Molecular Endocrinology, doi:10.1210/me.2004-0172
Molecular Endocrinology 19 (1): 76-89
Copyright © 2005 by The Endocrine Society
Dose-Dependent Inhibition of Thyroid Differentiation by RAS Oncogenes
Gabriella De Vita,
Lisa Bauer,
Vania M. Correa da Costa,
Mario De Felice,
Maria Giuseppina Baratta,
Marta De Menna and
Roberto Di Lauro
Stazione Zoologica Anton Dohrn, 80121 Napoli, Italy
Address all correspondence and requests for reprints to: Roberto Di Lauro, Stazione Zoologica Anton Dohrn, Villa Comunale 1, 80121 Napoli, Italy. E-mail: dilauro{at}szn.it.
 |
ABSTRACT
|
|---|
Activating mutations in RAS protooncogenes are associated with several different histotypes of thyroid cancer, including anaplastic thyroid carcinoma. The latter is the most aggressive cancer of the thyroid gland, showing little or no expression of the differentiated phenotype. Likewise, expression of viral RAS oncogenes in FRTL-5 rat thyroid cells mimics such loss of differentiation. We established FRTL-5 cell lines stably expressing constitutively active forms of RAS, either of viral (v-Ha-RAS or v-Ki-RAS) or cellular (H-RASV12) origin and generated a tamoxifen-inducible RAS oncoprotein to analyze the timing of RAS effects on thyroid differentiation. In RAS-transformed FRTL-5 cells, we measured the expression of many thyroid-specific genes by real-time PCR and observed that a clear loss of differentiation was only obtained in the presence of high RAS oncogene expression. In contrast, TSH-independent growth appeared to be induced in the presence of both low and high levels of oncogenic RAS expression. We also showed that inhibition of differentiation is an early RAS-induced phenomenon. Finally, we demonstrated that only high doses of RAS oncogenes are able to inhibit the activity of Titf1 and Pax8, two transcription factors essential for the maintenance of thyroid differentiation, and that the homeodomain of Titf1 is a target of the inhibitory action of RAS. Our results represent the first evidence of a dose- dependent effect of RAS oncogenes on thyroid epithelial differentiation.
 |
INTRODUCTION
|
|---|
ONCOGENIC MUTATIONS OF RAS-family genes play an important role in malignant transformation and tumor progression and are among the most common genetic alterations found in human cancers (1). Constitutive activation of all three RAS oncogenes (H-, K-, and N-RAS) has been identified in tumors originating from the follicular epithelium of the thyroid gland, with variable frequencies, depending on the tumor type (2). RAS-activating mutations are associated with all types of thyroid malignancies, leading to the suggestion that they are an early event in thyroid tumorigenesis (3, 4); furthermore, mutated RAS genes are detected with higher frequency in poorly differentiated and undifferentiated thyroid cancers (5, 6). These observations suggest that oncogenic RAS proteins could contribute to the partial or complete loss of differentiation characteristic of the more aggressive thyroid cancers where a favorable prognosis strictly depends on the degree of differentiation (7).
The rat epithelial thyroid cell line FRTL-5 retains in culture the expression of several thyroid-specific genes such as thyroglobulin (Tg), thyroperoxidase (TPO), TSH receptor (Tshr) and Na+/I symporter (NIS), thyroid oxidase (ThOX-2), Pendred syndrome gene (PDS) as well as a thyroid-specific combination of transcription factors, Titf1 (also indicated as TTF-1), Foxe1 (formerly called TTF-2) and Pax8, that are considered essential for the maintenance of differentiation. In addition, these cells depend on the presence of TSH for proliferation and are able to concentrate iodide from the medium (8, 9, 10, 11).
We have previously shown that cell lines obtained by infecting FRTL-5 cells with either Harvey or Kirsten rat sarcoma viruses show loss of the differentiated phenotype (12, 13). Harvey-transformed FRTL-5 (FRTL-5/Ha-RAS) cells showed detectable levels of Titf1, which was instead undetectable in Kirsten-transformed (FRTL-5/Ki-RAS) cells, thus suggesting that the molecular mechanisms underlying the observed de-differentiation should be different among the oncogenes encoded by the two viruses (13). Nevertheless, such experiments suffered from several limitations. First of all, because two different retroviruses were used for the transduction of v-Ha-RAS and v- Ki-RAS, it is possible that viral sequences other than the transduced oncogenes could be responsible for the observed differences. Second, retrovirus-infected cells were selected from the uninfected cells by their ability to grow in the absence of TSH, thus adding a selection for highly transformed cells. Finally, the retrovirus-infected FRTL-5 cells were maintained for an indeterminate number of passages in culture, making it possible that the observed differences were due to the differential rate of accumulation of other mutations in the diverse cell lines examined.
Recently, by using a different experimental approach, we demonstrated that the cellular oncogene H-RASV12 transiently expressed in FRTL-5 cells is able to inhibit the transcriptional activity of Titf1 through multiple effector pathways, including the Raf/MAPK pathway and an unknown pathway activated by the as-yet-uncharacterized RAS effector domain mutant V12N38 (14).
In the present study, we systematically compared the effects of different RAS oncogenes on the expression of endogenous thyroid-specific genes. We also, for the first time in thyroid cells, systematically correlated the observed biological effects with the amount of RAS protein expressed.
We established numerous FRTL-5 cell clones, stably expressing either one of the viral oncogenes v-Ha-RAS, v-Ki-RAS, or the activated cellular isoform H-RASV12. The clones were obtained either by selection for antibiotic resistance, or by selection for growth in the absence of TSH and antibiotic resistance. This dual mode of selection was designed to study the interference of oncogenic RAS on the differentiated thyroid phenotype, both in the presence and absence of selective pressure for transformation.
The FRTL-5/RAS clones obtained in this study were subjected to a detailed quantitative analysis of the whole differentiated status, revealing that loss of differentiation is only induced at high levels of active RAS. Similar results were also obtained with a tamoxifen-inducible RAS molecule.
Finally, to further our understanding on the molecular mechanisms responsible for the induction of dedifferentiation by high levels of oncogenic RAS, we tested the function of two transcription factors essential for the maintenance of thyroid differentiation, Titf1 and Pax8, in both the constitutive and inducible systems. We demonstrate that RAS is able to interfere with Titf1 and Pax8 by inhibiting both their expression and transcriptional activity. We have previously demonstrated that the inhibition of Titf1 activity is exerted through its activation domains (14). Here we show that also the homeodomain of Titf1 is inhibited by Ras, whereas the inhibition of Pax8 activity appears to be exerted exclusively on its activation domains.
 |
RESULTS
|
|---|
Establishment of FRTL-5 Cell Lines Stably Expressing RAS-Family Oncogenes
To obtain FRTL-5 cell clones expressing activated viral (v-Ha-RAS or v-Ki-RAS) or cellular (H-RASV12) RAS oncogenes, we cloned the cDNAs encoding the three oncogenes into the BamHI site of pBabePuro retroviral vector (15) and transfected FRTL-5 cells with either one of the three expression constructs, or with the empty vector as a control. Transfected cells were then selected with puromycin in duplicate either in complete (6H) medium or in medium lacking TSH (5H). After 2 wk of continuous selection, one series of dishes was stained with crystal violet and colonies were counted (Table 1
). As expected, due to the absolute requirement of TSH for the growth of the parental cell line, the empty vector gave rise to puromycin-resistant colonies only in 6H medium. In contrast, transfection of each of the three oncogene-expressing constructs resulted in a sizeable number of puromycin-resistant colonies also in 5H medium, indicating that the expression of a functional RAS oncogene made the cells independent from TSH for growth. Interestingly, the activated cellular oncogene appears to inhibit colony formation in 6H medium, if compared with the other two oncogenes. Conversely, in 5H medium it appears to induce growth at higher frequency. We do not know the reason of these differences. We suspect that they might be due to differential properties of the cellular and viral oncogenes resulting in either a differential efficiency of expression or in a differential ability to induce cell death (16).
