coupled receptor pharmacological inhibitors: none of these compounds exhibited any inhibitory effect on E2 mediated down-regulation of class II MHC protein expression in IBE-CIITA cells (data not shown). These data suggest that the JNK MAPK pathway is important for E2-mediated down-regulation of class II MHC expression.
|
|
c-Jun and ATF-2 are two downstream substrates of activated JNK. JNK phosphorylates c-Jun and ATF-2, which results in activation of these transcription factors (47). We find low constitutive phosphorylation of both c-Jun and ATF-2 that is inhibited by JNKi II (Fig. 4
, lanes 1 and 2). Stimulation of IBE cells with E2, TAM, ICI, and TNF-
(a positive control for JNK activation), results in substantial increases in both c-Jun and ATF-2 phosphorylation (lanes 3, 5, 7, and 9), which is blocked by the JNKi II compound (lanes 4, 6, 8, and 10). Dose-response studies were performed indicating that c-Jun was phosphorylated in the presences of as little as 10 nM E2 (data not shown). Together these data show that E2, TAM, and ICI activate the JNK MAPK signaling cascade, and that the JNKi II compound blocks this activation in IBE cells.
|
-induced and constitutive class II MHC expression was correlated with hypoacetylation of histones H3 and H4, as well as decreased recruitment of CBP to the class II MHC promoter (20). To determine whether or not E2 activation of the JNK-signaling pathway was necessary to mediate these changes on the class II MHC promoter, we performed ChIP assays to analyze E2 modifications of the class II MHC promoter in the absence or presence of JNKi II (Fig. 5
|
Additional ChIP experiments were performed to assess whether ERs and members of the AP-1/CREB family of transcription factors were recruited to the class II MHC promoter. We show, for the first time, that treatment with E2 leads to enhanced ER
and ERß association with the class II MHC promoter (Fig. 5
, lanes 1 and 2). However, the JNKi II compound has no effect on ER recruitment to the promoter (lanes 3 and 4), which suggests that the association of ER
and ERß with the class II MHC promoter is independent of the JNK MAPK pathway. E2 stimulation of IBE-CIITA cells results in a marked increase of ATF-2 association with the class II MHC promoter (lanes 1 and 2), which is completely abrogated by the JNKi II compound (lane 4). This novel finding suggests that E2 activation of the JNK-signaling pathway results in increased ATF-2 association with the class II MHC promoter. No significant changes in the levels of other AP-1 proteins (c-Jun, c-Fos, and Fra-1) or CREB were noted at the class II MHC promoter in the absence or presence of E2 (data not shown).
| DISCUSSION |
|---|
|
|
|---|
and ERß are recruited to the class II MHC promoter in the presence of E2, and that this association is not reversed by blocking JNK signaling. Together, these results demonstrate that E2 mediates inhibition of class II MHC expression through activation of the JNK MAPK pathway. The majority of autoimmune diseases have a gender bias toward the female population. More than two thirds of individuals with autoimmune disease in the United States are women (48). This observation suggests that sexually dimorphic hormones such as estrogen and testosterone play a role in this phenomenon. The immunomodulatory effects of estrogen are quite remarkable in that estrogen can act as either a pro- or an antiinflammatory mediator depending on the level of hormone present. Low circulating levels seem to promote inflammatory processes, but high levels, like those measured during pregnancy, dampen inflammatory responses. It is interesting to note that women with cell-mediated autoimmune diseases (e.g. multiple sclerosis and rheumatoid arthritis) often experience a significant degree of remission during pregnancy when circulating estrogen levels are at their highest (49, 50).
Estrogen can signal through many different pathways to modify gene expression. The classical nuclear signaling pathway is activated by estrogen ligation and dimerization of the ER, which then binds to specific EREs, located in the promoters of estrogen-responsive genes (21, 22). Antiestrogens such as TAM and ICI generally inhibit estrogen signaling through the classical pathway (23, 24). However, we find that neither compound blocks E2-mediated inhibition of class II MHC protein and mRNA expression. Interestingly, TAM and ICI also inhibit both constitutive and IFN-
-induced class II MHC expression, and like E2, TAM and ICI do not inhibit IFN-
-induced CIITA mRNA expression (Fig. 1
). These observations suggest that the inhibitory effect of E2 occurs through a nonclassical signaling pathway.
Dose-response studies were performed with E2, TAM, and ICI on both wild-type IBE and IBE-CIITA cell lines (data not shown). From these experiments we determined that maximal inhibition of class II MHC expression by E2 was achieved at a 1 µM concentration; however, we found up to 30% inhibition at 10 nM concentrations. Similarly, maximum inhibition of class II MHC expression by TAM and ICI was achieved at 1 µM concentrations; higher doses had some toxic effects on the IBE cells. Although we recognize that the maximal E2 dose used in this in vitro study is higher than the in vivo concentration of E2 found during pregnancy, these results are relevant in light of other studies employing in vivo animal models to study the effects of estrogen on the immune system. For example, investigators have shown that when rodents receiving tissue transplants are treated with physiological doses of estrogen, they display diminished or absent class II MHC expression on allograft vasculature, which corresponds to better graft function and survival (51, 52).
Estrogen activates many signaling events that are independent of the classical signaling pathway. This hormone can activate ion fluxes and multiple signal transduction cascades and cause modifications of membrane receptors and transcription factors (for review see Refs. 30 and 31). TAM and ICI have also been shown to mediate some of these same nongenomic events (26, 33). Estrogen and antiestrogens have been reported to activate the MAPK signaling pathways (25, 43, 44, 53). However, the specific pathways that are activated and the significance of this activation appears to depend on the cell type and system under investigation. We used multiple pharmacological inhibitors to block the MAPK pathways (Fig. 2
) as well as pharmacological inhibitors that block PKA, PI3K, NO, COX, and the major G protein-coupled receptor pathways (data not shown). JNKi II is a potent reversible inhibitor of the c-Jun N-terminal kinase. This compound has greater than 300-fold selectivity for JNK when compared with ERK 1/2 or p38 (54, 55). Curcumin, a spice commonly used in Indian cuisine and lauded for its antiinflammatory properties, is also a potent inhibitor of the JNK signaling pathway (56, 57). We find that the JNK inhibitors JNKi II and curcumin are the only compounds that reverse the effects of E2, TAM, and ICI on class II MHC expression. These results demonstrate that an intact JNK-signaling pathway is necessary for E2, TAM, and ICI inhibition of class II MHC expression.
We demonstrate that E2, TAM, and ICI stimulation can lead to phosphorylation and thus activation of the c-Jun and ATF-2 transcription factors (Fig. 4
). The JNKi II compound completely abolishes c-Jun and ATF-2 activation by E2, TAM, and ICI. c-Jun and ATF-2 can form homo- or heterodimers together or with other members of the AP-1/CREB family (47). The activated transcription factors bind to the promoter regions of a diverse assortment of genes, and this leads to either activation or inhibition of gene transcription (40, 58, 59, 60, 61). Several members of the AP-1 family are known to bind to the class II MHC promoter (62, 63, 64). Although we demonstrate by immunoblotting that E2 can activate c-Jun, our ChIP assays do not demonstrate any changes in c-Jun levels on the class II MHC promoter in the presence of E2 (data not shown). On the other hand, E2 activation of ATF-2 correlates with significant recruitment of this transcription factor to the class II MHC promoter (Fig. 5
). ATF-2 homodimers and Jun:ATF-2 heterodimers preferentially bind to the cAMP-response element (47). Studies have shown that one of the conserved cis-elements located in the class II MHC promoter, known as the X-box, is a cAMP response element that is constitutively bound by CREB (62, 63). It is interesting to speculate that E2-activated ATF-2 dimers might displace CREB from the X-box and therefore disrupt the classical organization of the class II MHC promoter, which might lead to decreased CBP recruitment and hypoacetylation of histones. However, we did not find any changes in CREB association with the class II MHC promoter after E2 treatment, which suggests that ATF-2 is binding to another site on the class II MHC promoter. E2 treatment did not alter the levels of c-Fos or Fra-1, the only other AP-1 members identified by our ChIP experiments, on the class II MHC promoter (data not shown).
