Molecular Endocrinology, doi:10.1210/me.2004-0016
Molecular Endocrinology 19 (1): 138-147
Copyright © 2005 by The Endocrine Society
The Pituitary-Specific Transcription Factor, Pit-1, Can Direct Changes in the Chromatin Structure of the Prolactin Promoter
Paul Kievit and
Richard A. Maurer
Department of Cell and Developmental Biology, Oregon Health & Science University, Portland, Oregon 97239
Address all correspondence and requests for reprints to: Richard A. Maurer, Department of Cell and Developmental Biology, L215, Oregon Health & Science University, 3181 South West Sam Jackson Park Road, Portland, Oregon 97239. E-mail: maurerr{at}ohsu.edu.
 |
ABSTRACT
|
|---|
The chromatin structure of a promoter is an important determinant of its transcriptional activity. Many promoters are assembled into repressive polynucleosomal arrays that are subsequently remodeled to allow for the activation of gene expression. This study addresses the contribution of a single transcription factor, Pit-1, in orchestrating the chromatin structure of the prolactin gene. Utilizing an in vivo reconstitution system, we found that Pit-1 can bind to multiple sites in the chromatin-assembled 5'-flanking region of the prolactin gene and activate transcription from the chromatin-assembled template. Interestingly, Pit-1 was able to substantially alter micrococcal nuclease digestion of the prolactin 5'-flanking region, and the results are consistent with presence of a translationally positioned nucleosome on the prolactin promoter. Changes in micrococcal nuclease digestion were also observed with a truncated Pit-1 mutant containing only the DNA-binding domain. As the truncation mutant was unable to activate transcription from the chromatin-assembled template, the ability of Pit-1 to alter chromatin structure of the prolactin gene is not dependent on transcriptional activation. We propose that Pit-1 likely plays a role in altering chromatin to facilitate recruitment and subsequent transcriptional activation by additional factors.
 |
INTRODUCTION
|
|---|
AN IMPORTANT ASPECT OF transcriptional regulation in eukaryotes involves packaging the DNA of inactive genes into repressive polynucleosome arrays (1). The process of transcriptional activation for a particular gene then involves the actions of sequence-specific DNA-binding factors leading to the recruitment of chromatin-modifying enzymes (2). These enzymes include factors that covalently modify histones and other chromatin proteins (3) and ATP-dependent chromatin-remodeling complexes (4, 5). The actions of these enzymes lead to modifications in chromatin structure that contribute to transcriptional activation. Changes in chromatin structure may involve a loss or redistribution of nucleosomes or a positioning of nucleosomes in a way that structurally facilitates interactions of transcription factors.
There are still many unanswered questions concerning the role of individual components in modulating chromatin structure. One question concerns the ability of specific, DNA-binding transcription factors to direct remodeling of chromatin. Although eukaryotic promoters generally contain binding sites for multiple factors, there is evidence that a single factor can direct changes in chromatin structure. For instance, GAGA factor appears to play a crucial role in positioning nucleosomes on the Drosophila heat shock protein (hsp)26 promoter (6), and reconstitution experiments have shown that GAGA factor can direct chromatin remodeling in vitro (7). In vitro chromatin reconstitution studies have shown that the yeast Pho4 transcription factor can remodel the PHO5 promoter (8). Similarly, it has been demonstrated that in vitro, the winged helix factor, hepatocyte nuclear factor-3 (HNF3), can direct positioning of a nucleosome on an enhancer from the albumin gene (9). An in vivo chromatin reconstitution system using Xenopus oocytes has been used to demonstrate that the thyroid hormone receptor can direct chromatin remodeling (10, 11).
In the present study we have examined the ability of the tissue-specific POU transcription factor, Pit-1 (12, 13), to direct changes in the chromatin structure of the prolactin promoter. Prolactin is a simple polypeptide hormone that is synthesized and secreted by the anterior pituitary. The proximal promoter region and distal enhancer of the prolactin gene contain multiple Pit-1 binding sites, and Pit-1 has been shown to be sufficient to activate the prolactin promoter in heterologous cells and in vitro (14). As cells that synthesize prolactin demonstrate changes in the chromatin structure of the prolactin gene (15, 16), it seems possible that Pit-1 contributes to the development of a specific chromatin structure. In addition, Pit-1 has been shown to interact with the coactivator, cAMP response element binding protein (CREB) binding protein (CBP), and the nuclear receptor corepressor (N-CoR) (17). As CBP has been shown to have intrinsic and associated histone acetyltransferase activity (18, 19, 20) and N-CoR associates with a histone deacetylase (21, 22), it is possible that recruitment of CBP or N-CoR by Pit-1 leads to localized changes in histone acetylation. Transfection experiments have provided evidence that Pit-1 can enhance acetylation of histone H4 on the prolactin promoter (23). Thus, it is possible that Pit-1 can modulate the status of histone acetylation on the prolactin promoter, perhaps leading to changes in chromatin structure.
We have used Xenopus oocytes as an in vivo chromatin reconstitution system (24) to study the ability of Pit-1 to direct changes in chromatin structure. The results of these studies offer evidence that Pit-1 can lead to positioning of a nucleosome in the proximal promoter region of the prolactin gene.
 |
RESULTS
|
|---|
Regulation of Prolactin Gene Expression by Pit-1 in Xenopus Oocytes
We have used Xenopus laevis oocytes as an in vivo chromatin reconstitution system to examine a role for Pit-1 in modulating the chromatin structure of the prolactin gene. As oocytes can assemble exogenous DNA into a chromatin template with physiologically spaced nucleosomes, this system provides a very useful in vivo model for studying chromatin structure and transcription (24). We microinjected oocytes with a reporter gene containing approximately 1900 bp of the 5'-flanking region and promoter of the rat prolactin gene linked to luciferase (1.9PRL-Luc). Previous studies have demonstrated the presence of multiple Pit-1 binding sites (14) in both the proximal region (designated 1P, 2P, 3P, and 4P) and distal enhancer (designated 1D, 2D, 3D, and 4D) of the prolactin gene (Fig. 1A
). In an initial experiment we used digestion with micrococcal nuclease to assess assembly of the prolactin reporter gene into a polynucleosome array (Fig. 1B
). The prolactin reporter gene was microinjected into oocytes and after incubation for various time intervals, the oocytes were homogenized and incubated with increasing amounts of micrococcal nuclease. When microinjected oocytes were homogenized immediately with no time to assemble chromatin, micrococcal nuclease yielded only a smear (compare lanes 1 and 2). At 4 and 18 h after microinjection, a regularly spaced ladder of micrococcal nuclease digestion products, suggesting the assembly of a polynucleosome array (lanes 810 and 1214), could be detected. Even as early as an hour after microinjection, it appeared that mono- and dinucleosomes had assembled on the injected DNA (lanes 46).

