| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Urology and Genetics (C.-Y.H., J.B., J.L., X.L., M.S., Z.S.), Stanford University School of Medicine, Stanford, California 94305-5328; and Division of Hematology/Oncology (X.L., B.L.), Department of Medicine, Beth Israel Deaconess Medical Center, Boston, Massachusetts 02115
Address all correspondence and requests for reprints to: Zijie Sun, Ph.D., Departments of Urology and Genetics, S287, Grant Building, Stanford University School of Medicine, Stanford, California 94305-5328. E-mail: zsun{at}stanford.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
PIAS and PIAS-like proteins share a zinc finger domain, termed Miz (msx-interacting zinc finger) (10). This domain appears to be important for protein-protein interactions and was recently shown to mediate the interaction between the homeobox protein Msx2 and PIASxß. An increasing number of proteins from invertebrates have been found to contain the Miz domain, suggesting a conserved and biologically important role for PIAS proteins throughout evolution. Recently, an increased interest has been focused on the role of PIAS proteins in sumoylation (11). It has been shown that the small ubiquitin-like modifier (SUMO) E3 ligase RING domain shares significant homology with the PIAS proteins (12). Moreover, PIASx
, xß, 1, and 3 have been found to interact with SUMO-1 and Ubc9 and to mediate the sumoylation of a variety of cellular proteins (13, 14, 15).
The androgen receptor (AR) belongs to the nuclear receptor superfamily (16, 17). The AR and other receptors in this family possess identifiable activation domains that confer transactivation potential when fused to a heterologous DNA-binding domain (DBD). However, an important feature of the AR and other nuclear receptors that distinguish them from other transcription factors is that they are activated through their ligand-binding domains. The unbound AR forms a complex with heat-shock proteins, which holds the AR in a conformation capable of high-affinity ligand binding (18, 19). Upon binding to ligand, the AR dissociates from the heat-shock proteins and translocates into the nucleus, where it binds to androgen response elements (AREs) and recruits cofactors to regulate the transcription of target genes (20).
Like other steroid hormone receptors, the AR can bind to different cofactors through its distinct functional domains (21). Through such interactions, these cofactors can modulate AR activity. Several members of the PIAS family have been implicated in the regulation of several nuclear hormone receptors, including the AR (3, 9, 22). Indeed, PIASx
was originally isolated as an AR-interacting protein 3, and it binds to AR and modulates AR-mediated transcription (23).
Recently, we identified a novel PIAS-like protein, hZimp10 (human zinc finger-containing, Miz1, PIAS-like protein on chromosome 10), which physically interacts with the AR and augments AR-mediated, ligand-dependent transactivation in prostate cells (1). Using specific antibodies, both endogenous AR and hZimp10 proteins were costained in the nuclei of prostate epithelial cells from normal and malignant human tissue samples. A conserved Miz domain and a strong intrinsic transactivation domain (TAD) were identified in the central and C-terminal regions of hZimp10, respectively. Transfection of hZimp10 into human prostate cancer cells showed augmentation of AR-mediated ligand-dependent transcription. A novel Drosophila gene, termed tonalli (tna), was identified recently and is the Drosophila ortholog of hZimp10 (24). The protein encoded by tna genetically interacts with the chromatin-remodeling complexes SWI2/SNF2 and Mediator, suggesting that it may play a role in transcription.
In the process of searching for potential homologs of hZimp10, we found a nucleotide sequence located on human chromosome 7 that shares a high degree of sequence similarity with hZimp10. Using 5'-RACE (rapid amplification of cDNA ends), we cloned the full-length protein. Like hZimp10 and other PIAS proteins, this novel protein contains a conserved Miz domain. Thus, we named the protein hZimp7 (human zinc finger containing, Miz1, PIAS-like protein on chromosome 7). hZimp7 is predominately expressed in testis, heart, brain, prostate, and ovary tissues. Part of the AR TAD (amino acids 243333) and the central region of hZimp7 (amino acids 392527) were found to be responsible for the interaction. Through fusion of hZimp7 to a heterologous DBD, it was determined that a strong TAD exists in the C terminus of the protein. Moreover, we demonstrated that hZimp7 colocalizes with the AR in the nucleus of prostate cells and prostate tissues and forms a protein complex at replication foci. Furthermore, we identified an interaction between hZimp7 and Brg1 and BAF57, components of the mammalian SWI/SNF-like BAF complexes, suggesting a possible role for hZimp7 in chromatin remodeling.
