help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0153
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chauvet, C.
Right arrow Articles by Danan, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chauvet, C.
Right arrow Articles by Danan, J.-L.
Molecular Endocrinology 19 (10): 2517-2526
Copyright © 2005 by The Endocrine Society

The Gene Encoding Fibrinogen-ß Is a Target for Retinoic Acid Receptor-Related Orphan Receptor {alpha}

Caroline Chauvet, Brigitte Bois-Joyeux, Coralie Fontaine, Philippe Gervois, Marguerite-Anne Bernard, Bart Staels and Jean-Louis Danan

Centre National de La Recherche Scientifique UPR9078 (C.C., B.-B.-J., J.-L.D.) Faculté de Médecine René Descartes Paris 5, site Necker, 75015 Paris, France; Institut National de la Santé et de la Recherche Médicale U545 (C.F., P.G., B.S.), Département d’Athérosclérose, Institut Pasteur de Lille, and Faculté de Pharmacie, Université de Lille II, 59019 Lille, France; and Fédération de Biochimie (M.-A.B.) , Groupe Hospitalier Pitié-Salpêtrière, 75013 Paris, France

Address all correspondence and requests for reprints to: Dr. Jean-Louis Danan, Faculté de Médecine René Descartes Paris 5, site Necker, Centre National de la Recherche Scientifique Unité Propre de Recherche 9078, 156 rue de Vaugirard 75730 Paris Cedex 15, France. E-mail: danan{at}necker.fr.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fibrinogen is a plasma protein synthesized by the liver. It is composed of three chains ({alpha}, ß, {gamma}). In addition to its main function as a coagulation factor, this acute phase protein is also a risk marker for atherosclerosis. Retinoic acid receptor-related orphan receptor (ROR){alpha} is a nuclear receptor modulating physiopathological processes such as cerebellar ataxia, inflammation, atherosclerosis, and angiogenesis. In this study, we identified ROR{alpha} as a regulator of fibrinogen-ß gene expression in human hepatoma cells and in mouse liver. A putative ROR{alpha} response element (RORE) was identified in the human fibrinogen promoter. EMSA showed that ROR{alpha} binds specifically to this RORE, and cotransfection experiments in HepG2 hepatoma cells indicated that this RORE confers ROR{alpha}-dependent transcriptional activation to both the human fibrinogen-ß and the thymidine kinase promoters. Stable transfection experiments in HepG2 and Hep3B hepatoma cells demonstrated that overexpression of ROR{alpha} specifically increases endogenous fibrinogen-ß mRNA levels. Chromatin immunoprecipitation experiments revealed that the fibrinogen RORE is occupied by ROR{alpha} in HepG2 cells. Thus, the human fibrinogen gene is a direct target for ROR{alpha}. Furthermore, fibrinogen mRNA levels in liver and plasma fibrinogen concentrations are specifically decreased in staggerer mice, which are homozygous for a deletion invalidating the Rora gene. Taken together, these data add further evidence for an important role of ROR{alpha} in the control of liver gene expression with potential pathophysiological consequences on coagulation and cardiovascular risk.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
RETINOIC ACID RECEPTOR-RELATED orphan receptor {alpha} [ROR{alpha}; NR1F1 (1)] is a transcription factor belonging to the nuclear receptor superfamily (for review, see Ref.2). ROR{alpha} binds as a monomer to ROR{alpha} response elements (ROREs) consisting of a 6-bp AT-rich sequence preceding the half-core PuGGTCA motif (3, 4, 5) or as a homodimer to a direct repeat of the monomeric site with a 2-bp spacing between the PuGGTCA sequences (6, 7) and to a site containing two ROREs in a palindromic configuration (8). ROR{alpha} has the typical structure of a nuclear receptor including a ligand-binding domain linked to a DNA-binding domain via a hinge region and a N-terminal region that modulates its transcriptional activity (for review, see Ref.2). The Rora gene generates four isoforms (ROR{alpha}1–4), which differ in their N-terminal regions and display distinct DNA recognition and transactivation properties (4, 9, 10, 11). A spontaneous mutation consisting of a deletion within the Rora gene that prevents translation of the ROR{alpha} ligand-binding domain has been identified in the staggerer mouse (10, 11). The homozygous staggerer (Rorasg/sg) mutant suffers from severe cerebellar ataxia caused by massive neurodegeneration of Purkinje cells (12). Moreover, analysis of the phenotype of the Rorasg/sg mouse has revealed a role for ROR{alpha} in regulating the inflammatory and immune responses (13, 14) and in modulating atherosclerosis susceptibility (15, 16) and postischemic angiogenesis (17).

Recent studies have aimed at identifying ROR{alpha} target genes in different cell types and organs. These genes cover a wide range of functions. ROR{alpha} controls the transcription of the genes encoding the Purkinje cell protein-2 and sonic hedgehog proteins that are crucially involved in the development of the central nervous system (10, 18, 19). The protooncogene N-myc appears also to be a ROR{alpha} target gene (19, 20). N-myc is essential for normal embryonic organogenesis, and its oncogenic activity is associated with tumors of neuroendocrine and embryonic origins. Moreover, ROR{alpha} is involved in the control of inflammation by stimulating the transcription of the nuclear factor-{kappa}B inhibitor I{kappa}B{alpha} (14) and in bone metabolism by stimulating the transcription of the gene encoding bone sialoprotein (21). The gene encoding apolipoprotein A-I, a major component of high-density lipoproteins, is also controlled by ROR{alpha} in rats (16). We and others provided evidence that ROR{alpha} may participate in the control of {alpha}-fetoprotein and apolipoprotein C-III gene expression in liver (22, 23). Our results showed that the ROR{alpha}4 and, to a lesser extent, the ROR{alpha}1 isoforms are expressed in cells of hepatic origin (24).

Fibrinogen is synthesized in hepatocytes and secreted into blood as a dimeric molecule, with each half composed of three polypeptides ({alpha}, ß, and {gamma}) linked by disulfide bonds. The three polypeptides are encoded by three distinct clustered genes located respectively on chromosomes 4, 3, and 2 in the human (25), mouse (26), and rat (27). These three genes are transcribed from classical promoters containing TATA and CAAT boxes and IL-6-responsive elements that are crucially involved in their induction during the acute phase of inflammation (28, 29, 30, 31, 32, 33, 34). In humans, the fibrinogen-ß-chain appears to be the rate-limiting chain for assembly and secretion of mature fibrinogen (35, 36). Fibrinogen plays a key role in the coagulation cascade: its proteolytic cleavage by thrombin leads to formation of fibrin, an essential component of the clot. Moreover, fibrinogen is a risk marker for cardiovascular diseases such as atherosclerosis (for a review, see Ref.37). Thus, precise characterization of the mechanisms that control expression of fibrinogen-ß is a goal of intensive research. For instance, fibrates, widely used hypolipidemic drugs, repress fibrinogen-ß gene expression through an indirect mechanism involving the peroxisome proliferator-activated receptor-{alpha} nuclear receptor (38, 39, 40).

In the present work, we identified ROR{alpha} as a positive regulator of fibrinogen-ß gene expression both in human hepatoma cells and in mouse liver. This effect of ROR{alpha} is mediated by a RORE located in the human fibrinogen-ß promoter. Stable overexpression of ROR{alpha} in human hepatoma cells leads to an increase in the amount of endogenous fibrinogen mRNA. In addition, chromatin immunoprecipitation (ChIP) experiments showed that the RORE is occupied by ROR{alpha} in cells, identifying human fibrinogen-ß as a direct ROR{alpha} target gene. Moreover, hepatic fibrinogen-ß mRNA level and plasma fibrinogen concentration are lower in Rorasg/sg mice, which lack a transcriptionally active ROR{alpha} protein, than in their Rora+/+ littermates.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A better understanding of the role of a transcription factor requires the identification of the genes that it controls in a given cell type or organ. To identify putative ROR{alpha} target genes in the liver, we conducted a computer-assisted analysis to search for ROREs in the cis-regulatory sequences of genes known to be actively and specifically transcribed in the liver. In this respect, we focused mainly on the regulatory elements of genes potentially regulated by the liver-enriched hepatocyte nuclear factor 1 (HNF1{alpha}/HNF1{alpha} homodimer or HNF1{alpha}/HNF1ß heterodimer) (41). This transcription factor of the POU-Homeo domain family plays major roles in specifying gene expression in liver (for review, see Ref.42). We found that the promoter of the human fibrinogen-ß gene, one of the best characterized HNF1 target genes (43), contains the sequence GTGAGTAGGTCA, between nucleotides –366 and –355 from the transcription initiation site. This sequence is very similar to the consensus RORE. To determine whether fibrinogen-ß is a putative ROR{alpha} target gene, we first tested the ability of ROR{alpha} to bind to the (–366/–355) fibrinogen-ß-RORE using EMSAs with in vitro synthesized ROR{alpha}1 and ROR{alpha}4 proteins. A specific DNA-protein complex with a retarded migration was formed when the ROR{alpha}1-programmed lysate (Fig. 1Go, lane 3) or the ROR{alpha}4-programmed lysate (Fig. 1Go, lane 12) was incubated with the 32P-labeled probe covering the fibrinogen-ß-RORE. The binding of the ROR{alpha}1 and ROR{alpha}4 proteins to the probe is specific, because it was competed by an excess of the unlabeled Fibrinogen-ß-RORE oligonucleotide (Fig. 1Go, lanes 4–6 for ROR{alpha}1, lanes 13–15 for ROR{alpha}4), but not by an excess of the unrelated unlabeled Epo-hypoxia response element oligonucleotide (Fig. 1Go, lanes 7–9 for ROR{alpha}1, lanes 16–18 for ROR{alpha}4). This oligonucleotide, which does not contain any RORE-like sequence, covers the binding site for hypoxia-inducible factor-1 in the enhancer of the erythropoietin gene (44). These data demonstrate that ROR{alpha}1 and ROR{alpha}4 bind to the putative (–366/–355) fibrinogen-ß-RORE present in the promoter of the human fibrinogen gene.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 1. ROR{alpha}1 and ROR{alpha}4 Specifically Bind to a Putative RORE of the Fibrinogen-ß Promoter

Upper panels, Radiolabeled Fib-ß-RORE probe was incubated with 0.5 µl of ROR{alpha}1 programmed lysate (lanes 3–9) or with 1 µl of ROR{alpha}4 programmed lysate (lanes 12–18). Radiolabeled Fib-ß-RORE probe alone (lanes 1 and 10) or incubated with unprogrammed reticulocyte lysate (lanes 2 and 11) was used as a control. Competition assays were carried out by incubating the radiolabeled Fib-ß-RORE probe with the ROR{alpha}1 or the ROR{alpha}4 programmed lysate in the presence of unlabeled Fib-ß-RORE (lanes 4–6 for ROR{alpha}1 and lanes 13–15 for ROR{alpha}4) or Epo-HRE (lanes 7–9 for ROR{alpha}1 and lanes 16–18 for ROR{alpha}4) double-stranded oligonucleotides at a 10-, 25-, or 50-fold molar excess. The arrows point to the specific ROR{alpha}/probe complexes. Lower panel, In the same manner, radiolabeled Fib-ß-RORE probe was incubated with 0.5 µl of ROR{alpha}1 programmed lysate in the absence of double-stranded competitor oligonucleotide (lanes 19 and 26) or in the presence of a 10-, 50-, and 100-fold molar excess of the wild-type Fib-ß-RORE (lanes 20–22) or of the mutated Fib-ß-ROREm (lanes 23–25) oligonucleotide. Similar results were obtained with ROR{alpha}4. Sequences of the oligonucleotides used in the EMSAs are represented in the right lower part of the figure. The sequence of the RORE is written in bold. Mutated nucleotides are underlined. The nucleotides written in lowercase do not belong to the fibrinogen-ß or the erythropoietin sequence and were added for convenience. HRE, Hypoxia response element.

 
To test whether ROR{alpha} activates transcription from the (–366/–355) Fib-ß-RORE, we first cloned four copies of this element in front of the herpes simplex virus thymidine kinase promoter to obtain the p(FibßRORE)4x-Tk-Luc luciferase reporter vector. HepG2 human hepatoma cells were cotransfected with the p(FibßRORE)4x-Tk-Luc vector with increasing amounts of the pCMX-hROR{alpha}1 expression vector. Cotransfection of ROR{alpha}1 specifically stimulated, in a dose-dependent manner, the activity of the p(FibßRORE)4x-Tk-Luc reporter vector but not that of the parent pTK-Luc plasmid (Fig. 2AGo). These experiments indicated that the element at –366/–355 in the human fibrinogen-ß promoter is a functional RORE. We then tested the functionality of the (–366/–355) fibrinogen-ß-RORE in the response to ROR{alpha} in the context of the human fibrinogen promoter. Interestingly, overexpression of ROR{alpha}1 significantly increased, in a dose-dependent manner, the activity of the wild-type fibrinogen-ß promoter (phFibß-Luc; from –400 to +13) in transient transfection experiments in HepG2 hepatoma cells (Fig. 2BGo). The stimulatory effect of ROR{alpha} is specific and is mediated by the identified (–366/–355) fibrinogen-ß-RORE, because it was observed neither with the plasmid (phFibß-Luc; from –258 to +13) that contains a truncated fibrinogen-ß promoter (Fig. 2BGo) nor with the construct phFibßmut-Luc (Fig. 2CGo) that carries the point mutations AGGCCT (instead of AGGTCA) that severely impair the binding of ROR{alpha} to the RORE as shown in Fig. 1Go. Taken together, these results strongly suggested that, upon targeting the RORE, ROR{alpha} acts as a transactivator on the fibrinogen-ß promoter.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. ROR{alpha} Activates Transcription through the (–355/–366) RORE of the Fibrinogen-ß Promoter

A, HepG2 human hepatoma cells were cotransfected with 500 ng of the p(FibßRORE)4x-Tk-Luc luciferase reporter vector or with 500 ng of the pTk-Luc control vector and increasing amounts (0, 166, 333, or 666 ng) of pCMX-hROR{alpha}1 expression vector while keeping the total amount of transfected DNA constant to 1166 ng by adding the pCMX insertless vector. B, HepG2 cells were cotransfected with 500 ng of the phFibß-Luc luciferase reporter vector carrying either the (–400 to +13) or the truncated (–258 to +13) region of the human fibrinogen-ß promoter or with 500 ng of the phFibßmut-Luc mutated vector and increasing amounts (0, 166, 333, or 666 ng) of pCMX-hROR{alpha}1 expression vector while keeping the total amount of transfected DNA constant to 1166 ng by adding the pCMX insertless vector. C, HepG2 cells were cotransfected with 500 ng of the phFibß-Luc or of the phFibß-mut-Luc luciferase reporter vector carrying either the wild-type (–400 to +13) or the mutated region of the human fibrinogen-ß promoter, respectively, and 666 ng of the empty pCMX vector (–) or of the pCMX-hROR{alpha}1 (+) expression vector. In all cases, the luciferase activity of the vectors in the presence of the pCMX-hROR{alpha}1 expression vector was expressed relative to that in the absence of expression vector. Results are given as means ± SEM (n = 6).

 
To gain further insights into the involvement of ROR{alpha} in fibrinogen gene expression, we tested the effect of overproducing ROR{alpha} on the level of endogenous fibrinogen-ß mRNA in human hepatoma cells. HepG2 and Hep3B human hepatoma cells were stably transfected with the pCMX-hROR{alpha}1 or the pCMX-mROR{alpha}4 expression vectors to overexpress the ROR{alpha}1 or the ROR{alpha}4 proteins, respectively, or with the insertless pCMX vector as a control. After selection by geneticin, the pools of clones were first characterized for ROR{alpha} expression. Real-time quantitative RT-PCR experiments indicated that all the pools of clones transfected with the ROR{alpha} expression vectors contain 4.5- to 35-fold more Rora mRNA than the pools of clones transfected with the insertless vector (Fig. 3AGo). Specific RT-PCR amplification of the Rora1 or the Rora4 mRNA shows that the level of the Rora1 mRNA and that of the Rora4 mRNA are increased in the pools of clones transfected with the pCMX-hROR{alpha}1 and the pCMX-mROR{alpha}4 expression vectors, respectively (Fig. 3BGo). In agreement with this result, we also observed that the ROR{alpha}1 and ROR{alpha}4 proteins were also overexpressed in the pools of clones transfected with the pCMX-hROR{alpha}1 and the pCMX-mROR{alpha}4 expression vectors, respectively (Fig. 3CGo). Interestingly, real-time quantitative RT-PCR experiments showed that the level of endogenous fibrinogen-ß mRNA is increased in most of the pools of HepG2 and Hep3B cells overexpressing ROR{alpha} as compared with the control cells (Fig. 3AGo). This up-regulation is specific because mRNA levels of SerpinA1, which is, similar to fibrinogen, a plasma protein synthesized by hepatocytes, are not affected by ROR{alpha} overexpression (Fig. 3AGo). In the same manner, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA level is not affected by ROR{alpha} overexpression (Fig. 3AGo). Taken together, these data indicate that ROR{alpha} specifically up-regulates the endogenous fibrinogen-ß gene expression in human hepatoma cells.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. Stably Transfected HepG2 and Hep3B Hepatoma Cells Overexpressing ROR{alpha} Have Higher Fibrinogen-ß mRNA Levels

HepG2 and Hep3B human hepatoma cells were stably transfected with the pCMX-hROR{alpha}1 (cells referred as to "ROR{alpha}1") or the pCMX-mROR{alpha}4 (cells referred as to "ROR{alpha}4") expression vector, or with the pCMX insertless vector ("control" cells). A, Total RNA obtained from HepG2 (left panel) and Hep3B (right panel) stably transfected cells was analyzed for Rora and Fib-ß mRNAs by Q-RT-PCR. SerpinA1 and GAPDH mRNAs were monitored as controls. Results are expressed relative to the means of the "control" cells for each of the three (for HepG2 cells) or two (for Hep3B cells) pools of clones of the control, ROR{alpha}1, and ROR{alpha}4 groups. B, Rora1 and Rora4 mRNAs were analyzed by semiquantitative RT-PCR (25 amplification cycles). Aliquots of the PCR mixture were submitted to electrophoresis and transferred to nitrocellulose filters, which were then hybridized with [{alpha}-32P]-labeled probes specific for Rora. Autoradiograms are shown. C, Nuclear proteins prepared from stably transfected HepG2 cells were analyzed by Western blotting with an antiserum against ROR{alpha} (lanes 3–5). A mix of lysates programmed for producing ROR{alpha}1 and ROR{alpha}4 proteins (lane 1) and the control unprogrammed lysate (lane 2) were processed simultaneously. The Ponceau Red staining of the proteins present in lanes 1–5 is shown as a control for protein loading and transfer (lanes 1*–5*). unprog., Unprogrammed; Q-PCR, quantitative PCR; SerpA1, serpinA1.

 
To determine whether ROR{alpha} binds to the fibrinogen promoter directly, ChIP experiments were performed in the HepG2 hepatoma cells overproducing ROR{alpha}1 (Fig. 4Go). The use of the anti-ROR{alpha} antiserum resulted in the precipitation of DNA fragments containing the region of the fibrinogen-ß promoter with the (–366/–355) RORE. By opposition, no PCR signal was observed with the HepG2 cells stably transfected with the control pCMX empty vector, which contain low amounts of ROR{alpha} proteins. The specificity of the immunoprecipitation was checked by using an antihemagglutinin antiserum instead of the anti-ROR{alpha} antiserum. Amplification of a fragment from the ß-actin gene was used as a further control. These results indicate that in these cells of liver origin, ROR{alpha} binds, in a dose-dependent manner, to the (–366/–355) RORE we mapped, strongly suggesting that fibrinogen is a direct target gene for ROR{alpha} in human liver cells.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. hROR{alpha} Is Recruited to the Fibrinogen-ß Promoter in HepG2 Human Hepatoma Cells

Soluble chromatin was prepared from the pCMX-hROR{alpha}1, and from the pCMX, stably transfected HepG2 cells and immunoprecipitated (IP) with an anti-ROR{alpha} antiserum or with an antihemagglutinin (HA) antiserum as a negative control. The final DNA extractions were PCR amplified using pairs of primers covering either the fibrinogen-ß promoter (–468 to –103) with the (–366/355) fibrinogen-ß-RORE (top panel) or a fragment of the ß-actin gene as a negative control (bottom panel), and the PCR products were analyzed by electrophoresis. Aliquots of DNA taken before the precipitation step (input) were also submitted to PCR as controls. ß-Act, ß-Actin.