For each oncogene construct, 36 clones selected for puromycin resistance in 6H medium and 10 clones selected both for drug resistance and TSH independence in 5H medium were selected and expanded for further analyses. First, expression of the transfected RAS oncogenes was measured by quantitative Western blotting (QWB) (see Materials and Methods). Because the oncoproteins are indistinguishable by size from the endogenous RAS proteins, we compared total RAS protein levels of the clones with that of the parental cell line, and clones were considered positive for the expression of the ectopic oncogenes when the total RAS level was at least twice the FRTL-5 endogenous level (representative Western blots are shown in Fig. 1A
). Only a fraction of clones selected in 6H medium scored positive for the expression of the transfected oncogene, with a slight variability among the different oncogenes. In contrast, all of the clones selected in 5H resulted positive (Table 1
). In Table 1
, the average level of expression of the three oncoproteins in clones selected in 6H or in 5H medium is reported. It is noteworthy that the average level of RAS expression is invariably higher in clones selected in the absence of TSH. Presumably, the selection for growth in 5H medium favored cells expressing higher RAS levels (Table 1
). To test for the ability of RAS-positive clones selected in 6H medium to proliferate in the absence of TSH, we assessed, by bromodeoxyuridine incorporation assay (see Materials and Methods), the ability of clones expressing different amounts of each of the three oncogenes to enter S-phase after stimulation with 6H or 5H medium. Parental FRTL-5 cells were only able to enter S-phase in 6H medium, whereas all Ras-positive clones tested also entered S-phase in 5H medium (Table 2
), demonstrating that the ability to proliferate in the absence of TSH is acquired even at very low oncogene expression levels and independently of the method used for selection.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1. RAS Oncogenes Inhibit Tg and Titf1 Protein Expression in a Dose-Dependent Fashion
A, Two representative Western blots showing the levels of total RAS expression in four clones for each oncogene are shown. Total RAS proteins were detected using an anti-pan-RAS antibody. For each blot, the names of analyzed clones (where H stands for v-Ha-RAS, K for v-Ki-RAS, and V for H-RASV12) are indicated on the top of the figure, and the level of RAS expression relative to wild-type FRTL-5 cells, below the figure. BD, RAS-positive clones were analyzed for the expression of Tg by QWB. Blots were probed with antibodies directed against Tg, revealed by chemiluminescence, and luminescence measured by a Fluor-S-MAX (Bio-Rad). The measured levels of Tg protein were normalized by the corresponding value of the parental cell line, and results were reported, for each analyzed clone, as a function of the amount of oncogene expressed. EG, Blots used in BD were reprobed with an antibody against Titf1 and the signal revealed as already described for Tg signal.
|
|
Inhibition of Titf1 and Tg Expression Depends on RAS Oncoprotein Dosage
Because transformed cells are known to be prone to genetic alterations, we maintained each line for a maximum of five passages in culture and, for each further analysis, we used cells derived from frozen stocks established early after transfection. In addition, before starting with the analysis of the differentiation markers, the clones obtained in the absence of TSH, were cultured in complete medium for 7 d, to exclude any possible clonal difference in the expression of thyroid-specific genes that might be influenced by the different culture conditions. All of the positive clones were analyzed for the expression of Titf1 and Tg by quantitative Western blotting, as already described for the screening of RAS levels (see Materials and Methods). The measured levels of Titf1 and Tg proteins were expressed as percentage of the parental cell line, and results are reported, for each analyzed clone, as a function of the amount of oncogene expressed (Fig. 1
, BG). At variance from a previous report (13), the analysis of differentiation-specific gene expression showed very similar results for all three oncogenes. However, the elevated number of individual colonies analyzed gave us the opportunity to establish that, for each of the three RAS oncogenes examined, a clear decrease in Tg and Titf1 proteins was only observed at high levels of oncoprotein expression (Fig. 1
, BG). It is interesting to note that clones selected for TSH-independent growth (TSH) invariably show high RAS levels and, hence, very low Tg and Titf1 expression, whereas clones neutrally selected (+TSH) show a high variability in oncogene expression. However, when the oncogene is expressed at high levels, Tg and Titf1 expression is similar to that measured in clones isolated in medium lacking TSH. Thus, we conclude that the factor ultimately determining the repression of the differentiated phenotype in FRTL-5/RAS cells is the amount of oncogene expressed, independently from the method used for selection.
RAS Oncogenes Modulate the Whole Thyroid Differentiation Program in a Dose-Dependent Fashion
The data presented in the previous section show a dose-dependent inhibitory effect of RAS oncogenes on Titf1 and Tg protein expression. We then asked whether a decrease of the corresponding mRNA accounts for the reduction of the two proteins. We also asked whether the other known thyroid differentiation markers are similarly regulated by RAS. To address these questions, the levels of mRNAs encoding all known thyroid-specific or enriched proteins were analyzed by real-time quantitative RT-PCR (QPCR) in FRTL-5/RAS clones. The mRNAs measured encoded the following proteins: Tg, TPO, NIS, Tshr, ThOX-2, PDS, and the transcription factors Titf1, Foxe1, and Pax8. The mRNA level of a housekeeping gene,
-1 tubulin, was also measured in each sample for normalization. The cellular clones subjected to the QPCR analysis were selected using the following criteria: 1) 10 clones were selected for each oncogene, for a total of 30 clones; 2) for each oncogene, five were chosen from those selected in the presence of TSH, and five from those selected in the absence of TSH (Fig. 1
); 3) clones expressing different levels of oncoprotein, as assessed by QWB (Fig. 1
) were selected for each transfected oncogene. Total RNA was extracted from selected clones and wild-type FRTL-5 cells, and processed for QPCR analysis, as indicated in Materials and Methods. After normalization of input cDNA for
-1 tubulin transcripts, mRNA levels for each gene were reported as the percentage of the levels measured in parental FRTL-5 cells (Fig. 2
, A and C). For each of the three oncogenes, we observed a clear loss of differentiation-specific gene expression only when activated RAS is expressed not less than 10-fold over the endogenous level, with no difference between the three different oncogenes (Fig. 2A
). For the majority of the analyzed genes, a threshold exists around 10-fold overexpression of the oncogenes respect to endogenous RAS, thereby defining the boundary between normally differentiated and de-differentiated clones. Such a dose-dependent Ras effect is even more evident if we average the expression of each gene for the clones below (low RAS) or above the threshold (high RAS), as shown in Fig. 2
, B and D. The slight increase in expression of the differentiation markers at low Ras level shown in panel B are not statistically significant.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2. High Levels of RAS Oncogene Expression Down-Regulate all Thyroid Differentiation Markers
A, The differentiated phenotype of FRTL-5/RAS clones was analyzed by QPCR. The expression of the indicated thyroid-specific genes measured in 30 selected clones is reported. In charts, each spot corresponds to a single clone (see chart legends). For each gene, values reported are averages of two independent experiments, normalized by the expression of 1-tubulin, and expressed as a percentage of the value measured in parental FRTL-5. Clones are ordered along the x-axis by increasing RAS level. An arrow on the x-axis indicates where the 10-fold increase in RAS expression, relatively to the wild-type cells, occurs. B, Analyzed clones are grouped in two categories: low-RAS (<10-fold the endogenous RAS level) and high-RAS (>10-fold the endogenous RAS level) expressing clones. The values shown in panel A are illustrated here as the average value for each category. The increase in expression of the differentiation markers at low RAS level shown in this panel are not statistically significant. C, The expression of the PDS gene has been measured by QPCR and reported as in panel A. D, PDS expression is shown in low-RAS and in high-RAS-expressing clones grouped as in panel B, showing that PDS is strongly up-regulated even at low levels of RAS expression.
