help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0097
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
19/12/2915    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, C.-Y.
Right arrow Articles by Sun, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, C.-Y.
Right arrow Articles by Sun, Z.
Molecular Endocrinology 19 (12): 2915-2929
Copyright © 2005 by The Endocrine Society

hZimp7, a Novel PIAS-Like Protein, Enhances Androgen Receptor-Mediated Transcription and Interacts with SWI/SNF-Like BAF Complexes

Chun-Yin Huang, Jason Beliakoff, Xiaoyu Li, Jane Lee, Xiaomeng Li, Manju Sharma, Bing Lim and Zijie Sun

Departments of Urology and Genetics (C.-Y.H., J.B., J.L., X.L., M.S., Z.S.), Stanford University School of Medicine, Stanford, California 94305-5328; and Division of Hematology/Oncology (X.L., B.L.), Department of Medicine, Beth Israel Deaconess Medical Center, Boston, Massachusetts 02115

Address all correspondence and requests for reprints to: Zijie Sun, Ph.D., Departments of Urology and Genetics, S287, Grant Building, Stanford University School of Medicine, Stanford, California 94305-5328. E-mail: zsun{at}stanford.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Members of the PIAS (protein inhibitor of activated signal transducer and activator of transcription) family are negative regulators of the Janus family of tyrosine kinase (JAK)-signal transducer and activator of transcription pathway. Recently, PIAS proteins have been shown to interact with multiple signaling pathways in various cellular processes, and it has been demonstrated that PIAS and PIAS-like proteins interact with nuclear hormone receptors. In this study, we have identified a novel human PIAS-like protein, provisionally termed hZimp7, which shares a high degree of sequence similarity with hZimp10 (human zinc finger-containing, Miz1, PIAS-like protein on chromosome 10). hZimp7 (human zinc finger-containing, Miz1, PIAS-like protein on chromosome 7) possesses a molecular mass of approximately 100 kDa and contains a conserved Miz (msx-interacting zinc finger) domain, a nuclear translocation signal sequence, and a C-terminal transactivation domain. Northern blot analysis revealed that hZimp7 is predominately expressed in testis, heart, brain, prostate, and ovary. Moreover, immunohistochemical staining of prostate tissues revealed that endogenous hZimp7 protein localizes to the nuclei of prostate epithelial cells and costains with the androgen receptor (AR). Further analysis of hZimp7 subcellular localization revealed that hZimp7 and the AR colocalize within the nucleus and form a protein complex at replication foci. Transient transfection experiments showed that hZimp7 augments the transcriptional activity of the AR and other nuclear hormone receptors. In contrast, reduction of endogenous hZimp7 protein expression by RNA interference decreased AR-mediated transcription. Finally, we determined that hZimp7 physically associates with Brg1 and BAF57, components of the ATP-dependent mammalian SWI/SNF-like BAF chromatin-remodeling complexes. The above data illustrate a potential role for hZimp7 in modulation of AR and/or other nuclear receptor-mediated transcription, possibly through alteration of chromatin structure by SWI/SNF-like BAF complexes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE PIAS PROTEINS [protein inhibitor of activated signal transducer and activator of transcription (STAT)] were first identified as transcriptional coregulators of the Janus family of tyrosine kinase (JAK)-STAT pathway (2). The binding of cytokines to cell surface receptors activates the Janus, or JAK, family of tyrosine kinases, which phosphorylate a family of at least seven cytoplasmic transcription factors termed STATs. PIAS1 and PIAS3 have been shown to inhibit the activity of STAT1 and STAT3, respectively, by blocking their abilities to bind DNA (3, 4, 5). However, a recent study has shown that the PIAS proteins may play a more general role in regulating chromatin structure (6, 7). Cross talk between PIAS proteins and other signaling pathways has also been demonstrated in various cellular processes, including signaling through the tumor suppressor p53, Smad proteins, and steroid hormone receptors (7, 8, 9).

PIAS and PIAS-like proteins share a zinc finger domain, termed Miz (msx-interacting zinc finger) (10). This domain appears to be important for protein-protein interactions and was recently shown to mediate the interaction between the homeobox protein Msx2 and PIASxß. An increasing number of proteins from invertebrates have been found to contain the Miz domain, suggesting a conserved and biologically important role for PIAS proteins throughout evolution. Recently, an increased interest has been focused on the role of PIAS proteins in sumoylation (11). It has been shown that the small ubiquitin-like modifier (SUMO) E3 ligase RING domain shares significant homology with the PIAS proteins (12). Moreover, PIASx{alpha}, xß, 1, and 3 have been found to interact with SUMO-1 and Ubc9 and to mediate the sumoylation of a variety of cellular proteins (13, 14, 15).

The androgen receptor (AR) belongs to the nuclear receptor superfamily (16, 17). The AR and other receptors in this family possess identifiable activation domains that confer transactivation potential when fused to a heterologous DNA-binding domain (DBD). However, an important feature of the AR and other nuclear receptors that distinguish them from other transcription factors is that they are activated through their ligand-binding domains. The unbound AR forms a complex with heat-shock proteins, which holds the AR in a conformation capable of high-affinity ligand binding (18, 19). Upon binding to ligand, the AR dissociates from the heat-shock proteins and translocates into the nucleus, where it binds to androgen response elements (AREs) and recruits cofactors to regulate the transcription of target genes (20).

Like other steroid hormone receptors, the AR can bind to different cofactors through its distinct functional domains (21). Through such interactions, these cofactors can modulate AR activity. Several members of the PIAS family have been implicated in the regulation of several nuclear hormone receptors, including the AR (3, 9, 22). Indeed, PIASx{alpha} was originally isolated as an AR-interacting protein 3, and it binds to AR and modulates AR-mediated transcription (23).

Recently, we identified a novel PIAS-like protein, hZimp10 (human zinc finger-containing, Miz1, PIAS-like protein on chromosome 10), which physically interacts with the AR and augments AR-mediated, ligand-dependent transactivation in prostate cells (1). Using specific antibodies, both endogenous AR and hZimp10 proteins were costained in the nuclei of prostate epithelial cells from normal and malignant human tissue samples. A conserved Miz domain and a strong intrinsic transactivation domain (TAD) were identified in the central and C-terminal regions of hZimp10, respectively. Transfection of hZimp10 into human prostate cancer cells showed augmentation of AR-mediated ligand-dependent transcription. A novel Drosophila gene, termed tonalli (tna), was identified recently and is the Drosophila ortholog of hZimp10 (24). The protein encoded by tna genetically interacts with the chromatin-remodeling complexes SWI2/SNF2 and Mediator, suggesting that it may play a role in transcription.

In the process of searching for potential homologs of hZimp10, we found a nucleotide sequence located on human chromosome 7 that shares a high degree of sequence similarity with hZimp10. Using 5'-RACE (rapid amplification of cDNA ends), we cloned the full-length protein. Like hZimp10 and other PIAS proteins, this novel protein contains a conserved Miz domain. Thus, we named the protein hZimp7 (human zinc finger containing, Miz1, PIAS-like protein on chromosome 7). hZimp7 is predominately expressed in testis, heart, brain, prostate, and ovary tissues. Part of the AR TAD (amino acids 243–333) and the central region of hZimp7 (amino acids 392–527) were found to be responsible for the interaction. Through fusion of hZimp7 to a heterologous DBD, it was determined that a strong TAD exists in the C terminus of the protein. Moreover, we demonstrated that hZimp7 colocalizes with the AR in the nucleus of prostate cells and prostate tissues and forms a protein complex at replication foci. Furthermore, we identified an interaction between hZimp7 and Brg1 and BAF57, components of the mammalian SWI/SNF-like BAF complexes, suggesting a possible role for hZimp7 in chromatin remodeling.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of a Novel PIAS-Like Protein, hZimp7
In searching for the homolog of hZimp10, we identified a KIAA clone, KIAA1886, which shares significant similarity with hZimp10. Because KIAA1886 is a truncated fragment, we performed 5'-RACE to isolate the full-length cDNA. Sequence analysis of the full-length clone, created by combining the 5'-RACE fragments and the KIAA1886 clone, revealed a methionine initiation codon at nucleotide 28 followed by an open reading frame encoding an 892-amino acid protein with a predicted molecular mass of approximately 100 kDa (GenBank accession no. AY426594). Using an in vitro transcription and translation assay, an approximately 100-kDa protein was generated by the full-length clone (data not shown), confirming the identity of the predicted initiation codon.