 
These observations prompted us to check whether ROR{alpha} also participates in the regulation of fibrinogen-ß gene expression in vivo in mouse liver. Therefore, fibrinogen expression was measured in liver of the staggerer mice that carry a natural deletion in the Rora gene (10), rendering the ROR{alpha} transcriptionally inactive. The fibrinogen-ß mRNA levels were thus measured in the livers of Rorasg/sg mice and of their Rora+/+ littermates by real-time quantitative RT-PCR. Interestingly, hepatic fibrinogen mRNA levels were lower in all the Rorasg/sg mice analyzed than in their Rora+/+ littermates of the same sex (Fig. 5AGo). On average, hepatic fibrinogen-ß mRNA levels were significantly (P < 0.01) lower in Rorasg/sg mice than in Rora+/+ mice (60% ± 3 vs. 100% ± 12). As controls for the specificity, the expression of several other genes was also measured by real-time RT-PCR in the same liver RNA samples. No significant differences between the staggerer mice and their wild-type control littermates were observed in the levels of mRNA for the secreted plasma protein albumin (Alb) the transcription factor HNF1{alpha} (Hnf1{alpha}) the mitochondrial protein uncoupling protein 2 (Ucp2), and the cytoskeletal protein ß-actin (ß-Act) (Fig. 5AGo). These results strongly suggest that mouse fibrinogen-ß gene expression is specifically controlled by ROR{alpha} in vivo in the liver. Moreover, several putative ROREs were identified by bioinformatics analysis in the 5'-flanking region of the mouse fibrinogen gene (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Staggerer Mice Have Decreased Hepatic Fibrinogen-ß mRNA Levels Associated with Decreased Plasma Fibrinogen Concentrations

Homozygous staggerer (sg) mice carrying a nonfunctional Rora gene and their wild-type littermates (wt) of the same sex were males and females from 2–15 months old. A, Total hepatic RNA was analyzed by Q-RT-PCR for fibrinogen-ß (Fib-b), albumin (Alb), hepatocyte nuclear factor-1{alpha} (Hnf1{alpha}), uncoupling protein-2 (Ucp2), and ß-actin (ß-Act) mRNA levels (six animals per group except for albumin for which the number of animals was five). The values corresponding to a paired staggerer and her wild-type littermate are visualized by the same symbol. Significant differences, P < 0.01, from the control wild-type mice are indicated by **(paired t test). B, Fibrinogen concentrations were measured in plasma from staggerer mice and from their control littermates as described in Materials and Methods (eight animals per group). The values corresponding to a paired staggerer and its wild-type littermate are visualized by the same symbol. Significant differences, P < 0.01, from the control wild-type mice are indicated by **(paired t test). C, The concentrations of total plasma protein were measured in plasma from wild-type and staggerer mice. Results are expressed as means ± SEM (n = 6). Prot., Protein; conc., concentration.

 
Because the fibrinogen-ß chain is one of the three polypeptidic chains ({alpha}, ß, and {gamma}) constituting plasma fibrinogen, plasma fibrinogen concentrations were measured in Rorasg/sg mice and their Rora+/+ littermates by using an immunonephelometric assay. Interestingly, all Rorasg/sg mice analyzed exhibited lower plasma fibrinogen concentrations than their Rora+/+ littermates (Fig. 5BGo) whereas no significant differences were observed in the concentration of total plasma protein (Fig. 5CGo). The mean concentration of plasma fibrinogen of the Rorasg/sg mice was 30% lower than that of the Rora+/+ mice. These results correlate with the lower amount of fibrinogen-ß mRNA in the livers of staggerer mice. Taken together, our results strongly suggest that ROR{alpha} participates in vivo in the control of fibrinogen gene expression in the mouse liver.

In the present study, we provide converging lines of evidence identifying the fibrinogen-ß gene as a new ROR{alpha} target gene in liver. This finding extends our knowledge on the role of ROR{alpha} in regulating gene expression in the liver. It suggests new potential functions of this transcription factor in physiology and physiopathology. Because fibrinogen is a coagulation factor, our results suggest an implication of ROR{alpha} in the control of coagulation. However, further work is needed to determine to what extent the ROR{alpha}-fibrinogen-ß pathway may play a role in cardiovascular pathophysiology. Fibrinogen is among the plasma proteins the concentration of which rises during the acute phase response after an inflammatory stimulus (45). The main mediator of this stimulation is IL-6 (31). The specific increase in the amount of acute phase proteins is part of a response to maintain a correct homeostasis. In this respect, it is interesting to note that ROR{alpha} also exerts antiinflammatory properties (14). One of its target genes is the gene encoding I{kappa}B{alpha}, an inhibitor that prevents the action of nuclear factor-{kappa}B (14). It may well be that another aspect of the antiinflammatory role of ROR{alpha} is to participate in the control of some of the genes coding for acute phase proteins. It will be informative to compare the response to inflammatory stresses induced by lipopolysaccharide or turpentine injections in staggerer and wild-type mice.

Very often the ROREs also constitute response elements for nuclear receptors of the Rev-erb family (Rev-erb{alpha} and Rev-erbß) (46), which are potent transcriptional inhibitors (47, 48). By competition for the binding to a same response element, Rev-erb{alpha} and Rev-erbß inhibit ROR{alpha}-dependent transactivation (22, 49). A recent study showed that the fibrinogen gene exhibits a circadian rhythm of expression in liver (50). Interestingly, it is known that Rev-erb/ROR response elements are involved in the control of circadian gene expression and that the Rev-erba and Rev-erbb genes but not the Rora gene exhibit a circadian rhythm of expression in liver (51). In this respect, we observed that the –366/–355 RORE in the human fibrinogen-ß gene is also recognized by Rev-erb{alpha} because cotransfection experiments indicated that Rev-erb{alpha} down-regulates, in a specific manner, the activity of the p(FibßRORE)4x-Tk-Luc vector (data not shown). These data illustrate a functional cross-talk between the ROR{alpha} and Rev-erb nuclear receptors, which could be implicated in the control of fibrinogen gene under physiological situations such as circadian variation in liver gene expression.