| RESULTS |
|---|
|
|
|---|
A BLAST search of the human genome database showed that this full-length sequence is located on human chromosome 7 at 7p13 and is comprised of 17 putative exons. Comparison of this protein with hZimp10 showed that they share more than 71% sequence similarity, particularly in the C-terminal region (Fig. 1A
). Further analysis of the protein sequence revealed that it contains several functional domains, including a Miz zinc finger, a nuclear localization signal (NLS), and a proline-rich region (see Fig. 3C
). A high degree of sequence similarity was observed when this clone was aligned with the Miz domains of other PIAS proteins (Fig. 1B
). Based on these features, we named this protein hZimp7 (human zinc finger containing, Miz1, PIAS-like protein on chromosome 7).
|
|
|
The central region of hZimp10 (amino acids 556790) has been shown to be responsible for binding to AR (1). This region shares significant sequence similarity with hZimp7 between amino acids 386621(Fig. 1B
). Based on this feature, we made a series of deletion mutants to determine whether the region between amino acids 386621 is required for interacting with the AR (Fig. 3C
). No interaction was observed between the AR and the truncated mutants of hZimp7 (1435, 506643, and 581892) (Fig. 3C
). In contrast, full-length hZimp7 and two deletion mutants, hZimp7 (310892) and hZimp7 (310700), which possess the entire region between amino acids 386621, showed interactions with the AR. An additional mutant that contains the central region of the protein (amino acids 392527) was generated and used to further map the precise interaction region of hZimp7. As expected, this mutant showed the highest ß-gal activity, indicating that the central region between amino acids 435506 may be the primary binding region for AR (Fig. 3C
).
To confirm the interaction between hZimp7 and the AR in vivo, we tagged hZimp7 at its amino terminus with a FLAG epitope and expressed the tagged protein together with the AR in CV-1 cells. Both AR and FLAG-hZimp7 proteins were detected in the transfected cells (Fig. 3D
, top panels). Whole cell lysates containing equal amounts of overexpressed proteins were immunoprecipitated with normal mouse IgG or an anti-FLAG monoclonal antibody. As shown in Fig. 3D
, the AR protein was detected only in immunoprecipitates in which the FLAG antibody was used, indicating that the AR protein forms a protein complex with FLAG-hZimp7. These data suggest that the AR and hZimp7 interact in mammalian cells.
hZimp7 Protein Is Expressed in the Nuclei of Prostate Epithelial Cells and Colocalizes with the AR Protein
To further explore the potential biological role of hZimp7, we examined the expression of hZimp7 in human prostate tissues by immunohistochemistry. The human prostate tissues used in our experiments were collected from normal prostate, benign prostatic hyperplasia, and prostate cancer samples obtained by radical prostatectomy. Two adjacent sections from three individual tissue samples were stained with either an anti-AR or anti-hZimp7 antibody directed against the N terminus of the protein. As reported previously, AR was found exclusively in the nuclei of prostate epithelial cells (Fig. 4
, A, C, and E). hZimp7 protein also showed a strong nuclear staining pattern in normal and malignant prostate epithelial cells (Fig. 4
, B, D, and F). There was no, or very weak, staining in the stromal elements with either antibody in all samples examined. Similar results were also obtained using another hZimp7 antibody directed against the C-terminal region (data not shown). As shown in Fig. 4
, a clear costaining of AR and hZimp7 proteins was found in the nucleus of prostate epithelial cells. The above data demonstrate that endogenous AR and hZimp7 proteins are both expressed in the nuclei of human prostate cells, suggesting that they may interact in vivo. Consistent with our immunohistochemical staining results, endogenous hZimp7 was also detected in the nuclei of LNCaP prostate cancer cells using immunofluorescent staining (data not shown).
|
Fusion of the GAL4 DBD to full-length hZimp7 showed an approximately 4-fold induction compared with the GAL4 DBD alone, and deletions of the N-terminal region between amino acids 1377 did not significantly affect the activity (Fig. 5
). However, removal of amino acids 377512 elevated the activity. The truncated mutants containing the C-terminal region (amino acids 512892) showed 80-fold more transcriptional activity than that of the full-length hZimp7 construct, and deletion of the NLS and Miz domains significantly reduced the transcriptional activity. Moreover, the N-terminal fragment (amino acids 1619) showed no transcriptional activity. Taken together, these results suggest that the C terminus of hZimp7 containing the NLS, Miz domain, and proline-rich region possesses strong transcription activity.
|
|
(ER
), thyroid receptor ß (TRß), and vitamin D receptor (VDR). We first examined whether hZimp7 could enhance the activity of the AR, GR, and PRß. To limit experimental variation, we used a luciferase promoter containing the mouse mammary tumor virus promoter, which can be activated by all three receptors (28, 29). In CV-1 cells, we observed that hZimp7 augments AR-mediated transcription on the mouse mammary tumor virus promoter, but has no effect on GR or PRß activity (Fig. 6B
, and TRß-mediated transcription from the promoters driven by their corresponding responsive elements. These results suggest that hZimp7 functions as a transcriptional coactivator to augment AR and other nuclear hormone receptor-mediated transcription.
To further examine the enhancement of hZimp7 in a biologically relevant manner, we knocked down endogenous hZimp7 expression in LNCaP cells with a lentivirus containing an hZimp7-specific small hairpin RNA (shRNA). Because the lentiviral vector also expressed a blasticidin resistance gene, cells infected with the hZimp7 shRNA or vector alone were selected with blasticidin, and AR-mediated transcription was then assessed using the PSA-luciferase reporter. As shown in Fig. 6D
, DHT-stimulated reporter activity was reduced approximately 50% in cells infected with the hZimp7 shRNA virus when compared with vector control. These data provide an additional line of evidence to demonstrate the biological role of hZimp7 in AR-mediated transcription.
To further study whether the effect of hZimp7 on AR is through an interaction between the two proteins, we made several truncated mutants of hZimp7 and tested their abilities to augment AR transcriptional activity (Fig. 6E
). As observed previously, hZimp7 showed an enhancement on AR-mediated transcription (Fig. 6F
). Cotransfection of the truncated hZimp7 constructs with the AR and full-length hZimp7 expression plasmids showed that the mutant, hZ7D2 (amino acids 392527), covering the binding region for AR, inhibits the enhancement of AR activity by full-length hZimp7 (Fig. 6F
). These data demonstrate a dominantly negative effect of hZ7D2 mutant in hZimp7-mediated enhancement and provide an additional line of evidence that the interaction between hZimp7 and AR through this region is responsible for enhancement of AR activity.
hZimp7 Is Found at Cell Cycle-Regulated DNA Replication Foci throughout S Phase
Previous data have shown that hZimp10 is found at sites of DNA synthesis throughout all phases of DNA replication (1). Therefore, we systematically probed the nuclear distribution of hZimp7 during DNA replication by using immunofluorescence imaging. Cells were transfected with FLAG-hZimp7, synchronized in late G1 phase with mimosine, and then allowed to enter S phase (30). Newly synthesized DNA was detected by bromodeoxyuridine (BrdU) labeling and staining with a fluorescein isothiocyanate-conjugated anti-BrdU antibody (Fig. 7A
, left panel), and hZimp7 was detected using an anti-FLAG monoclonal antibody and a rhodamine-conjugated secondary antibody. A pattern of replication foci in synchronized cells was observed for hZimp7 during S-phase progression (Fig. 7A
, middle panel). Replication foci changed from numerous small, punctate structures in early S-phase cells to large, toroidal structures in late S-phase cells. Intriguingly, hZimp7 displayed a similar pattern of nuclear distribution as the BrdU-labeled DNA and colocalized with BrdU throughout S phase (Fig. 7A
, right panel). Next, we costained hZimp7 with PCNA (proliferating cell nuclear antigen) to confirm the localization of hZimp7 at DNA replication foci. As shown in Fig. 7B
, we observed similar staining patterns for PCNA and hZimp7 throughout S phase. Taken together, our results demonstrate that like hZimp10, hZimp7 localizes to sites of DNA synthesis throughout all phases of DNA replication, implying that hZimp7 may play a role in DNA synthesis and chromatin modification.
|
hZimp7 Interacts with the Mammalian SWI/SNF-Like BAF Complexes
One of the mechanisms by which coregulators modulate nuclear hormone receptors is through modification of chromatin. The Drosophila ortholog of hZimp7 and 10, tonalli (tna), has been shown to genetically interact with the SWI2/SNF and Mediator chromatin-remodeling complexes (24). Thus, we performed immunoprecipitation experiments to assess the potential interaction between hZimp7 and mammalian SWI/SNF-like BAF complexes (31). Expression constructs of FLAG-hZimp7 and Brg1, a component of SWI/SNF-like BAF complexes, were cotransfected into CV-1 cells. Nuclear extracts containing equal amounts of hZimp7 protein were immunoprecipitated with normal mouse IgG or an anti-FLAG monoclonal antibody. As shown in Fig. 8A
, FLAG-hZimp7 protein was detected in immunoprecipitates where the FLAG antibody was used. Importantly, the Brg1 protein was also detected in the same immunoprecipitates, suggesting a protein-protein interaction between hZimp7 and Brg1. An interaction between hZimp7 and BAF57, a Brg1-associated protein, was also demonstrated using the same procedure (Fig. 8B
). These data provide the first line of evidence that hZimp7 interacts with Brg1 and BAF57, members of the mammalian SWI/SNF-like BAF chromatin-remodeling complexes.
|
| DISCUSSION |
|---|
|
|
|---|
Sequence analysis showed that hZimp7 shares high sequence similarity with hZimp10. Both of these proteins contain a central Miz finger and a C-terminal proline-rich domain. Fusing the full-length protein and a series of truncation mutants of hZimp7 to the DBD of GAL4, we demonstrated that the C terminus of hZimp7, which contains the NLS, Miz, and proline-rich domains, possesses significant, intrinsic transcriptional activity. Intriguingly, the transactivation activity of hZimp7 is much higher than that of other transcription factors, such as p53, Smad, ER, and AR, and is even comparable to transactivation by the TAD of VP16. These results, combined with our previous observations with hZimp10, suggest that hZimp7 and hZimp10 may function as transcriptional coactivators through their intrinsic TADs. Identification of the intrinsic transcriptional activation domains in hZimp7 and hZimp10 also suggests a unique and distinctive role of these two proteins from other PIAS proteins in transcriptional regulation. In this study, we also examined whether hZimp7 enhances or represses the activity of other nuclear hormone receptors. Interestingly, aside from acting as an AR coactivator, hZimp7 was also shown to augment TRß, ER
, and VDR-mediated transcription to varying degrees. This result suggests that hZimp7 may act more broadly than hZimp10 in modulating nuclear hormone receptor-mediated transcription.
As we observed previously with hZimp10 (1), the full-length hZimp7 displays very limited activity compared with the truncated mutants containing the C-terminal proline-rich domain. Using a series of deletion mutants, we identified that the N terminus of hZimp7 (amino acids 1512) significantly inhibits the activity of the C-terminal proline-rich region. Currently, the molecular mechanism(s) of this autoinhibition is unknown. The autoinhibitory effects in both hZimp7 and hZimp10 suggest that a similar mechanism may be involved in the regulation of these two PIAS-like proteins. Further investigation into the mechanism(s) by which hZimp7 and hZimp10 are released from this inhibition will be extremely important for understanding the in vivo function of these hZimp proteins.
Using the N-terminal fragment of hZimp7, the nucleotide sequence of which is very distinct from hZimp10 and other PIAS, we assessed the expression of hZimp7 in human tissues by Northern blotting. Interestingly, hZimp7 and hZimp10 show different tissue distribution profiles (1). hZimp7 is highly expressed in testis, whereas hZimp10 was detected most abundantly in ovary. The different expression profiles of hZimp7 and hZimp10 may implicate specific roles for these proteins in different human tissues. Identification of targets for hZimp10 and hZimp7 may help us to better elucidate the functional differences between these two related proteins.
Multiple members of the PIAS protein family have been shown to be capable of interacting with the AR and other nuclear hormone receptors and to regulate their activities (3). PIASx
was originally identified as an AR-interacting protein, named AR-interacting protein 3 (23). PIAS and PIAS-like proteins share a conserved Miz domain in their central regions important for interactions with target proteins (10). Previously, we demonstrated that the central region of hZimp10, which contains the Miz finger, is involved in the interaction with the AR (1). In this study, we used several truncation mutants of hZimp7 to map the interaction region for binding to the AR. We showed that the region between amino acids 392527, rather than the Miz region, is required for the interaction. Interestingly, this region is highly conserved between both hZimp7 and hZimp10. Recently, using a comparable construct, we further confirmed that a similar region in hZimp10 displayed strong AR binding (data not shown).
In this study, we show that hZimp7 colocalizes with newly synthesized DNA and PCNA at replication foci throughout S phase. In eukaryotic cells, newly synthesized DNA must be rapidly assembled into the proper chromatin configuration to form transcriptionally active (euchromatin) and inactive domains (heterochromatin), respectively (32, 33). These data suggest a possible role of hZimp7 in both chromatin assembly and maintenance of chromatin. A homolog of hZimp7 and hZimp10, termed tonalli (tna), was identified recently in Drosophila (24). Intriguingly, the protein encoded by tna was shown to interact with SWI2/SNF2 and the Mediator complex. In this study, we examined the possible interaction between hZimp7 and the mammalian SWI/SNF-like BAF complexes (31). Using immunoprecipitation assays, we demonstrated that hZimp7 interacts with both Brg1 and BAF57, the DNA-binding subunits of the above complexes (34). Moreover, cotransfection of Brg1 or BAF57 with hZimp7 enhanced AR-mediated transcription to a greater extent than with either protein alone. Furthermore, knockdown of endogenous hZimp7 reduced the augmentation of Brg1 and BAF57 on AR-meditated transcription. These data provide the first link between hZimp7 and the human SWI/SNF-like BAF complexes. Unlike the yeast SWI/SNF complex, which is monomorphic, the mammalian BAF complexes contain several subunits that are coexpressed in the same cell, thus leading to their combinatorial assembly and the generation of perhaps hundreds of complexes (35). Identification of the interaction between hZimp7 and the components of BAF complexes suggests a role for hZimp7 in BAF complex-modulated transcription, which may further contribute to the heterogeneity of these complexes.
Modification of chromatin by different mechanisms, such as acetylation, methylation, phosphorylation, and ubiquitination, plays important roles in the regulation of chromatin structure to either foster or inhibit transcription (36). Recently, PIAS proteins-mediated sumoylation was also implicated in this regulatory process (37, 38). Although the precise role of PIAS proteins in the modulation of chromatin is unclear, it has been shown that PIAS proteins can recruit SUMO and Ubc 9 onto chromatin (37). Previously, we also demonstrated the colocalization of hZimp10 and SUMO-1 at replication foci (1). In this study, we observed that hZimp7 colocalizes with AR and SUMO-1 at replication foci (data not shown). However, hZimp7 does not directly affect AR sumoylation. Our observations suggest that hZimp7 not only directly enhances AR-mediated transcription but also participates other regulatory processes, possibly through modulating chromatin and/or recruiting other transcriptional factors such as AR onto chromatin. In both regards, it will be very interesting and worthwhile to further characterize the interaction between AR and hZimp7 at replication foci.
In conclusion, we have identified another novel PIAS-like protein, hZimp7. Multiple lines of evidence provided in this study suggest that hZimp7, like hZimp10, functions as a transcriptional coregulator to modify the activity of the AR and, probably, other nuclear hormone receptors. Intriguingly, we have also demonstrated that hZimp7 interacts with the mammalian SWI/SNF-like BAF complexes, suggesting a potential important role for hZimp7 in chromatin modification and transcriptional regulation. Further studies on the role of hZimp7 in transcription should provide new insight into the biology of PIAS and PIAS-like proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The human AR expression vector, pSV-hAR, was kindly provided by Dr. Albert Brinkmann (Erasmus University, Rotterdam, The Netherlands). A simian virus 40-driven ß-gal reporter plasmid (pSV-ß-GAL) was purchased from Promega Corp. (Madison, WI). The human ER
expression construct and pERE-luc plasmid were generously supplied by Dr. Myles Brown (Dana-Farber Cancer Institute, Boston, MA). A human PRß construct and the PRE-luc reporter were provided by Dr. Kathryn B. Horwitz (University of Colorado, Boulder, CO). The expression constructs of human GR and VDR and the pVDRE-luc reporter plasmid were the kind gifts of Dr. David Feldman (Stanford University, Stanford, CA). The pARE-luc reporter was the kind gift of Dr. Chawnshang Chang (40). The pPSA7kb-luc was kindly provided by Dr. Jan Trapman (41). The human Brg1 and BAF57 expression vectors were gifts from Dr. Gerald Crabtree (Stanford University). The lentiviral construct of hZimp7 shRNA was generated as described previously (42). A 22-mer sequence (GGGCAGCAGCAGCAGTTCTCAA) for the hZimp7 transcript was introduced into the pBS/U6 vector to generate the hZimp7 shRNA (43). Subsequently, the U6 promoter and the hZimp7 shRNA were PCR amplified and transferred into the pLentiSuper vector (Invitrogen, Carlsbad, CA). The viral vector was cotransfected with other packaging plasmids into human embryonic kidney 293T cells to produce the hZimp7 lentivirus (42).
Yeast Two-Hybrid System
Yeast two-hybrid experiments were performed as described previously (44). The DNA fragments containing the various truncation mutants of AR were fused in frame to the GAL4 DBD in the pGBT9 vector (CLONTECH Laboratories, Inc., Palo Alto, CA). Different hZimp7 mutants were fused to the GAL4 TAD in the pACT2 vector (CLONTECH). The constructs were transformed into the modified yeast strain PJ694A (25). Transformants were selected on Sabouraud Dextrose medium lacking tryptophan, leucine, and/or adenine. The specificity of interaction with the AR was measured by a liquid ß-gal assay as described previously (44).
Cell Culture and Transfection
The monkey kidney cell line, CV-1, was maintained in DMEM supplemented with 5% fetal bovine serum (HyClone Laboratories, Inc., South Logan, UT). An AR-positive prostate cancer cell line, LNCaP, was maintained in T medium (Life Technologies, Inc., Gaithersburg, MD) with 5% fetal bovine serum (FBS). A LNCaP variant stably expressing hZimp7 shRNA was generated by infecting with a hZimp7shRNA-containing lentivirus and selecting for infected cells with 10 µg/ml blasticidin. A cell line expressing the lentiviral vector alone was generated as a negative control. Transient transfections were carried out using LipofectAMINE for CV-1 cells, and LipofectAMINE 2000 for LNCaP cells (Invitrogen, Carlsbad, CA). For reporter assays, approximately 1.52 x 104 cells were plated in a 48-well plate 16 h before transfection. Twelve to sixteen hours after transfection, the cells were washed and fed medium containing 5% charcoal-stripped FBS (HyClone) in the presence or absence of ligands. Cells were incubated for another 24 h, and luciferase activity was measured as relative light units (RLUs) (45). The RLUs from individual transfections were normalized by measuring the activity of a cotransfected constitutive ß-gal reporter in the same samples. Individual transfection experiments were done in triplicate, and the results were reported as mean RLU/ß-gal (±SD).
Northern Blot Analysis
Blots with RNA from multiple human tissues were obtained from CLONTECH Laboratories, Inc., and hybridized to DNA fragments specific for the N-terminal region (amino acids 1316) of hZimp7. ß-Actin was used to normalize loading.
Preparation of Whole-Cell Lysates and Nuclear Extracts
To make the whole-cell lysates, cells were washed with PBS and resuspended in RIPA buffer [1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 50 mM NaF, 0.2 mM Na3VO4, 0.5 mM dithiothreitol (DTT), 150 mM NaCl, 2 mM EDTA, 10 mM sodium phosphate buffer (pH 7.2)]. Nuclear extracts were prepared according to the method of Dignam et al. (46) with minor modifications. Briefly, cells were washed with PBS, mechanically disrupted by scraping into homogenization buffer A (10 mM HEPES, pH 7.9; 10 mM KCl; 1.5 mM MgCl2; 0.5 mM DTT; and 0.5 mM phenylmethylsulfonylfluoride), and incubated on ice for 10 min. Cells were further disrupted by 10 strokes with a homogenizer and centrifuged at 15,000 rpm for 20 min. The pellet was resuspended in buffer containing 20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonylfluoride, and 25% glycerol, and then homogenized with 10 strokes. The lysate was incubated on ice for 30 min and centrifuged for 10 min at 15,000 rpm. The supernatant was saved and analyzed as the nuclear fraction.
Immunoprecipitation and Western Blotting
Whole-cell lysates or nuclear extracts were first precleared with Protein A Sepharose beads for 1 h and then incubated with mouse or rabbit normal IgG or specific antibodies conjugated with preequilibrated Protein A Sepharose beads at 4 C for 2 h. The beads were collected by centrifugation and gently washed three times with the same buffer as described above. Proteins were eluted by boiling in sodium dodecyl sulfate-sample buffer, resolved on 10% polyacrylamide gels, and transferred onto nitrocellulose membranes. Membranes were then blocked with 5% milk in Tris-buffered saline-Tween 20 for 1 h, and then probed with anti-AR (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-Brg-1, or anti-BAF57 specific antibody (provided by G. Crabtree, Stanford University), followed by incubation with species-specific horseradish peroxidase-conjugated antibodies.
Antibody Production
The N-terminal region (amino acids 277363) or C-terminal region (amino acids 714824) of hZimp7 was cloned into the pGEX-4T1 vector, and glutathione-S-transferase fusion proteins were generated as described previously (1). These glutathione-S-transferase fusions were then used as a source of antigen for antibody production. Rabbit polyclonal, affinity-purified antibodies were produced by Proteintech Group, Inc. (Chicago, IL). Antibody specificity was confirmed by Western blot and ELISA assay.
Cell Synchronization, BrdU Labeling, and Immunofluoresence
Experiments were performed as described previously (1). A FLAG-tagged hZimp7 cDNA-containing vector was transfected with pSV-hAR into CV-1 cells using the LipofectAMINE-plus reagent (Invitrogen). Synchronization was carried out as described by Krude (30). Briefly, at 18 h posttransfection, cells were treated with 0.5 mM mimosine (Sigma Chemical Co., St. Louis, MO) in DMEM supplemented with 10% FBS for 24 h to arrest cells in late G1 phase. Cells were released from the mimosine block by washing three times with PBS and incubating in fresh DMEM containing 10% FBS at 37 C, which allowed the growth-arrested cells to progress synchronously through S phase.
For detection of DNA replication, cells were pulsed with 10 µM 5-BrdU (Sigma) and 1 µM fluorodeoxyuridine (Sigma) for 15min in the dark at 37 C to inhibit thymidylate synthetase. Cells were then washed twice with cold PBS and fixed with 3% formaldehyde for 30 min at room temperature. To visualize the newly synthesized DNA labeled with BrdU, the cells were treated with 4 N hydrochloric acid for 30 min at room temperature to denature the DNA, rinsed several times in Tris-buffered saline-Tween 20, and incubated at 37 C for 1 h with fluorescein isothiocyanate-conjugated monoclonal anti-BrdU antibody (PharMingen, San Diego, CA). For the cells cotransfected with different plasmids, specific primary antibodies and fluorescein isothiocyanate-conjugated anti-mouse or rhodamine-conjugated antirabbit secondary antibody were used (Molecular Probes, Inc., Eugene, OR). Images were acquired using a confocal microscope.
Immunohistochemical Staining
Human prostate tissues were fixed in 10% neutral-buffered formalin and processed to paraffin. Samples were cut into 3- to 5-µm sections, deparaffinized in xylene, and rehydrated using a decreasing ethanol gradient followed by PBS. Tissues were then blocked with 3% hydrogen peroxide in methanol and protein block for 60 min each to inhibit endogenous peroxidase activity and nonspecific antibody binding, respectively. Samples were exposed to a 1:500 dilution of rabbit polyclonal anti-hZimp7 antibody or anti-AR antibody (clone 441; Santa Cruz Biotechnology) in 1% goat serum overnight at 4 C. Slides were then incubated with biotinylated antirabbit/antimouse antibody solution (Biogenex, San Ramon, CA) and streptavidin peroxidase (Lab Vision, Fremont, CA) for 30 min each. Between each antibody step, slides were washed three times with PBS. Antibody staining was visualized with 3,3'-diaminobenzidine substrate solution (DAKO Corp., Carpinteria, CA) in PBS containing 0.3% hydrogen peroxide. Slides were subsequently counterstained with 5% (wt/vol) Harris hematoxylin.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
First Published Online July 28, 2005
Abbreviations: AR, Androgen receptor; ARE, androgen-responsive element; BrdU, bromodeoxyuridine; DBD, DNA-binding domain; DHT, dihydrotestosterone; DTT, dithiothreitol; ER
, estrogen receptor
; FBS, fetal bovine serum; GR, glucocorticoid receptor; hZimp10, human zinc finger containing, Miz1, PIAS-like protein on chromosome 10; Miz, msx-interacting zinc finger; NLS, nuclear localization signal; PCNA, proliferating cell nuclear antigen; PRß, progesterone receptor ß; PSA, prostate-specific antigen; ß-gal, ß-galactosidase; PIAS, protein inhibitor of activated STAT; RACE, rapid amplification of cDNA ends; RLU, relative light units; shRNA, short hairpin RNA; STAT, signal transducer and activator of transcription; SUMO, small ubiquitin-like modifier; TAD, transcription activation domain; TR, thyroid hormone receptor; VDR, vitamin D receptor.
Received for publication February 22, 2005. Accepted for publication July 20, 2005.
| REFERENCES |
|---|
|
|
|---|
function as SUMO-E3 ligases toward androgen receptor and repress androgen receptor-dependent transcription. J Biol Chem 277:4131141317NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
J. Beliakoff, J. Lee, H. Ueno, A. Aiyer, I. L. Weissman, G. S. Barsh, R. D. Cardiff, and Z. Sun The PIAS-Like Protein Zimp10 Is Essential for Embryonic Viability and Proper Vascular Development Mol. Cell. Biol., January 1, 2008; 28(1): 282 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
|