|
|
In general, we observed a more marked decrease in the expression of structural genes (Tg, TPO, NIS, Tshr, and, to a lesser extent, ThOX-2) than in those encoding the transcription factors. Also among the three transcription factors, however, there are differences in response to RAS because Pax8 and Foxe1 were markedly down-regulated, whereas Titf1 was much less affected, even by high levels of RAS (Fig. 2
, A and B). In contrast with all markers examined, the gene responsible for the Pendred syndrome (PDS), encoding a putative apical porter of iodide (Fig. 2
, C and D) is markedly up regulated in all samples analyzed, without exception and irrespective of the amount of oncogenic RAS expressed (Fig. 2
, C and D).
A Tamoxifen-Dependent RAS Oncogene Rapidly Dedifferentiate FRTL-5 Only when Expressed at High Levels
To confirm and extend the dose-dependent effects of RAS in a different experimental context, we generated a novel inducible system in FRTL-5 cells expressing a conditional RAS oncoprotein, obtained by fusing H-RASV12 downstream of a tamoxifen (4OHT)-sensitive mutant of the estrogen receptor ligand binding domain (ERTMLBD) (ERTM-RAS, see Materials and Methods). FRTL-5 cells were transfected with an expression construct encoding both ERTM-RAS and neomycin resistance and subjected to different selections. A portion of the transfected population was subjected to a neutral selection for G418 resistance in a complete medium, including TSH, which is necessary for proliferation of FRTL-5 cells. An equivalent portion of cells were selected for G418 resistance in the absence of TSH but in the presence of 4OHT, to select for cells made TSH-independent for growth by the activated RAS. Finally, to test whether RAS was under tight control by ERTMLBD, we subjected a similar number of transfected cells to selection for G418 resistance in the absence of both TSH and 4OHT. After 2 wk of continuous selection, cells were fixed and stained with crystal violet (Fig. 3A
). As expected, numerous G418-resistant colonies were generated both in the presence of TSH and in the absence of TSH with 4OHT, whereas no colonies were obtained in the absence of TSH without 4OHT, demonstrating that the chimeric oncogene is able to induce TSH-independent growth of FRTL-5 cells only in the presence of tamoxifen. From parallel dishes selected in complete medium, individual colonies were picked, expanded and tested for ERTM-RAS expression. We analyzed the effects of RAS activation on Tg expression in clones expressing either low or high levels of ERTM-RAS and in parental FRTL-5 cells, as a control. Cells were treated 24 h with 4OHT, or left untreated, and total proteins were analyzed by Western blot. In Fig. 4B
, a representative Western blot is shown with two clones expressing low levels and two clones expressing high levels of the chimeric oncogene. All clones expressed wild-type levels of Tg in the absence of 4OHT, but only those expressing high levels of ERTM-RAS showed a tamoxifen-dependent decrease in Tg expression (Fig. 3B
). It is noteworthy that tamoxifen induces an increase in the ERTM-RAS protein levels (Fig. 3B
), as has also been observed for other ER-fusion proteins, presumably due to the stabilization of the chimera by the binding of tamoxifen (17, 18).

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3. FRTL-5 Dedifferentiation Is an Early Effect of High Levels of Oncogenic RAS
A, FRTL-5 were transfected with pCEFL-ERTMRAS. Transfected cells were selected with 40 µg/ml of G418 in TSH-supplemented (6H) or -deficient (5H) medium, or in 5H medium plus 100 nM 4OHT (5H + 4OHT) for 2 wk, colonies were then fixed and stained. B, Individual clones isolated in 6H medium were analyzed for ERTMRAS and Tg expression in the steady state or after 24 h of 4OHT treatment. Total cell lysates were prepared and Western blot probed with anti-RAS and anti-Tg antibodies. Representative results obtained with clones expressing low ERTMRAS levels (clones 21 and 15), as well as clones expressing high ERTMRAS levels (clones 11 and 20) are shown. Parental FRTL-5 cells treated with 4OHT for 24 h are shown as a control. C and D, Growth curves of a low-RAS clone (clone 15) and an high-RAS clone (clone 11) in the absence of TSH. Cells were plated on d 2 in 6H medium. On d 0, replicate plates were fed 5H (filled symbols) or 5H + 4OHT (open symbols) medium, and cell number was determined at the indicated times. Data reported are mean values of two independent experiments, each performed in duplicate. E, The differentiated phenotype of a representative FRTL-5/ERTMRAS clone expressing high levels of the chimeric oncogene (clone 11) was analyzed by QPCR. The expression of the indicated genes was measured in cells treated for 24 h with 4OHT, or left untreated. Expression values are normalized for -tubulin expression, and reported, for each gene, as a percentage of expression in the absence of 4OHT. Reported values are averages of two independent experiments. F, Tg expression in cells cultured in the absence of TSH and treated with 4OHT for the indicated times was analyzed by Western blot. Parental FRTL-5 cells and representative low-RAS (clone 15) and high-RAS (clone 11) clones are shown. G, A low-RAS (clone 21) and a high-RAS (clone 20) clone were transfected with C5 and Cp5 reporter constructs, measuring Titf1 and Pax8 transcriptional activities, respectively. For each experimental point, replicate plates were pretreated with 4OHT 18 h before transfection, then transfected in the presence of 4OHT and maintained in medium with 4OHT for an additional 48 h. Lysates were then collected and CAT activities determined. Measured CAT activities were normalized by protein concentration and reported, for each promoter, as the percentage of its activity in the absence of 4OHT.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4. Titf1 Transcriptional Activity Is Strongly Repressed in Clones Expressing High RAS Oncogene Levels
AC, Individual clones expressing variable amounts of each oncogene were transiently cotransfected with C5-CAT, together with pCMV encoding Titf1 or HDvp16. The amount of DNA was held constant by including the pCMV empty vector. Values of C5-CAT are expressed as percentages of the activity of the CMV-CAT reporter in each cell line. In each chart, clones are ordered on the x-axis by increasing RAS oncogene expression levels, which are reported in the legend in brackets. Values reported are the means of three experiments each performed in duplicate. In panel C at the bottom, a representative Western blot of the lysates from the transiently transfected clones reported in the chart is shown. In this experiment, 3xFLAG-tagged Titf1 and HDvp16 constructs were used. Exogenous proteins were detected with an anti-FLAG antibody and are indicated by arrows. Titf1 was expressed at high levels in all analyzed clones, whereas HDvp16 was barely detectable. An arrow indicates a nonspecific band (n.s.) detected by the anti-FLAG antibody in FRTL-5 cells, which is shown as a loading control. D, FRTL-5 (TL-5) and HeLa cells were transfected as described in AC, and C5 activities are reported for each cell line, as a percentage activity of the CMV-CAT reporter.
|
|
The ability to proliferate in the absence of TSH was measured in both low- and high-RAS-expressing clones, showing that Ras is able to induce TSH-independent growth even at low levels of expression, albeit at different proliferation rates (Fig. 3
, C and D).