Taken together, these observations provide new information concerning the role of ROR{alpha} in the control of gene expression in liver, which may be of relevance in physiological and pathophysiological processes such as hemostasis, inflammation, and atherosclerosis. This intensifies the objective to identify pharmacological regulators of ROR{alpha} transcriptional activity.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression and Luciferase Reporter Vectors
The pCMX-hROR{alpha}1 and pCMX-mROR{alpha}4 expression vectors containing the human ROR{alpha}1 cDNA and the mouse ROR{alpha}4 cDNA, respectively, were kind gifts from Dr. V. Giguère (4). The pGK-neo expression vector (a gift from Dr. P. Djian) (52) contains the phosphoglycerate kinase 1 promoter driving the neomycin phosphotransferase gene. The p(FibßRORE)4x-Tk-Luc vector was obtained by cloning four copies (sense-antisense-sense-antisense) of the RORE, located between nucleotides –355 and –366 of the human fibrinogen promoter, in the BglII restriction site in the polylinker of the TkpGL3 luciferase reporter vector (referred to as pTk-Luc in the remainder of this manuscript) (53). To this aim, the oligonucleotides hFibß-366-RORE/U, 5'-GATCTGTGAGTAGGTCAAATA-3' and hFibß-366-RORE/L, 5'-GATCTATTTGACCTACTCACA-3' were used. The phFibß-Luc vector [previously named phFib-ß, (40)] contains a genomic fragment corresponding to nucleotides –400 to +13 of the human fibrinogen promoter. A specific mutation of the RORE located between nucleotides –355 and –366 of the human fibrinogen promoter (G–371CCTTGTGAGTAGGTCAAATTTAC–348-> G–371CCTTGTGAGTAGGCCTAATTTAC–348) was generated by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) and phFibß-Luc as template, giving rise to the phFibßmut-Luc vector. Identity of the pFibßRORE4x-Tk-Luc and the phFibßmut-Luc vectors was verified by DNA sequencing.

EMSAs
Unlabeled ROR{alpha}1 and ROR{alpha}4 proteins were obtained in vitro from the pCMX-hROR{alpha}1 and the pCMX-mROR{alpha}4 vectors using the TNT-T7 Quick coupled transcription/translation kit (Promega Corp., Madison, WI). DNA-protein complexes were allowed to form by incubating aliquots of the programmed lysates (0.5 µl for ROR{alpha}1 and 1 µl for ROR{alpha}4) for 20 min on ice in a 15-µl reaction containing 15 mM Tris-HCl (pH 7.5), 50 mM KCl, 15 mM NaCl, 1 mM MgCl2, 0.03 mM EDTA, 1 mM dithiothreitol, 7% glycerol (vol/vol), 50 ng of polydeoxyinosinic deoxycytidylic acid, 50 ng of unspecific single-stranded oligonucleotides, and 0.3 ng (10,000 cpm) of the double-stranded oligonucleotide labeled by fill in with the Klenow polymerase and [{alpha}-32-P]-dATP (3000 Ci/mmol, Amersham Pharmacia Biotech, Arlington Heights, IL). For competition experiments, double-stranded oligonucleotides were added simultaneously with the labeled probe. Electrophoresis was performed at 200 V for 2 h and 20 min at 15 C in 0.25 xTris-borate-EDTA buffer on a native 6% polyacrylamide gel that had been prerun for 2 h under the same conditions. The gels were then fixed for 15 min in 20% ethanol, 10% acetic acid, dried, and submitted to autoradiography.

Cell Culture, Transient and Stable Transfections, and Luciferase Assay
HepG2 and Hep3B human hepatoma cells (American Type Culture Collection, Manassas, VA; HB-8065 and HB-8064, respectively) were cultured in a 1:1 mixture of DMEM and Ham-F12 media with Glutamax-I, supplemented with 10% (vol/vol) fetal bovine serum, 100 µg/ml gentamycin, and 2.5 µg/ml fungizone (all from Invitrogen, San Diego, CA) as previously described (24). Transient and stable transfection experiments were done using the calcium phosphate precipitation method as described elsewhere (54). For transient transfection experiments, cells cultured in 12-well plates were cotransfected with 500 ng/well of p(FibßRORE)4x-Tk-Luc reporter vector and 166, 333, or 666 ng/well of pCMX-hROR{alpha}1 expression vector. The total amount of transfected DNA was kept constant to 1166 ng/well by addition of the pCMX insertless vector. The precipitate was incubated with the cells for 4 h, and the medium was replaced with fresh medium. Luciferase activity was assayed 48 h after transfection as described previously (54). For stable transfection experiments, cells plated in 100-mm diameter dishes were cotransfected with 10 µg of one of the three pCMX, pCMX-hROR{alpha}1, and pCMX-mROR{alpha}4 vectors and 0.5 µg of the pGK-neo selection vector (d 1). The medium was replaced 4 h later with fresh medium and 3 d later (d 4) with medium supplemented with 500 µg/ml of geneticin (Invitrogen). Medium was then changed every 2 d. For selection, the transfected cells were cultured in the presence of geneticin at a concentration of 500 µg/ml from d 4 to d 12, which was raised to 800 µg/ml from d 12 to d 21. The selected cells from one plate were pooled, replated, and cultured in the presence of 500 µg/ml of geneticin from d 21 to d 25. Cells were then cultured in medium containing 200 µg/ml of geneticin.

Plasma Fibrinogen Measurements from Wild-Type and Staggerer Mice
Mice used in the experiments were bred in accordance with criteria outlined in the European Convention for the Protection of Laboratory Animals. Staggerer (Rorasg/sg) mutant and wild-type (Rora+/+) mice were obtained by crossing heterozygote (Rora+/sg) mice (gifts from Professor J. Mariani) maintained in a C57BL/6J genetic background. Homozygous offspring were identified by PCR genotyping (55). Mice were housed and maintained on a chow diet (A03 diet purchased from Usine d’Alimentation Rationelle, Epinay-sur-Orge, France) as described elsewhere (24). Blood samples were obtained under anesthesia by intracardiac puncture using heparinized syringes. Mice were immediately killed and liver was taken, frozen in liquid nitrogen, and stored at –80 C for further analysis.

Plasma concentrations of fibrinogen were measured by an immunonephelometric assay with a BN II instrument (Dade Behring, Paris, France) using a polyclonal antiserum against fibrinogen (56).