To our knowledge, this is the first report to identify ER
and ERß bound to the class II MHC promoter in the presence of E2. Three putative EREs were identified within the 1.0-kb region upstream of the transcriptional start site. However, we are unable to detect ER binding directly to these sites through EMSAs using both nuclear extracts and recombinant ER proteins (our unpublished observation). It is possible that the ERs are binding to the DNA at other sites, or ER may be tethered to other transcription factors through protein-protein interactions. JNKi II did not block the association of ER
or ERß with the class II MHC promoter, which indicates that this association is independent of the JNK signaling pathway. It is not clear whether or not ER binding to the promoter is necessary for inhibition of class II MHC transcription. Future studies using cells deficient in one or both of the receptor subtypes as well as studies involving short interfering RNA directed against the ER can be used to address this issue.
CIITA, the master regulator of class II MHC expression, is a non-DNA-binding protein that binds to transcription factors and the basal transcription machinery at the class II MHC promoter. CIITA association with the promoter is directly correlated with histone acetylation, which is necessary for class II MHC gene transcription (9, 10). In previous studies, we and others have shown that E2 does not inhibit CIITA expression (20) nor does E2 significantly decrease CIITA association with the class II MHC promoter (65). We find that E2-mediated inhibition of class II MHC expression correlates with hypoacetylation of H3 and H4 histones and with diminished CBP association with the promoter (Fig. 5
and Ref. 20). These changes cause chromatin to adopt a "closed" conformation that is not conducive for transcription. Hypoacetylation and reduced CBP binding in the presence of E2 are completely reversed by blocking the JNK signaling pathway (Fig. 5
). Although our results strongly suggest that inhibition of class II MHC is due to E2 activation of the JNK MAPK pathway, the molecular connection(s) between the JNK-signaling pathway, histone acetylation, and CBP recruitment at the class II MHC promoter remains unclear. There are likely other mechanisms involved that are specific to E2 signaling and the class II MHC promoter because other activators of JNK (e.g. TNF-
and phorbol 12-myristate-13-acetate) do not inhibit class II MHC expression (our unpublished observation). Further studies that will help define more of the molecular changes that occur on the class II MHC promoter in the presence of E2 are planned.
The etiologies of most autoimmune diseases are unknown, but aberrant expression of class II MHC is suspected to be one of the factors in this pathological process (66, 67). We and others have shown that estrogen can down-regulate class II MHC expression, which in turn may lead to suppression of inflammatory responses. This is one possible scenario by which pregnancy-mediated remission of autoimmune disease occurs. Until now, the mechanism by which estrogen meditates inhibition of class II MHC expression was unknown. We provide evidence that E2 is signaling in a manner other than the classical nuclear pathway because the antiestrogens TAM and ICI do not prevent E2 down-regulation of class II MHC. Instead, these compounds mimic E2 by inhibiting class II MHC expression on their own without any effect on CIITA expression. Blocking the JNK MAPK pathway completely reverses the inhibitory effects of E2, TAM, and ICI on class II MHC protein expression and prevents activation of c-Jun and ATF-2 by these compounds. Additionally, we find that the JNKi II compound reverses E2-mediated hypoacetylation of histones and diminished CBP recruitment to the class II MHC promoter and restores class II MHC expression levels. By determining the mechanisms by which estrogen and antiestrogens mediate inhibition of class II MHC expression, we may be one step closer to finding alternate treatments against cell-mediated autoimmunity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, 4 mM L-glutamine, and 2.5 µg/ml amphotericin-B, as previously described (20). IBE-CIITA cells were generated by transfecting IBE cells with a pcDNA3 expression vector containing N-terminal Flag-tagged cDNA of human CIITA described elsewhere (20). IBE-CIITA cells stably express CIITA and therefore constitutively express class II MHC. IBE-CIITA cells are cultured under the same conditions as IBE cells (see above), with the addition of G418 sulfate (400 µg/ml) to the culture media.