We measured the expression of Tg, NIS, Tshr, Titf1, Foxe1, and Pax8 in one representative high RAS clone (clone 11, see panel B) by QPCR, after 24 h of RAS induction by tamoxifen (Fig. 3E
). All markers analyzed showed a decrease in their mRNA level after induction of RAS activity, albeit to different extents. This experiment demonstrated that the down-regulation of thyroid differentiation markers by RAS is exerted through a rapid decrease of their mRNAs. It was conceivable, however, that the marked decrease of Tshr expression could be responsible for the decrease of all the other markers because TSH is required for the maintenance of thyroid differentiated phenotype. To address this point, we tested the time course of Tg disappearance in the absence of TSH and after RAS induction in clones with high RAS, by comparing them with clones with low RAS and with parental FRTL-5 cells (Fig. 3F
). After 3 d of 4OHT treatment in medium lacking TSH, Tg protein was undetectable in high RAS-expressing cells, whereas it remained unchanged in low RAS and in parental cells (Fig. 3F
). These latter two showed only a slight decrease in Tg protein levels after an additional 4 d of treatment (Fig. 3F
, d 7). These data strongly suggest that RAS is able to directly inhibit the expression of Tg, by exerting its effect independently from Tshr signaling.
We then asked whether the different outcomes of high vs. low levels of RAS oncogenes in dedifferentiating thyroid cells lie in their ability to inhibit or not the activity of thyroid transcription factors. To this aim, we analyzed the activity of Titf1 and Pax8, that have been demonstrated to be important for thyroid-specific gene expression (19) using artificial promoters specific for each of the two transcription factors. Two reporter constructs, bearing a 5x repeat of either the Titf1 binding site (C5) or the Pax8 binding site (Cp5) upstream of a CAT reporter gene (9) were transiently transfected in FRTL-5/ERTM-RAS clones expressing high or low amounts of the inducible oncoprotein, and promoter activity was measured in the presence or absence of tamoxifen. A dramatic reduction of Titf1 and Pax8 transcriptional activity was only induced by tamoxifen in clones expressing high levels of ERTM-RAS (Fig. 3G
), suggesting that the loss of thyroid-specific gene expression induced by RAS is due to the inhibition of these transcription factors.
TITF1 Activity Is Inhibited by Multiple Mechanisms in High RAS-Expressing FRTL-5 Cells
We have previously demonstrated that Titf1 is inhibited at the posttranslational level by RAS in FRTL-5 cells (14). To establish whether the residual Titf1 protein present in clones expressing low levels of RAS oncogenes was transcriptionally active (see Fig. 1
, EG), we performed a series of promoter activity assays on selected clones. Clones expressing different levels of one of the three oncogenes were transiently transfected with the Titf1-specific reporter C5-CAT alone or together with an expression construct encoding either wild-type Titf1 or a chimeric protein obtained by the fusion of the homeodomain of Titf1 (HD) and the vp16 activation domain (HDvp16). The activity of the C5 promoter in each clone was expressed as a percentage of the cytomegalovirus (CMV)-chloramphenicol acetyl transferase (CAT) reporter activity, after normalization for transfection efficiency. As shown in Fig. 4
, the clones expressing less RAS oncogene, showed a C5 activity comparable with that observed in the parental FRTL-5 cells. Conversely, the C5 driven expression was very low in all lines with high RAS expression, independently of the oncogene used. Overexpression of either Titf1 or HDvp16 was not able to restore C5 activity in these cells (Fig. 4
, AC), suggesting that RAS may also act at a posttranscriptional level. To check the expression of the ectopic transcription factors in transiently transfected cells, transfection experiments were repeated with 3xFLAG-tagged versions of Titf1 and HDvp16. Although the 3xFLAG-Titf1 was well expressed and easily detectable by Western blot, the 3xFLAG-HDvp16 was expressed at very low levels and barely detectable (Fig. 4C
, bottom panel), even though it seems to be expressed at similar levels in all clones analyzed. To measure the ability of the two proteins in activating the Titf1-specific reporter C5 in thyroid as well as in nonthyroid cells, parental FRTL-5 and HeLa were transfected similarly to the FRTL-5/RAS clones. Both Titf1 and HDvp16 were unable to overactivate the C5 reporter in FRTL-5 cells, where it is already very active (Fig. 4D
). Conversely, in HeLa cells, where the C5 reporter is totally inactive, both proteins are able to strongly activate it (Fig. 4D
), with HDvp16 being more potent than Titf1.
Taken together, these results suggest that in the presence of high levels of RAS oncoproteins both the synthesis and the activity of Titf1 can be inhibited. Interestingly, RAS oncogenes are able to inhibit the function of both Titf1 and the fusion protein HDvp16, bearing only the homeodomain of Titf1. Because the activation domain of vp16 is not inhibited by RAS when fused to other DNA binding domains (see below), we suggest that the Titf1 DNA binding domain could be a target of the inhibitory activity of RAS.
RAS Inhibits Titf1 and Pax8 Activity by Acting through Different Domains
To further investigate the ability of RAS in repressing the activity of HDvp16, we asked whether the inhibitory effect was exerted through the Titf1 homeodomain or the vp16 moiety. To ascertain this, three FRTL-5/RAS clones (one for each oncogene) were transiently transfected with the reporter constructs specific for Titf1 or Pax8. The Titf1-specific reporter C5-CAT was cotransfected with either wild-type Titf1 or the already described HDvp16 chimera, whereas the Pax8-specific reporter, was cotransfected with either wild-type Pax8 or a fusion protein bearing the paired-domain of Pax8 fused to the vp16 transactivation domain (PDvp16). To check the specificity of RAS repression on thyroid-specific transcription, and to exclude the possibility that inhibition of the chimeric transcription factors could be mediated by their vp16 moiety, a GAL4-responsive promoter, bearing five repeats of the GAL4 binding site upstream of a CAT reporter gene (G5-CAT), was transfected in parallel, stimulated by a GAL4vp16 chimeric transcription factor (Fig. 5A
). Cp5 basal activity was strongly inhibited in all three clones, showing that RAS is able to inhibit Pax8. The inhibition by RAS is specific for thyroid-specific reporters because activation of the G5 promoter by GAL4vp16 was not inhibited by RAS. Unlike that observed for Titf1, Pax8 expression is able to weakly reactivate its reporter, whereas the PDvp16 chimera appears to be fully functional, being able to strongly activate the Cp5 promoter. Importantly, the absence of RAS inhibitory effects on both PDvp16 and GAL4vp16 chimeras allowed us to exclude that the inhibition observed with HDvp16 was exerted through its vp16 moiety.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5. Different Domains of Titf1 and Pax8 Are Targets of RAS Inhibition
A, Three stable FRTL-5/RAS clones expressing high levels of either one of the RAS oncogenes were transiently transfected with reporters for either Titf1, Pax8, or GAL4 (C5-CAT, Cp5-CAT or G5-CAT, respectively). C5 was cotransfected together with pCMV encoding either Titf1 or HDvp16; Cp5 was cotransfected with pCMV encoding either Pax8 or PDvp16; G5 was cotransfected with a vector expressing GAL4vp16. The amount of DNA was held constant by including the pCMV empty vector where needed. After 48 h, cell extracts were prepared and equal volumes assayed for reporter activities. Measured CAT activities were normalized by protein concentration. Values of C5-CAT, Cp5-CAT, and G5-CAT are expressed, for each clone, as percentages of the activity of a CMV promoter measured in parallel dishes. Data reported are mean values of two independent experiments, each performed in duplicate. B, Parental FRTL-5 cells were transiently transfected as already described for panel A, either in the absence or presence of pCMV encoding H-RASV12. Values of C5-CAT, Cp5-CAT, and G5-CAT are reported as percentages of the activity of a CMV promoter measured in parallel dishes. Data reported are mean values of three independent experiments, each performed in duplicate.
|
|
We have already shown that RAS is able to acutely repress the activity of Titf1 in parental FRTL-5 cells (14), thus demonstrating that Titf1 inhibition is a direct effect of RAS. To confirm that the inhibition of the Titf1 homeodomain and Pax8 were also direct consequences of RAS constitutive activity, and not due to secondary changes in chronically transformed FRTL-5/RAS cells, we performed a transient transfection experiment. FRTL-5 cells were transfected with C5-CAT, Cp5-CAT, or G5-CAT promoters, with or without vectors expressing the corresponding transcription factors, in the presence or absence of a vector encoding H-RASV12. The results obtained in FRTL-5 were consistent with those obtained in stable clones (Fig. 5B
).
Taken together, these data confirmed that RAS inhibition of Titf1 is exerted at least in part through its DNA binding domain. Conversely, RAS appears to inhibit Pax8 by a different mechanism because the DNA binding domain of Pax8 is not affected by RAS, as demonstrated by the complete rescue of Cp5 activity by PDvp16.
 |
DISCUSSION
|
|---|
The present study demonstrates for the first time that constitutively active RAS proteins can elicit dose- dependent effects in thyroid cells. We show that high level expression of oncogenic RAS induces deregulated growth and loss of differentiation in cultured rat thyroid cells, whereas low levels of the same protein elicit only deregulated growth without interference with differentiation. Activating Ras mutations are considered an early event in thyroid tumorigenesis, given their presence in a wide spectrum of thyroid neoplasia, including highly differentiated benign tumors, malignant anaplastic cancers and several cancers of intermediate severity and/or degree of differentiation (3, 4). The ability of RAS oncogenes to interfere with differentiation of thyroid cells is a controversial issue because contrasting data have been obtained using different in vitro thyroid models. Chiefly, human primary thyrocytes expressing oncogenic RAS maintain their differentiated status (20), whereas different rat cell lines transfected with RAS oncogenes lose the expression of thyroid-specific genes (12, 13, 14, 21, 22). In the present study, analyzing a large number of individual clones, it was possible to establish a correlation between the observed phenotype and the amount of oncogene expressed. Previous studies, both from our and other laboratories, did not take into consideration the levels of expression of RAS oncogenes, which here we show to be critical for the inhibitory effects on differentiation. Thus, low level RAS expression could explain the cases where dedifferentiation was not observed (20). However, we cannot rule out that differences between immortalized cell lines and primary cells or species differences could account, at least in part, for the discrepancies reported previously. Moreover, here we show that selecting RAS expressing clones for growth in the absence of TSH only highly expressing, totally undifferentiated clones are obtained. This observation is consistent with previous studies that reported a constant loss of differentiation in FRTL-5 cells expressing oncogenic RAS, given that in those studies TSH independence was always used as a tool to select RAS-transformed FRTL-5 cells (12, 13, 14).
RAS family GTPases regulate key steps in the transduction of extracellular signals, and, hence, their activity has to be finely tuned (23, 24). The complexity of RAS function is further underlined by recent data suggesting tumor suppressor properties of wild-type RAS alleles (25, 26, 27, 28). Transfection of wild-type HRAS into rat fibroblasts inhibits anchorage-independent growth and colony formation, induced by the oncogenic RAS allele (25). Furthermore, in vivo, wild-type KRAS2 can inhibit oncogenic RAS-induced lung carcinogenesis in mice (26), and very recently it has been shown that human lung tumors bearing activating mutations in one KRAS2 allele, frequently show the loss of the wild-type allele (28). This evidence reveals a critical role for the balance between the amount of RAS oncoproteins and the wild-type RAS in the process of malignant transformation. In accordance with these observations, our data show the requirement of high RAS oncoproteins overexpression to achieve the loss of the differentiated phenotype, at least 10-fold over the endogenous wild-type RAS. It is conceivable that, also in this case, the balance between the oncogenic and wild-type RAS proteins instead of the absolute level of oncoprotein, is the factor controlling the threshold for thyroid dedifferentiation.
To validate these novel results in a different experimental setting, we established an inducible RAS system, in which a mutant of the ligand binding domain of the estrogen receptor (LBD-ERTM) (29) is fused to H-RASV12 resulting in a chimeric RAS oncogene (ERTMRAS) whose activity is tamoxifen dependent. Recently, a very similar molecule has been independently reported (30). The chimeric RAS that we generated is subjected to a very tight tamoxifen control because induced TSH-independent growth of FRTL-5 cells occurs only in the presence of tamoxifen. Clones expressing different levels of such protein were isolated and differentiation markers were analyzed after ERTMRAS induction by tamoxifen. Similarly to what observed in FRTL-5/RAS clones, only clones expressing high levels of ERTMRAS were dedifferentiated by the induction of the oncogene. Furthermore, this system allowed us to analyze the effects of RAS activity at very early time points, demonstrating that RAS is able to dedifferentiate FRTL-5 cells rapidly after its induction, hence showing that inhibition of thyroid differentiation appears to be a direct and early effect of RAS oncogenic activation.
RAS-induced alterations in the differentiated thyroid phenotype, as assessed by QPCR, were quite complex. The analysis of the complete panel of thyroid-specific genes revealed different alterations for diverse classes of genes. Proteins required for the physiologic function of the adult thyrocyte, namely Tshr and NIS, the enzymes TPO and ThOX-2 and the thyroid hormones precursor Tg, are all strongly down-regulated as a result of RAS oncogene overexpression. Among transcription factors known to play a role in thyroid differentiation, Pax8 appears to be as sensitive to RAS inhibition, whereas Titf1 and Foxe1 are much less repressed even by high levels of RAS. In the majority of high-RAS clones, in fact, Titf1 protein is undetectable while maintaining relatively high levels of Titf1 mRNA. Hence, our data indicate that RAS down- regulates Titf1 mainly by posttranslational mechanisms leading to the loss of protein expression. Interestingly, one of the nine markers analyzed, pendrin (PDS), showed a marked up-regulation by RAS, independently of the levels of oncogene expressed. PDS is a recently characterized apical transporter of iodide in thyroid follicular cells and is the gene causing the Pendred syndrome (11, 31, 32). Even very low levels of RAS oncogenes were able to strongly induce the overexpression of PDS that hence appears to be controlled by RAS with mechanisms different from those regulating all other thyroid-specific or thyroid-enriched genes. Pendrin expression has been measured previously in thyroid tumors (33, 34, 35), and it has been also proposed to be methylated early in the process of thyroid tumorigenesis (36). We suggest that, in thyroid tumors where RAS is activated, there could be a prevalence of Pendrin expression and that presence of Pendrin could be a marker of poorly differentiated or anaplastic cancers.