View larger version (88K):
[in this window]
[in a new window]
|
Fig. 1. Time Course of Nucleosome Formation on the Prolactin Promoter in Oocytes
A, Schematic diagram indicating the relative location of Pit-1-binding sites in the prolactin gene. Pit-1 sites in the proximal region are designated 1P4P, and sites in the distal enhancer region are designated 1D4D. The 1.9 PRL-Luc reporter construct used in these studies contains approximately 1.9 kbp of 5' flanking and promoter sequence of the prolactin gene including regulatory regions linked to luciferase (1.9 PRL-Luc). B, Injection of the 1.9 PRL-Luc reporter gene into oocytes results in chromatin formation. The 1.9 PRL-Luc reporter was injected into oocytes and incubated for 1, 4, or 18 h. Homogenates were treated with 0.8, 2.5, and 7.5 U/ml of micrococcal nuclease. The digested DNA was resolved on an agarose gel, transferred to a nylon membrane, and visualized by hybridization to radiolabeled DNA probe representing the prolactin gene sequences.
|
|
The ability of Pit-1 to bind to the chromatin-assembled prolactin gene was examined (Fig. 2
). We first used a mobility shift to examine the ability of Pit-1 to bind in vitro to the proximal region of the prolactin gene (Fig. 2A
). A 161-bp radiolabeled fragment of DNA containing three Pit-1 binding sites (4P2P) of the prolactin gene was assembled into a nucleosome in vitro by using decreasing salt concentrations to deposit core histones on the DNA (25). The small size of the DNA allowed assembly of only a single nucleosome on the DNA. Pit-1 readily bound to DNA that was not assembled into a nucleosome (Fig. 2A
, compare lane 1 to lanes 25). As this region of the prolactin gene contains three Pit-1 binding sites, binding of Pit-1 to different combinations of the sites presumably accounts for the presence of the multiple, slowly migrating complexes that are observed. Assembly of a nucleosome onto the DNA greatly decreased binding of Pit-1, as assessed by the limited ability of Pit-1 to produce slowly migrating complexes (Fig. 2A
, compare lane 6 to lanes 710). A DNase footprint assay was used to examine Pit-1 binding to chromatin in vivo (Fig. 2B
). Xenopus oocytes were injected with the rat prolactin-luciferase reporter gene (1.9 PRL-Luc) and a Pit-1 expression vector. The oocytes were incubated to permit Pit-1 expression and in vivo binding. The oocytes were homogenized, and incubated with increasing concentration of DNase, and sites of DNase cleavage were identified by linear PCR using a radiolabeled primer. The results of the footprint assay demonstrate that Pit-1 expression in vivo clearly led to protection of the known Pit-1 binding sites (14, 26) in the proximal (lanes 1116) and distal regions (lanes 1722) of the prolactin gene (Fig. 2B
). Thus, although Pit-1 appears to have a limited ability to bind to chromatin in vitro, binding to chromatin was clearly achieved in vivo.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2. In Vitro and in Vivo Binding of Pit-1 to DNA or Reconstituted Chromatin
A, In vitro analysis of Pit-1 binding. Increasing concentrations of partially purified Pit-1 were incubated with a 32P-labeled DNA representing the 236 to 76 region of the rat prolactin 5'-flanking region. The 32P-labeled DNA was present in the binding reactions either as naked DNA (DNA) or reconstituted chromatin (chromatin). After incubation, protein-DNA complexes were resolved by nondenaturing PAGE and visualized by autoradiography. B, In vivo binding of Pit-1 to the proximal and distal regions of the prolactin gene. Oocytes were injected with either an empty expression vector (empty) or an expression vector for Pit-1 (Pit1) as indicated. At 40 h after injection the oocytes were homogenized and incubated with varying concentrations of DNase. DNA was isolated from the homogenates, and the sites of DNase cleavage were identified by a linear PCR using a 32P-labeled primer complementary to either the luciferase-coding sequence (proximal PRL) or a site downstream from the distal enhancer (distal PRL). The products of the PCR were assayed by denaturing gel electrophoresis, and the position of DNase digestion sites was determined by comparison to radiolabled DNA standards. A schematic diagram indicating the relative location of Pit-1 binding sites is shown at the right of each autoradiogram.
|
|
We next assessed whether Pit-1 could activate transcription from a chromatin-assembled, prolactin reporter gene in Xenopus oocytes. Oocytes were injected with prolactin reporter constructs containing both the proximal promoter and distal enhancer regions (1.9PRL-Luc) or a shorter construct containing only the proximal region and promoter (0.6PRL-Luc). Some of the oocytes were also injected with an expression vector for Pit-1 or with an expression vector for the DNA-binding domain of Pit-1. The Pit-1 expression vector activated transcription in Xenopus oocytes with both prolactin reporter gene constructs whereas the Pit-1 DNA-binding domain failed to activate transcription (Fig. 3A
). At the protein level, expression of Pit-1 and the Pit-1 DNA-binding domain were similar (Fig. 3B
). These findings provide evidence that Pit-1 is capable of stimulating transcription from a chromatin-assembled template. The finding that, in oocytes, the 1.9PRL-Luc reporter gene is not substantially more active that the 0.6PRL-Luc reporter gene is similar to studies using transfection of these reporter genes into heterologous mammalian cells deficient in estrogen receptors (27). Whereas the distal enhancer contributes substantial transcriptional activation in homologous GH3 cells that contain both Pit-1 and estrogen receptor, the distal enhancer has little or no activity in heterologous mammalian cells transfected with Pit-1 expression vector in the absence of estrogen receptor expression. In future experiments it will be of interest to determine whether expression of exogenous estrogen receptors can enhance transcription in oocytes of prolactin reporter genes containing the distal enhancer region.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 3. Pit-1 Can Stimulate Transcription from Prolactin Reporter Genes in Oocytes
A, Xenopus oocytes were injected with the 1.9 PRL-Luc reporter construct and a Xenopus expression vector directing expression of FLAG-Pit-1 (Pit1) or FLAG-DNA binding domain of Pit-1 (DBD) as indicated. After incubation, oocytes were homogenized and RNA was prepared. Primer extension analysis with a luciferase-specific, radiolabeled primer was used to detect the prolactin/luciferase transcript (PRL/Luc), and histone H4 transcripts (H4) were also assayed as an internal standard. B, Analysis of protein expression in oocytes. Xenopus oocytes were injected with expression vectors encoding FLAG-Pit-1(Pit1) or the FLAG-DNA binding domain of Pit-1 (DBD). After incubation the oocytes were homogenized, and FLAG-tagged proteins were isolated by immunoprecipitation using mouse monoclonal anti-FLAG antibody and resolved on a denaturing polyacrylamide gel. After transfer of the proteins to a membrane, the epitope-tagged proteins were visualized using a rabbit polyclonal anti-FLAG antibody.