A BLAST search of the human genome database showed that this full-length sequence is located on human chromosome 7 at 7p13 and is comprised of 17 putative exons. Comparison of this protein with hZimp10 showed that they share more than 71% sequence similarity, particularly in the C-terminal region (Fig. 1AGo). Further analysis of the protein sequence revealed that it contains several functional domains, including a Miz zinc finger, a nuclear localization signal (NLS), and a proline-rich region (see Fig. 3CGo). A high degree of sequence similarity was observed when this clone was aligned with the Miz domains of other PIAS proteins (Fig. 1BGo). Based on these features, we named this protein hZimp7 (human zinc finger containing, Miz1, PIAS-like protein on chromosome 7).



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of hZimp7, hZimp10, and Other PIAS Proteins

A, Alignment of hZimp7 and hZimp10 amino acid sequences, GenBank accession nos AY426594 and AY235683, respectively. Both identical and similar amino acids are marked. B, Alignment of the Miz zinc finger domain of hZimp7 with those of other PIAS and PIAS-like proteins. Letters in bold correspond to identical amino acids. The consensus sequence of Miz finger is shown.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. Specific Interaction between hZimp7 and AR

A, A schematic representation of the yeast two-hybrid assay for mapping the interaction between the AR and hZimp7 proteins. B, The cDNA fragments containing different portions of the human AR were fused to the GAL4-DBD in the pGBT9 vector. Numbers correspond to amino acid residues. The pACT2-hZimp7 containing the fusion protein of VP16-TAD and hZimp7 was cotransformed with pGBT9 vector alone or different pGBT9-AR constructs. Transformed cells were plated on SD-Ade-Leu-Trp plates and SD-Leu-Trp plates to monitor transformation efficiency. Three independent colonies were inoculated from each transformation experiment for subsequent liquid ß-gal assays. The data for the liquid ß-gal assays are shown as the mean ± SD. C, Different truncation mutants of hZimp7 were generated by fusing portions of the hZimp7 sequence to the TAD of VP16 in the pACT2 vector and were cotransformed with the pGBT9-AR/pTAD1. Transformants were selected and analyzed as described in the above experiments. D, CV-1 cells were transiently cotransfected with AR and FLAG-tagged hZimp7. Equal amounts of whole-cell lysates were blotted with AR or FLAG antibody to detect expression levels of the two proteins (input) or subjected to immunoprecipitation (IP) with normal mouse IgG or anti-FLAG monoclonal antibody. The precipitated fractions were then resolved by SDS-PAGE and analyzed by Western blot (IB) using anti-FLAG or anti-AR antibody (Ab). HR, Hinge region; LBD, ligand-binding domain.

 
hZimp7 Is Selectively Expressed in Human Testis, Heart, Brain, Pancreas, Prostate, and Ovary
Northern blot analysis was carried out to examine the expression of hZimp7 in human tissues. A cDNA fragment encoding the N-terminal region (amino acids 1–316) of hZimp7 was used as the probe, and a ß-actin probe was used to control for RNA loading. An approximately 4.2-kb transcript was detected by the hZimp7 probe in various human tissues (Fig. 2AGo). To precisely assess the expression of hZimp7, we measured the mean intensity of the hZimp7 and ß-actin transcripts by densitometry (Fig. 2BGo). The transcript of hZimp7 was detected most abundantly in testis and at modest levels in heart, brain, pancreas, prostate, and ovary. There was little or no detectable signal in other human tissues. Interestingly, the expression profile of hZimp7 in human tissues is different from our previous observation with hZimp10 (1).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2. Expression of hZimp7 in Human Tissues

A, Multiple human tissue blots were hybridized with an hZimp7 probe covering the N-terminal region between amino acids 1–316. The blots were reprobed for ß-actin to control for equal loading. B, Relative densities (signals of the hZimp7 probe divided by those of ß-actin), were used to measure the expression levels.

 
hZimp7 Is an AR-Interacting Protein
Because hZimp10, a homolog of hZimp7, was previously identified as an AR-interacting protein (1), we performed yeast two-hybrid assays to assess a possible interaction between the AR and hZimp7. We cotransformed full-length hZimp7 in a VP16-containing vector (pACT2) with various constructs containing either a GAL4 DBD alone or with various fusions of different fragments of AR into the modified yeast strain PJ69–4A (25) (Fig. 3AGo). A liquid ß-galactosidase (ß-gal) assay was performed to quantify the interactions. The AR/pTAD1 construct containing the partial TAD (amino acids 1–333) showed an approximately 23-fold induction compared with pVP16 alone. However, the AR/TAD2 (amino acids 1–243) showed virtually no interaction with hZimp7, suggesting that the region between amino acids 243–333 is critical for the interaction. In addition, in the presence of 100 nM dihydrotestosterone (DHT), the ligand-binding domain of AR showed approximately 4-fold induction compared with samples in which no DHT was added. No significant production of ß-gal was observed in samples cotransformed with hZimp7 and the AR-DBD. As observed in our previous experiments with hZimp10, we found that the region between amino acids 243–333 in the TAD of the AR is required for the interaction with hZimp7.

The central region of hZimp10 (amino acids 556–790) has been shown to be responsible for binding to AR (1). This region shares significant sequence similarity with hZimp7 between amino acids 386–621(Fig. 1BGo). Based on this feature, we made a series of deletion mutants to determine whether the region between amino acids 386–621 is required for interacting with the AR (Fig. 3CGo). No interaction was observed between the AR and the truncated mutants of hZimp7 (1–435, 506–643, and 581–892) (Fig. 3CGo). In contrast, full-length hZimp7 and two deletion mutants, hZimp7 (310–892) and hZimp7 (310–700), which possess the entire region between amino acids 386–621, showed interactions with the AR. An additional mutant that contains the central region of the protein (amino acids 392–527) was generated and used to further map the precise interaction region of hZimp7. As expected, this mutant showed the highest ß-gal activity, indicating that the central region between amino acids 435–506 may be the primary binding region for AR (Fig. 3CGo).

To confirm the interaction between hZimp7 and the AR in vivo, we tagged hZimp7 at its amino terminus with a FLAG epitope and expressed the tagged protein together with the AR in CV-1 cells. Both AR and FLAG-hZimp7 proteins were detected in the transfected cells (Fig. 3DGo, top panels). Whole cell lysates containing equal amounts of overexpressed proteins were immunoprecipitated with normal mouse IgG or an anti-FLAG monoclonal antibody. As shown in Fig. 3DGo, the AR protein was detected only in immunoprecipitates in which the FLAG antibody was used, indicating that the AR protein forms a protein complex with FLAG-hZimp7. These data suggest that the AR and hZimp7 interact in mammalian cells.

hZimp7 Protein Is Expressed in the Nuclei of Prostate Epithelial Cells and Colocalizes with the AR Protein
To further explore the potential biological role of hZimp7, we examined the expression of hZimp7 in human prostate tissues by immunohistochemistry. The human prostate tissues used in our experiments were collected from normal prostate, benign prostatic hyperplasia, and prostate cancer samples obtained by radical prostatectomy. Two adjacent sections from three individual tissue samples were stained with either an anti-AR or anti-hZimp7 antibody directed against the N terminus of the protein. As reported previously, AR was found exclusively in the nuclei of prostate epithelial cells (Fig. 4Go, A, C, and E). hZimp7 protein also showed a strong nuclear staining pattern in normal and malignant prostate epithelial cells (Fig. 4Go, B, D, and F). There was no, or very weak, staining in the stromal elements with either antibody in all samples examined. Similar results were also obtained using another hZimp7 antibody directed against the C-terminal region (data not shown). As shown in Fig. 4Go, a clear costaining of AR and hZimp7 proteins was found in the nucleus of prostate epithelial cells. The above data demonstrate that endogenous AR and hZimp7 proteins are both expressed in the nuclei of human prostate cells, suggesting that they may interact in vivo. Consistent with our immunohistochemical staining results, endogenous hZimp7 was also detected in the nuclei of LNCaP prostate cancer cells using immunofluorescent staining (data not shown).



View larger version (162K):
[in this window]
[in a new window]
 
Fig. 4. hZimp7 and the AR Colocalize in Prostate Epithelial Cells

Three pairs of paraffin-embedded human prostate tissue samples (A–F) were stained with either anti-AR (left panel) or anti-hZimp7 (right panel) antibodies. Color was developed with DAB in PBS. All sections used for immunohistochemistry were lightly counterstained with 5% (wt/vol) Harris hematoxylin.

 
hZimp7 Contains a Strong TAD
The C-terminal sequences of hZimp7 and hZimp10 are very similar (Fig. 1BGo), and a strong TAD has been identified at the C-terminal region of hZimp10 (1). Based on these observations, we investigated a possible role for hZimp7 in transcription. Fragments containing full-length or various N-terminal truncation mutants of hZimp7 were targeted to DNA by fusion with the GAL4 DBD. These constructs were then tested for their abilities to modulate transcription from a minimal promoter, derived from the chicken myelomonocytic growth factor gene (–41 to +61), driving transcription of a luciferase reporter (26).

Fusion of the GAL4 DBD to full-length hZimp7 showed an approximately 4-fold induction compared with the GAL4 DBD alone, and deletions of the N-terminal region between amino acids 1–377 did not significantly affect the activity (Fig. 5Go). However, removal of amino acids 377–512 elevated the activity. The truncated mutants containing the C-terminal region (amino acids 512–892) showed 80-fold more transcriptional activity than that of the full-length hZimp7 construct, and deletion of the NLS and Miz domains significantly reduced the transcriptional activity. Moreover, the N-terminal fragment (amino acids 1–619) showed no transcriptional activity. Taken together, these results suggest that the C terminus of hZimp7 containing the NLS, Miz domain, and proline-rich region possesses strong transcription activity.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. Detection of Intrinsic Transcriptional Activity of hZimp7

Full-length or truncated fragments of hZimp7 were fused to the GAL4 DBD in the pM expression vector. Numbers correspond to amino acid residues. CV-1 cells were cotransfected with the pM constructs, luciferase reporter constructs containing the chicken myelomonocytic growth factor gene minimal promoter (–41 to +61) containing GAL4 binding sites, and a constitutive ß-gal reporter. Data are presented in RLUs, which were obtained by normalizing the activities of luciferase to those of ß-gal. Individual transfection experiments were done in triplicate, and the results are reported as the mean ± SD from representative experiments.

 
hZimp7 Functions as a Transcriptional Coactivator
Next, we investigated whether hZimp7 enhances AR-mediated transcription. Transient transfection experiments were first carried out in LNCaP, an AR-positive cell line. A luciferase reporter driven by the 7-kb promoter of the prostate-specific antigen (PSA) gene (27) was cotransfected with hZimp7, or hZimp10 as a control. In the presence of 1 or 10 nM DHT, ligand-dependent transactivation mediated by endogenous AR was observed (Fig. 6AGo). Cotransfection with hZimp7 or hZimp10 expression constructs further augmented AR activity (Fig. 6AGo). Of note, cells transfected with hZimp7 showed approximately 35–45% more luciferase activity than those transfected with hZimp10. These results provide the first line of evidence that hZimp7 functions as a coactivator of AR and is able to enhance AR-mediated transcription.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. hZimp7 Enhances AR and Other Nuclear Hormone Receptor-Mediated Transcription

A, LNCaP cells were transfected with a luciferase reporter driven by the human PSA promoter (100 ng), pcDNA3-ß-gal (25 ng), and different amounts of pcDNA3-FLAG-hZimp7 or -hZimp10 as indicated. Cells were incubated 24 h after transfection in the presence or absence of DHT for 24 h. Cell lysates were then prepared for assessment of luciferase and ß-gal activities. B, MMTV-Luc (100 ng) and expression vectors for different steroid hormone receptors were transfected with or without hZimp7 into CV-1 cells. Cells were cultured for 24 h in the presence or absence of specific ligands for each receptor, including 10 nM DHT, dexamethasone, and progesterone. C, Luciferase reporters (100 ng) driven by different response elements, as labeled in the figure, were cotransfected with 50 ng of pSV40-ß-gal, 10 ng of different receptors, and 0 or 20 ng of pcDNA3-FLAG-hZimp7 into CV-1 cells. Cells were cultured in the presence or absence of the specific ligands to each receptor, including 10 nM DHT, 10 nM 1{alpha}25-dihydroxyvitamin D3, 100 nM ß-estradiol, and 10 nM triiodothyronine. Cell lysates were measured for luciferase and ß-gal activities as described above. D, LNCaP cells were infected with lentivirus containing hZimp7 shRNA or vector control and selected with blasticidin for stable integrants. Cells were then transfected with PSA-luc (100 ng) and pcDNA3-ß-gal (25 ng). Cells were stimulated 24 h after transfection with 10 nM DHT for 24 h. Lysates were collected and luciferase and ß-gal activities were determined as described above. E, A schematic representation of the truncated hZimp7 constructs was shown. Numbers correspond to amino acid residues. F, PSA luciferase reporters (100 ng) were cotransfected with 25 ng of pSV40-ß-gal, 5 ng of AR expression vector (pSVAR), and 20 ng of pcDNA3-FLAG-hZimp7 in the presence of 20 ng of different truncated hZimp7 plasmids into CV-1 cells. Cell lysates were collected and measured for luciferase and ß-gal activities as described above. ERE, Estrogen response element; MMTV, mouse mammary tumor virus; TRE, thyroid response element; VDRE, vitamin D response element.

 
The specificity of hZimp7-mediated augmentation was further investigated with other nuclear receptors, including the glucocorticoid receptor (GR), progesterone receptor ß (PRß), estrogen receptor {alpha} (ER{alpha}), thyroid receptor ß (TRß), and vitamin D receptor (VDR). We first examined whether hZimp7 could enhance the activity of the AR, GR, and PRß. To limit experimental variation, we used a luciferase promoter containing the mouse mammary tumor virus promoter, which can be activated by all three receptors (28, 29). In CV-1 cells, we observed that hZimp7 augments AR-mediated transcription on the mouse mammary tumor virus promoter, but has no effect on GR or PRß activity (Fig. 6BGo). The effect of hZimp7 on transcription was further investigated with other nuclear receptors. As shown in Fig. 6CGo, hZimp7 enhances AR-mediated transcription from a luciferase reporter driven by a minimal promoter containing two AREs. However, hZimp7 also augments VDR, ER{alpha}, and TRß-mediated transcription from the promoters driven by their corresponding responsive elements. These results suggest that hZimp7 functions as a transcriptional coactivator to augment AR and other nuclear hormone receptor-mediated transcription.

To further examine the enhancement of hZimp7 in a biologically relevant manner, we knocked down endogenous hZimp7 expression in LNCaP cells with a lentivirus containing an hZimp7-specific small hairpin RNA (shRNA). Because the lentiviral vector also expressed a blasticidin resistance gene, cells infected with the hZimp7 shRNA or vector alone were selected with blasticidin, and AR-mediated transcription was then assessed using the PSA-luciferase reporter. As shown in Fig. 6DGo, DHT-stimulated reporter activity was reduced approximately 50% in cells infected with the hZimp7 shRNA virus when compared with vector control. These data provide an additional line of evidence to demonstrate the biological role of hZimp7 in AR-mediated transcription.

To further study whether the effect of hZimp7 on AR is through an interaction between the two proteins, we made several truncated mutants of hZimp7 and tested their abilities to augment AR transcriptional activity (Fig. 6EGo). As observed previously, hZimp7 showed an enhancement on AR-mediated transcription (Fig. 6FGo). Cotransfection of the truncated hZimp7 constructs with the AR and full-length hZimp7 expression plasmids showed that the mutant, hZ7D2 (amino acids 392–527), covering the binding region for AR, inhibits the enhancement of AR activity by full-length hZimp7 (Fig. 6FGo). These data demonstrate a dominantly negative effect of hZ7D2 mutant in hZimp7-mediated enhancement and provide an additional line of evidence that the interaction between hZimp7 and AR through this region is responsible for enhancement of AR activity.

hZimp7 Is Found at Cell Cycle-Regulated DNA Replication Foci throughout S Phase
Previous data have shown that hZimp10 is found at sites of DNA synthesis throughout all phases of DNA replication (1). Therefore, we systematically probed the nuclear distribution of hZimp7 during DNA replication by using immunofluorescence imaging. Cells were transfected with FLAG-hZimp7, synchronized in late G1 phase with mimosine, and then allowed to enter S phase (30). Newly synthesized DNA was detected by bromodeoxyuridine (BrdU) labeling and staining with a fluorescein isothiocyanate-conjugated anti-BrdU antibody (Fig. 7AGo, left panel), and hZimp7 was detected using an anti-FLAG monoclonal antibody and a rhodamine-conjugated secondary antibody. A pattern of replication foci in synchronized cells was observed for hZimp7 during S-phase progression (Fig. 7AGo, middle panel). Replication foci changed from numerous small, punctate structures in early S-phase cells to large, toroidal structures in late S-phase cells. Intriguingly, hZimp7 displayed a similar pattern of nuclear distribution as the BrdU-labeled DNA and colocalized with BrdU throughout S phase (Fig. 7AGo, right panel). Next, we costained hZimp7 with PCNA (proliferating cell nuclear antigen) to confirm the localization of hZimp7 at DNA replication foci. As shown in Fig. 7BGo, we observed similar staining patterns for PCNA and hZimp7 throughout S phase. Taken together, our results demonstrate that like hZimp10, hZimp7 localizes to sites of DNA synthesis throughout all phases of DNA replication, implying that hZimp7 may play a role in DNA synthesis and chromatin modification.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7. Immunofluorescent Colocalization of hZimp7 and AR at Sites of DNA Replication throughout S Phase

A, pcDNA3-FLAG-hZimp7 (F-hZimp7) was transfected into CV-1 cells. Cells were then synchronized with 0.5 mM mimosine (see Materials and Methods). Representative confocal laser scanning microscopy images from cells expressing FLAG-tagged hZimp7 proteins and pulsed with BrdU are shown. Cells were immunostained with either a fluorescein isothiocyanate (FITC)-conjugated monoclonal anti-BrdU antibody (green) or an anti-FLAG primary antibody followed by a rhodamine-conjugated secondary antibody (red). Merge (right panel) of left and middle panels indicates areas of colocalization (yellow). B, The above experiments were repeated. Overexpressed hZimp7 or endogenous PCNA proteins were detected by anti-FLAG or PCNA antibody followed by FITC or rhodamine-conjugated secondary antibodies as labeled in the figure. C, CV-1 cells cotransfected with pcDNA3-FLAG-hZimp7 and pSVARo were synchronized with mimosine. Double immunostaining was conducted with anti-FLAG monoclonal and anti-AR polyclonal antibodies, followed by secondary antibodies conjugated with FITC (green) or rhodamine (red), respectively. Merged images demonstrating colocalization of proteins are shown in the right panels (yellow). D, As described above, LNCaP cells growing on chamber slides were fixed with 4% paraformaldehyde, permeabilized, and incubated with antibodies against hZimp7 and the AR. Species-specific Alexafluor 488 (green) and 594 (red) antibodies were used to detect hZimp7 and AR, respectively. Left panels indicate hZimp7 localization, middle panels indicate AR localization, and right panels are merged images showing areas of hZimp7-AR overlap.

 
hZimp7 Colocalizes with the AR during Cell Cycle Progression
Next, we examined whether hZimp7 colocalized with the AR during cell cycle progression. As described previously, cells were synchronized in late G1 phase with mimosine and then allowed to progress through S phase. In cells synchronized in late G1 phase, both the AR and FLAG-hZimp7 showed diffuse nuclear staining (Fig. 7CGo). When merged, these staining patterns showed a considerable amount of overlap (yellow) throughout the nucleus, suggesting that the proteins colocalize during G1 phase. When the cells were allowed to progress into S phase, FLAG-hZimp7 became associated with the distinctive small punctate structures of early S phase replication foci, whereas a portion of AR protein retained a diffuse nuclear staining pattern (Fig. 7CGo; 0 and 4 h). When the cells progressed further into S phase, FLAG-hZimp7 displayed the slightly larger punctate staining indicative of mid-S phase (Fig. 7CGo; 8 and 12 h), and then the large, toroidal replication foci characteristic of late S phase (Fig. 7CGo; 18 h). A significant amount of overlap between FLAG-hZimp7 and AR was observed throughout S phase. Next, we costained both endogenous AR and hZimp7 proteins in LNCaP. As shown in Fig. 7DGo, both AR and hZimp7 proteins are localized in the nuclei, and a significant amount of overlay between these two proteins was observed. These data are consistent with our previous observation in CV-1 cells and suggest that hZimp7 colocalizes with the AR at replication foci.

hZimp7 Interacts with the Mammalian SWI/SNF-Like BAF Complexes
One of the mechanisms by which coregulators modulate nuclear hormone receptors is through modification of chromatin. The Drosophila ortholog of hZimp7 and 10, tonalli (tna), has been shown to genetically interact with the SWI2/SNF and Mediator chromatin-remodeling complexes (24). Thus, we performed immunoprecipitation experiments to assess the potential interaction between hZimp7 and mammalian SWI/SNF-like BAF complexes (31). Expression constructs of FLAG-hZimp7 and Brg1, a component of SWI/SNF-like BAF complexes, were cotransfected into CV-1 cells. Nuclear extracts containing equal amounts of hZimp7 protein were immunoprecipitated with normal mouse IgG or an anti-FLAG monoclonal antibody. As shown in Fig. 8AGo, FLAG-hZimp7 protein was detected in immunoprecipitates where the FLAG antibody was used. Importantly, the Brg1 protein was also detected in the same immunoprecipitates, suggesting a protein-protein interaction between hZimp7 and Brg1. An interaction between hZimp7 and BAF57, a Brg1-associated protein, was also demonstrated using the same procedure (Fig. 8BGo). These data provide the first line of evidence that hZimp7 interacts with Brg1 and BAF57, members of the mammalian SWI/SNF-like BAF chromatin-remodeling complexes.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8. hZimp7 Interacts with Components of the SWI/SNF Protein Complex

A and B, CV-1 cells were cotransfected with pcDNA3-FLAG-hZimp7 and Brg-1 or BAF57 expression constructs. After 48 h incubation, nuclear extracts were prepared. Equal amounts of nuclear extracts were subjected to immunoprecipitation with equal amounts of normal mouse IgG or anti-FLAG antibody. Proteins were resolved by SDS-PAGE and immunoblotted with antibodies to FLAG, Brg-1 (panel A), or BAF57 (panel B). C, CV-1 cells were grown in 48-well plates and cotransfected with 100 ng of PSA-luc reporter, 50 ng of pSV40-ß-gal, 10 ng of hAR, and 5 ng of pcDNA3-FLAG-hZimp7, with 20 ng of either Brg-1 or BAF-57 expression plasmid. After a 48-h incubation, cells were harvested and luciferase and ß-gal activities were measured, and RLUs were calculated. Individual transfection experiments were carried out in triplicate, and the results from representative experiments are reported as the mean ± SD. D, LNCaP cells were transfected with PSA-luc (100 ng), pcDNA3-ß-gal (25 ng), and 20 ng of hBrg1 and BAF57 in the presence or absence of an hZimp7 shRNA construct. Cells were stimulated 24 h after transfection with 1 nM DHT for 24 h. Lysates were collected, and luciferase and ß-gal activities were determined as described above. IB, Immunoblot; IP, immunoprecipitation.

 
Finally, we tested whether hZimp7 is involved in Brg1 and hBAF57-mediated enhancement of AR activity. Transfection of the AR expression construct with a luciferase reporter driven by the 7-kb PSA promoter showed a clear ligand-dependent enhancement of reporter activity (Fig. 8CGo), and overexpression of hZimp7 further enhanced AR-mediated transcription. Importantly, cotransfection of either human Brg1 or BAF57 augmented the activity of AR significantly in the presence of hZimp7 but showed no effect in the absence of hZimp7, suggesting an involvement of hZimp7 in hBrg1- and BAF57-mediated enhancement of AR activity. Next, we further examined the involvement of endogenous hZimp7 in hBrg1 and BAF57 using a RNA interference approach. As shown in Fig. 8DGo, knockdown of endogenous hZimp7 using an shRNA construct of hZimp7 reduces the enhancement of Brg1 and BAF57 on AR-mediated transcription in LNCaP cells. Taken together, these data demonstrate that BRG1 and BAF57 may cooperate with hZimp7 to enhance AR-mediated transcription.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
hZimp7 is a novel PIAS-like protein that shares high sequence similarity with hZimp10. Because hZimp10 has been suggested to be an AR coactivator, in this study we first tested whether hZimp7 also interacts with the AR and augments AR-mediated transcription. Using immunoprecipitation assays, we demonstrated that the AR interacts with hZimp7 to form a protein complex in cells. In addition, we showed that the region between amino acids 243 and 333 within the TAD of the AR and the central region of hZimp7 between amino acids 435 and 506 are necessary and sufficient for the interaction using yeast two-hybrid analysis. To investigate the functional consequence of the hZimp7-AR interaction, we performed transient transfection assays and demonstrated that hZimp7 augments the ligand-dependent activity of the AR on both the natural AR-dependent promoter from the PSA gene and on a minimal promoter containing only two AREs. Consistent with the idea that hZimp7 is an AR coactivator, reduction of hZimp7 expression reduced endogenous AR-mediated transcription by approximately 50% in the human prostate cancer cell line, LNCaP. Taken together, these data show that, like hZimp10, hZimp7 interacts with the AR and enhances AR-mediated transactivation.

Sequence analysis showed that hZimp7 shares high sequence similarity with hZimp10. Both of these proteins contain a central Miz finger and a C-terminal proline-rich domain. Fusing the full-length protein and a series of truncation mutants of hZimp7 to the DBD of GAL4, we demonstrated that the C terminus of hZimp7, which contains the NLS, Miz, and proline-rich domains, possesses significant, intrinsic transcriptional activity. Intriguingly, the transactivation activity of hZimp7 is much higher than that of other transcription factors, such as p53, Smad, ER, and AR, and is even comparable to transactivation by the TAD of VP16. These results, combined with our previous observations with hZimp10, suggest that hZimp7 and hZimp10 may function as transcriptional coactivators through their intrinsic TADs. Identification of the intrinsic transcriptional activation domains in hZimp7 and hZimp10 also suggests a unique and distinctive role of these two proteins from other PIAS proteins in transcriptional regulation. In this study, we also examined whether hZimp7 enhances or represses the activity of other nuclear hormone receptors. Interestingly, aside from acting as an AR coactivator, hZimp7 was also shown to augment TRß, ER{alpha}, and VDR-mediated transcription to varying degrees. This result suggests that hZimp7 may act more broadly than hZimp10 in modulating nuclear hormone receptor-mediated transcription.

As we observed previously with hZimp10 (1), the full-length hZimp7 displays very limited activity compared with the truncated mutants containing the C-terminal proline-rich domain. Using a series of deletion mutants, we identified that the N terminus of hZimp7 (amino acids 1–512) significantly inhibits the activity of the C-terminal proline-rich region. Currently, the molecular mechanism(s) of this autoinhibition is unknown. The autoinhibitory effects in both hZimp7 and hZimp10 suggest that a similar mechanism may be involved in the regulation of these two PIAS-like proteins. Further investigation into the mechanism(s) by which hZimp7 and hZimp10 are released from this inhibition will be extremely important for understanding the in vivo function of these hZimp proteins.

Using the N-terminal fragment of hZimp7, the nucleotide sequence of which is very distinct from hZimp10 and other PIAS, we assessed the expression of hZimp7 in human tissues by Northern blotting. Interestingly, hZimp7 and hZimp10 show different tissue distribution profiles (1). hZimp7 is highly expressed in testis, whereas hZimp10 was detected most abundantly in ovary. The different expression profiles of hZimp7 and hZimp10 may implicate specific roles for these proteins in different human tissues. Identification of targets for hZimp10 and hZimp7 may help us to better elucidate the functional differences between these two related proteins.

Multiple members of the PIAS protein family have been shown to be capable of interacting with the AR and other nuclear hormone receptors and to regulate their activities (3). PIASx{alpha} was originally identified as an AR-interacting protein, named AR-interacting protein 3 (23). PIAS and PIAS-like proteins share a conserved Miz domain in their central regions important for interactions with target proteins (10). Previously, we demonstrated that the central region of hZimp10, which contains the Miz finger, is involved in the interaction with the AR (1). In this study, we used several truncation mutants of hZimp7 to map the interaction region for binding to the AR. We showed that the region between amino acids 392–527, rather than the Miz region, is required for the interaction. Interestingly, this region is highly conserved between both hZimp7 and hZimp10. Recently, using a comparable construct, we further confirmed that a similar region in hZimp10 displayed strong AR binding (data not shown).

In this study, we show that hZimp7 colocalizes with newly synthesized DNA and PCNA at replication foci throughout S phase. In eukaryotic cells, newly synthesized DNA must be rapidly assembled into the proper chromatin configuration to form transcriptionally active (euchromatin) and inactive domains (heterochromatin), respectively (32, 33). These data suggest a possible role of hZimp7 in both chromatin assembly and maintenance of chromatin. A homolog of hZimp7 and hZimp10, termed tonalli (tna), was identified recently in Drosophila (24). Intriguingly, the protein encoded by tna was shown to interact with SWI2/SNF2 and the Mediator complex. In this study, we examined the possible interaction between hZimp7 and the mammalian SWI/SNF-like BAF complexes (31). Using immunoprecipitation assays, we demonstrated that hZimp7 interacts with both Brg1 and BAF57, the DNA-binding subunits of the above complexes (34). Moreover, cotransfection of Brg1 or BAF57 with hZimp7 enhanced AR-mediated transcription to a greater extent than with either protein alone. Furthermore, knockdown of endogenous hZimp7 reduced the augmentation of Brg1 and BAF57 on AR-meditated transcription. These data provide the first link between hZimp7 and the human SWI/SNF-like BAF complexes. Unlike the yeast SWI/SNF complex, which is monomorphic, the mammalian BAF complexes contain several subunits that are coexpressed in the same cell, thus leading to their combinatorial assembly and the generation of perhaps hundreds of complexes (35). Identification of the interaction between hZimp7 and the components of BAF complexes suggests a role for hZimp7 in BAF complex-modulated transcription, which may further contribute to the heterogeneity of these complexes.

Modification of chromatin by different mechanisms, such as acetylation, methylation, phosphorylation, and ubiquitination, plays important roles in the regulation of chromatin structure to either foster or inhibit transcription (36). Recently, PIAS proteins-mediated sumoylation was also implicated in this regulatory process (37, 38). Although the precise role of PIAS proteins in the modulation of chromatin is unclear, it has been shown that PIAS proteins can recruit SUMO and Ubc 9 onto chromatin (37). Previously, we also demonstrated the colocalization of hZimp10 and SUMO-1 at replication foci (1). In this study, we observed that hZimp7 colocalizes with AR and SUMO-1 at replication foci (data not shown). However, hZimp7 does not directly affect AR sumoylation. Our observations suggest that hZimp7 not only directly enhances AR-mediated transcription but also participates other regulatory processes, possibly through modulating chromatin and/or recruiting other transcriptional factors such as AR onto chromatin. In both regards, it will be very interesting and worthwhile to further characterize the interaction between AR and hZimp7 at replication foci.

In conclusion, we have identified another novel PIAS-like protein, hZimp7. Multiple lines of evidence provided in this study suggest that hZimp7, like hZimp10, functions as a transcriptional coregulator to modify the activity of the AR and, probably, other nuclear hormone receptors. Intriguingly, we have also demonstrated that hZimp7 interacts with the mammalian SWI/SNF-like BAF complexes, suggesting a potential important role for hZimp7 in chromatin modification and transcriptional regulation. Further studies on the role of hZimp7 in transcription should provide new insight into the biology of PIAS and PIAS-like proteins.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Construction
Full-length hZimp7 cDNA was created by combining the cDNA fragment isolated by 5'-RACE (1–237 amino acids) and the KIAA 1886 fragment (238–892 amino acids) in the pcDNA3 vector either with or without an amino-terminal FLAG epitope tag (39). Subsequently, truncated mutants of hZimp7 were generated from the full-length clone in the pM vector containing a GAL4 DBD, the pVP16 vector containing the transcriptional activation domain of VP16, and the pcDNA3 expression vector.

The human AR expression vector, pSV-hAR, was kindly provided by Dr. Albert Brinkmann (Erasmus University, Rotterdam, The Netherlands). A simian virus 40-driven ß-gal reporter plasmid (pSV-ß-GAL) was purchased from Promega Corp. (Madison, WI). The human ER{alpha} expression construct and pERE-luc plasmid were generously supplied by Dr. Myles Brown (Dana-Farber Cancer Institute, Boston, MA). A human PRß construct and the PRE-luc reporter were provided by Dr. Kathryn B. Horwitz (University of Colorado, Boulder, CO). The expression constructs of human GR and VDR and the pVDRE-luc reporter plasmid were the kind gifts of Dr. David Feldman (Stanford University, Stanford, CA). The pARE-luc reporter was the kind gift of Dr. Chawnshang Chang (40). The pPSA7kb-luc was kindly provided by Dr. Jan Trapman (41). The human Brg1 and BAF57 expression vectors were gifts from Dr. Gerald Crabtree (Stanford University). The lentiviral construct of hZimp7 shRNA was generated as described previously (42). A 22-mer sequence (GGGCAGCAGCAGCAGTTCTCAA) for the hZimp7 transcript was introduced into the pBS/U6 vector to generate the hZimp7 shRNA (43). Subsequently, the U6 promoter and the hZimp7 shRNA were PCR amplified and transferred into the pLentiSuper vector (Invitrogen, Carlsbad, CA). The viral vector was cotransfected with other packaging plasmids into human embryonic kidney 293T cells to produce the hZimp7 lentivirus (42).

Yeast Two-Hybrid System
Yeast two-hybrid experiments were performed as described previously (44). The DNA fragments containing the various truncation mutants of AR were fused in frame to the GAL4 DBD in the pGBT9 vector (CLONTECH Laboratories, Inc., Palo Alto, CA). Different hZimp7 mutants were fused to the GAL4 TAD in the pACT2 vector (CLONTECH). The constructs were transformed into the modified yeast strain PJ69–4A (25). Transformants were selected on Sabouraud Dextrose medium lacking tryptophan, leucine, and/or adenine. The specificity of interaction with the AR was measured by a liquid ß-gal assay as described previously (44).

Cell Culture and Transfection
The monkey kidney cell line, CV-1, was maintained in DMEM supplemented with 5% fetal bovine serum (HyClone Laboratories, Inc., South Logan, UT). An AR-positive prostate cancer cell line, LNCaP, was maintained in T medium (Life Technologies, Inc., Gaithersburg, MD) with 5% fetal bovine serum (FBS). A LNCaP variant stably expressing hZimp7 shRNA was generated by infecting with a hZimp7shRNA-containing lentivirus and selecting for infected cells with 10 µg/ml blasticidin. A cell line expressing the lentiviral vector alone was generated as a negative control. Transient transfections were carried out using LipofectAMINE for CV-1 cells, and LipofectAMINE 2000 for LNCaP cells (Invitrogen, Carlsbad, CA). For reporter assays, approximately 1.5–2 x 104 cells were plated in a 48-well plate 16 h before transfection. Twelve to sixteen hours after transfection, the cells were washed and fed medium containing 5% charcoal-stripped FBS (HyClone) in the presence or absence of ligands. Cells were incubated for another 24 h, and luciferase activity was measured as relative light units (RLUs) (45). The RLUs from individual transfections were normalized by measuring the activity of a cotransfected constitutive ß-gal reporter in the same samples. Individual transfection experiments were done in triplicate, and the results were reported as mean RLU/ß-gal (±SD).

Northern Blot Analysis
Blots with RNA from multiple human tissues were obtained from CLONTECH Laboratories, Inc., and hybridized to DNA fragments specific for the N-terminal region (amino acids 1–316) of hZimp7. ß-Actin was used to normalize loading.

Preparation of Whole-Cell Lysates and Nuclear Extracts
To make the whole-cell lysates, cells were washed with PBS and resuspended in RIPA buffer [1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 50 mM NaF, 0.2 mM Na3VO4, 0.5 mM dithiothreitol (DTT), 150 mM NaCl, 2 mM EDTA, 10 mM sodium phosphate buffer (pH 7.2)]. Nuclear extracts were prepared according to the method of Dignam et al. (46) with minor modifications. Briefly, cells were washed with PBS, mechanically disrupted by scraping into homogenization buffer A (10 mM HEPES, pH 7.9; 10 mM KCl; 1.5 mM MgCl2; 0.5 mM DTT; and 0.5 mM phenylmethylsulfonylfluoride), and incubated on ice for 10 min. Cells were further disrupted by 10 strokes with a homogenizer and centrifuged at 15,000 rpm for 20 min. The pellet was resuspended in buffer containing 20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonylfluoride, and 25% glycerol, and then homogenized with 10 strokes. The lysate was incubated on ice for 30 min and centrifuged for 10 min at 15,000 rpm. The supernatant was saved and analyzed as the nuclear fraction.

Immunoprecipitation and Western Blotting
Whole-cell lysates or nuclear extracts were first precleared with Protein A Sepharose beads for 1 h and then incubated with mouse or rabbit normal IgG or specific antibodies conjugated with preequilibrated Protein A Sepharose beads at 4 C for 2 h. The beads were collected by centrifugation and gently washed three times with the same buffer as described above. Proteins were eluted by boiling in sodium dodecyl sulfate-sample buffer, resolved on 10% polyacrylamide gels, and transferred onto nitrocellulose membranes. Membranes were then blocked with 5% milk in Tris-buffered saline-Tween 20 for 1 h, and then probed with anti-AR (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-Brg-1, or anti-BAF57 specific antibody (provided by G. Crabtree, Stanford University), followed by incubation with species-specific horseradish peroxidase-conjugated antibodies.

Antibody Production
The N-terminal region (amino acids 277–363) or C-terminal region (amino acids 714–824) of hZimp7 was cloned into the pGEX-4T1 vector, and glutathione-S-transferase fusion proteins were generated as described previously (1). These glutathione-S-transferase fusions were then used as a source of antigen for antibody production. Rabbit polyclonal, affinity-purified antibodies were produced by Proteintech Group, Inc. (Chicago, IL). Antibody specificity was confirmed by Western blot and ELISA assay.

Cell Synchronization, BrdU Labeling, and Immunofluoresence
Experiments were performed as described previously (1). A FLAG-tagged hZimp7 cDNA-containing vector was transfected with pSV-hAR into CV-1 cells using the LipofectAMINE-plus reagent (Invitrogen). Synchronization was carried out as described by Krude (30). Briefly, at 18 h posttransfection, cells were treated with 0.5 mM mimosine (Sigma Chemical Co., St. Louis, MO) in DMEM supplemented with 10% FBS for 24 h to arrest cells in late G1 phase. Cells were released from the mimosine block by washing three times with PBS and incubating in fresh DMEM containing 10% FBS at 37 C, which allowed the growth-arrested cells to progress synchronously through S phase.

For detection of DNA replication, cells were pulsed with 10 µM 5-BrdU (Sigma) and 1 µM fluorodeoxyuridine (Sigma) for 15min in the dark at 37 C to inhibit thymidylate synthetase. Cells were then washed twice with cold PBS and fixed with 3% formaldehyde for 30 min at room temperature. To visualize the newly synthesized DNA labeled with BrdU, the cells were treated with 4 N hydrochloric acid for 30 min at room temperature to denature the DNA, rinsed several times in Tris-buffered saline-Tween 20, and incubated at 37 C for 1 h with fluorescein isothiocyanate-conjugated monoclonal anti-BrdU antibody (PharMingen, San Diego, CA). For the cells cotransfected with different plasmids, specific primary antibodies and fluorescein isothiocyanate-conjugated anti-mouse or rhodamine-conjugated antirabbit secondary antibody were used (Molecular Probes, Inc., Eugene, OR). Images were acquired using a confocal microscope.

Immunohistochemical Staining
Human prostate tissues were fixed in 10% neutral-buffered formalin and processed to paraffin. Samples were cut into 3- to 5-µm sections, deparaffinized in xylene, and rehydrated using a decreasing ethanol gradient followed by PBS. Tissues were then blocked with 3% hydrogen peroxide in methanol and protein block for 60 min each to inhibit endogenous peroxidase activity and nonspecific antibody binding, respectively. Samples were exposed to a 1:500 dilution of rabbit polyclonal anti-hZimp7 antibody or anti-AR antibody (clone 441; Santa Cruz Biotechnology) in 1% goat serum overnight at 4 C. Slides were then incubated with biotinylated antirabbit/antimouse antibody solution (Biogenex, San Ramon, CA) and streptavidin peroxidase (Lab Vision, Fremont, CA) for 30 min each. Between each antibody step, slides were washed three times with PBS. Antibody staining was visualized with 3,3'-diaminobenzidine substrate solution (DAKO Corp., Carpinteria, CA) in PBS containing 0.3% hydrogen peroxide. Slides were subsequently counterstained with 5% (wt/vol) Harris hematoxylin.


    ACKNOWLEDGMENTS
 
We thank Drs. Albert Brinkmann, Kathryn B. Horwitz, Myles Brown, Chawnshang Chang, Jan Trapman, David Feldman, Donald Ayer, and Gerald Crabtree for the various reagents received. We thank Dr. Jorma Palvimo for critical reading of our manuscript.


    FOOTNOTES
 
This work was supported by National Institute of Health Grants CA70297, CA87767, and DK61002 (to Z.S.) and DK 47636 and 54417 (to B.L.), and the Department of Army Prostate Cancer Grant DAMD17-03-1-0090 (to Z.S.).

First Published Online July 28, 2005

Abbreviations: AR, Androgen receptor; ARE, androgen-responsive element; BrdU, bromodeoxyuridine; DBD, DNA-binding domain; DHT, dihydrotestosterone; DTT, dithiothreitol; ER{alpha}, estrogen receptor {alpha}; FBS, fetal bovine serum; GR, glucocorticoid receptor; hZimp10, human zinc finger containing, Miz1, PIAS-like protein on chromosome 10; Miz, msx-interacting zinc finger; NLS, nuclear localization signal; PCNA, proliferating cell nuclear antigen; PRß, progesterone receptor ß; PSA, prostate-specific antigen; ß-gal, ß-galactosidase; PIAS, protein inhibitor of activated STAT; RACE, rapid amplification of cDNA ends; RLU, relative light units; shRNA, short hairpin RNA; STAT, signal transducer and activator of transcription; SUMO, small ubiquitin-like modifier; TAD, transcription activation domain; TR, thyroid hormone receptor; VDR, vitamin D receptor.

Received for publication February 22, 2005. Accepted for publication July 20, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sharma M, Li X, Wang Y, Zamegar M, Huang CY, Palvimo JJ, Lim B, Sun Z 2003 hZimp10 is an androgen receptor co-activator and forms a complex with SUMO-1 at replication foci. EMBO J 22:6101–6114[CrossRef][Medline]
  2. Shuai K 2000 Modulation of STAT signaling by STAT-interacting proteins. Oncogene 19:2638–2644[CrossRef][Medline]
  3. Tan J, Hall SH, Hamil KG, Grossman G, Petrusz P, Liao J, Shuaki K, French FS 2000 Protein inhibitor of activated STAT-1 (signal transducer and activator of transcription-1) is a nuclear receptor coregulator expressed in human testis. Mol Endocrinol 14:14–26[Abstract/Free Full Text]
  4. Chung CD, Liao J, Liu B, Rao X, Jay P, Berta P, Shuai K 1997 Specific inhibition of Stat3 signal transduction by PIAS3. Science 278:1803–1805[Abstract/Free Full Text]
  5. Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, Shuai K 1998 Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci USA 95:10626–10631[Abstract/Free Full Text]
  6. Dobreva G, Dambacher J, Grosschedl R 2003 SUMO modification of a novel MAR-binding protein, SATB2, modulates immunoglobulin µ gene expression. Genes Dev 17:3048–3061[Abstract/Free Full Text]
  7. Jackson PK 2001 A new RING for SUMO: wrestling transcriptional responses into nuclear bodies with PIAS family E3 SUMO ligases. Genes Dev 15:3053–3058[Free Full Text]
  8. Megidish T, Xu JH, Xu CW 2002 Activation of p53 by protein inhibitor of activated Stat1 (PIAS1). J Biol Chem 277:8255–8259[Abstract/Free Full Text]
  9. Kotaja N, Vihinen M, Palvimo JJ, Janne OA 2002 Androgen receptor-interacting protein 3 and other PIAS proteins cooperate with glucocorticoid receptor-interacting protein 1 in steroid receptor-dependent signaling. J Biol Chem 277:17781–17788[Abstract/Free Full Text]
  10. Wu L, Wu H, Ma L, Sangiorgi F, Wu N, Bell JR, Lyons GE, Maxson R 1997 Miz1, a novel zinc finger transcription factor that interacts with Msx2 and enhances its affinity for DNA. Mech Dev 65:3–17[CrossRef][Medline]
  11. Schmidt D, Muller S 2003 PIAS/SUMO: new partners in transcriptional regulation. Cell Mol Life Sci 60:2561–2574[CrossRef][Medline]
  12. Hochstrasser M 2001 SP-RING for SUMO: new functions bloom for a ubiquitin-like protein. Cell 107:5–8[CrossRef][Medline]
  13. Kotaja N, Karvonen U, Janne OA, Palvimo JJ 2002 PIAS proteins modulate transcription factors by functioning as SUMO-1 ligases. Mol Cell Biol 22:5222–5234[Abstract/Free Full Text]
  14. Nishida T, Yasuda H 2002 PIAS1 and PIASx{alpha} function as SUMO-E3 ligases toward androgen receptor and repress androgen receptor-dependent transcription. J Biol Chem 277:41311–41317[Abstract/Free Full Text]
  15. Kahyo T, Nishida T, Yasuda H 2001 Involvement of PIAS1 in the sumoylation of tumor suppressor p53. Mol Cell 8:713–718[CrossRef][Medline]
  16. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  17. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract]
  18. Sanchez ER, Faber LE, Henzel WJ, Pratt WB 1990 The 56–59-kilodalton protein identified in untransformed steroid receptor complexes is a unique protein that exists in cytosol in a complex with both the 70- and 90-kilodalton heat shock proteins. Biochemistry 29:5145–5152[CrossRef][Medline]
  19. Sullivan WP, Vroman BT, Bauer VJ 1992 Isolation of steroid receptor binding protein from chicken oviduct and production of monoclonal antibodies. J Steroid Biochem Mol Biol 43:37–41[CrossRef][Medline]
  20. Jenster G 1999 The role of the androgen receptor in the development and progression of prostate cancer. Semin Oncol 26:407–421[Medline]
  21. Heinlein CA, Chang C 2002 The roles of androgen receptors and androgen-binding proteins in nongenomic androgen actions. Mol Endocrinol 16:2181–2187[Abstract/Free Full Text]
  22. Tan JA, Hall SH, Hamil KG, Grossman G, Petrusz P, French FS 2002 Protein inhibitors of activated STAT resemble scaffold attachment factors and function as interacting nuclear receptor coregulators. J Biol Chem 277:16993–17001[Abstract/Free Full Text]
  23. Moilanen AM, Karvonen U, Poukka H, Yan W, Toppari J, Janne OA, Palvimo JJ 1999 A testis-specific androgen receptor coregulator that belongs to a novel family of nuclear proteins. J Biol Chem 274:3700–3704[Abstract/Free Full Text]
  24. Gutierrez L, Zurita M, Kennison JA, Vazquez M 2003 The Drosophila trithorax group gene tonally (tna) interacts genetically with the Brahma remodeling complex and encodes an SP-RING finger protein. Development 130:343–354[Abstract/Free Full Text]
  25. James P, Halladay J, Craig EA 1996 Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425–1436[Abstract]
  26. Sterneck E, Muller C, Katz S, Leutz A 1992 Autocrine growth induced by kinase type oncogenes in myeloid cells requires AP-1 and NF-M, a myeloid specific, C/EBP-like factor. EMBO 11:115–126[Medline]
  27. Pang S, Dannull J, Kaboo R, Xie Y, Tso CL, Michel K, deKernion JB, Belldegrun AS 1997 Identification of a positive regulatory element responsible for tissue-specific expression of prostate-specific antigen. Cancer Res 57:495–499[Abstract/Free Full Text]
  28. Hoeck W, Hofer P, Groner B 1992 Overexpression of the glucocorticoid receptor represses transcription from hormone responsive and non-responsive promoters. J Steroid Biochem Mol Biol 41:283–289[CrossRef][Medline]
  29. Mink S, Ponta H, Cato AC 1990 The long terminal repeat region of the mouse mammary tumour virus contains multiple regulatory elements. Nucleic Acids Res 18:2017–2024[Abstract/Free Full Text]
  30. Krude T 1999 Mimosine arrests proliferating human cells before onset of DNA replication in a dose-dependent manner. Exp Cell Res 247:148–159[CrossRef][Medline]
  31. Wang W, Chi T, Xue Y, Zhou S, Kuo A, Crabtree GR 1998 Architectural DNA binding by a high-mobility-group/kinesin-like subunit in mammalian SWI/SNF-related complexes. Proc Natl Acad Sci USA 95:492–498[Abstract/Free Full Text]
  32. Lewin B 1994 Chromatin and gene expression: constant questions, but changing answers. Cell 79:397–406[CrossRef][Medline]
  33. Berger SL, Felsenfeld G 2001 Chromatin goes global. Mol Cell 8:263–268[CrossRef][Medline]
  34. Chi TH, Wan M, Zhao K, Taniuchi I, Chen L, Littman DR, Crabtree GR 2002 Reciprocal regulation of CD4/CD8 expression by SWI/SNF-like BAF complexes. Nature 418:195–199[CrossRef][Medline]
  35. Wang W, Cote J, Xue Y, Zhou S, Khavari PA, Biggar SR, Muchardt C, Kalpana GV, Goff SP, Yaniv M, Workman JL, Crabtree GR 1996 Purification and biochemical heterogeneity of the mammalian SWI-SNF complex. EMBO J 15:5370–5382[Medline]
  36. Wolffe AP 1997 Histones, nucleosomes and the roles of chromatin structure in transcriptional control. Biochem Soc Trans 25:354–358[Medline]
  37. Vigodner M, Morris PL 2005 Testicular expression of small ubiquitin-related modifier-1 (SUMO-1) supports multiple roles in spermatogenesis: silencing of sex chromosomes in spermatocytes, spermatid microtubule nucleation, and nuclear reshaping. Dev Biol 282:480–492[CrossRef][Medline]
  38. Hannich JT, Lewis A, Kroetz MB, Li SJ, Heide H, Emili A, Hochstrasser M 2005 Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae. J Biol Chem 280:4102–4110[Abstract/Free Full Text]
  39. Kikuno R, Nagase T, Nakayama M, Koga H, Okazaki N, Nakajima D, Ohara O 2004 HUGE: a database for human KIAA proteins, a 2004 update integrating HUGEppi and ROUGE. Nucleic Acids Res 32(Database issue):D502–D504
  40. Yeh S, Chang C 1996 Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proc Natl Acad Sci USA 93:5517–5521[Abstract/Free Full Text]
  41. Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkman AO, Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specfic antigen promoter. J Biol Chem 271:6379–6388[Abstract/Free Full Text]
  42. Delenda C 2004 Lentiviral vectors: optimization of packaging, transduction and gene expression. J Gene Med 6 (Suppl 1):S125–S138
  43. Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC 2002 A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA 99:5515–5520[Abstract/Free Full Text]
  44. Yang F, Li X, Sharma M, Zarnegar M, Lim B, Sun Z 2001 Androgen receptor specifically interacts with a novel p21-activated kinase, PAK6. J Biol Chem 276:15345–15353[Abstract/Free Full Text]
  45. Sharma M, Zarnegar M, Li X, Lim B, Sun Z 2000 Androgen receptor interacts with a novel MYST protein, HBO1. J Biol Chem 275:35200–35208[Abstract/Free Full Text]
  46. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   TRβ  |  VDR  |  ERα  |  ERβ  |  GR  |  PR  |  AR
Coregulators:   BRG-1  |  BAF57  |  hZimp10  |  hZimp7
Ligands:   Calcitriol  |  Dexamethasone  |  17β-Estradiol  |  Dihydrotestosterone  |  Progesterone  |  Thyroid hormone



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
J. Beliakoff, J. Lee, H. Ueno, A. Aiyer, I. L. Weissman, G. S. Barsh, R. D. Cardiff, and Z. Sun
The PIAS-Like Protein Zimp10 Is Essential for Embryonic Viability and Proper Vascular Development
Mol. Cell. Biol., January 1, 2008; 28(1): 282 - 292.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.