We have previously shown that RAS oncogenes expressed in thyroid cells exert an inhibitory action on Titf1 and Pax8 activity, as demonstrated by the use of the Titf1- and Pax8-specific reporters C5 and Cp5, respectively (14, 37). Here, by using an inducible system, we demonstrate that only high levels of RAS are able to inhibit Titf1 and Pax8 activity, whereas lower levels, sufficient for the stimulation of TSH-independent proliferation, are unable to inhibit their transcriptional activity. We also demonstrated that the inhibition of Titf1 is mediated by its DNA binding domain because a chimera obtained by the fusion between the Titf1 homeodomain and the transactivation domain of the transcriptional coactivator vp16 is also inhibited by RAS. On the contrary, the chimera bearing the paired-domain of Pax8 fused to vp16 is able to rescue the inhibition exerted by RAS on the Pax8-specific promoter, both in stable clones and in transiently RAS-expressing FRTL-5, implying that the Pax8 DNA binding domain is not a target of RAS.
The action of RAS on the thyroid-specific transcriptional apparatus is controversial. It has been reported that the DNA binding activity of Titf1 is inhibited by RAS via a phosphorylation-dependent mechanism (38). Other reports have demonstrated that thyroid cells expressing oncogenic H-RAS contain Titf1 that is capable of binding DNA but unable to activate transcription (13). We suggest that the discrepancies could be to the use of diverse transformed cell lines kept for long time in culture and to the absence of controls for the amounts of RAS. Further studies on the inducible RAS system that we have developed, should control for both variables and help resolve the mechanism used by RAS to dedifferentiate thyroid cells.
In conclusion, this paper represents the first evidence of a correlation between the extent of RAS oncogene expression and the loss of thyroid differentiated phenotype. We also show that the three RAS oncogenes analyzed exert similar effects on thyroid phenotype. The use of a novel inducible system revealed that inhibition of differentiation is an early effect elicited only by high levels of RAS oncogenes in FRTL-5 cells. Finally, we provide some evidence on the mechanisms responsible for RAS-induced dedifferentiation, suggesting that interference with transcription factors activity, either at the transactivation or DNA binding level might be involved in RAS inhibition of the expression of thyroid-specific genes.
We suggest that some of these mechanisms might be operating in human thyroid cancers, where the extent of dedifferentiation is directly linked to the severity of the prognosis. It is conceivable that the elucidation of the mechanism operating in the dedifferentiation of cultured cells might provide some insights for a redifferentiating therapy of anaplastic thyroid cancers.
 |
MATERIALS AND METHODS
|
|---|
Expression and Reporter Constructs
The cDNAs encoding v-Ha-RAS, v-Ki-RAS, and the human H-RASV12 were cloned into the BamHI site of the pBabePuro (pBpuro) retroviral vector (15). To ensure equal expression levels, the coding regions for all the three oncogenes were flanked by the 5' and 3' noncoding regions belonging from the human H-RASV12 cDNA. The construct pBS-ERTM containing the DNA encoding amino acids 281599 of a tamoxifen-responsive mutant of the murine estrogen receptor (ERTM) cloned into the BamHI and EcoRI sites of pBluescript KS+ (Stratagene, La Jolla, CA) has been described (29). To obtain a ERTM coding sequence suitable to be cloned in frame with H-RASV12 at its 5', ERTM was amplified from pBS-ERTM by PCR using the following primers: 5' GCGGATCCCTGGTTTGGCAGCCCCTGTAGAAGCGATGCGAAATGAAATGGGTGC-3' and 5'-GCCCAAGCTTGTATTCTGTTCGTGGATCGATCGTGTTGGGGAAGCC-3'. The amplified DNA was cloned into the BamHI and HindIII sites of pBluescript KS+ and fused with a HindIII-SalI fragment of HRASV12 excised from pBpuro-H-RASV12, to generate the chimeric construct ERTMRAS. The construct was then cloned into the BamHI site of pCEFL expression vector. The correct frame of the fusion was verified by DNA sequencing. RcCMVTitf1 and pCMV5-Pax8 encoding wild-type Titf1 and Pax8, respectively, have been previously described (39). 3xFLAG-Titf1 has already been described (40). RcCMV-HDvp16 and -PDvp16 are expression constructs encoding chimeric proteins obtained by the fusion between the homeodomain (HD) of Titf1 or, respectively, the paired domain (PD) of Pax8, and 78 C- terminal amino acids of the transactivation domain of vp16 transcriptional activator. 3xFLAG-HDvp16 was generated by PCR amplification of the HDvp16 coding region from RcCMV-HDvp16, and subsequent cloning in the HindIII and XbaI sites of the 3xFLAG CMV-10 vector (Sigma, St. Louis, MO). C5-CAT and Cp5-CAT are artificial reporter constructs in which the cat gene is under the control of an artificial promoter containing five binding sites either for the transcription factor Titf1 (C5), or Pax8 (Cp5), respectively (9).
Cell Culture and Transfection
Rat thyroid follicular FRTL-5 cells were maintained in Coons modified F12 medium (EuroClone, Milano, Italy) supplemented with 5% newborn bovine serum (HyClone, Logan, UT) and six growth factors (6H), including TSH (1 mU/ml), and insulin (10 µg/ml) as previously described (8) (6H medium). For experiments performed in the absence of TSH, the medium was identical with the complete medium above described (6H medium), but TSH was not added (5H medium). All transfections on FRTL-5 cells were carried out by the use of FuGene 6 (Roche Molecular Biochemicals, Indianapolis, IN) following the manufacturers instructions. For stable transfection experiments, FRTL-5 cells were plated at 20% confluency in 100-mm dishes and transfected with 2 µg/dish of pBabePuro encoding v-Ha-RAS, v-Ki-RAS, H-RASV12, or the empty vector. Forty-eight hours later, transfected cells were selected either in 6H medium or in 5H medium, in the presence of 1 µg/ml of puromycin (Sigma). After 2 wk of continuous selection in the indicated conditions, for each experimental point single colonies were selected from one dish, whereas a twin dish was stained with crystal violet and colonies counted.
Bromodeoxyuridine incorporation assays were performed as previously described (37). Briefly, the cells were seeded in chamber slides in complete medium. After 48 h, cells were switched to low serum medium (Coons modified F12 medium with 0.2% newborn bovine serum) for 72 h, then stimulated with 6H or 5H medium. After 24 h of incubation, cells were subjected to a 2-h BrdU pulse.
For cell proliferation assays, 105 cells were seeded in 60-mm dishes in 6H medium for 48 h, medium was then substituted with 5H medium or 5H medium with the addition of 100 nM tamoxifen, where indicated, and cell number was determined at the indicated times.
For transient transfection experiments, cells were plated at 40% confluency in 60-mm dishes and C5-CAT reporter plasmid (2.5 µg) was transfected with the different expression vectors as indicated in the figure legends. After 48 h, cells were lysed in lysis buffer [10 mM HEPES (pH 7.9), 400 mM NaCl, 0.1 mM EGTA, 0.5 mM dithiothreitol, 5% glycerol, and 0.5% phenylmethylsulfonyl fluoride]. Luciferase and chloramphenicol acetyltransferase (CAT) activities were measured as previously described (41, 42). Briefly, CAT activity was measured by incubation with 5 mM chloramphenicol and 0.1 µCi of [3H] acetyl-coenzyme A (1.4 Ci/mmol, 50 µCi/ml). Reactions were performed in the presence of water-insoluble scintillation fluid (Econofluor-2; Packard Bioscience, Meriden, CT) at 37 C and counted after 5 h. Luciferase activity was measured in the presence of 0.2 mM D-luciferin (Sigma) in a Lumat LB 9501 luminometer (Berthold Technologies, Bad Wildbad, Germany).