|
|
Pit-1 Expression Alters Micrococcal Nuclease Digestion of Prolactin 5'-Flanking DNA Sequences When Assembled into Chromatin
To examine the chromatin structure in the proximal region of the prolactin promoter, we digested homogenates of microinjected oocytes with micrococcal nuclease, which digests DNA in the linker region between nucleosomes. To map sites within the prolactin reporter gene that were cleaved by micrococcal nuclease, isolated DNA was digested to completion with AflIII, the DNA fragments were resolved by gel electrophoresis and then transferred to a membrane, and specific fragments were identified by indirect end labeling using a hybridization probe representing the 3'-end of the region of interest. To examine possible sequence selectivity for digestion of the prolactin 5'-flanking region, the prolactin reporter gene was mixed with oocyte homogenates and subjected to micrococcal nuclease digestion (Fig. 4A
, lanes 29). Micrococcal nuclease digestion of this presumably nonchromatinized DNA tended to yield a smear of varying sized DNA fragments with several discrete bands. For instance, relatively discrete bands were observed at positions 70 and 20 relative to the prolactin transcription start site. These discrete bands may indicate that micrococcal nuclease has some sequence selectivity leading to enhanced digestion of some specific sites in naked DNA. Alternatively, it is possible that DNA binding by components of the oocyte extract may influence micrococcal nuclease digestion leading to enhanced digestion at specific sites. As injected DNA is assembled quite rapidly in vivo to nucleosomes (Fig. 1B
), it also seems possible that some DNA may be assembled into chromatin by the oocyte homogenate. Therefore, it is possible that mixing DNA with oocyte homogenate does not provide an appropriate, naked DNA control. To further assess selectivity for micrococcal digestion of the 5'-flanking region of the prolactin gene, digestion of naked DNA in buffer was performed (Fig. 4B
). In the absence of Xenopus oocytes extract, micrococcal nuclease digested the prolactin DNA sequences to near completion, producing relatively few partial digestion products (Fig. 4B
, lanes 2027). The few partial digestion products that were obtained tended to yield a smear with relatively few discrete bands. However, digestion sites at positions 300 and 70 could be detected for digestion of naked DNA in buffer in the absence of Pit-1 (Fig. 4B
, lanes 22 and 23), suggesting that micrococcal nuclease has some modest sequence selectivity for digestion of the 5'-flanking region of the prolactin gene. For naked DNA, the digestion site at 70 was substantially protected by addition of Pit-1 (Fig. 4B
, compare lanes 22 and 23 with lanes 26 and 27). Similar results for digestion of naked DNA by micrococcal nuclease were observed in two other experiments (data not shown). Interestingly, the upstream boundary of the 1P Pit-1 footprint is about position 62, which does not overlap the micrococcal nuclease digestion site at about 70. Nonetheless, Pit-1 binding appears to protect the 70 site from micrococcal nuclease digestion of naked DNA, presumably due to steric interference.

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 4. Pit-1 Expression in Oocytes Results in Micrococcal Nuclease Digestion of the Proximal Promoter Region of the Prolactin Gene
A, Analysis of micrococcal cleavage of a prolactin reporter gene either as naked DNA (DNA) or after assembly into chromatin in oocytes (chromatin). Oocytes were injected with the FLAG-Pit-1 expression vector (Pit-1) as indicated. Some oocytes were also injected with the 1.9 PRL-Luc reporter gene for in vivo assembly into chromatin. After 40 h incubation, the oocytes were homogenized. For the naked DNA samples, 10 ng of DNA for the 1.9 PRL-Luc reporter gene were added after the oocytes were homogenized. All samples were incubated with increasing amounts of micrococcal nuclease (0, 0.8, 2.5, and 7.5 U nuclease/ml). Isolated DNA was digested with AflIII, which cleaves the reporter gene upstream of the distal enhancer and within the luciferase coding sequence. DNA was resolved on an agarose gel and transferred to a membrane. The locations of nuclease digestion were identified by hybridization to a radiolabeled EcoRI-XbaI fragment from the luciferase-coding sequence. Solid arrows indicate sites where Pit-1 expression increased nuclease cleavage. An open arrow indicates sites with decreased cleavage in the presence of Pit-1. An asterisk indicates a site that appears to be essentially unaffected by Pit-1. A schematic map indicating the relative position of Pit-1-binding sites is shown at the left. B, Analysis of micrococcal nuclease digestion of naked DNA in buffer. Samples containing 10 ng of 1.9 PRL-Luc reporter gene and partially purified recombinant Pit-1 as indicated were incubated with increasing concentrations of micrococcal nuclease in buffer. The samples were deproteinized and subject to indirect end-label analysis as above. C, Schematic indicating the position of micrococcal nuclease digestion sites on chromatin samples and the proposed position of a possible translationally positioned nucleosome.
|
|
Micrococcal nuclease digestion of samples that were assembled in vivo into chromatin yielded a more distinctive pattern of discrete bands (Fig. 4A
, lanes 1118). In the absence of Pit-1, micrococcal nuclease of chromatin yielded particularly prominent digestion products at positions 300 and 70. The 300 site was also observed with samples containing naked DNA, although not as prominently. Thus micrococcal nuclease preferentially cleaves the DNA at about 300, and digestion at this site may be enhanced by assembly of the DNA into chromatin. Expression of Pit-1 resulted in several distinct changes in the micrococcal nuclease digestion of the chromatinized reporter gene (Fig. 4A
, lanes 1518). As with naked DNA, Pit-1 expression led to reduced cleavage at position 70 of the chromatin samples. As discussed above, this is presumably due to steric interference of Pit-1 with nuclease digestion. In contrast to Pit-1-mediated protection at 70, Pit-1-stimulated cleavage was clearly detected at positions 20 and 210. Enhanced digestion at these sites was observed only for the chromatin samples. Thus, the ability of Pit-1 to enhance digestion at the 20 and 210 cleavage sites appears to be chromatin dependent. The ability of Pit-1 to enhance micrococcal cleavage at 20 and 210 of the prolactin gene has been consistently observed in a large number of experiments (see Figs. 5
and 6
for further examples). Interestingly, the enhanced cuts at 20 and 210 are consistent with the possible presence of a translationally positioned nucleosome interacting with a DNA region containing several Pit-1 binding sites (Fig. 4C
). The ability of micrococcal nuclease to cleave the linker region between nucleosomes has led to the extensive use of this enzyme to identify and locate nucleosomes on DNA. Of course, it remains possible that other changes in chromatin structure may lead to changes in micrococcal nuclease digestion. It is possible that Pit-1 leads to architectural or topological changes in chromatin structure rather than a translationally positioned nucleosome, and these changes may account for the changes in micrococcal nuclease digestion. In any case, the findings demonstrate that Pit-1 is able to stimulate changes in micrococcal nuclease cleavage and suggest that Pit-1 is sufficient to direct alterations in chromatin structure of the prolactin 5'-flanking region.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5. Time Course of Pit-1 Expression and Chromatin Remodeling in Oocytes
A, Oocytes were injected with the PRL reporter construct and incubated overnight. A FLAG-Pit-1 expression construct was injected 72, 48, 20, or 8 h before micrococcal nuclease digestion. After injection, groups of 10 oocytes were incubated in [35S]methionine for analysis of Pit-1 expression. B, Expression of Pit-1. Radiolabeled FLAG-Pit-1 was immunoprecipitated from homogenates and resolved on a denaturing polyacrylamide gel. C, Indirect end-labeling analysis of the proximal 5'-flanking region of the prolactin gene. After the indicated incubation times, 30 oocytes were homogenized, digested with micrococcal nuclease, and subjected to indirect end labeling. Selected sites are indicated with solid arrows (Pit-1 enhanced cleavage) or open arrows (decrease in cleavage) or an asterisk (no change in cleavage).
|
|

View larger version (132K):
[in this window]
[in a new window]
|
Fig. 6. Analysis of the Ability of the Pit-1 DNA Binding Domain to Alter Transcription and Chromatin Remodeling
PRL-Luc reporter constructs were injected into oocytes together with expression vectors encoding wild-type Pit-1 (wild type) or the Pit-1 DNA binding domain (DBD). The oocytes were homogenized, digested with micrococcal nuclease, and subjected to indirect end labeling. Selected sites are indicated with solid arrows (Pit-1-enhanced cleavage) or open arrows (decrease in cleavage) or an asterisk (no change in cleavage).
|
|
The Time Course of Changes in Chromatin Structure Correspond to the Time Course of Pit-1 Expression
To further examine the ability of Pit-1 to alter chromatin structure, we examined the time course of Pit-1-stimulated changes in chromatin structure. For this experiment, the prolactin reporter gene was injected into oocytes, followed by a 20-h incubation to permit assembly of chromatin on the injected template (Fig. 5A
). Then, an expression vector for Pit-1 was injected, and the oocytes were incubated for varying times before analysis. Some of the oocytes were incubated in [35S]methionine to permit analysis of the time course of Pit-1 accumulation (Fig. 5B
). After homogenization, other oocytes were incubated with micrococcal nuclease for indirect end-labeling analysis of the chromatin structure of the proximal region of the prolactin gene (Fig. 5C
). The time course of Pit-1 accumulation very closely corresponded to the time course of changes in chromatin structure, as assessed by enhanced cleavage at positions 210 and 20 and decreased cleavage of the 70 site. As for the studies shown in Fig. 3
, the changes in micrococcal nuclease cleavage are consistent with the possibility that Pit-1 expression results in the presence of translationally positioned nucleosome over the proximal region of the prolactin promoter. The excellent correlation between Pit-1 expression and these chromatin changes supports a role for Pit-1 in directing changes in chromatin structure.
Transcriptional Activation Is Not Required for Changes in the Chromatin Structure of the Prolactin Gene
The DNA binding region of Pit-1 consists of two separate domains that can individually interact with DNA, the POU-specific domain and the homeodomain (28). Structural studies have confirmed that both domains of Pit-1 make specific base contacts and that Pit-1 homodimer involves an interaction of the POU specific with the POU homeodomain domain (29). To further examine the role of Pit-1 in directing changes in chromatin, the ability of the Pit-1 DNA binding domain to modulate chromatin structure was examined (Fig. 6
). Interestingly, although the Pit-1 DNA binding domain was unable to activate transcription in oocytes (Fig. 2A
), the micrococcal nuclease digestion pattern was similar to that obtained with full-length Pit-1. In particular, the DNA-binding domain led to enhanced micrococcal nuclease cleavage at the 210 and 20 sites and protection of the 70 site, very similar to the results obtained with full-length Pit-1.
 |
DISCUSSION
|
|---|
These studies have used an in vivo chromatin reconstitution system in Xenopus oocytes to examine the ability of Pit-1 to stimulate transcription and to alter chromatin structure. Although it has been known for some time that Pit-1 plays a key role in stimulating prolactin gene expression (12, 13, 30), the possible involvement of Pit-1 in establishing the chromatin structure of the prolactin promoter has not been previously explored. The present findings demonstrate that Pit-1 expression leads to changes in micrococcal nuclease digestion of the 5'-flanking region of the prolactin gene offering evidence that Pit-1 can alter chromatin structure. The Pit-1 DNA binding domain, which was not transcriptionally active, also led to changes in chromatin structure. Thus, Pit-1-mediated changes in chromatin structure do not appear to require transcriptional activation and are not sufficient for transcriptional activation. The changes in micrococcal nuclease are consistent with the possible presence of a translationally positioned nucleosome on the proximal promoter region of the prolactin gene.