E2, TAM, and curcumin were purchased from Sigma Chemical Co. (St. Louis, MO). ICI was purchased from Tocris Cookson, Inc. (Ellisville, MO). Recombinant murine IFN-
and TNF-
were purchased from Endogen (Woburn, MA). JNKi II (SP600125), PD98059, U0126, and SB202190 were purchased from Calbiochem (San Diego, CA). Phycoerythrin-conjugated rat IgG antimouse class II MHC antibody (clone NIMR-4) was purchased from Southern Biotechnology Associates (Birmingham, AL). Mouse antiphospho-c-Jun (clone KM-1), rabbit anti-c-Jun (clone N), rabbit antiphospho-ATF-2 (clone thr 71), rabbit anti-ATF-2 (clone N-96), rabbit anti-CBP (clone A-22), rabbit anti-ER
(clone mc-20), rabbit anti-ERß (clone H-150), rabbit anti-CREB-1 (clone C-21), rabbit anti-c-Jun (clone N), rabbit anti-c-Fos (clone 4), and rabbit anti-Fra-1 (clone N-17) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Antibodies directed against acetylated histone H3 and acetylated histone H4 were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY).
Fluorescence-Activated Cell Sorting (FACS)
Cells were plated at 3.0 x 105 cells per well into six-well plates and allowed to grow for 1216 h in media supplemented with 10% FBS. Serum-containing media were aspirated and 2 ml of fresh serum-free media were added to each well. The cells were then treated with 4 U/ml of murine IFN-
, 1 µM E2, 1 µM TAM, or 1 µM ICI either alone or in various combinations for 36 h (IBE cells) or 24 h (IBE-CIITA cells). For experiments using the MAPK inhibitors, cells were pretreated for 1 h with 10 µM JNKi II, 10 µM curcumin, 25 µM PD98059, 25 µM U0126, or 1 µM SB202190 followed by stimulation with IFN-
, E2, TAM, or ICI. Cells were trypsinized and stained for class II MHC antigens as previously described (69). Negative controls were stained with an isotype-matched control antibody.
RNA Isolation, Riboprobes, and Ribonuclease Protection Assay (RPA)
Total cellular RNA was isolated from confluent monolayers of cells that were treated with IFN-
, E2, TAM, ICI, or various combinations for 24 h to assay for IE-ß or 12 h to assay for CIITA mRNA (20).
A pGEM-4Z vector containing a fragment of the mouse CIITA cDNA corresponding to bp 27243152 was linearized with PvuI. In vitro transcription of this fragment with T7 polymerase generates a 627-bp antisense RNA probe. A pT7T3 vector containing murine H2-IE-ß cDNA (Integrated Molecular Analysis of Genomes and their Expression clone ID: 1262900) was purchased from ATCC (Manassas, VA). The vector was linearized with XmnI, and in vitro transcription of this construct with T3 polymerase yielded a 338-bp antisense RNA probe, which encompasses bp 829-1119 of the IE-ß cDNA. A pGEM-4Z vector containing a fragment of the mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA, corresponding to bp 223434, was linearized with NcoI and used to generate a 145-bp antisense RNA probe (70).
RPAs were conducted with the RPA III kit from Ambion (Austin, TX) according to the manufacturers instructions and as previously described (71). Briefly, 30 µg of RNA were hybridized with IE-ß, CIITA, and GAPDH riboprobes (3.0 x 104 cpm) at 42 C overnight in 20 µl of hybridization buffer. The hybridization mixture was then treated with RNaseA/T1 at 37 C for 30 min and analyzed by 5% denaturing PAGE, and the gels were exposed to a phosphorimaging cassette (Molecular Dynamics, Inc., Sunnyvale, CA). The protected fragment sizes for IE-ß, CIITA, and GAPDH riboprobes are 290, 429, and 87 nucleotides in length, respectively. Quantification of the protected RNA fragments was performed by scanning with the PhosphorImager (Molecular Dynamics) and analyzing with the ImageQuant v1.2 program (Molecular Dynamics). Values for IE-ß and CIITA mRNA expression were normalized to GAPDH mRNA levels for each experimental condition.
JNK Activity Assay
IBE cells were plated at 3.5 x 106 cells per 100-mm dish and allowed to grow for 1216 h in media containing 10% FBS. Fresh serum-free media were then added, and the cells were serum starved for 1 h. Next, IBE cells were pretreated with 10 µM JNKi II for 1 h followed by stimulation with 1 µM E2, 1 µM TAM, 1 µM ICI, or 10 ng/ml of TNF-
for 20 min. IBE cells were then lysed using chilled lysis buffer plus phosphatase and proteinase inhibitors [20 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton-100, 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerolphosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1 mM phenylmethylsulfonylfluoride (PMSF)-20]. Cell lysates were than analyzed for JNK activity using a commercially available nonradioactive in vitro kinase assay kit (Phospho-SAPK/JNK Pathway Sampler Kit, Cell Signaling Technology, Beverly, MA).
Immunoblotting
IBE cells were plated at 3.5 x 106 cells per 100-mm dish and allowed to grow for 1216 h in media containing 10% FBS. Fresh serum-free media were then added and the cells were serum starved for 1 h. Next, IBE cells were pretreated with 10 µM JNKi II for 1 h followed by stimulation with 1 µM E2, 1 µM TAM, 1 µM ICI, or 10 ng/ml of TNF-
for 20 min. IBE cells were then lysed using chilled lysis buffer plus phosphatase and proteinase inhibitors (20 mM Tris; pH 7.5; 150 mM NaCl; 1% Triton-100, 1 mM EDTA; 1 mM EGTA; 2.5 mM sodium pyrophosphate; 1 mM ß-glycerolphosphate; 1 mM Na3VO4; 1 µg/ml leupeptin; and 1 mM PMSF-20). Total cell lysate (60 µg) was subjected to 10% SDS-PAGE. Proteins were then transferred to a nitrocellulose membrane and probed with antibody directed against phospho-c-Jun, total c-Jun, phospho-ATF-2, and total ATF-2 (1:300 dilution). Enhanced chemiluminescence (ECL) was used for the detection of bound antibody.
ChIP Assay
IBE-CIITA cells were plated at 8.0 x 106 cells per 150-mm dish and allowed to grow for 1216 h in media containing 10% FBS. Serum-containing media were aspirated, and 15 ml of fresh serum-free media were added to each plate. IBE-CIITA cells were either left untreated or were pretreated with 10 µM of JNKi II for 1 h before stimulation with 1 µM E2 for 4.5 h. After treatment, cells were trypsinized, washed one time in 10% FBS containing media to inactivate the trypsin, and then washed two times in cold PBS. Next, cells were resuspended in a hypotonic buffer containing phosphatase and protease inhibitors (10 mM HEPES, 1.5 MgCl2, 10 mM KCl, 1 mM NaF, 1 mM sodium orthovanadate, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20) and incubated on ice for 10 min. A final concentration of 0.5% Nonidet P-40 was added to the suspension to release cell nuclei by lysing the plasma membrane. Nuclei were washed in cold PBS one time, resuspended in 1% paraformaldehyde, and incubated at room temperature for 15 min to cross-link chromatin. Nuclei were then washed two times with cold TE buffer containing phosphatase and protease inhibitors (10 mM Tris-HCl, 1 mM EDTA, 1 mM NaF, 1 mM sodium orthovanadate, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20). Nuclei were resuspended in 2 ml of TE buffer, and cross-linked chromatin was sheared by sonication to an average size of 500-bp fragments. Samples were then centrifuged at 14,000 rpm, 4 C, for 15 min to remove nuclear debris. Supernatant was collected and chromatin concentrations were measured.