RNA Analysis
Total RNA was isolated using TRIZOL LS reagent (Invitrogen). Total RNA was reverse transcribed exactly as described previously (24). Real-time quantitative PCR was carried out with the LightCycler Instrument using the LightCycler FastStart DNA Master SYBR Green I kit for detection of PCR products (Roche Molecular Biochemicals, Mannheim, Germany), according to the manufacturer’s guidelines. Final concentrations of MgCl2 and primers were 3 mM and 0.5 µM, respectively. Sequences of primers used to simultaneously amplify all the Rora transcripts have been described elsewhere (24). The other PCR primers used were: for human and mouse fibrinogen-ß, fibß-F, 5'-ATTAGCCAGCTTACCAGGATGGGACCCAC-3', and fibß-R, 5'-CAGTAGTAT CTGCCGTTTGGATTGGCTGC-3'; for human SerpinA1, serpinA1-F, 5'-TGAGCATCGCTACAGCCTTTGC-3', and serpinA1-R, 5'-ATCATAGGCACCTTCACGGTGG-3'; for human and mouse GAPDH, GAPDH-F, 5'-GAGCCAAAAGGGTCATCATC-3', and GAPDH-R, 5'-CCATCCACAGTCTTCTGGGT-3'; for human and mouse ß-actin, ß-actin-F, 5'-TGACCCAGATCATGTTTGAGACC-3', and ß-actin-R, 5'-GGATGTCCACGTCACACTTCATG-3', for mouse albumin, ALB-F, 5'-TCAACTGTCAGAGCAGAGAAGC-3' and ALB-R, 5'-AGACTGCCTTGTGTGGAAGACT-3', for mouse uncoupling protein 2, UCP2-F, 5'-GGCCTCTGGAAAGGGACTTC-3'.and UCP2-R 5'-ACCAGCTCAGCACAGTTGACA-3' for mouse hepatocyte nuclear factor-1{alpha}, HNF1-F 5'-TTCTAAGCTGAGCCAGCTGCAGACG-3' and HNF1-R 5'-GCTGAGGTTCTCCGGCTCTTTCAGA-3'. Care was taken to most often choose these oligonucleotides in different exons of the respective genes. PCR-specific amplification of the Rora1 and Rora4 mRNAs was carried out using an iCycler thermal cycler (Bio-Rad, Marnes La Coquette, France) exactly as described (24).

Preparation of Nuclear Extracts and Western Blot Analysis
HepG2 cell nuclear extracts were prepared as described elsewhere (24). Human ROR{alpha}1 and mouse ROR{alpha}4 proteins were obtained in vitro from the pCMX-hROR{alpha}1 and the pCMX-mROR{alpha}4 vectors using the TNT-T7 Quick coupled transcription/translation kit (Promega). Aliquots of the HepG2 cell protein extracts (50 µg) and of the programmed and unprogrammed lysates were analyzed by Western blotting with an antiserum against ROR{alpha} (sc-6062, Santa Cruz Biotechnology/Tebu, Le Perray en Yvelines, France) as described previously (24).

ChIP Assay
ChIP experiments were performed according to the method of Shang et al. (57) as modified by Giraud et al. (58). Briefly, HepG2 cells were grown to 60% confluence. Cell lysates were sonicated on ice, 15 times for 15 sec, and separated by 45 sec. A volume of lysate equivalent to 20 x 106 cells was immunoprecipitated using 4 µg of anti-ROR{alpha} antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or of an antihemagglutinin antibody (Santa Cruz Biotechnology, Inc.) as a negative control. The same lysate volume was kept without immunoprecipitation for subsequent purification of input genomic DNA. One-tenth of the immunoprecipitated DNA was PCR amplified twice for 35 cycles (30 sec at 95 C, 30 sec at 55 C, and 30 sec at 72 C) using primers covering either the –468 to –103 region of the human fibrinogen promoter containing the (–336/–355)Fib-ß-RORE: forward, 5'-ATTGATTTTAATGGCCC-3'; reverse, 5'-TGTTGGCTGAACCATTT-3'; or part of the ß-actin gene: forward, 5'-CGAGCCATAAAAGGCAACTTTCG-3'; reverse, AGGAAGAGGAGGAGGGGAGAGTTT-3' as a negative control.

Statistical Analysis
Data are expressed as means ± SEM of the number of experiments as indicated. Statistical analysis was carried out using the ANOVA test, with significance defined as P < 0.01 (**). The paired t test was used to analyze the results of the experiments with the staggerer and their wild-type control littermate of the same sex.


    ACKNOWLEDGMENTS
 
We thank Dr. V. Giguère for kindly providing us with the pCMX-hROR{alpha}1 and pCMX-mROR{alpha}4 vectors; Dr. P. Djian for the pGK-neo vector; and Dr. V. Laudet for the pSG5-Rev-erb{alpha} vector. We are indebted to Professor J. Mariani for donating the Rora+/sg mice and to Mrs. D. Chamereau for animal care.


    FOOTNOTES
 
This work was supported by the Centre National de la Recherche Scientifique and by a grant from the Association pour la Recherche sur le Cancer (no. 3511) (to J.L.D.). C.C. was recipient of successive fellowships from the Ministère de l’Education Nationale de la Recherche et de la Technologie and from La Ligue Nationale contre le Cancer. The LightCycler Instrument was financed by the Institut Fédératif de Recherche Necker-Enfants Malades (IFR94).

First Published Online June 7, 2005

Abbreviations: ChIP, Chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF, hepatocyte nuclear factor; ROR, retinoic acid receptor-related orphan receptor; RORE, ROR{alpha} response element.

Received for publication April 15, 2005. Accepted for publication May 31, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Nuclear Receptors Nomenclature Committee 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163[CrossRef][Medline]
  2. Giguère V 1999 Orphan nuclear receptors: from gene to function. Endocr Rev. 20:689–725
  3. Carlberg C, Hooft van Huijsduijnen R, Staple JK, DeLamarter JF, Becker-André M 1994 RZRs, a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Mol Endocrinol. 8:757–770
  4. Giguère V, Tini M, Flock G, Ong E, Evans RM, Otulakowski G 1994 Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR{alpha}, a novel family of orphan hormone nuclear receptors. Genes Dev. 8:538–553
  5. Giguère V, McBroom LD, Flock G 1995 Determinants of target gene specificity for ROR{alpha}1: monomeric DNA binding by an orphan nuclear receptor. Mol Cell Biol. 15:2517–2526
  6. Harding HP, Atkins GB, Jaffe AB, Seo WJ, Lazar MA 1997 Transcriptional activation and repression by ROR{alpha}, an orphan nuclear receptor required for cerebellar development. Mol Endocrinol. 11:1737–1746
  7. Raspé E, Mautino G, Duval C, Fontaine C, Duez H, Barbier O, Monte D, Fruchart J, Fruchart J-C, Staels B 2002 Transcriptional regulation of human Rev-erb{alpha} gene expression by the orphan nuclear receptor retinoic acid-related orphan receptor {alpha}. J Biol Chem. 277:49275–49281
  8. Gawlas K, Stunnenberg HG 2000 Differential binding and transcriptional behaviour of two highly related orphan receptors, ROR{alpha}4 and RORß1. Biochim Biophys Acta. 1494:236–241
  9. Becker-André M, André E, DeLamarter JF 1993 Identification of nuclear receptor mRNAs by RT-PCR amplification of conserved zinc-finger motif sequences. Biochem Biophys Res Commun. 194:1371–1379
  10. Hamilton BA, Frankel WN, Kerrebrock AW, Hawkins TL, Fitzhugh W, Kusumi K, Russell LB, Mueller KL, van Berkel V, Birren BW, Kruglyak L, Lander ES 1996 Disruption of the nuclear hormone receptor ROR{alpha} in staggerer mice. Nature 379:736–739[CrossRef][Medline]
  11. Matysiak-Scholze U, Nehls M 1997 The structural integrity of ROR{alpha} isoforms is mutated in staggerer mice: cerebellar coexpression of ROR{alpha}1 and ROR{alpha}4. Genomics 43:78–84[CrossRef][Medline]
  12. Herrup K, Mullen RJ 1979 Regional variation and absence of large neurons in the cerebellum of the staggerer mouse. Brain Res. 172:1–12
  13. Kopmels B, Mariani J, Delhaye-Bouchaud N, Audibert F, Fradelizi D, Wollman EE 1992 Evidence for a hyperexcitability state of staggerer mutant mice macrophages. J Neurochem. 58:192–199
  14. Delerive P, Monté D, Dubois G, Trottein F, Fruchart-Najib J, Mariani J, Fruchart J-C, Staels B 2001 The orphan nuclear receptor ROR{alpha} is a negative regulator of the inflammatory response. EMBO Rep. 2:42–48
  15. Mamontova A, Seguret-Mace S, Esposito B, Chaniale C, Bouly M, Delhaye-Bouchaud N, Luc G, Staels B, Duverger N, Mariani J, Tedgui A 1998 Severe atherosclerosis and hypoalphalipoproteinemia in the staggerer mouse, a mutant of the nuclear receptor ROR{alpha}. Circulation 98:2738–2743[Abstract/Free Full Text]
  16. Vu-Dac N, Gervois P, Grotzinger T, De Vos P, Schoonjans K, Fruchart JC, Auwerx J, Mariani J, Tedgui A, Staels B 1997 Transcriptional regulation of apolipoprotein A-I gene expression by the nuclear receptor ROR{alpha}. J Biol Chem. 272:22401–22404
  17. Besnard S, Silvestre J-S, Duriez M, Bakouche J, Lemaigre-Dubreuil Y, Mariani J, Levy BI, Tedgui A 2001 Increased ischemia-induced angiogenesis in the staggerer mouse, a mutant on the nuclear receptor ROR{alpha}. Circ Res. 89:1209–1215
  18. Matsui T 1997 Transcriptional regulation of a Purkinje cell-specific gene through a functional interaction between ROR{alpha} and RAR. Genes Cells 2:263–272[Abstract]
  19. Gold DA, Baek SH, Schork NJ, Rose DW, Larsen DD, Sachs B, Rosenfeld MG, Hamilton BA 2003 ROR{alpha} coordinates reciprocal signaling in cerebellar development through sonic hedgehog and calcium-dependent pathways. Neuron. 40:1119–1131
  20. Dussault I, Giguère V 1997 Differential regulation of the N-myc proto-oncogene by ROR{alpha} and RVR, two orphan members of the superfamily of nuclear hormone receptors. Mol Cell Biol. 17:1860–1867
  21. Meyer T, Kneissel M, Mariani J, Fournier B 2000 In vitro and in vivo evidence for orphan nuclear receptor ROR{alpha} function in bone metabolism. Proc Natl Acad Sci USA. 97:9197–9202
  22. Bois-Joyeux B, Chauvet C, Nacer-Chérif H, Bergeret W, Mazure N, Giguère V, Laudet V, Danan J-L 2000 Modulation of the far upstream enhancer of the rat {alpha}-fetoprotein gene by members of the ROR{alpha}, Rev-erb{alpha}, and Rev-erbß groups of monomeric orphan nuclear receptors. DNA Cell Biol. 19:589–599
  23. Raspé E, Duez H, Gervois P, Fiévet C, Fruchart J-C, Besnard S, Mariani J, Tedgui A, Staels B 2001 Transcriptional regulation of apolipoprotein C-III gene expression by the orphan receptor ROR{alpha}. J Biol Chem. 276:2865–2871
  24. Chauvet C, Bois-Joyeux B, Danan J-L 2002 Retinoic acid receptor-related orphan receptor (ROR) {alpha}4 is the predominant isoform of the nuclear receptor ROR{alpha} in liver and is up regulated by hypoxia in HepG2 human hepatoma cells. Biochem J. 364:449–456
  25. Kant JA, Fornace AJJ, Saxe D, Simon MI, McBride OW, Crabtree GR 1985 Evolution and organization of the fibrinogen locus on chromosome 4: gene duplication accompanied by transposition and inversion. Proc Natl Acad Sci USA. 82:2344–2348
  26. Mouse Genome Sequencing Consortium 2002 Initial sequencing and comparative analysis of the mouse genome. Nature 420:520–562[CrossRef][Medline]
  27. Marino MW, Fuller GM, Elder FF 1986 Chromosomal localization of human and rat A {alpha}, B ß, and {gamma} fibrinogen genes by in situ hybridization. Cytogenet Cell Genet. 42:36–41
  28. Anderson GM, Shaw AR, Shafer JA 1993 Functional characterization of promoter elements involved in regulation of human Bß-fibrinogen expression. J Biol Chem. 268:22650–22655
  29. Dalmon J, Laurent M, Courtois G 1993 The human ß fibrinogen promoter contains a hepatocyte nuclear factor 1-dependent interleukin-6-responsive element. Mol Cell Biol. 13:1183–1193
  30. Hu C-H, Harris JE, Davie EW, Chung DW 1995 Characterization of the 5'-flanking region of the gene for the {alpha} chain of human fibrinogen. J Biol Chem. 270:28342–28349