Immunoblotting
Whole cell lysate of stable FRTL-5/RAS clones were prepared in sample buffer and protein concentration was measured by the BCA protein assay reagent (Pierce, Rockford, IL), following the manufacturers instructions. Western blots were performed as previously described (14). Rabbit polyclonal antibodies against Tg, TITF1, Foxe1, and Pax8 previously produced in our laboratory were used at approximately 1 µg/ml (13). Anti-RAS rat monoclonal antibodies (259) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Immune complexes were detected by enhanced chemiluminescence as instructed by manufacturer (Amersham Biosciences, Arlington Heights, IL). ANTI-FLAG M2 antibody was purchased from Sigma. For QWB, chemiluminescence was captured and analyzed with a Fluor-S MAX MultiImager (Bio-Rad, Hercules, CA) supported by the Quantity One 4.1 software (Bio-Rad).
RNA Extraction, cDNA Synthesis, and QPCR
Total RNA was isolated from FRTL-5/RAS clones and the parental FRTL-5 by the acid guanidinium thiocyanate/phenol procedure (43). Four micrograms of total RNA from each cell line were used as a template for the synthesis of the first strand cDNA, starting from random hexamers, using the Superscript II Reverse Transcriptase kit (Invitrogen Life Technologies, Carlsbad, CA) according to manufacturers instructions. QPCR was conducted using an ABI Prism 7000 sequence detection system and SYBR Green chemistry (PE Biosystems, Foster City, CA). Reactions were carried out in duplicate or triplicate, which were executed in identical well positions in different runs, using cDNA obtained from 50 ng of total RNA per reaction as template. Specific primer sets for each gene (sequences available upon request) were designed using their known cDNA sequence and the program Primer Express. For all QPCR experiments, the output raw data from each cDNA sample were internally normalized against the
-1 tubulin mRNA in each sample. Throughout the text and the figures, the QPCR results for each FRTL-5/RAS clone are presented as percent of parental FRTL-5 levels, whereas the values measured in FRTL-5/ERTMRAS cells treated with 4OHT are presented as percent of the value measured in the same cells left untreated. Both calculations used the formula 1.94
Ct, where 1.94 is the multiplier for amplification per PCR cycle, and the exponent
Ct is the cycle threshold difference with
-tubulin found for that sample.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to V. Enrico Avvedimento, Nina Dathan, and Massimo Santoro for critical review of the manuscript. We thank Gerard I. Evan (Cancer Research Institute, University of California at San Francisco, San Francisco, CA) for the generous gift of the plasmid encoding ERTMLBD.
 |
FOOTNOTES
|
|---|
This study was supported by the Associazione Italiana per la Ricerca sul Cancro (AIRC), from the Progetto Finalizzato Ministero della Salute (RF 02/184) and by Ministero dellUniversita' e della Ricerca Scientifica e Tecnologica, Grant "I geni delluomo" cluster 01. G.D.V. and L.B. were supported by a Biogem s.c.a.r.l. salary. V.M.C.d.C. was a recipient of a CAPES Foundation (Brazil) fellowship.
Current address for V.M.C.d.C.: Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, CCS-Bloco G, 21949-900 Rio de Janeiro, Brazil.
First Published Online September 23, 2004
Abbreviations: CAT, Chloramphenicol acetyl transferase; CMV, cytomegalovirus; H-RASV12, oncogenic form of cellular RAS; NIS, Na+/ I symporter; 4OHT, tamoxifen; PDS, Pendred syndrome gene; QPCR, quantitative RT-PCR; QWB, quantitative Western blotting; Tg, thyroglobulin; ThOX-2, thyroid oxidase; TPO, thyroperoxidase; Tshr, TSH receptor; v-Ha-RAS or v-Ki-RAS, two forms of viral RAS.
Received for publication April 27, 2004.
Accepted for publication September 17, 2004.
 |
REFERENCES
|
|---|
- Bos JL 1989 ras Oncogenes in human cancer: a review. Cancer Res [Erratum 50:1352 (1990)] 49:46824689
- Tallini G 2002 Molecular pathobiology of thyroid neoplasms. Endocr Pathol 13:271288[CrossRef][Medline]
- Lemoine NR, Mayall ES, Wyllie FS, Williams ED, Goyns M, Stringer B, Wynford-Thomas D 1989 High frequency of ras oncogene activation in all stages of human thyroid tumorigenesis. Oncogene 4:159164[Medline]
- Namba H, Rubin SA, Fagin JA 1990 Point mutations of ras oncogenes are an early event in thyroid tumorigenesis. Mol Endocrinol 4:14741479[Abstract]
- Gimm O 2001 Thyroid cancer. Cancer Lett 163:143156[CrossRef][Medline]
- Garcia-Rostan G, Zhao H, Camp RL, Pollan M, Herrero A, Pardo J, Wu R, Carcangiu ML, Costa J, Tallini G 2003 ras Mutations are associated with aggressive tumor phenotypes and poor prognosis in thyroid cancer. J Clin Oncol 21:32263235[Abstract/Free Full Text]
- Sherman SI 2003 Thyroid carcinoma. Lancet 361:501511[CrossRef][Medline]
- Ambesi-Impiombato FS, Parks LA, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 77:34553459[Abstract/Free Full Text]
- Missero C, Cobellis G, De Felice M, Di Lauro R 1998 Molecular events involved in differentiation of thyroid follicular cells. Mol Cell Endocrinol 140:3743[CrossRef][Medline]
- Dupuy C, Pomerance M, Ohayon R, Noel-Hudson MS, Deme D, Chaaraoui M, Francon J, Virion A 2000 Thyroid oxidase (THOX2) gene expression in the rat thyroid cell line FRTL-5. Biochem Biophys Res Commun 277:287292[CrossRef][Medline]
- Royaux IE, Suzuki K, Mori A, Katoh R, Everett LA, Kohn LD, Green ED 2000 Pendrin, the protein encoded by the Pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology 141:839845[Abstract/Free Full Text]
- Fusco A, Berlingieri MT, Di Fiore PP, Portella G, Grieco M, Vecchio G 1987 One- and two-step transformations of rat thyroid epithelial cells by retroviral oncogenes. Mol Cell Biol 7:33653370[Abstract/Free Full Text]
- Francis-Lang H, Zannini M, De Felice M, Berlingieri MT, Fusco A, Di Lauro R 1992 Multiple mechanisms of interference between transformation and differentiation in thyroid cells. Mol Cell Biol 12:57935800[Abstract/Free Full Text]
- Missero C, Pirro MT, Di Lauro R 2000 Multiple ras downstream pathways mediate functional repression of the homeobox gene product TTF-1. Mol Cell Biol 20:27832793[Abstract/Free Full Text]
- Morgenstern JP, Land H 1990 Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 18:35873596[Abstract/Free Full Text]
- Shirokawa JM, Elisei R, Knauf JA, Hara T, Wang J, Saavedra HI, Fagin JA 2000 Conditional apoptosis induced by oncogenic ras in thyroid cells. Mol Endocrinol 14:17251738[Abstract/Free Full Text]