The mechanisms mediating the ability of Pit-1 to alter chromatin structure have not been determined. Although Pit-1 was not able to bind to chromatin in vitro, footprint studies clearly demonstrated Pit-1 binding to chromatin in vivo. It should be noted that the different assays involve very different time intervals. The in vitro binding assay was completed in 20 min whereas the in vivo assay involved expression of Pit-1 over a 40-h interval. The extended time of the in vivo assay may have permitted Pit-1 to bind to transiently exposed DNA sites. There is evidence that DNA binding sites in chromatin can be transiently available (31). Alternatively, the ability of Pit-1 to bind to chromatin and modulate chromatin structure may involve the action of an ATP-dependent remodeling complex. At the present time there is no information concerning the possible direct interaction of Pit-1 with components of an ATP-dependent remodeling complex. It remains possible, therefore, that Pit-1 directly recruits a remodeling complex. There are also studies that raise the possibility of an indirect recruitment. The CCAAT-enhancer binding protein (C/EBP) has been shown to stimulate activity of the prolactin promoter (32), and there is a functional interaction between C/EBP and Pit-1 to stimulate the GH promoter (33). As C/EBP has been shown to interact with the SWI/SNF complex (34), it is possible that interactions between Pit-1 and C/EBP lead to recruitment of the SWI/SNF complex or another complex leading to chromatin remodeling. This model for the role of Pit-1 in modifying chromatin structure has some similarity to the role of GAGA factor in organizing chromatin on the hsp70 promoter. GAGA factor binds to [GA]n repeats in the hsp70 promoter (7, 35), resulting in the recruitment of a chromatin-remodeling complex (36). The complex contains several subunits, including the imitation switch (ISWI) ATP-dependent chromatin-remodeling factor. ISWI appears to mediate GAGA-directed nucleosome sliding resulting in the formation of an inducible heat shock promoter (37). Additional studies will be required to examine the role of ATP-dependent remodeling complexes in mediating Pit-1 effects on chromatin structure and transcriptional activation.
The ability of Pit-1 to direct nucleosome positioning could play a role in transcriptional regulation of the prolactin gene. Previous studies have used micrococcal nuclease digestion and indirect end-labeling experiments to provide evidence for cell-specific differences in chromatin structure of the prolactin gene (38). The present studies provide evidence that Pit-1 may be sufficient to position a nucleosome that probably corresponds to one of the nucleosomes detected in GH3 cells. These findings suggest that Pit-1-dependent changes in nucleosome positioning likely contribute to the mechanisms that establish the cell-specific chromatin structure of the prolactin gene. The finding that the Pit-1 DNA binding domain is sufficient to direct chromatin changes, but unable to activate transcription, provides evidence that Pit-1-mediated changes in chromatin structure are not sufficient to activate transcription. This is probably due to a role for the transcriptional activation domain of Pit-1 in recruitment of coactivators such as CBP (17, 39), which are required for activation. The ability of Pit-1 to modulate chromatin structure may also enhance recruitment of other transcription factors and facilitate functional synergism between factors. This would be similar to findings that the glucocorticoid receptor can alter chromatin structure, leading to enhanced recruitment of other transcription factors (40, 41). Interestingly, the synergism observed with the glucocorticoid receptor does not occur on naked DNA or with mononucleosomes, suggesting that the chromatin template is required for maximal gene activation (42).
In summary, this work provides new insights into the ability of Pit-1 to modulate chromatin structure and transcription. We have used a Xenopus oocyte, in vivo system to assemble the prolactin gene into chromatin. The studies provide evidence that Pit-1 can direct changes in the chromatin structure of the prolactin gene. Pit-1 expression was found to lead to changes in micrococcal nuclease consistent with the possible presence of a translationally positioned nucleosome in the proximal promoter region of the prolactin gene. The Xenopus oocyte system used in the present study should provide a useful tool to further explore the mechanisms mediating these responses and to examine the role other transcription factors may play in modulating chromatin structure and prolactin transcription.
 |
MATERIALS AND METHODS
|
|---|
DNA Constructs
Luciferase reporter constructs containing approximately 0.6- or 1.9-kb pairs of the 5'-flanking sequence and the promoter from the rat prolactin gene have been described previously (43, 44). Expression vectors encoding Pit-1 fused to the FLAG epitope were generated by subcloning the appropriate coding sequence into pCS2+ (45).
Preparation and Microinjection of Oocytes
The preparation and microinjection of X. laevis oocytes were performed using a modification of methods previously described (24). Mature female X. laevis were anesthetized in 0.2% Tricaine (Sigma Chemical Co., St. Louis, MO) and the ovaries were removed. Fragments of ovary were incubated with 0.2 Wünsch units/ml Liberase Blendzyme 3 (Roche Molecular Biochemicals, Indianapolis, IN) for 3 h at 18 C in 5 mM HEPES, pH 7.9; 82.5 mM NaCl; 2.5 mM KCl; 1 mM MgCl2. The oocytes were then washed several times in ND-96 (5 mM HEPES, pH 7.9; 96 mM NaCl; 2 mM KCl; 1.8 mM CaCl2; 1 mM MgCl2; 50 µg/ml gentamycin). Stage VI oocytes were injected with 9.2 nl of an aqueous solution containing 100 ng/µl of DNA using a Nanoject II (Drummond Scientific Co., Broomall, PA). After 2448 h incubation at 18 C on a rotating platform, healthy oocytes were selected for analysis.
RNA Preparation and Primer Extension Analysis
RNA was isolated from 20 oocytes using methods similar to those described previously (46). Oocytes were washed once in ND-96 and then homogenized by repeated pipetting in 0.1 ml 10 mM Tris (pH 8.0)-1 mM EDTA. Then, 0.5 ml Trizol reagent (Invitrogen, Carlsbad, CA) and 0.1 ml chloroform were added, and the sample was vigorously mixed. After 5 min on ice, the RNA was collected by centrifugation for 15 min at 10,000 x g for 15 min, after which 0.35 ml of supernatant was removed, and RNA was precipitated by adding 1 volume of isopropanol. The RNA was collected by centrifugation, the supernatant was removed, and the pellet was rinsed with 1 ml of 70% ethanol. RNA pellets were resuspended in 40 µl of water. Primer extension analysis was performed with a primer specific for the luciferase RNA product (luc-primer: 5'-GCAGTTGCTCTCCAGCGGTTCCATCCTC-3') and a primer recognizing the endogenous histone H4 mRNA (H4-primer: 5'-GGCTTGGTGATGCCCTGGATGTTATCC-3'), which acted as a recovery/loading control. RNA (equivalent of two oocytes) was incubated in a final volume of 10 µl with 0.2 pmol of the luc-primer and 0.04 pmol of the H4-primer for 10 min at 65 C, 30 min at 55 C, and 10 min at 42 C in 1x First Strand Buffer (50 mM Tris, pH 8.3; 75 mM KCl; 3 mM Mg2Cl2; Invitrogen, Carlsbad, CA). Primer extension was performed in a reaction volume of 40 µl in the same buffer with the addition of 0.25 mM deoxynucleotide triphosphates, 1 mM dithiothreitol, and 100 U of Moloney leukemia virus RNase H reverse transcriptase (Superscript II, Invitrogen). After a 60-min incubation at 42 C, the reaction was stopped by adding 200 µl of 1% sodium dodecyl sulfate (SDS), 50 mM Tris (pH 8.0), 10 mM EDTA, and 0.5 mg/ml Proteinase K (Roche Molecular Biochemicals, Indianapolis, IN). The samples were incubated at 55 C for 1 h, followed by addition of an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) and vigorous mixing. After centrifugation, the upper aqueous phase was removed, and nucleic acids were precipitated by addition of 2 volumes of ethanol. Extension products were collected by centrifugation and analyzed on a 7% polyacrylamide gel containing 8 M urea (24). Products were visualized by autoradiography.
Protein Expression Assay
Oocytes were injected with expression vectors encoding FLAG-Pit-1 and incubated for the indicated times in the presence of [35S]methionine (Dupont NEN, Boston, MA). The oocytes (n = 10) were washed three times in ND-96 and homogenized by repeated pipetting in 0.3 ml of 50 mM Tris-HCl (pH 8.0), 10% glycerol, 1% Nonidet (NP-40), 200 mM NaCl, 2.5 mM MgCl2. Homogenates were combined with an equal volume of 1,1,2-trichloro-trifluoroethane (Sigma), vortexed for 1 min, and centrifuged for 5 min at 4 C. The supernatant was transferred to a new tube and incubated with a resin containing an immobilized anti-FLAG antibody (Sigma) for 90 min at 4 C. The resin was washed with 50 mM Tris-HCl (pH 8.0), 10% glycerol, 1% NP-40, 200 mM NaCl, 2.5 mM MgCl2 buffer three times. Radiolabeled proteins were separated on a 12%, denaturing polyacrylamide gel (47) and visualized by autoradiography. In some cases, oocytes were not labeled with [35S]methionine, and the nonradioactive proteins were detected by immunoblotting with a rabbit polyclonal anti-FLAG antibody.
Micrococcal Nuclease Assay
For analysis of chromatin structure, oocyte homogenates were treated with micrococcal nuclease, after which DNA was isolated. For these assays, 30 oocytes for each group were washed twice with ND-96 and homogenized in 210 µl of nuclease buffer (10 mM HEPES, pH 8.0; 50 mM KCl; 5 mM MgCl2; 3 mM CaCl2; 1 mM dithiothreitol; 0.1% NP-40, 8% glycerol). Then, 60 µl aliquots of the homogenate were incubated with 0, 0.83, 2.5, or 7.5 U/ml of micrococcal nuclease (Sigma) for 20 min at room temperature. The reaction was stopped by adding 200 µl of 50 mM Tris (pH 8.0), 20 mM EDTA, 1% SDS. Samples were adjusted to contain 100 µg/ml RNase A and incubated for 1 h at 37 C. Proteinase K (Roche Molecular Biochemicals) was then added to 0.3 mg/ml, and the samples were incubated overnight at 55 C. An equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) was added and mixed vigorously, and the phases were separated by centrifugation. DNA was precipitated from the supernatant by addition of two volumes of ethanol. After collection by centrifugation, the DNA was dissolved in 20 µl H20, and the equivalent of DNA from 15 oocytes was used for indirect end-labeling analysis. For analysis of the proximal region of the prolactin gene, DNA was digested to completion with restriction endonucleases KpnI and EcoRI or AflIII and separated on a 1.5% agarose gel in 90 mM Tris-borate (pH 8.3) and 2 mM EDTA. The DNA was transferred to a nylon filter by blotting (48), and fragments containing prolactin gene sequences were visualized by hybridization (49) with a radiolabeled DNA probe corresponding to the 3'-end of the gene fragment.
In Vitro Pit-1 Binding
A radiolabeled DNA fragment representing the 236 to 76 region of the rat prolactin 5'-flanking region was prepared by PCR using 32P-labeled CAGTCAGCCTCAGCATTTCTCT and CTCCCAATCATCTATTTCCGTC as primers. For chromatin reconstitution, oligonucleosomes were isolated from whole chicken blood as described previously (50). Nucleosomes were reconstituted on the 32P-labeled PRL DNA fragment by incubation with chicken oligonucleosomes in 2 M NaCl followed by step dilution to lower NaCl concentrations as described elsewhere (25). Binding reactions contained 10,000 cpm of 32P-labeled PRL DNA fragment either as naked DNA or as reconstituted chromatin, 1 µg sheared salmon sperm DNA, 20 µg BSA, varying amounts of partially purified Pit-1 that had been expressed in insect cells using a baculovirus vector, 10 mM Tris (pH 7.5), 5% glycerol, 50 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol in a total volume of 25 µl. The reactions were incubated for 30 min at room temperature and then analyzed using a nondenaturing, 4% polyacrylamide gel in 45 mM Tris-borate (pH 8.3) and 1 mM EDTA.
In Vivo DNase I Footprint Assay of Pit-1 Binding
For each group injected with different DNAs, 50 oocytes were homogenized in 0.5 ml of 10 mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 5% glycerol and then divided into 3 x 150 µl aliquots at room temperature. The samples were digested with either 60, 80, or 100 U of DNase I (Invitrogen) for 10 min at room temperature. Then 0.3 ml of 1% SDS, 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, and 0.6 mg/ml proteinase K was added and incubated at 37 C for 16 h. After extraction with phenol/chloroform, the DNA was precipitated with ethanol, collected by centrifugation, and then resuspended in 44 µl water. To remove RNA, the samples were adjusted to contain 0.2 mg/ml pancreatic RNase, 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 50 mM NaCl and digested for 2 h at 37 C. The samples were extracted with phenol/chloroform, precipitated with ethanol, and collected by centrifugation. Linear PCR was performed with the DNA as template using 32P-labeled primers complementary to either the luciferase-coding sequence of the reporter gene (luc-primer, as described above) or a region downstream of the distal enhancer (GCAACACATAGTGCAATCAATCAC).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Jan Christian and Catherine Degnin for helpful advice and generous gifts of a number of reagents. We thank S. Jue and B. Maurer for aid with these studies.
 |
FOOTNOTES
|
|---|
This work was supported by Public Health Service Grant DK40339 (to R.A.M.).
First Published Online September 16, 2004
Abbreviations: CBP, cAMP response element-binding protein (CREB)-binding protein; C/EBP, CCAAT-enhancer binding protein; hsp, heat shock protein; N-CoR, nuclear receptor corepressor; NP-40, Nonidet P-40; SDS, sodium dodecyl sulfate.
Received for publication January 14, 2004.
Accepted for publication September 8, 2004.
 |
REFERENCES
|
|---|
- Struhl K 1999 Fundamentally different logic of gene regulation in eukaryotes and prokaryotes. Cell 98:14[CrossRef][Medline]
- Urnov FD, Wolffe AP 2001 Chromatin remodeling and transcriptional activation: the cast (in order of appearance). Oncogene 20:29913006[CrossRef][Medline]
- Strahl BD, Allis CD 2000 the language of covalent histone modifications. Nature 403:4145[CrossRef][Medline]
- Vignali M, Hassan AH, Neely KE, Workman JL 2000 ATP-dependent chromatin-remodeling complexes. Mol Cell Biol 20:18991910[Free Full Text]
- Kingston RE, Narlikar GJ 1999 ATP-dependent remodeling and acetylation as regulators of chromatin fluidity. Genes Dev 13:23392352[Free Full Text]
- Lu Q, Wallrath LL, Granok H, Elgin SC 1993 (CT)n (GA)n repeats and heat shock elements have distinct roles in chromatin structure and transcriptional activation of the Drosophila hsp26 gene. Mol Cell Biol 13:28022814[Abstract/Free Full Text]
- Tsukiyama T, Becker PB, Wu C 1994 ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of GAGA transcription factor. Nature 367:525532[CrossRef][Medline]
- Haswell ES, OShea EK 1999 An in vitro system recapitulates chromatin remodeling at the PHO5 promoter. Mol Cell Biol 19:28172827[Abstract/Free Full Text]
- Shim EY, Woodcock C, Zaret KS 1998 Nucleosome positioning by the winged helix transcription factor HNF3. Genes Dev 12:510[Abstract/Free Full Text]
- Collingwood TN, Urnov FD, Chatterjee VKK, Wolffe AP 2001 Chromatin remodeling by the thyroid hormone receptor in regulation of the thyroid-stimulating hormone
-subunit promoter. J Biol Chem 276:3422734234[Abstract/Free Full Text]
- Urnov FD, Wolffe AP 2001 An array of positioned nucleosomes potentiates thyroid hormone receptor action in vivo. J Biol Chem 276:1975319761[Abstract/Free Full Text]
- Ingraham HA, Chen R, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson L, Rosenfeld MG 1988 A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55:519529[CrossRef][Medline]
- Bodner M, Castrillo J-L, Theill LE, Deerinck T, Ellisman M, Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 55:505518[CrossRef][Medline]
- Mangalam HJ, Albert VR, Ingraham HA, Kapiloff M, Wilson L, Nelson C, Elsholtz H, Rosenfeld MG 1989 A pituitary POU domain protein, Pit-1, activates both growth hormone and prolactin promoters transcriptionally. Genes Dev 3:946958[Abstract/Free Full Text]
- Durrin LK, Weber JL, Gorski J 1984 Chromatin structure, transcription and methylation of the prolactin gene domain in pituitary tumors of Fischer 344 rats. J Biol Chem 259:70867093[Abstract/Free Full Text]
- Durrin LK, Gorski J 1985 The prolactin gene hypersensitive sites are present early in development and are not induced by estrogen administration. Endocrinology 117:20982105[Abstract]
- Xu L, Lavinsky RM, Dasen JS, Flynn SE, McInerney EM, Mullen TM, Heinzel T, Szeto D, Korzus E, Kurokawa R, Aggarwal AK, Rose DW, Glass CK, Rosenfeld MG 1998 Signal-specific co-activator domain requirements for Pit-1 activation. Nature 395:301306[CrossRef][Medline]
- Ogryzko VV, Schlitz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferances. Cell 87:953959[CrossRef][Medline]
- Yang X, Ogryzko VV, Nishikawa J, Howard B, Nakatani Y 1996 A p300/CBP-associated factor that competes with the adenoviral E1A oncoprotein. Nature 382:319324[CrossRef][Medline]
- Bannister AJ, Kouzarides T 1996 The CBP co-activator is a histone acetyltransferase. Nature 384:641643[CrossRef][Medline]
- Heinzel T, Lavinsky RM, Mullen T-M, Soderstrom M, Laherty CD, Torchia J, Wang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:4348[CrossRef][Medline]
- Alland L, Muhle R, Hour Jr H, Potes J, Chin L, Schreiber-Agus N, DePinho RA 1997 Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature 387:4955[CrossRef][Medline]
- Diamond SE, Gutierrez-Hartmann A 2000 The Pit-1ß domain dictates active repression and alteration of histone acetylation of the proximal prolactin promoter. J Biol Chem 275:3097730986[Abstract/Free Full Text]
- Almouzni G, Wolffe AP 1993 Replication-coupled chromatin assembly is required for the repression of basal transcription in vivo. Genes Dev 7:20332047[Abstract/Free Full Text]
- Simpson RT, Thoma F, Brubaker JM 1985 Chromatin reconstituted from tandemly repeated cloned DNA fragments and core histones: a model system for study of higher order structure. Cell 42:799808[CrossRef][Medline]
- Nelson C, Albert VR, Elsholtz HP, Lu LI-W, Rosenfeld MG 1988 Activation of cell-specific expression of rat growth hormone and prolactin genes by a common transcription factor. Science 239:14001405[Abstract/Free Full Text]
- Day RN, Koike S, Sakai M, Muramatsu M, Maurer RA 1990 Both Pit-1 and the estrogen receptor are required for estrogen responsiveness of the rat prolactin gene. Mol Endocrinol 4:19641971[Abstract]
- Ingraham HA, Flynn SE, Voss JW, Albert VR, Kapiloff MS, Wilson L, Rosenfeld MG 1990 The POU-specific domain of Pit-1 is essential for sequence-specific, high affinity DNA binding and DNA-dependent Pit-1-Pit-1 interactions. Cell 61:10211033[CrossRef][Medline]
- Jacobson EM, Li P, Leon-del-Rio A, Rosenfeld MG, Aggarwal AK 1997 Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected arrangement and flexibility. Genes Dev 11:198212[Abstract/Free Full Text]
- Li S, Crenshaw III EB, Rawson EJ, Simmons DM, Swanson LW, Rosenfeld MG 1990 Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene, pit-1. Nature 347:528533[CrossRef][Medline]
- Polach KJ, Widom J 1995 Mechanism of protein access to specific DNA sequences in chromatin: a dynamic equilibrium model for gene regulation. J Mol Biol 254:130149[CrossRef][Medline]
- Jacob KK, Stanley FM 1999 CCAAT/enhancer-binding protein
is a physiological regulator of prolactin gene expression. Endocrinology 140:45424550[Abstract/Free Full Text]
- Schaufele F 1996 CCAAT/enhancer-binding protein
activation of the rat growth hormone promoter in pituitary progenitor GHFT15 cells. J Biol Chem 271:2148421489[Abstract/Free Full Text]
- Pedersen TA, Kowenz-Leutz E, Leutz A, Nerlov C 2001 Cooperation between C/EBP
TBP/TFIIB and SWI/SNF recruiting domains is required for adipocyte differentiation. Genes Dev 15:32083216[Abstract/Free Full Text]
- Wu C 1984 Activating protein factor binds in vitro to upstream control sequences in heat shock gene chromatin. Nature 311:8184[CrossRef][Medline]
- Tsukiyama T, Wu C 1995 Purification and properties of an ATP-dependent nucleosome remodeling factor. Cell 83:10111020[CrossRef][Medline]
- Langst G, Becker PB 2001 Nucleosome mobilization and positioning by ISWI-containing chromatin-remodeling factors. J Cell Sci 114:25612568
- Willis SD, Seyfred MA 1996 Pituitary-specific chromatin structure of the rat prolactin distal enhancer element. Nucleic Acids Res 24:10651072[Abstract/Free Full Text]
- Zanger K, Cohen LE, Hashimoto K, Radovick S, Wondisford FE 1999 A novel mechanism for cyclic adenosine 3',5'-monophosphate regulation of gene expression by CREB-binding protein. Mol Endocrinol 13:268275[Abstract/Free Full Text]
- Beato M 1996 Chromatin structure and the regulation of gene expression: remodeling at the MMTV promoter. J Mol Med 74:711724[CrossRef][Medline]
- Deroo BJ, Archer TK 2001 Glucocorticoid receptor-mediated chromatin remodeling in vivo. Oncogene 20:30393046[CrossRef][Medline]
- Di Croce L, Koop R, Venditti P, Westphal HM, Nightingale KP, Corona DF, Becker PB, Beato M 1999 Two-step synergism between the progesterone receptor and the DNA-binding domain of nuclear factor 1 on MMTV minichromosomes. Mol Cell 4:4554[CrossRef][Medline]
- Iverson RA, Day KH, dEmden M, Day RN, Maurer RA 1990 Clustered point mutation analysis of the rat prolactin promoter. Mol Endocrinol 4:15641571[Abstract]
- Nowakowski BE, Maurer RA 1994 Multiple Pit-1 binding sites facilitate estrogen responsiveness of the prolactin gene. Mol Endocrinol 8:17421749[Abstract]
- Rupp RAW, Snider L, Weintraub H 1994 Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev 8:13111323[Abstract/Free Full Text]
- Wong J, Shi YB, Wolffe AP 1995 A role for nucleosome assembly in both silencing and activation of the Xenopus TR ß A gene by the thyroid hormone receptor. Genes Dev 9:26962711[Abstract/Free Full Text]
- Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680685[CrossRef][Medline]
- Southern EM 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503517[CrossRef][Medline]
- Church GM, Gilbert W 1984 Genomic sequencing. Proc Natl Acad Sci USA 81:19911995[Abstract/Free Full Text]
- Hansen JC, Ausio J, Stanik VH, van Holde KE 1989 Homogeneous reconstituted olignucleosomes, evidence for salt-dependent folding in the absences of histone H1. Biochemistry 28:91299136[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. D. Adamson, S. Friedrichsen, S. Semprini, C. V. Harper, J. J. Mullins, M. R. H. White, and J. R. E. Davis
Human Prolactin Gene Promoter Regulation by Estrogen: Convergence with Tumor Necrosis Factor-{alpha} Signaling
Endocrinology,
February 1, 2008;
149(2):
687 - 694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R A Sporici, J S Hodskins, D M Locasto, L B Meszaros, A L Ferry, A M Weidner, C A Rinehart, J C Bailey, I M Mains, and S E Diamond
Repression of the prolactin promoter: a functional consequence of the heterodimerization between Pit-1 and Pit-1 {beta}
J. Mol. Endocrinol.,
October 1, 2005;
35(2):
317 - 331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Liu, R. E. Baker, W. Chow, C. K. Sun, and H. P. Elsholtz
Epigenetic Mechanisms in the Dopamine D2 Receptor-Dependent Inhibition of the Prolactin Gene
Mol. Endocrinol.,
July 1, 2005;
19(7):
1904 - 1917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A L Ferry, D M Locasto, L B Meszaros, J C Bailey, M D Jonsen, K Brodsky, C J Hoon, A Gutierrez-Hartmann, and S E Diamond
Pit-1{beta} reduces transcription and CREB-binding protein recruitment in a DNA context-dependent manner
J. Endocrinol.,
April 1, 2005;
185(1):
173 - 185.
[Abstract]
[Full Text]
[PDF]
|
 |
|