Chromatin (100500 ng) was added to RIPA buffer containing phosphatase and protease inhibitors (50 mM Tris-HCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 1 mM sodium orthovanadate, 5 µg/ml aprotinin, 5 µg/ml leupeptin, and 1 mM PMSF-20) and precleared with salmon sperm DNA/protein A agarose beads purchased from Upstate Biotechnology. Next, cross-linked chromatin was immunoprecipitated using 5 µg of antibody against acetylated H3 or H4, CBP, ATF-2, ER
and ERß proteins, or 5 µg of normal rabbit IgG control. The antibody/chromatin solution was mixed gently on a rotator for at least 16 h at 4 C. To collect antibody and chromatin complexes, salmon sperm DNA/protein A agarose beads were added, and the solution was again gently rotated at 4 C for 2 h. Immune complex-bound beads were washed, and the cross-linked chromatin was eluted from the beads. To remove cross-links from precipitated chromatin, NaCl was added at a final concentration of 200 µM to the eluate, and the mixture was incubated for at least 12 h at 65 C. Next, EDTA (pH 8.0) and Tris-HCl (pH 6.5) (final concentrations 10 mM and 40 mM, respectively) and 15 mg/ml proteinase K were added to the eluate and placed in a shaker at 37 C for 2 h. DNA was recovered with phenol-chloroform-isoamyl (25:24:1) extraction and ethanol precipitation and then resuspended in nuclease-free water.
PCR was performed on 2% of input and 2040% of immunoprecipitated DNA using primers specific for the mouse H2-IEß promoter: forward, 5'-3' AAACAACCCAAAGCAAAACC; and reverse, 5'-3' TCAGCATCAAAGGAGTCCAG. The amplified 283-bp PCR product was separated on a 2% agarose gel containing ethidium bromide and visualized using UV light.
Statistical Analysis
Levels of significance for comparisons between samples were determined using Students t test distribution.
| FOOTNOTES |
|---|
First Published Online September 23, 2004
Abbreviations: AP-1, Activator protein 1; APC, antigen presenting cell; ATF, activating transcription factor; CBP, CREB-binding protein; ChIP, chromatin immunoprecipitation; COX, cyclooxygenase; CREB, cAMP response element-binding protein; CIITA, class II transactivator; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen response element; FACS, fluorescence-activated cell sorting; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IBE, Immortomouse brain endothelial; ICI, ICI 182,780; IE-ß, class II MHC; IFN, interferon; JNK, c-Jun N-terminal kinase; MHC, major histocompatibility complex; NOS, nitric oxide synthase; PI3K, phosphoinositide-3 kinase; PKA, protein kinase A; PMSF, phenylmethylsulfonyl fluoride; RPA, ribonuclease protection assay; TAM, tamoxifen.
Received for publication July 5, 2004. Accepted for publication September 13, 2004.
| REFERENCES |
|---|
|
|
|---|
production and reduces the severity of experimental autoimmune encephalomyelitis in cytokine knockout mice. J Immunol 167:542552
transcription requires estrogen receptor activation function-2 and is enhanced by coactivators. Proc Natl Acad Sci USA 96:1516115166
(ER
) required for ER
/Sp1-mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol Endocrinol 17:804817
. J Biol Chem 278:1519215200
response pathways. Mol Endocrinol 17:25092518
. Cell 52:773782