- Samuels ML, Weber MJ, Bishop JM, McMahon M 1993 Conditional transformation of cells and rapid activation of the mitogen-activated protein kinase cascade by an estradiol-dependent human raf-1 protein kinase. Mol Cell Biol 13:62416252[Abstract/Free Full Text]
- Greulich H, Erikson RL 1998 An analysis of Mek1 signaling in cell proliferation and transformation. J Biol Chem 273:1328013288[Abstract/Free Full Text]
- Di Palma T, Nitsch R, Mascia A, Nitsch L, Di Lauro R, Zannini M 2003 The paired domain-containing factor Pax8 and the homeodomain-containing factor TTF-1 directly interact and synergistically activate transcription. J Biol Chem 278:33953402[Abstract/Free Full Text]
- Gire V, Wynford-Thomas D 2000 RAS oncogene activation induces proliferation in normal human thyroid epithelial cells without loss of differentiation. Oncogene 19:737744[CrossRef][Medline]
- Kupperman E, Wofford D, Wen W, Meinkoth JL 1996 Ras inhibits thyroglobulin expression but not cyclic adenosine monophosphate-mediated signaling in Wistar rat thyrocytes. Endocrinology 137:96104[Abstract]
- Velasco JA, Acebron A, Zannini M, Martin-Perez J, Di Lauro R, Santisteban P 1998 Ha-ras interference with thyroid cell differentiation is associated with a down-regulation of thyroid transcription factor-1 phosphorylation. Endocrinology 139:27962802[Abstract/Free Full Text]
- Crespo P, Leon J 2000 Ras proteins in the control of the cell cycle and cell differentiation. Cell Mol Life Sci 57:16131636[CrossRef][Medline]
- Malumbres M, Barbacid M 2003 RAS oncogenes: the first 30 years. Nat Rev Cancer 3:459465[CrossRef][Medline]
- Spandidos DA, Frame M, Wilkie NM 1990 Expression of the normal H-ras1 gene can suppress the transformed and tumorigenic phenotypes induced by mutant ras genes. Anticancer Res 10:15431554[Medline]
- Zhang Z, Wang Y, Vikis HG, Johnson L, Liu G, Li J, Anderson MW, Sills RC, Hong HL, Devereux TR, Jacks T, Guan KL, You M 2001 Wildtype Kras2 can inhibit lung carcinogenesis in mice. Nat Genet 29:2533[CrossRef][Medline]
- Diaz R, Ahn D, Lopez-Barcons L, Malumbres M, Perez de Castro I, Lue J, Ferrer-Miralles N, Mangues R, Tsong J, Garcia R, Perez-Soler R, Pellicer A 2002 The N-ras proto-oncogene can suppress the malignant phenotype in the presence or absence of its oncogene. Cancer Res 62:45144518[Abstract/Free Full Text]
- Li J, Zhang Z, Dai Z, Plass C, Morrison C, Wang Y, Wiest JS, Anderson MW, You M 2003 LOH of chromosome 12p correlates with Kras2 mutation in non-small cell lung cancer. Oncogene 22:12431246[CrossRef][Medline]
- Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI 1995 A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 23:16861690[Abstract/Free Full Text]
- Dajee M, Tarutani M, Deng H, Cai T, Khavari PA 2002 Epidermal Ras blockade demonstrates spatially localized Ras promotion of proliferation and inhibition of differentiation. Oncogene 21:15271538[CrossRef][Medline]
- Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, Green ED 1997 Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17:411422[CrossRef][Medline]
- Yoshida A, Taniguchi S, Hisatome I, Royaux IE, Green ED, Kohn LD, Suzuki K 2002 Pendrin is an iodide-specific apical porter responsible for iodide efflux from thyroid cells. J Clin Endocrinol Metab 87:33563361[Abstract/Free Full Text]
- Arturi F, Russo D, Bidart JM, Scarpelli D, Schlumberger M, Filetti S 2001 Expression pattern of the pendrin and sodium/iodide symporter genes in human thyroid carcinoma cell lines and human thyroid tumors. Eur J Endocrinol 145:129135[Abstract]
- Russo D, Bulotta S, Bruno R, Arturi F, Giannasio P, Derwahl M, Bidart JM, Schlumberger M, Filetti S 2001 Sodium/iodide symporter (NIS) and pendrin are expressed differently in hot and cold nodules of thyroid toxic multinodular goiter. Eur J Endocrinol 145:591597[Abstract]
- Porra V, Bernier-Valentin F, Trouttet-Masson S, Berger-Dutrieux N, Peix JL, Perrin A, Selmi-Ruby S, Rousset B 2002 Characterization and semiquantitative analyses of pendrin expressed in normal and tumoral human thyroid tissues. J Clin Endocrinol Metab 87:17001707[Abstract/Free Full Text]
- Xing M, Tokumaru Y, Wu G, Westra WB, Ladenson PW, Sidransky D 2003 Hypermethylation of the Pendred syndrome gene SLC26A4 is an early event in thyroid tumorigenesis. Cancer Res 63:23122315[Abstract/Free Full Text]
- Cobellis G, Missero C, Di Lauro R 1998 Concomitant activation of MEK-1 and Rac-1 increases the proliferative potential of thyroid epithelial cells, without affecting their differentiation. Oncogene 17:20472057[CrossRef][Medline]
- Avvedimento VE, Musti AM, Ueffing M, Obici S, Gallo A, Sanchez M, DeBrasi D, Gottesman ME 1991 Reversible inhibition of a thyroid-specific trans-acting factor by Ras. Genes Dev 5:2228[Abstract/Free Full Text]
- Zannini M, Acebron A, De Felice M, Arnone MI, Martin-Perez J, Santisteban P, Di Lauro R 1996 Mapping and functional role of phosphorylation sites in the thyroid transcription factor-1 (TTF-1). J Biol Chem 271:22492254[Abstract/Free Full Text]
- Park KS, Whitsett JA, Di Palma T, Hong JH, Yaffe MB, Zannini M 2004 TAZ interacts with TTF-1 and regulates expression of surfactant protein-C. J Biol Chem 279:1738417390[Abstract/Free Full Text]
- Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:10441051[Abstract/Free Full Text]
- Brasier AR, Tate JE, Habener JF 1989 Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7:11161122[Medline]
- Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156159[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
G. Riesco-Eizaguirre and P. Santisteban
New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy
Endocr. Relat. Cancer,
December 1, 2007;
14(4):
957 - 977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D'Andrea, R. Iacone, T. Di Palma, R. Nitsch, M. G. Baratta, L. Nitsch, R. Di Lauro, and M. Zannini
Functional Inactivation of the Transcription Factor Pax8 through Oligomerization Chain Reaction
Mol. Endocrinol.,
August 1, 2006;
20(8):
1810 - 1824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Garcia-Jimenez, M. A. Zaballos, and P. Santisteban
DARPP-32 (Dopamine and 3',5'-Cyclic Adenosine Monophosphate-Regulated Neuronal Phosphoprotein) Is Essential for the Maintenance of Thyroid Differentiation
Mol. Endocrinol.,
December 1, 2005;
19(12):
3060 - 3072.
[Abstract]
[Full Text]
[PDF]
|
 |
|
| This Article |
 |
 |
Abstract
|
 |
Full Text (PDF)
|
 |
All Versions of this Article:
19/1/76
most recent
Author Manuscript (PDF)
|
 |
| |