  31. Huber P, Laurent M, Dalmon J 1990 Human ß-fibrinogen gene expression. J Biol Chem. 265:5695–5701
  32. Liu Z, Fuller GM 1995 Detection of a novel transcription factor for the A{alpha} fibrinogen gene in response to interleukin 6. J Biol Chem. 270:7580–7586
  33. Mizuguchi J, Hu C-H, Cao Z, Loeb KR, Chung DW, Davie EW 1995 Characterization of the 5'-flanking region of the gene for the {gamma} chain of human fibrinogen. J Biol Chem. 270:28350–28356
  34. Zhang Z, Fuentes NL, Fuller GM 1995 Characterization of the IL-6 responsive elements in the {gamma} fibrinogen gene promoter. J Biol Chem. 270:24287–24291
  35. Yu S, Sher B, Kudryk B, Redman CM 1983 Intracellular assembly of human fibrinogen. J Biol Chem. 258:13407–13410
  36. Roy SN, Mukhopadhyay G, Redman CM 1990 Regulation of fibrinogen assembly: transfection of HepG2 cells with Bß cDNA specifically enhances synthesis of the three component chains of fibrinogen. J Biol Chem. 265:6389–6393
  37. Koenig W 2003 Fibrin(ogen) in cardiovascular disease: an update. Thromb Haemost. 89:601–609
  38. Sirtori CR, Colli S 1993 Influences of lipid-modifying agents on hemostasis. Cardiovasc Drugs Ther. 7:817–823
  39. Kockx M, Gervois PP, Poulain P, Derudas B, Peters JM, Gonzalez FJ, Princen HMG, Kooistra T, Staels B 1999 Fibrates suppress fibrinogen gene expression in rodents via activation of the peroxisome proliferator-activated receptor-{alpha}. Blood 93:2991–2998[Abstract/Free Full Text]
  40. Gervois P, Vu-Dac N, Kleeman R, Kockx M, Dubois G, Laine B, Kosykh V, Fruchart J-C, Kooistra T, Staels B 2001 Negative regulation of human fibrinogen gene expression by peroxisome proliferator-activated receptor {alpha} agonists via inhibition of CCAAT box/enhancer-binding protein ß. J Biol Chem. 276:33471–33477
  41. Tronche F, Ringeisen F, Blumenfeld M, Yaniv M, Pontoglio M 1997 Analysis of the distribution of binding sites for a tissue-specific transcription factor in the vertebrate genome. J Mol Biol. 266:231–245
  42. Costa RH, Kalinichenko VV, Holterman A-XL, Wang X 2003 Transcription factors in liver development, differentiation, and regeneration. Hepatology 38:1331–1347[CrossRef][Medline]
  43. Courtois G, Baumhueter S, Crabtree GR 1988 Purified hepatocyte nuclear factor 1 interacts with a family of hepatocyte-specific promoters. Proc Natl Acad Sci USA. 85:7937–7941
  44. Wang GL, Semenza GL 1993 Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. J Biol Chem. 268:21513–21518
  45. Marinkovic S, Jahreis GP, Wong GG, Baumann H 1989 IL-6 modulates the synthesis of a specific set of acute phase plasma proteins in vivo. J Immunol. 142:808–812
  46. Harding HP, Lazar MA 1993 The orphan receptor Rev-erbA{alpha} activates transcription via a novel response element. Mol Cell Biol. 13:3113–3121
  47. Harding HP, Lazar MA 1995 The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Mol Cell Biol. 15:4791–4802
  48. Retnakaran R, Flock G, Giguère V 1994 Identification of RVR, a novel orphan nuclear receptor that acts as a negative transcriptional regulator. Mol Endocrinol. 8:1234–1244
  49. Forman BM, Chen J, Blumberg B, Kliewer SA, Henshaw R, Ong ES, Evans RM 1994 Cross-talk among ROR{alpha}1 and the Rev-erb family of orphan nuclear receptors. Mol Endocrinol. 8:1253–1261
  50. Sakao E, Ishihara A, Horikawa K, Akiyama M, Arai M, Kato M, Seki N, Fukunaga K, Shimizu-Yabe A, Iwase K, Ohtsuka S, Sato T, Kohno Y, Shibata S, Takiguchi M 2003 Two-peaked synchronization in day/night expression rhythms of the fibrinogen gene cluster in the mouse liver. J Biol Chem. 278:30450–30457
  51. Ueda HR, Chen W, Adachi A, Wakamatsu H, Hayashi S, Takasugi T, Nagano M, Nakahama K-I, Suzuki Y, Sugano S, Lino M, Shigeyoshi Y, Hashimoto S 2002 A transcription factor response element for gene expression during circadian night. Nature 418:534–539[CrossRef][Medline]
  52. Djian P, Easley K, Green H 2000 Targeted ablation of the murine involucrin gene. J Cell Biol. 151:381–387
  53. Raspé E, Madsen L, Lefebvre A-M, Leitersdorf I, Gelman L, Peinado-Onsurbe J, Dallongeville J, Fruchart J-C, Berge R, Staels B 1999 Modulation of rat liver apolipoprotein gene expression and serum lipid levels by tetradecylthioacetic acid (TTA) via PPAR{alpha} activation. J Lipid Res. 40:2099–2110
  54. Bois-Joyeux B, Denissenko M, Thomassin H, Guesdon S, Ikonomova R, Bernuau D, Feldmann G, Danan J-L 1995 The c-jun proto-oncogene down-regulates the rat {alpha}-fetoprotein promoter in HepG2 hepatoma cells without binding to DNA. J Biol Chem. 270:10204–10211
  55. Doulazmi M, Frédéric F, Lemaigre-Dubreuil Y, Hadj-Sahraoui N, Delhaye-Bouchaud N, Mariani J 1999 Cerebellar Purkinje cell loss during life span of the heterozygous staggerer mouse (Rora+/Rorasg) is gender-related. J Comp Neurol. 411:267–273
  56. Jelic-Ivanovic Z, Pevcevic N 1990 Fibrinogen determination by five methods in patients receiving streptokinase therapy. Clin Chem. 36:698–699
  57. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103: 843–852
  58. Giraud S, Bienvenu F, Avril S, Gascan H, Heery DM, Coqueret O 2002 Functional interaction of STAT3 transcription factor with the coactivator NcoA/SRC1{alpha}. J Biol Chem. 277:8004–8011

NURSA Molecule Pages Link:

Nuclear Receptors:   RORα



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Chen, S. Coulter, A. M. Jetten, and J. A. Goldstein
Identification of Human CYP2C8 as a Retinoid-Related Orphan Nuclear Receptor Target Gene
J. Pharmacol. Exp. Ther., April 1, 2009; 329(1): 192 - 201.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E.-J. Kim, Y.-G. Yoo, W.-K. Yang, Y.-S. Lim, T.-Y. Na, I.-K. Lee, and M.-O. Lee
Transcriptional Activation of HIF-1 by ROR{alpha} and its Role in Hypoxia Signaling
Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1796 - 1802.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, L. Yin, and M. A. Lazar
The Orphan Nuclear Receptor Rev-erb{alpha} Regulates Circadian Expression of Plasminogen Activator Inhibitor Type 1
J. Biol. Chem., November 10, 2006; 281(45): 33842 - 33848.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chauvet, C.
Right arrow Articles by Danan, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chauvet, C.
Right arrow Articles by Danan, J.-L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals