help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0162
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De la Vieja, A.
Right arrow Articles by Carrasco, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De la Vieja, A.
Right arrow Articles by Carrasco, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*GLUTAMIC ACID HYDROCHLORIDE
*GLYCINE
*IODINE
Medline Plus Health Information
*Thyroid Diseases
Molecular Endocrinology 19 (11): 2847-2858
Copyright © 2005 by The Endocrine Society

Molecular Analysis of a Congenital Iodide Transport Defect: G543E Impairs Maturation and Trafficking of the Na+/I Symporter

Antonio De la Vieja, Christopher S. Ginter and Nancy Carrasco

Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461

Address all correspondence and requests for reprints to: Nancy Carrasco, Department of Molecular Pharmacology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461. E-mail: carrasco{at}aecom.yu.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Na+/I symporter (NIS) is a key membrane glycoprotein that mediates active I transport in the thyroid and other tissues. Upon isolation of the cDNA encoding NIS, 10 NIS mutations that cause congenital iodide transport defect have been identified. Three of these mutations (T354P, G395R, and Q267E) have been thoroughly characterized at the molecular level. All three NIS mutant proteins are correctly targeted to the plasma membrane; however, whereas Q267E displays minimal activity, T354P and G395R are inactive. Here, we show that in contrast to these mutants, G543E NIS matures only partially and is retained intracellularly; thus, it is not targeted properly to the cell surface, apparently because of faulty folding. These findings indicate that the G543 residue plays significant roles in NIS maturation and trafficking. Remarkably, NIS activity was rescued by small neutral amino acid substitutions (volume < 129 Å3) at this position, suggesting that G543 is in a tightly packed region of NIS.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE NA+/I SYMPORTER (NIS) (1) is a plasma membrane glycoprotein that mediates the active transport of I in the thyroid and other tissues, such as salivary glands, gastric mucosa, and lactating mammary gland (2, 3, 4, 5, 6). In the thyroid, I uptake is the first step in the biosynthesis of the iodine-containing hormones T3 and tetraiodothyronine, or T4. The pathophysiological and medical significance of NIS in the thyroid is difficult to overstate, for NIS is the molecular basis for the widespread and highly successful use of radioiodide in the diagnosis and treatment of major thyroid diseases, including thyroid cancer and its metastases (7, 8). NIS couples the inward transport of Na+, which occurs in favor of its electrochemical gradient, to the simultaneous inward translocation of I against its electrochemical gradient. NIS activity is electrogenic: two Na+ ions are translocated per each I ion (9, 10). NIS-mediated active I transport is driven by the Na+ gradient generated by the Na+/K+-ATPase. NIS concentrates I in thyroid cells by a factor of 20–40 with respect to the blood under physiological conditions (11).

The rat and human (h) NIS cDNAs encode a 618- and a 643-amino acid protein, respectively (9, 12, 13). hNIS exhibits an 84% amino acid identity and 93% similarity to rat NIS. The current NIS secondary structure model (Fig. 1Go) depicts NIS as a protein with 13 transmembrane segments (TMS), the amino terminus facing the extracellular milieu, and the carboxy terminus facing the cytosol; the location of both termini has been confirmed experimentally (14, 15).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Thirteen-TMS hNIS Secondary Structure Model

ITD-causing mutations are shown in the rounded rectangles, which contain the WT amino acid letter, its position, and the letter of the amino acid causing the mutation. The G543E mutation is located on the cytosolic side of TMS XIII. X, Stop codon; fS, frame shift; {Delta}, deletion.

 
Before isolation of the NIS cDNA, several cases of congenital hypothyroidism due to an iodide transport defect (ITD) (OMIM 274400; online, Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/OMIM) were reported (16). ITD is an uncommon condition caused by NIS mutations with an autosomal-recessive inheritance pattern. The isolation of the NIS cDNA made it possible to address the molecular basis of ITD.

The general clinical picture of ITD consists of a variable degree of hypothyroidism; large or small goiter; reduced or absent thyroid uptake of radioiodide or pertechnetate, as determined by scintigraphy; and a low I saliva to plasma (S/P) ratio (normal > 20). Eleven ITD NIS mutations have been identified so far: V59E, G93R, Q267E, C272X, G395R, T354P, frame-shift 515X, Y531X, G543E, {Delta}143–323, and {Delta}439–443 (17, 18, 19, 20, 21, 22, 23, 24, 25, 26) (Fig. 1Go). They are either nonsense, alternative splicing, frame-shift, deletion, or missense mutations of the NIS gene.

Although the clinical picture and genetic alterations of these patients are well described, only three mutations have been characterized at the molecular level to date: T354P (27), G395R (28), and Q267E (29). Although inactive when transiently transfected into COS-7 cells, the T354P and G395R NIS proteins are normally expressed and posttranslationally processed, as well as correctly targeted to the plasma membrane. The mechanisms underlying the lack of activity are different for T354P and G395R NIS, and each mechanism proved highly revealing of structure/function information on NIS. The ß-carbon hydroxyl at residue 354 was shown to be essential for NIS function, and the presence of a charged or large amino acid side chain at position 395 was demonstrated to interfere with NIS activity. For its part, the Q267E mutation was found to decrease (but not abolish) I transport activity by lowering the turnover number of NIS, without affecting its expression or trafficking to the plasma membrane, and without significantly altering the Michaelis-Menten constant (Km) of NIS for I or Na+.

The G543E substitution was detected in two siblings carrying a homozygous mutation (20). The patients inherited a substitution of guanidine for adenine at nucleotide 1628 (exon 13) that resulted in a Gly-for-Glu amino acid replacement (G543E). Position 543 is putatively located on the cytoplasmic side of TMS XIII (Fig. 1Go). Kosugi et al. (20) observed that COS-7 cells transfected with G543E NIS cDNA did not exhibit I transport activity, but the mutation has not been characterized further until now. Here we report the thorough molecular analysis of the G543E NIS substitution by a wide range of approaches. We observed that G543E NIS matures only partially, is retained intracellularly and thus not properly targeted to the plasma membrane, and is intrinsically inactive even in membrane vesicles, apparently due to faulty folding. These findings indicate that the G543 residue plays significant roles in the maturation and trafficking of NIS.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The G543E NIS Mutant Protein Exhibits Only Partial Maturation
COS-7 cells were transfected with either wild-type (WT) or G543E NIS cDNA and assayed for Na+-dependent, perchlorate-sensitive I transport activity. At steady state, WT NIS-expressing cells accumulated approximately 95 pmol of I/µg DNA, whereas G543E NIS-expressing cells displayed no I transport (Fig. 2AGo), even at supersaturating external concentrations [160 µM of I (data not shown)]. Lysates from cells expressing either WT or G543E NIS were subjected to immunoblot analysis with an antibody (Ab) against the carboxy terminus of NIS (anti-Ct-hNIS Ab) (Fig. 2BGo). The following NIS polypeptides were detected in WT NIS-expressing cells: nonglycosylated premature (~55 kDa, band A); immaturely glycosylated (~60 kDa, band B); dimer of the immaturely glycosylated (~120 kDa, band BB); and fully glycosylated or mature (~100 kDa, band C); upon longer exposure, the dimer of the mature form was also observed (200 kDa, band CC). In striking contrast, the fully glycosylated or mature approximately 100-kDa NIS polypeptide was absent in G543E NIS-expressing cells (Fig. 2BGo), clearly indicating that G543E NIS was not fully processed. To probe this issue further, we treated protein extracts from cells transfected with WT or G543E NIS cDNAs with N-glycanase F (PNGase F), an enzyme that cleaves between the innermost N-acetylglucosamine and Asp residues of N-linked glycoproteins (Fig. 2CGo). As expected, PNGase F treatment of WT NIS resulted in the disappearance of both the approximately 100-kDa mature WT NIS (band C) and the 60-kDa immaturely glycosylated WT NIS (band B) polypeptides, with a concomitant increase in both the 55-kDa nonglycosylated WT NIS polypeptide (band A) and its dimer (band AA). Similarly, PNGase F treatment of G543E NIS caused the disappearance of the immaturely glycosylated approximately 60-kDa band and a simultaneous increase in both the nonglycosylated approximately 55-kDa G543E NIS polypeptide (band A) and its dimer (band AA), indicating that band AA is indeed a dimer of band A.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Characterization of Expression and Activity of G543E NIS in Transfected COS Cells

A, Steady-state I transport assays. Nontransfected COS-7 cells (NT) or COS-7 cells transfected with either WT- or G543E-NIS cDNA were incubated for 1 h in the presence of 20 µM I/140 mM Na+ (gray bars) or 20 µM I/140 mM Na+/80 µM perchlorate (open bars). Results are expressed in pmol I/µg DNA ± SEM. Values represent the average of at least five different experiments; in each experiment, activity was analyzed in triplicate or sextuplicate. B, Immunoblot analysis. Total protein of lysed cells (5 µg/lane) was isolated from NT cells or COS-7 cells transfected either with WT- or G543E-NIS cDNA. Total proteins were then electrophoresed, electrotransferred, and immunoblotted with 4 nM anti-Ct-hNIS Ab. Right and left panels depict the same immunoblot but at different times of exposure (5 sec and 2 min, respectively). Lines on the right side of the blot indicate the relative electrophoretic mobilities of the corresponding NIS bands (A, 55 kDa; B, 60 kDa; C, 100 kDa; BB, 120 kDa; and CC, 200 kDa), depending on the glycosylation of the protein. This is a representative immunoblot. C, Immunoblot analysis of proteins treated with PNGase F. Total proteins of lysed cells (20 µg) were treated with (+) or without (–) PNGase F (as described in Materials and Methods), electrophoresed, electrotransferred, and immunoblotted with 4 nM anti-Ct-hNIS Ab.

 
G543E NIS Is Retained Intracellularly and Thus Not Targeted to the Plasma Membrane
Given that the driving force for NIS activity is the Na+ electrochemical gradient generated by the plasma membrane Na+/K+ ATPase, NIS is functional only when it is present at the cell surface (11). Therefore, it is critical to determine whether G543E NIS, which is only immaturely glycosylated, is targeted to the plasma membrane. To investigate this point, we carried out surface biotinylation experiments with the amino-specific and membrane-impermeable reagent Sulfo-NHS-SS-biotin. The entire biotinylated fraction was isolated with streptavidin-coated beads and immunoblotted with anti-Ct-hNIS Ab. Whereas an approximately 100-kDa immunoreactive band (band C) corresponding to mature WT NIS is evident in the immunoblot from WT NIS-expressing cells, we detected no biotinylated NIS polypeptides at all in G543E NIS-expressing cells (Fig. 3AGo). This demonstrates that G543E NIS, in addition to being only immaturely glycosylated (as shown in Fig. 2Go), fails to reach the plasma membrane. To further analyze this finding, we performed confocal immunofluorescence studies in COS-7 cells expressing either WT or G543E NIS, using a polyclonal Ab against the C terminus (anti-Ct-NIS), an intracellularly oriented epitope of NIS, and a monoclonal Ab against an unidentified outwardly facing epitope (anti-hNIS VJ1) (30). WT NIS-expressing cells showed a plasma membrane-associated immunofluorescence staining pattern when probed either with anti-hNIS VJ1 Ab in nonpermeabilized cells (Fig. 3BGo) or with anti-Ct-hNIS Ab in permeabilized cells (Fig. 3CGo). In contrast, G543E NIS-expressing cells displayed no staining whatsoever when probed with anti-hNIS VJ1 Ab in nonpermeabilized cells (Fig. 3BGo), and only intracellular (i.e. non-plasma membrane-associated) staining when probed with anti-Ct-hNIS Ab in permeabilized cells (Fig. 3CGo). These results, taken together, demonstrate that G543E NIS is retained in intracellular organelles and fails to reach the plasma membrane.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 3. G543E NIS Targeting

A, Surface biotinylation analysis of G543E NIS. NT COS-7 cells or COS-7 cells transfected with WT- or G543E-NIS cDNA were biotinylated with 1 mg/ml Sulfo-NHS-SS-biotin. Immunoblot analysis of surface-biotinylated polypeptides precipitated with streptavidin-agarose beads was performed with 4 nM anti-Ct-hNIS Ab. B and C, Immunofluorescence analysis. Bars, 10 µm. B, Nonpermeabilized COS-7 cells transfected with WT- or G543E-NIS (E) cDNA were incubated with anti-hNIS VJ1 Ab (1:50), followed by fluorescein-conjugated antimouse Ab. C, Permeabilized COS-7 cells transfected with WT- or G543E-NIS cDNA were incubated with 4 nM anti-Ct-hNIS Ab, followed by fluorescein-conjugated goat antirabbit Ab. D, Immunoblot analysis of proteins treated with Endo H. Total proteins of lysed cells (10 µg) were treated with (+) or without (–) Endo H (as described in Materials and Methods), electrophoresed, electrotransferred, and immunoblotted with 4 nM anti-Ct-hNIS Ab. E–F, Immunofluorescence colocalization experiments. E, Permeabilized transfected cells were incubated with anti-Ct-hNIS Ab (top panel) and anti-calnexin mAb (1:250) (middle panel). A second incubation was performed with fluorescein-conjugated goat antirabbit Ab and antimouse rhodamine Ab, respectively. Overlay of the two images is shown in bottom panels. F, Permeabilized transfected cells were incubated with anti-Ct-hNIS Ab (top panel) and anti-PDI mAb (1:250) (middle panel). The second incubation was performed with fluorescein-conjugated goat antirabbit Ab and antimouse rhodamine Ab, respectively. Overlay of the two images is shown in bottom panels. PDI, Protein disulfide isomerase.

 
To determine the intracellular location of G543E NIS more precisely, we assessed the effect of endoglycosidase H (Endo H) treatment. Endo H cleaves high-mannose oligosaccharides from N-linked glycoproteins. Because proteins that have matured beyond the medial Golgi are Endo H resistant, the demonstration of Endo H sensitivity indicates that the protein in question is at a premedial Golgi stage. Indeed, Endo H treatment caused the disappearance of the immaturely glycosylated NIS proteins in both WT and G543E NIS-expressing cells (Fig. 3DGo, bands B and BB), whereas, as expected, mature WT NIS was Endo H resistant (Fig. 3DGo, band C). This shows that G543E NIS is retained in intracellular organelles before the medial Golgi. Hence, we then performed coimmunofluorescence studies with anti-Ct-hNIS and Abs against calnexin [an endoplasmic reticulum (ER)-resident protein], protein disulfide isomerase (PDI, another ER-resident protein) (another ER-resident protein), GM130 (a cis-Golgi marker; data not shown) and EEA1 (a marker for early endosome vesicles, not shown). We found that G543E NIS colocalized with ER-resident proteins, but not with either Golgi or early endosome vesicle markers (Fig. 3Go, E and F). This demonstrates that G543E NIS is retained in the ER, and no G543E NIS matures beyond the medial Golgi. In conclusion (aside from any impact that incomplete glycosylation may have on G543E NIS), the protein’s intracellular retention and its consequent failure to reach the plasma membrane clearly account for the absence of NIS activity in G543E NIS-expressing cells.

Charged Residues Other Than Glutamate at Position 543 Also Render NIS Inactive
The G543E mutation involves the presence of Glu, a residue with a negatively charged side chain, in place of neutral Gly. To investigate the importance of charge at position 543, we studied the effects of substituting other charged side chains at this position. Using site-directed mutagenesis, we engineered Asp, Lys, or Arg into position 543. All constructs were transiently transfected into COS-7 cells. Transport assays showed that the G543D, G543R, and G543K NIS mutant proteins were inactive (Fig. 4AGo). Similarly to G543E, all charged substitutions yielded only immaturely glycosylated proteins, as demonstrated by immunoblot analysis (Fig. 4BGo). None of the mutant NIS proteins reached the plasma membrane, as shown by the absence of cell surface biotinylation (Fig. 4CGo). These results were confirmed by immunofluorescence analysis, which showed only intracellularly associated staining in cells expressing each of the NIS mutants (Fig. 4DGo). Clearly, all charged substitutions at position 543 of NIS matured only partially and failed to reach the plasma membrane, thus explaining the absence of NIS activity in the transfected cells.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. Effect of Charged Residue Substitutions at Position 543 on NIS Expression and Activity

A, Steady-state I transport assays. Nontransfected (NT) COS-7 cells or COS-7 cells transfected with either WT- or G543D-(D), G543R-(R), or G543K(K)-NIS cDNA were incubated for 1 h in the presence of 20 µM I/140 mM Na+ (gray bars) or 20 µM I/140 mM Na+/80 µM perchlorate (open bars). Results are expressed in picomoles I/µg DNA. B, Immunoblot. C, Surface biotinylation. D, Immunofluorescence analysis of permeabilized cells with 4 nM anti-Ct-hNIS Ab. Bars, 10 µm. Procedures were performed as described in Figs. 2Go and 3Go and in Materials and Methods.

 
Neutral and Small Side Chain Residues at Position 543 Restore NIS Activity
Having shown that charged residues at position 543 render NIS inactive and impair its glycosylation and targeting to the plasma membrane, we examined the effects of neutral residues at this position. We engineered cDNA constructs encoding the following residues into this position [arranged by volume (31)]: Ala (91.5 Å3), Ser (99.1 Å3), Cys (105.6 Å3), Thr (122.1 Å3), Pro (129.3 Å3), Val (135.2 Å3), Asn (141.7 Å3), Gln (161.8 Å3), and Trp (237.6 Å3). We then analyzed I uptake under steady-state conditions. WT NIS transported 95.3 ± 5.0 pmol/µg DNA, whereas, interestingly, G543A, G543S, G543T, and G543C NIS exhibited I accumulation values of 65.1 ± 2.4, 37.7 ± 1.1, 14.3 ± 1.3, and 7.7 ± 0.6 pmol/µg DNA ± SEM, respectively (Fig. 5AGo). No NIS activity was detected when the residue substituted at position 543 had a volume larger than 129 Å (3) (i.e. Pro, Val, Asn, Gln, and Trp).



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 5. Effect of Neutral-Residue Substitutions at Position 543 on NIS Expression and Activity

A, Steady-state I transport assays. Nontransfected (NT) COS-7 cells or COS-7 cells transfected with either WT-, G543A-, G543S-, G543C-, G543T-, G543P-, G543N-, G543V-, G543Q-, or G543W-NIS cDNA were incubated for 1 h in the presence of 20 µM I/140 mM Na+ (gray bars) or 20 µM I/140 mM Na+/80 µM ClO4 (open bars). Amino acid volumes are indicated at the bottom of the plot. B, Immunoblot. C, Surface biotinylation. D, Immunofluorescence analysis of permeabilized cells with anti-Ct-hNIS Ab. Bars, 10 µm. Methods were performed as described in Figs. 2Go and 3Go, and in Materials and Methods.

 
We observed a remarkable correlation between the ability of each mutant protein to mediate I transport activity and the extent to which each protein was fully glycosylated. Polypeptides corresponding to mature NIS were detected by immunoblot analysis only in those mutant NIS proteins that mediated active I transport, i.e. G543A, G543S, and G543T NIS (Fig. 5BGo, band C). The expected presence of these functional mutant NIS molecules in the plasma membrane was confirmed by both cell surface biotinylation (Fig. 5CGo) and confocal immunofluorescence microscopy (Fig. 5DGo). The most sensitive assay was I uptake; for example, G543C NIS exhibited readily detectable I transport activity (7.7 ± 0.6 pmol/µg DNA), even though its targeting to the plasma membrane was barely noticeable by cell surface biotinylation (Fig. 5CGo).

G543A, G543S, and G543T NIS Exhibit Similar Km for I but Different Maximal I Transport Rates
We analyzed the kinetic properties of I uptake in COS-7 cells expressing G543A, G543S, and G543E, as compared with WT NIS. Initial rates were assessed by measuring I accumulation at 4-min time points over a range of I concentrations of 2.5–160 µM. No significant variations in the Km for I were observed among cells expressing the mutant proteins with respect to WT NIS (Fig. 6Go). In contrast, the maximal rate of I uptake (Vmax) was lower in G543A [53.4 ± 0.7 pmol/(µg DNA*4 min)] and G543S [35.7 ± 0.6 pmol/(µg DNA*4 min)] NIS than in WT NIS [87.6 ± 1.2 pmol/(µg DNA*4 min)] (Fig. 6Go). We quantitated the levels of mature G543A- and G543S-NIS proteins (Fig. 5BGo, band C) with respect to the WT NIS on the immunoblots (values were standardized to tubulin expression). We observed a direct correlation between WT, G543A-, and G543S-NIS Vmax values and the corresponding protein expression levels, expressed as "%Vmax/% C" (Fig. 6Go). This suggests that the mature NIS molecules that reach the plasma membrane are equally active, independently of their residue substitution at position 543.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. Kinetic Analysis of I Uptake in Transfected COS Cells

Initial rates (4-min time points) of I uptake were determined at the indicated concentrations of I, as described in Materials and Methods. Calculated curves (solid lines) were generated using the equation v([I]) = (Vmax*[I])/(Km+ [I]) + 0.06*[I] + 0.80. The terms 0.06*[I] + 0.80 correspond to background adjusted by least squares to the data obtained with nontransfected (NT) cells. Vmax-I and Km-I values are indicated in the table. Symbols: dotted line, NT cells; squares, WT NIS; circles, G543A; triangles, G543S; and diamonds, G543E. Km and Vmax values are expressed as mean ± SEM. "%Vmax/%C" in the table indicates the correlation between the Vmax values and the percent of mature polypeptide (band C) expressed, calculated with respect to WT NIS. Nitrocellulose membranes were stripped and reprobed with anti-tubulin (total protein blots) or anti-Na+/K+-ATPase {alpha}-subunit Abs (biotinylated protein blots) (data not shown) to determine the levels of NIS protein expression respect to the WT NIS protein. Expression of both NIS and tubulin or NIS and Na+/K+-ATPase {alpha}-subunit was quantitated in three different experiments.

 
G543E NIS Is Not Active in Membrane Vesicles (MVs)
It is clear that G543E NIS is not active in transiently transfected COS-7 cells ultimately because it is not targeted to the plasma membrane. However, the lack of I transport activity in these cells does not necessarily mean that G543E NIS is intrinsically inactive independently of its trafficking to the plasma membrane. Kaminsky et al. (32) observed NIS activity in MVs prepared from rat thyroid-derived FRTL-5 cells that themselves, when intact, exhibited no I transport because they had been maintained in the absence of TSH. Such MVs contained membranes from all intracellular organelles, as well as from the plasma membrane. NIS activity occurred in MVs in which an artificial Na+ gradient was imposed as a driving force in the absence of a Na+ gradient generated by the Na+/K+ ATPase. NIS activity in these MVs exhibited nearly identical kinetic characteristics to those of NIS in intact FRTL-5 cells in the presence of TSH. Riedel et al. (33) subsequently demonstrated that the lack of I transport activity in intact FRTL-5 cells in the absence of TSH was due to "internalization" of NIS to intracellular organelles caused by the absence of TSH, not to an intrinsic lack of functional ability by the NIS molecule.

To examine whether G543E NIS is intrinsically active, we prepared MVs from COS-7 cells expressing either WT, G543A, G543S, or G543E NIS and assayed them for I transport. As expected, given their proven I uptake activity in intact cells, MVs from WT, G543A, or G543S NIS-expressing cells exhibited Na+-dependent and perchlorate-inhibitable I accumulation in MVs as well. In contrast, there was no I transport in MVs from G543E NIS-expressing cells (Fig. 7Go). These results show that, in addition to displaying incomplete glycosylation and impaired trafficking to the cell surface, G543E NIS may either be intrinsically inactive or have such a low level of activity that it is not detectable by transport assays in MVs.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. I Uptake in MVs Prepared from Transfected COS Cells

MVs were prepared from G543A(A)-, G543S(S)-, G543E(E)-, or WT-NIS-cDNA-transfected COS-7 cells. Aliquots (10 µl:100 µg) were assayed for 125I uptake at the indicated times by incubation at room temperature (RT) in an equal volume (10 µl) of 40 µM of Na125I (1.1 Ci/mmol),1 mM MgCl2,10 mM HEPES-KOH (pH 7.5), and 2 mM methimazole with 200 mM NaCl (solid symbols) or 200 mM NaCl plus 80 µM NaClO4 [(open symbols and dotted lines)(only MVs from WT and G543E NIS are shown)]. Reactions were terminated at the times shown by the addition of 4 ml ice-cold quenching solution [250 mM KCl, 1 mM Tris-HCl (pH 7.5)], and 1 mM methimazole, followed by rapid filtration through wet nitrocellulose filters (0.22 µm). Filters were washed twice with an additional 4 ml quenching solution. Radioactivity retained by MVs was determined in a {gamma}-counter. Error bars indicate SD of triplicate determinations. Symbols: squares, WT NIS; circles, G543A; triangles, G543S and diamonds, G543E. prot, Protein.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The prior detailed molecular analysis of three ITD-causing NIS mutations, namely T354P (27), G395R, (28), and Q267E (29), has provided highly meaningful structure/function information on NIS, establishing the functional role of the hydroxyl group at the ß-carbon of the residue at position 354, the ability of a charged or large side chain at position 395 to interfere with NIS activity, and the significance of the Q267 residue in maintaining the turnover number of NIS. Remarkably, all three of these mutant NIS proteins exhibited normal maturation, expression, and targeting to the plasma membrane. In contrast, in the present study, we have identified G543E as the first ITD-causing NIS mutant that matured only partially and was retained in intracellular organelles instead of being targeted to the plasma membrane.

After it had been shown that G543E NIS mediates no I uptake in COS-7 cells transiently transfected with G543E NIS cDNA (Fig. 2AGo), partial maturation of G543E NIS was conclusively demonstrated by immunoblot analysis (Fig. 2BGo) and by assessing the effect of N-Glycanase treatment on the electrophoretic mobility of G543E NIS (Fig. 2CGo). Only the immaturely glycosylated approximately 60-kDa G543E NIS species was detected in the immunoblot (Fig. 2Go, B and C; band B), a species that, upon N-Glycanase treatment, disappeared with a simultaneous increase in the nonglycosylated approximately 55-kDa species (Fig. 2CGo, band A) and its approximately 110-kDa dimer (Fig. 2CGo, band AA). The retention of G543E NIS in intracellular organelles was clearly shown by surface biotinylation, which revealed that no G543E NIS molecules reached the plasma membrane (Fig. 3AGo), and by confocal immunofluorescence, which proved that G543E NIS was detectable only as intracellular staining in permeabilized cells (Fig. 3Go, B and C). Moreover, upon observing that G543E NIS is Endo H sensitive (Fig. 3DGo), we determined that G543E NIS is retained, more specifically, at some point before the medial Golgi, the site where Endo H resistance is conferred. Coimmunofluorescence studies with intracellular organelle markers established that G543E NIS is primarily retained in the ER (Fig. 3Go, E and F).

We then observed that the presence of charged residues other than Glu at position 543 also led to incomplete glycosylation and prevented targeting of NIS to the plasma membrane, consequently rendering NIS inactive (Fig. 4Go), just as Glu does, indicating that charge is at least one causative factor in all these effects. This notion was reinforced by the finding that neutral residues (other than the native and similarly neutral Gly) at position 543 restored NIS activity (Fig. 5Go). However, only neutral residues with a volume smaller than 129 A3 (Fig. 5Go) had this restorative effect, underscoring that not only the charge (or lack thereof) but also the size of the residue at position 543 is significant for NIS function. The larger the volume of the residue at this position, the more pronounced the decrease in function the residue will cause, suggesting that G543 is in a tightly packed region of NIS. Indeed, a comparison of a three-dimensional rendering of TMS XIII of NIS with Gly (the native residue) vs. Glu (the residue in the patient’s mutant) at position 543 (Fig. 8Go) dramatically illustrates the impact that the volume difference can have on the three-dimensional configuration of this TMS.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8. Amino Acid Substitutions at Position 543 in the Secondary Structure Model of Putative TMS XIII

Coordinates were generated with SwissProtpdb (45 ). Figures were drawn using the programs MolScript (46 ) and Raster 3D (47 ). {alpha}-Helix backbone is depicted as a blue ribbon. The NH2 terminus of the helix, depicted in aqua, faces the extracellular milieu, whereas the COOH terminus, depicted in orange, faces the cytosol. Amino acid residues are represented in ball-and-stick form except for the residue at position 543 (gly or glu), which is represented as space-filling model. Color code: gray, carbon; red, oxygen; and yellow, sulfur.

 
The direct correlation that exists between the levels of mature G543A and G543S NIS proteins expressed (Fig. 5BGo, band C) and targeted to the plasma membrane (Fig. 5CGo) and their Vmax values (Fig. 6Go) is a strong indication of the equal extent of activity of both mutant proteins, independently of the presence of Ala or Ser at position 543. Significantly, we have shown that G543E NIS is inactive in MVs (Fig. 7Go), suggesting either that this mutant NIS is intrinsically inactive or that its activity is so low that it is undetectable by the transport assay.

Chemical chaperones have been shown to reverse the cellular mislocalization or misfolding of certain plasma membrane proteins such as the most common mutation in cystic fibrosis, CFTR-{Delta}F508 (34, 35), and aquaporin molecules associated with nephrogenic diabetes insipidus (36). We examined the effect of several treatments that have been effective in improving trafficking of intracellularly retained plasma membrane proteins in the cell trafficking of G543E NIS (data not shown). No G543E NIS targeting to the plasma membrane was observed with low temperature (27 C), treatment with chemical "chaperones" such as 10% glycerol, dimethylsulfoxide, or with the combination of low temperature (27 C) and 10% glycerol. We observed that although 10 mM 4-phenylbutyrate treatment successfully up-regulated G543E NIS expression, it had no effect on the mutant protein’s maturation or trafficking. Similarly, treatment with either the proteasome inhibitors ALLN (5–50 µM for 18 h) or lactacystin (2 µM for 1–6 h), or the Ca2+ ATPase inhibitor thapsigargin (2 µM for 30 min to 6 h) had no effect on G543E NIS maturation or targeting to the plasma membrane. The failure of these treatments to improve G543E NIS trafficking suggests that trafficking mechanisms for NIS, and perhaps for other members of the SLC5 family, are different from those operative in other proteins.

Although mutations in other members of the SLC5 family of plasma membrane transporters, such as SGLT1 (sodium/glucose cotransporter) and SGLT2 (sodium/glucose cotransporter, low affinity), affect protein trafficking (37, 38, 39), very little is known about the mechanisms that regulate the targeting of these transporters to the plasma membrane. Slight conformational changes in the transporters may interfere with interactions between the transport vesicles containing the transporters and the motor proteins responsible for the delivery of the vesicles to the plasma membrane (38).

That G543E NIS is not fully glycosylated is no doubt of considerable interest, but it appears unlikely to be the direct cause of G543E NIS’s lack of function. We have previously demonstrated that glycosylation per se is not required for NIS to be active and targeted to the plasma membrane (15). Normally, WT NIS is a highly glycosylated protein. We have shown that the three asparagines (N225, N485, and N497) located at glycosylation consensus sequences in NIS are indeed glycosylated. Thus, when we generated a mutant NIS in which we replaced those three Asn with Gln, we observed that nonglycosylated NIS was still targeted to the plasma membrane and was functional with kinetic properties similar to those of WT NIS (15).

It seems possible that the presence of a large neutral or a charged residue instead of the native Gly at position 543 has deleterious effects on the NIS molecule that go beyond merely interfering with continuation of glycosylation in the medial Golgi. Rather, it seems likely that the presence of such residues at this position leads to three-dimensional misfolding of the molecule, which in turn interferes not only with glycosylation but also with trafficking to the plasma membrane and probably with the protein’s intrinsic function. This putative three-dimensional misfolding may alter NIS interaction with chaperones that would otherwise steer it through its normal maturation and targeting to the plasma membrane. Our findings prove that Glu 543 is the first NIS residue identified to play key roles in the maturation and trafficking of NIS.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Site-Directed Mutagenesis
Individual mutagenic oligonucleotides were generated to make the following substitutions at the G543 position of hNIS. G543E and G543D: CCACTGTGCTGTGCGAMGCCCTCA TCAGC; G543R and G543Q: CCACTGTGCTGTGCCRAGCCCTCATCAGC; G543K: CCACTGTG CTGTGCAAAGCCCTC ATCAGC; G543A and G543P: CCACTGTGCTGTGCSCAGCCCTCATCA GC; G543S and G543C: CCACTGTGCTGTGCTSTGCCCTCATCAGC; G543T: CCACTGTGCTG TGCACAGCCCTCATCAGC; G543N, G543V: CCACTGTGCTGTGCGTAGCCCTCATCAGC; and G543W: CCACTGTGCTGTGCTGGGCCCTCATCAGC.

The initial PCR extensions were performed using reverse primers complementary to the mutant sequences (see above oligonucleotides) and the 3'-end (5'-GGTCTGGCCCTAAGCTTAGAGGTTTG TCTCCT-3'). Amplified fragments (324 bp) were gel purified and used for a second round of PCR extension with primers complementary to the 5'-end (5'-GGCGCAGGTGRAGCGCTACGTGGCTTG-3'). Fragments with the mutant sequences were obtained by digestion of the final PCR products with the appropriate unique restriction enzymes (PstI/HindIII) that would yield the smallest mutant fragments (866 bp). These fragments were ligated into WT hNIS cDNA (pSVSport1-hNIS), and the mutant inserts were sequenced past their respective cloning sites.

Transient Transfections
COS-7 cells were transfected by the diethylaminoethyl-Dextran method (15) with 1 µg/ml hNIS or mutant cDNAs in pSVSport1 plasmid (Life Technologies, Inc., Gaithersburg, MD), or with lipofectamine reagent (Invitrogen, San Diego, CA) enhanced with Plus Reagent (Invitrogen) according to the manufacturer’s instructions. Flow cytometry analysis was used to determine the transfection efficiency (29). After 2 d they were assayed for I uptake, biotinylation, immunoblot analysis, immunofluorescence, and/or flow cytometry analysis.

I Transport in Intact Cells
Transiently transfected cells with WT or mutant NIS cDNAs were assayed as described previously (15, 40). Cells were washed twice with 137 mM NaCl, 5.4 mM KCl, 1.3 mM CaCl2, 0.4 mM MgSO4 ·7 H2O, 0.5 mM MgCl2, 0.4 mM NaHPO4 · 7 H2O, 0.44 mM KH2PO4, and 5.55 mM glucose in 10 mM HEPES at pH 7.5 [Hanks’ balanced salt solution (HBSS)]. Cells were incubated in HBSS containing 20 µM NaI supplemented with 1 µCi carrier-free Na125I to give a specific activity of 100 mCi/mmol. For steady-state experiments, incubations proceeded for 1 h at 37 C in a humidified atmosphere and were terminated by aspirating the radioactive medium and washing twice with 1 ml ice-cold HBSS.

To determine the amount of 125I accumulated in the cells, 500 µl cold ethanol was added for 20 min at 4 C, and radioactivity was quantitated in a LKB {gamma}-counter. DNA was determined by the diphenylamine method (14) after trichloroacetic acid precipitation. Uptake was expressed as picomoles of I per µg of DNA. Results are the average of at least five different experiments performed in triplicate or sextuplicate. Data were analyzed with GraphPad Prism (Intuitive Software for Science, San Diego, CA). I uptake values are the mean ± SEM. Statistical significance was determined by t test analysis using two-tailed P values, and differences were considered significant at P < 0.05.

For I-dependent kinetic analysis, cells were incubated with the indicated concentrations of I (2.5–160 µM) and 140 mM NaCl for 4 min. Initial-rate data were analyzed by a nonlinear regression using the following equation for I-dependent I uptake: v([I]) = (Vmax*[I])/(Km+ [I]) + 0.06*[I] + 0.80. The terms 0.06*[I] + 0.80 correspond to background adjusted by least squares of the data obtained with nontransfected cells. Data were fitted by nonlinear least squares using the Marquard-Levenberg algorithm (41). Data were analyzed with Gnuplot (www.gnuplot.info). Km and Vmax values are the average of three experiments and are expressed as mean ± SEM.

Membrane Vesicle Preparation and I Transport
MVs were prepared from transfected cells as described elsewhere (14). Forty-eight hours after cDNA NIS transfection, COS-7 cells were washed, harvested, and resuspended in ice-cold 250 mM sucrose, 1 mM EGTA, and 10 mM HEPES-KOH at pH 7.5 containing aprotinin (90 µg/ml) and leupeptin (4 µg/ml). Cells were disrupted with a motor-driven Teflon-pestle homogenizer (25 strokes). The homogenate was centrifuged twice at 500 x g for 15 min at 4 C. The supernatant was centrifuged at 100,000 x g for 1 h at 4 C. The pellet was resuspended in ice-cold 250 mM sucrose, 1 mM MgCl2, 10 mM HEPES-KOH at pH 7.5. Protein determination was performed as described elsewhere (14).

MVs prepared from transiently transfected cells were assayed as described previously (32). MVs were thawed at 37 C and placed on ice. Aliquots containing 100 µg of protein (10 µl) were assayed for 125I uptake by incubating at room temperature with an equal volume of a solution containing 40 µM Na125I (specific activity 1 Ci/mmol), 1 mM MaCl2, 10 mM HEPES-OH (pH 7.5), 2 mM methimazole, and 200 mM NaCl. Reactions were terminated at the indicated time points by the addition of 4 ml of ice-cold quenching solution: 250 mM KCl, 1 mM methimazole, and 1 mM Tris-HCl (pH 7.5), followed by rapid filtration though wet nitrocellulose filters (0.22-µm pore diameter). Radioactivity retained by MVs was determined by quantitating filters in a {gamma}-counter. Data were standardized per gram of protein.

Abs
Anti-Ct-hNIS.
Affinity-purified site-directed polyclonal Ab was used at a final concentration of 4 nM in immunoblot and immunofluorescence analysis. This Ab was generated against the last 13 amino acids of hNIS (6).

Anti-hNIS VJ1.
Monoclonal Ab that recognizes the last two extracellular segments of hNIS protein (30) (kindly provided by Dr. S. Costagliola, Institute of Interdisciplinary Research, Free University of Brussels, Brussels, Belgium) was used at a 1:50 dilution in immunofluorescence analysis (29).

Primary monoclonal Abs against calnexin (Transduction Laboratories, Inc., Lexington, KY), protein disulfide isomerase (Affinity BioReagents, Inc., Golden, CO), GM130 (Transduction Laboratories), EEA1 (Sigma Chemical Co., St. Louis, MO), tubulin (Sigma), and Na+/K+-ATPase {alpha}-subunit (Affinity BioReagents) were used following the manufacturers’ instructions. Secondary Abs were also obtained from commercial sources: sheep antirabbit IgG (H+L) horseradish peroxidase (HRP)-conjugated affinity-purified Ab (Chemicon, Temecula, CA) (1:3000), antimouse goat IgG HRP-conjugated (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) (1:3000), fluorescein-conjugated goat antirabbit IgG (H+L) (Vector Laboratories, Burlingame, CA) (1:1000) and rhodamine red-X-conjugated affinipure F(ab')2 fragment goat antimouse IgG (Jackson ImmunoResearch Laboratories, Inc.) (1:6000).

Immunoblot
SDS/9% PAGE and electroblotting to nitrocellulose were performed as previously described (14). All samples were diluted 1:2 with loading buffer and heated at 37 C for 30 min before electrophoresis. Immunoblot analysis was carried out with the corresponding amount of 4 nM anti-Ct-hNIS Ab, and a 1:3000 dilution of a HRP-linked sheep antirabbit IgG (Chemicon International). Both incubations were performed for 1 h. Polypeptides were visualized by enhanced chemiluminescence Western blot detection system (Amersham Pharmacia Biotech, Arlington Heights, IL). Nitrocellulose membranes were stripped and reprobed with antitubulin (total protein blots) or anti-Na+/K+-ATPase {alpha}-subunit (biotinylated protein blots) Ab (data not shown).

Immunofluorescence and Confocal Microscopy
Cells were grown on glass coverslips, washed two times with PBS and fixed in 2% paraformaldehyde in PBS for 20 min at room temperature, quenched with 50 mM NH4Cl for 10 min at room temperature and washed three times with PBS, and then permeabilized with 0.2% (vol/vol) Triton X-100 in PBS containing 0.5% (wt/vol) BSA (Sigma), 0.1 mM CaCl2, and 0.1 mM MgCl2 (PBSACMT), or not permeabilized in PBSACMT without Triton X-100 (PBSACM) for 5 min at room temperature. Coverslips were incubated with primary Abs diluted in PBSACM or PBSACMT for 1 h at room temperature, washed twice with PBS, and incubated with fluorescein-conjugated goat antirabbit (Vector Laboratories) and/or rhodamine red-X-conjugated affinipure goat antimouse IgG Abs (Jackson ImmunoResearch Laboratories, Inc.) diluted in PBSACM or PBSACMT for 1 h at room temperature. Coverslips were mounted and examined using a Radiance 2000 laser-scanning confocal microscope (Bio-Rad Laboratories, Hercules, CA), using excitation wavelengths of 488 and 568 nm. Adobe Photoshop software (Adobe Systems, Inc., San Jose, CA) was used to prepare figures from the digitized images obtained with the confocal microscope.

Flow Cytometry
Cells in suspension were stained using indirect immunofluorescence procedures (42, 43). Washed cells (2 x 106) were fixed with 2% paraformaldehyde (Sigma) in PBS for 10 min. Fixed cells were centrifuged (200 x g, 10 min) and washed with PBS containing 0.1% (wt/vol) BSA (PBSA) for nonpermeabilized cells and additional 0.2% (wt/vol) saponin (Sigma) (PBSAS) for permeabilized cells. Samples were resuspended in 100 µl primary Ab in PBSA or PBSAS for 1 h. After washing, cells were incubated with 1:1000 dilution of fluorescein thiocyanate-conjugated goat antirabbit (or antimouse) IgG (Vector) for 1 h. Cells were washed in PBSA and resuspended in 500 µl of PBS before flow cytometry analysis. Propidium iodide (20 µg/ml) was added to each sample to exclude dead cells in the nonpermeabilized cell preparation. The fluorescence of 1 x 104 cells per tube was assayed by a fluorescence-activated cell sorting scan flow cytometer (Becton Dickinson and Co., Franklin Lakes, NJ).

Biotinylation
Cell surface proteins were labeled with the membrane-impermeable biotinylation reagent Sulfo-NHS-SS-biotin (Pierce Chemical Co., Madison, WI) as described elsewhere (44). Transiently transfected cells were rinsed twice with PBS containing 1 mM MgCl2 and 0.1 mM CaCl2 at pH 7.4 (PBSCM) at 4 C. Cells were incubated with 1 mg/ml Sulfo-NHS-SS-biotin (Pierce) in biotinylation medium containing 2 mM CaCl2, 150 mM NaCl, and 20 mM HEPES at pH 8.5 for 30 min at 4 C with gentle shaking. The reagent was quenched by washing twice with 100 mM glycine in PBSCM for 10 min. Cells were lysed with buffer containing 150 mM NaCl, 5 mM EDTA, 1% (vol/vol) Triton X-100, 1% (vol/vol) sodium dodecyl sulfate (SDS), and protease inhibitors in 50 mM Tris-HCl at pH 7.5 (lysis buffer) for 15 min at 4 C. SDS concentration was diluted 10 times in lysis buffer without SDS. Cell surface proteins were isolated from the cell extract with streptavidin-agarose beads (Pierce) incubated overnight with rotation at 4 C. Beads were rinsed three times with lysis buffer without SDS, twice with high-salt buffer containing 5 mM EDTA, 0.1% (vol/vol) Triton X-100 and 500 mM NaCl in Tris-HCl, pH 7.5, and once with 50 mM Tris-HCl at pH 7.5. The beads were eluted in SDS-PAGE sample buffer containing 200 mM dithiothreitol, heated for 5 min at 75 C, chilled for 10 min on ice, and loaded onto the gel.

Deglycosylation Treatments
Total proteins were deglycosylated with PNGase F (New England Biolabs, Beverly, MA). Protein (40 µg) was denatured in 1% (wt/vol) lithium dodecyl sulfate and 1% (vol/vol) 2-mercaptoethanol at 37 C for 30 min. The deglycosylation reaction was performed in 50 mM PBS at pH 7.5 containing 1% (vol/vol) Nonidet P-40 and 1000 U of PNGase F at 37 C for 18 h. Controls were incubated in the same buffer but without enzyme. For deglycosylation of total proteins with Endo H (New England Biolabs), total protein (40 µg) was denatured at 37 C for 30 min in a buffer containing 1% (wt/vol) lithium dodecyl sulfate, 1% (vol/vol) 2-mercaptoethanol, 10 mM Tris at pH 7.5, 100 mM NaCl, and 250 µM sucrose. The deglycosylation reaction was performed in a total volume of 40 µl with the addition of 50 mM sodium citrate at pH 5.5, 5% (vol/vol) Triton X-100, and 1500 U of Endo H at 37 C for 18 h. Controls were incubated in the same buffer without enzyme. Samples were subjected to immunoblot analysis as described above.

Densitometric Analysis
Films were scanned, and the optical density of the bands was measured using two different image analysis softwares: NIH image (National Institute of Mental Health, Bethesda, MD) and ImageQuant (Molecular Dynamics, Inc., Sunnyvale, CA). Only signals in the linear exposure range of the films were used. The amount of expressed protein (arbitrary units) was compared with WT NIS expression and expressed as percent of WT NIS.


    ACKNOWLEDGMENTS
 
We thank Dr. Sabine Costagliola (Institute of Interdisciplinary Research, Free University of Brussels, Brussels, Belgium) for providing the anti-hNIS VJ1 monoclonal Abs. We are grateful to Drs. Mario Amzel (Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD) and Pamela Stanley (Department of Cell Biology, Albert Einstein College of Medicine of Yeshiva University, Bronx, NY) for insightful comments, and to the members of the Carrasco laboratory for discussions and critical reading of the manuscript.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant DK-41544 (to N.C.). A.V. was supported in part by Grant PF 97 52094152 from the Ministry of Education and Culture (Ministerio de Educación y Cultura) of Spain.

First Published Online June 23, 2005

Abbreviations: Ab, Antibody; Ct-hNIS, carboxy terminus of hNIS; Endo H, endoglycosidase H; ER, endoplasmic reticulum; HBSS, Hanks’ balanced salt solution; HRP, horseradish peroxidase; ITD, iodide transport defect; MV, membrane vesicle; NIS, Na+/I symporter; PNGase F, N-glycanase F; SDS, sodium dodecyl sulfate; TMS, transmembrane segment; WT, wild type.

Received for publication April 21, 2005. Accepted for publication June 14, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Carrasco N, Puttner IB, Antes LM, Lee JA, Larigan JD, Lolkema JS, Roepe PD, Kaback HR 1989 Characterization of site-directed mutants in the lac permease of Escherichia coli. 2. Glutamate-325 replacements. Biochemistry 28:2533–2539[CrossRef][Medline]
  2. Levy O, De la Vieja A, Carrasco N 1998 The Na+/I– symporter (NIS): recent advances. J Bioenerg Biomembr 30:195–206[CrossRef][Medline]
  3. De la Vieja A, Dohan O, Levy O, Carrasco N 2000 Molecular analysis of the sodium/iodide symporter: impact on thyroid and extrathyroid pathophysiology. Physiol Rev 80:1083–1105[Abstract/Free Full Text]
  4. Dohan O, De la Vieja A, Paroder V, Riedel C, Artani M, Reed M, Ginter CS, Carrasco N 2003 The sodium/iodide Symporter (NIS): characterization, regulation, and medical significance. Endocr Rev 24:48–77[Abstract/Free Full Text]
  5. Spitzweg C, Morris JC 2002 The sodium iodide symporter: its pathophysiological and therapeutic implications. Clin Endocrinol (Oxf) 57:559–574[CrossRef][Medline]
  6. Tazebay UH, Wapnir IL, Levy O, Dohan O, Zuckier LS, Zhao QH, Deng HF, Amenta PS, Fineberg S, Pestell RG, Carrasco N 2000 The mammary gland iodide transporter is expressed during lactation and in breast cancer. Nat Med 6:871–878[CrossRef][Medline]
  7. Mazzaferri EL 1996 Carcinoma of follicular epithelium: radioiodide and other treatments and outcomes. In: Braverman LE, Utiger RD, eds. The thyroid: a fundamental and clinical text. 7th ed. Philadelphia: Lippincott-Raven; 922–945
  8. Mazzaferri EL, Jhiang SM 1994 Long-term impact of initial surgical and medical therapy on papillary and follicular thyroid cancer. Am J Med 97:418–428[CrossRef][Medline]
  9. Dai G, Levy O, Carrasco N 1996 Cloning and characterization of the thyroid iodide transporter. Nature 379:458–460[CrossRef][Medline]
  10. Eskandari S, Loo DD, Dai G, Levy O, Wright EM, Carrasco N 1997 Thyroid Na+/I– symporter. Mechanism, stoichiometry, and specificity. J Biol Chem 272:27230–27238[Abstract/Free Full Text]
  11. Carrasco N 1993 Iodide transport in the thyroid gland. Biochim Biophys Acta 1154:65–82[Medline]
  12. Smanik PA, Liu Q, Furminger TL, Ryu K, Xing S, Mazzaferri EL, Jhiang SM 1996 Cloning of the human sodium iodide symporter. Biochem Biophys Res Commun 226:339–345[CrossRef][Medline]
  13. Smanik PA, Ryu KY, Theil KS, Mazzaferri EL, Jhiang SM 1997 Expression, exon-intron organization, and chromosome mapping of the human sodium iodide symporter. Endocrinology 138:3555–3558[Abstract/Free Full Text]
  14. Levy O, Dai G, Riedel C, Ginter CS, Paul EM, Lebowitz AN, Carrasco N 1997 Characterization of the thyroid Na+/I– symporter with an anti-COOH terminus antibody. Proc Natl Acad Sci USA 94:5568–5573[Abstract/Free Full Text]
  15. Levy O, De la Vieja A, Ginter CS, Riedel C, Dai G, Carrasco N 1998 N-linked glycosylation of the thyroid Na+/I– symporter (NIS). Implications for its secondary structure model. J Biol Chem 273:22657–22663[Abstract/Free Full Text]
  16. Wolff J 1983 Congenital goiter with defective iodide transport. Endocr Rev 4:240–254[Abstract/Free Full Text]
  17. Fujiwara H, Tatsumi K, Miki K, Harada T, Miyai K, Takai S, Amino N 1997 Congenital hypothyroidism caused by a mutation in the Na+/I– symporter. Nat Genet 16:124–125[CrossRef][Medline]
  18. Fujiwara H, Tatsumi K, Miki K, Harada T, Okada S, Nose O, Kodama S, Amino N 1998 Recurrent T354P mutation of the Na+/I– symporter in patients with iodide transport defect. J Clin Endocrinol Metab 83:2940–2943[Abstract/Free Full Text]
  19. Fujiwara H, Tatsumi K, Tanaka S, Kimura M, Nose O, Amino N 2000 A novel V59E missense mutation in the sodium iodide symporter gene in a family with iodide transport defect. Thyroid 10:471–474[Medline]
  20. Kosugi S, Inoue S, Matsuda A, Jhiang SM 1998 Novel, missense and loss-of-function mutations in the sodium/iodide symporter gene causing iodide transport defect in three Japanese patients. J Clin Endocrinol Metab 83:3373–3376[Abstract/Free Full Text]
  21. Kosugi S, Sato Y, Matsuda A, Ohyama Y, Fujieda K, Inomata H, Kameya T, Isozaki O, Jhiang SM 1998 High prevalence of T354P sodium/iodide symporter gene mutation in Japanese patients with iodide transport defect who have heterogeneous clinical pictures. J Clin Endocrinol Metab 83:4123–4129[Abstract/Free Full Text]
  22. Kosugi S, Bhayana S, Dean HJ 1999 A novel mutation in the sodium/iodide symporter gene in the largest family with iodide transport defect. J Clin Endocrinol Metab 84:3248–3253[Abstract/Free Full Text]
  23. Kosugi S, Okamoto H, Tamada A, Sanchez-Franco F 2002 A novel peculiar mutation in the sodium/iodide symporter gene in Spanish siblings with iodide transport defect. J Clin Endocrinol Metab 87:3830–3836[Abstract/Free Full Text]
  24. Pohlenz J, Medeiros-Neto G, Gross JL, Silveiro SP, Knobel M, Refetoff S 1997 Hypothyroidism in a Brazilian kindred due to iodide trapping defect caused by a homozygous mutation in the sodium/iodide symporter gene. Biochem Biophys Res Commun 240:488–491[CrossRef][Medline]
  25. Pohlenz J, Rosenthal IM, Weiss RE, Jhiang SM, Burant C, Refetoff S 1998 Congenital hypothyroidism due to mutations in the sodium/iodide symporter. Identification of a nonsense mutation producing a downstream cryptic 3' splice site. J Clin Invest 101:1028–1035[Medline]
  26. Tonacchera M, Agretti P, de Marco G, Elisei R, Perri A, Ambrogini E, De Servi M, Ceccarelli C, Viacava P, Refetoff S, Panunzi C, Bitti ML, Vitti P, Chiovato L, Pinchera A 2003 Congenital hypothyroidism due to a new deletion in the sodium/iodide symporter protein. Clin Endocrinol (Oxf) 59:500–506[CrossRef][Medline]
  27. Levy O, Ginter CS, De la Vieja A, Levy D, Carrasco N 1998 Identification of a structural requirement for thyroid Na+/I– symporter (NIS) function from analysis of a mutation that causes human congenital hypothyroidism. FEBS Lett 429:36–40[CrossRef][Medline]
  28. Dohan O, Gavrielides MV, Ginter C, Amzel LM, Carrasco N 2002 Na(+)/I(–) symporter activity requires a small and uncharged amino acid residue at position 395. Mol Endocrinol 16:1893–1902[Abstract/Free Full Text]
  29. De La Vieja A, Ginter CS, Carrasco N 2004 The Q267E mutation in the sodium/iodide symporter (NIS) causes congenital iodide transport defect (ITD) by decreasing the NIS turnover number. J Cell Sci 117:677–687[Abstract/Free Full Text]
  30. Pohlenz J, Duprez L, Weiss RE, Vassart G, Refetoff S, Costagliola S 2000 Failure of membrane targeting causes the functional defect of two mutant sodium iodide symporters. J Clin Endocrinol Metab 85:2366–2369[Abstract/Free Full Text]
  31. Richards FM 1977 Areas, volumes, packing and protein structure. Annu Rev Biophys Bioeng 6:151–176[CrossRef][Medline]
  32. Kaminsky SM, Levy O, Salvador C, Dai G, Carrasco N 1994 Na(+)-I– symport activity is present in membrane vesicles from thyrotropin-deprived non-I(–)-transporting cultured thyroid cells. Proc Natl Acad Sci USA 91:3789–3793[Abstract/Free Full Text]
  33. Riedel C, Levy O, Carrasco N 2001 Post-transcriptional regulation of the sodium/iodide symporter by thyrotropin. J Biol Chem 276:21458–21463[Abstract/Free Full Text]
  34. Sato S, Ward CL, Krouse ME, Wine JJ, Kopito RR 1996 Glycerol reverses the misfolding phenotype of the most common cystic fibrosis mutation. J Biol Chem 271:635–638[Abstract/Free Full Text]
  35. Zeitlin PL 1999 Novel pharmacologic therapies for cystic fibrosis. J Clin Invest 103:447–452[Medline]
  36. Tamarappoo BK, Verkman AS 1998 Defective aquaporin-2 trafficking in nephrogenic diabetes insipidus and correction by chemical chaperones. J Clin Invest 101:2257–2267[Medline]
  37. Martin MG, Turk E, Lostao MP, Kerner C, Wright EM 1996 Defects in Na+/glucose cotransporter (SGLT1) trafficking and function cause glucose-galactose malabsorption. Nat Genet 12:216–220[CrossRef][Medline]
  38. Wright EM, Turk E 2004 The sodium/glucose cotransport family SLC5. Pflugers Arch 447:510–518[CrossRef][Medline]
  39. van den Heuvel LP, Assink K, Willemsen M, Monnens L 2002 Autosomal recessive renal glucosuria attributable to a mutation in the sodium glucose cotransporter (SGLT2). Hum Genet 111:544–547[CrossRef][Medline]
  40. Weiss SJ, Philp NJ, Grollman EF 1984 Iodide transport in a continuous line of cultured cells from rat thyroid. Endocrinology 114:1090–1098[Abstract/Free Full Text]
  41. Press WH, Flannery BP, Teukolsky SA, Wetterling WT 1986 Numerical recipes: the art of scientific computing. Cambridge, UK: Cambridge University Press; 523–528
  42. Jacobberger JW 1991 Intracellular antigen staining: quantitative immunofluorescence. Methods 2:207–218
  43. Jacobberger JW, Fogleman D, Lehman JM 1986 Analysis of intracellular antigens by flow cytometry. Cytometry 7:356–364[CrossRef][Medline]
  44. Chen JG, Liu-Chen S, Rudnick G 1998 Determination of external loop topology in the serotonin transporter by site-directed chemical labeling. J Biol Chem 273:12675–12681[Abstract/Free Full Text]
  45. Guex N, Peitsch MC 1997 SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714–2723[CrossRef][Medline]
  46. Kraulis PJ 1991 MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures. J Appl Cryst 24:946–950[CrossRef]
  47. Merritt EA, Bacon DJ 1997 Raster3D: photorealistic molecular graphics. Methods Enzymol 277:505–524[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Riesco-Eizaguirre, I. Rodriguez, A. De la Vieja, E. Costamagna, N. Carrasco, M. Nistal, and P. Santisteban
The BRAFV600E Oncogene Induces Transforming Growth Factor {beta} Secretion Leading to Sodium Iodide Symporter Repression and Increased Malignancy in Thyroid Cancer
Cancer Res., November 1, 2009; 69(21): 8317 - 8325.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
V. E. Smith, M. L. Read, A. S. Turnell, R. J. Watkins, J. C. Watkinson, G. D. Lewy, J. C. W. Fong, S. R. James, M. C. Eggo, K. Boelaert, et al.
A novel mechanism of sodium iodide symporter repression in differentiated thyroid cancer
J. Cell Sci., September 15, 2009; 122(18): 3393 - 3402.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. P. Nicola, C. Basquin, C. Portulano, A. Reyna-Neyra, M. Paroder, and N. Carrasco
The Na+/I- symporter mediates active iodide uptake in the intestine
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C654 - C662.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Bizhanova and P. Kopp
The Sodium-Iodide Symporter NIS and Pendrin in Iodide Homeostasis of the Thyroid
Endocrinology, March 1, 2009; 150(3): 1084 - 1090.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S.-L. Wu, T.-Y. Ho, J.-A. Liang, and C.-Y. Hsiang
Histidine residue at position 226 is critical for iodide uptake activity of human sodium/iodide symporter
J. Endocrinol., November 1, 2008; 199(2): 213 - 219.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. D. Reed-Tsur, A. De la Vieja, C. S. Ginter, and N. Carrasco
Molecular Characterization of V59E NIS, a Na+/I- Symporter Mutant that Causes Congenital I- Transport Defect
Endocrinology, June 1, 2008; 149(6): 3077 - 3084.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Dayem, C. Basquin, V. Navarro, P. Carrier, R. Marsault, P. Chang, S. Huc, E. Darrouzet, S. Lindenthal, and T. Pourcher
Comparison of expressed human and mouse sodium/iodide symporters reveals differences in transport properties and subcellular localization
J. Endocrinol., April 1, 2008; 197(1): 95 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. De la Vieja, M. D. Reed, C. S. Ginter, and N. Carrasco
Amino Acid Residues in Transmembrane Segment IX of the Na+/I Symporter Play a Role in Its Na+ Dependence and Are Critical for Transport Activity
J. Biol. Chem., August 31, 2007; 282(35): 25290 - 25298.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
G. Riesco-Eizaguirre and P. Santisteban
A perspective view of sodium iodide symporter research and its clinical implications.
Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Szinnai, S. Kosugi, C. Derrien, N. Lucidarme, V. David, P. Czernichow, and M. Polak
Extending the Clinical Heterogeneity of Iodide Transport Defect (ITD): A Novel Mutation R124H of the Sodium/Iodide Symporter Gene and Review of Genotype-Phenotype Correlations in ITD
J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1199 - 1204.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De la Vieja, A.
Right arrow Articles by Carrasco, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De la Vieja, A.
Right arrow Articles by Carrasco, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*GLUTAMIC ACID HYDROCHLORIDE
*GLYCINE
*IODINE
Medline Plus Health Information
*Thyroid Diseases


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals