help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0497
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vander Kooi, B. T.
Right arrow Articles by O’Brien, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vander Kooi, B. T.
Right arrow Articles by O’Brien, R. M.
Molecular Endocrinology 19 (12): 3001-3022
Copyright © 2005 by The Endocrine Society

The Glucose-6-Phosphatase Catalytic Subunit Gene Promoter Contains Both Positive and Negative Glucocorticoid Response Elements

Beth T. Vander Kooi, Hiroshi Onuma, James K. Oeser, Christina A. Svitek, Shelley R. Allen, Craig W. Vander Kooi, Walter J. Chazin and Richard M. O’Brien

Department of Molecular Physiology and Biophysics (B.T.V.K., H.O., J.K.O., C.A.S., S.R.A., R.M.O’B.), Department of Biochemistry (C.W.V.K., W.J.C.), Center for Structural Biology (C.W.V.K.), and Department of Physics (W.J.C.), Schools of Medicine and Arts and Science, Vanderbilt University, Nashville, Tennessee 37232

Address all correspondence and requests for reprints to: Richard M. O’Brien, Department of Molecular Physiology and Biophysics, 761 PRB (MRB II), Vanderbilt University Medical School, Nashville, Tennessee 37232-0615. E-mail: richard.obrien{at}vanderbilt.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Glucose-6-phosphatase catalyzes the final step in the gluconeogenic and glycogenolytic pathways. Glucocorticoids stimulate glucose-6-phosphatase catalytic subunit (G6Pase) gene transcription and studies performed in H4IIE hepatoma cells demonstrate the presence of a glucocorticoid response unit (GRU) in the proximal G6Pase promoter. In vitro deoxyribonuclease I footprinting analyses show that the glucocorticoid receptor binds to three glucocorticoid response elements (GREs) in the –231 to –129 promoter region and transfection results indicate all three contribute to glucocorticoid induction of G6Pase gene transcription. Furthermore, binding sites for hepatocyte nuclear factor-1 and -4, CRE binding factors, and FKHR (FOXO1a) are required for the full glucocorticoid response. Chromatin immunoprecipitation assays show that dexamethasone treatment stimulates glucocorticoid receptor and FKHR binding to the endogenous G6Pase promoter. Surprisingly, although glucocorticoids stimulate G6Pase gene transcription, deoxyribonuclease I footprinting and transfection analyses demonstrate the presence of a negative GRE and an associated negative accessory factor element in the –271 to –225 promoter region, which inhibit the glucocorticoid response. This appears to be the first report of a promoter that contains both positive and negative GREs, which function within the same cellular environment. We hypothesize that targeted signaling to the negative accessory element within the GRU may provide tight regulation of the glucocorticoid stimulation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GLUCOSE-6-PHOSPHATASE catalyzes the final step in both the gluconeogenic and glycogenolytic pathways, namely the hydrolysis of glucose-6-phosphate (G6P) to glucose and inorganic phosphate. Enzymatic activity is primarily detected in the liver and kidney (1, 2), but it is also found in the small intestine (3), pancreatic islets (4), and brain (5). Glucose-6-phosphatase is located in the endoplasmic reticulum membrane and it is thought to exist as a multicomponent enzyme system, which is comprised of a catalytic subunit as well as individual transporters for G6P, glucose, and inorganic phosphate (1, 2). However, only the glucose-6-phosphatase catalytic subunit (G6Pase) (6) and G6P transporter (7) have been identified to date.

G6Pase gene expression is regulated by a number of hormones and metabolites, including insulin, glucagon, glucose, and glucocorticoids (see Ref.8 for individual references). Glucocorticoids induce G6Pase mRNA expression in rat primary hepatocytes (9), as well as in rat H4IIE hepatoma cells (10, 11) and studies in the rat FAO (12) and H4IIE hepatoma cell lines (10, 13, 14) have shown that this effect is manifest, at least in part, at the transcriptional level.

Glucocorticoids are ligands for the glucocorticoid receptor (GR), a member of the nuclear hormone receptor superfamily (15). The non-ligand-bound GR is sequestered in the cytoplasm, but glucocorticoid binding induces GR translocation to the nucleus, where the receptor can either directly or indirectly bind gene promoters to regulate gene transcription (16). The GR stimulates gene transcription primarily through the recruitment of cofactor complexes and chromatin remodeling complexes (17, 18, 19, 20). Glucocorticoid induction of transcription has been studied extensively for a number of promoters, including those of the mouse mammary tumor virus (MMTV), tyrosine aminotransferase (TAT), and phosphoenolpyruvate carboxykinase (PEPCK). The MMTV (21, 22, 23), TAT (24, 25), and PEPCK (26) promoters contain multiple glucocorticoid response elements (GREs), which are DNA elements that directly bind GR. The GRE consensus sequence, (T/G)GTACANNNTGTTCT, consists of two hexamer half-sites, which are each recognized by a single subunit of a GR homodimer (27). The bases highlighted in bold have been shown to be most critical for GR activation of gene transcription through the GRE (28, 29).

Glucocorticoids use a common mechanism to regulate transcription of these genes, which involves the coordinated action of GR and multiple DNA-bound transcription factors. These factors, known as accessory factors, contribute to the glucocorticoid response by stabilizing GR binding and/or recruiting coregulators to the gene promoter (30, 31). In addition, some accessory factors are expressed in a tissue-specific manner, which enables them to provide cell type specificity to the glucocorticoid response (32). Together, the binding elements for GR and its accessory factors form a glucocorticoid response unit (GRU) (30). Accessory factors are essential for full glucocorticoid induction of MMTV, TAT, and PEPCK transcription because GR binding alone is insufficient. Nuclear factor-1 (33, 34), octamer transcription factors (35, 36), and Ets transcription factors (37) contribute to glucocorticoid induction of MMTV transcription. CCAAT/enhancer binding protein (C/EBP) (38), Ets transcription factors (39), and hepatocyte nuclear factor-3 (HNF-3) (38, 40) enhance glucocorticoid stimulation of TAT gene transcription. Finally, HNF-3 (41, 42, 43), hepatocyte nuclear factor-4 (HNF-4) (42, 44, 45), chicken ovalbumin upstream transcription factor (44), and C/EBP (46) contribute to glucocorticoid induction of PEPCK gene transcription.

For some genes, glucocorticoids can either activate or repress gene transcription, depending on the expression levels of individual transcription factors and the availability and activity of cofactors that interact with GR and its accessory factors (47). For instance, glucocorticoids activate PEPCK gene transcription in the liver and kidney, but repress PEPCK gene transcription in adipose tissue (48, 49, 50, 51). The regulation of PEPCK gene transcription by glucocorticoids is therefore one example of a gene in which the hormone response is dependent on the cellular environment in which the gene is expressed. However, glucocortiocoids specifically inhibit the expression of multiple genes, including those encoding proopiomelanocortin, osteocalcin, and prolactin (see Ref.16 for references). Each of these gene promoters contain negative GREs (nGREs), which are DNA elements that directly bind GR and mediate an inhibitory effect of glucocorticoids on gene transcription. The nGREs are related to the well-defined GRE described above, but they often do not closely match the consensus sequence (27, 52, 53).

The goal of this study was to determine which binding elements in the proximal G6Pase promoter play a role in glucocorticoid induction of G6Pase gene transcription. Surprisingly, the results reveal that the G6Pase GRU contains both positive and negative GREs as well as both positive and negative accessory factor elements. We believe this is the first example of a promoter that contains both positive and negative GREs, which both function within the same cellular environment.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Proximal G6Pase Promoter Contains a GRU
To determine which regions in the proximal G6Pase promoter contain binding elements involved in glucocorticoid induction of gene transcription, a series of 5'-truncated G6Pase-luciferase fusion genes ranging from –231 to –35 were generated. These fusion genes were transfected into the rat H4IIE hepatoma cell line and the ability of dexamethasone, a synthetic glucocorticoid, to stimulate expression of each was assessed. There were significant decreases in dexamethasone-stimulated fusion gene expression when the promoter was truncated from –231 to –198, from –198 to –158, and from –158 to –129 (Fig. 1Go). These results indicate there are multiple elements downstream of –231 that contribute to dexamethasone induction of G6Pase-luciferase fusion gene expression.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. The Proximal G6Pase Promoter Contains a GRU

H4IIE cells were transiently transfected, as described in Materials and Methods, with a series of 5'-truncated G6Pase-luciferase fusion genes (15 µg), and expression vectors encoding Renilla luciferase (0.15 µg) and GR (5.0 µg). After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase and protein assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as fold induction). Results represent the mean ± SEM of three to six experiments, in which each sample was assayed in duplicate. *, P < 0.05 vs. –231; **, P < 0.05 vs. –198; ***, P < 0.05 vs. –158. There was a statistically significant decrease (28 ± 9%; n = 3) in basal G6Pase-luciferase fusion gene expression when the promoter was truncated from –231 to –35. However, basal expression did not change when the –231 to –85 G6Pase promoter region was deleted (data not shown).

 
Identification of Three Glucocorticoid Response Elements (GREs) in the Proximal G6Pase Promoter
Although dexamethasone-stimulated G6Pase-luciferase fusion gene expression was lost when the promoter was truncated from –231 to –129 (Fig. 1Go), it was not clear whether this region contained GREs. This was because glucocorticoids can regulate gene transcription by multiple mechanisms, including those that involve direct GR binding to a gene promoter and those that involve GR tethering to a gene promoter via interaction with a DNA-bound transcription factor (16). To determine whether GR directly binds the –231 to –129 promoter region, in vitro deoxyribonuclease (DNase) I footprinting analyses were performed with both the sense and antisense strands of the G6Pase promoter (Fig. 2AGo). Increasing concentrations of the DNA binding domain of GR (GR-DBD), which contains the dimerization domain, were incubated with 32P-radiolabeled G6Pase promoter fragments and the samples were subjected to DNase I digestion. The GR-DBD protected multiple nucleotides from DNase I digestion, indicating GR directly binds the proximal G6Pase promoter (Fig. 2AGo). Results from the sense and antisense strand analyses were consistent in that they both suggest the presence of three separate GREs, designated GRE A, GRE B, and GRE C (Fig. 2Go, A and B). The predicted locations of the GREs are based on the DNase I footprinting data as well as comparison with the consensus GRE sequence (Fig. 2BGo). GRE A is located between –197 and –183; it matches the GRE consensus sequence at 8/12 total bases and 3/5 critical bases. GRE B is located between –180 and –166; it matches the GRE consensus sequence at eight of 12 total bases and three of five critical bases. GRE C is located between –156 and –142; it matches the GRE consensus sequence at 9/12 total bases and 2/5 critical bases.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2. Identification of Three GREs in the Proximal G6Pase Promoter

A, End-labeled sense and antisense fragments of the G6Pase promoter were incubated with 0–2.0 µg of GR-DBD protein extract and an in vitro DNase I footprinting analysis was performed as described in Materials and Methods. Representative experiments, which indicate the nucleotide positions of the predicted GREs, are shown. B, Sequence of the G6Pase promoter with summary of in vitro DNase I footprinting results. {bullet}, Nucleotides protected from DNase I digestion by GR. C, The GRE consensus sequence (27 ), the WT GRE A, GRE B, and GRE C sequences in the G6Pase promoter, and the SDMs introduced into each GRE, indicated in bold lowercase letters, are shown. {bullet}, Nucleotides protected from DNase I digestion by GR. D, H4IIE cells were transiently cotransfected, as described in Materials and Methods, with various G6Pase-luciferase fusion genes (15 µg) and expression vectors encoding Renilla luciferase (0.15 µg) and GR (5.0 µg). The G6Pase-luciferase fusion genes incorporated either the WT promoter sequence, located between –231 and +66 (–231 WT), or contained the same promoter fragment with site-directed mutations in the indicated elements. After transfection, the cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase and protein assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as fold induction). Results represent the mean ± SEM of three to seven experiments, in which each sample was assayed in duplicate. *, P < 0.05 vs. –231 WT. There was a statistically significant decrease in basal G6Pase-luciferase fusion gene expression when GRE A (33 ± 11%; n = 4) or GRE B (49 ± 3%; n = 3) was mutated.

 
To determine whether GRE A, GRE B, and GRE C play a role in the regulation of G6Pase gene transcription by glucocorticoids, G6Pase-luciferase fusion genes were constructed which contain mutations in each element individually (Fig. 2CGo). The mutations in GRE A and B were designed so as to leave intact two insulin response sequences (IRSs) that overlap these elements (54). These fusion genes were transfected into H4IIE cells and the ability of dexamethasone to stimulate expression of each was assessed. There was a significant decrease in dexamethasone induction of fusion gene expression when GRE A, GRE B, and GRE C were mutated individually (Fig. 2DGo). These results are consistent with the DNase I footprinting analyses (Fig. 2Go, A and B) and further suggest that GRE A, GRE B, and GRE C are each functional GREs.

The HNF-1, HNF-4, CRE 1, and CRE 2 Binding Elements Are Required for Full Glucocorticoid Induction of G6Pase-Luciferase Fusion Gene Expression
Binding sites for HNF-1 (55, 56) and HNF-4 (57) have previously been identified in the proximal G6Pase promoter. In addition, this region of the promoter contains two binding sites for the cAMP response element (CRE) binding protein (CREB), designated CRE 1 and CRE 2 (55, 58, 59). It has recently been shown that CRE 1 also binds members of the C/EBP transcription factor family (59). Interestingly, all of these factors have been shown to play a role in the glucocorticoid-induced transcription of other genes (see introductory text and Ref.60). To assess the ability of these elements to contribute to dexamethasone induction of G6Pase expression, G6Pase-luciferase fusion genes containing mutations in each of these binding elements were constructed (Fig. 3AGo). Importantly, the introduced mutations have been shown to abrogate transcription factor binding [Refs.8 , 56 , and 59 ; and Boustead, J. N., and Richard M. O’Brien, unpublished data). These fusion genes were transfected into H4IIE cells and the ability of dexamethasone to stimulate expression of each was assessed. Mutation of the HNF-1, HNF-4, CRE 1, and CRE 2 elements individually resulted in a significant decrease in dexamethasone induction, when compared with that of the –231 wild-type (WT) fusion gene (Fig. 3BGo). These results indicate that the HNF-1, HNF-4, CRE 1, and CRE 2 binding sites in the G6Pase promoter act as accessory factor elements for glucocorticoid induction of G6Pase gene transcription. The involvement of HNF-1 and CRE 1 in glucocorticoid stimulation of G6Pase gene transcription are consistent with previously published studies on the human G6Pase promoter (10, 58).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. The HNF-1, CRE 1, CRE 2, and HNF-4 Binding Elements Are Required for Full Glucocorticoid Induction of G6Pase-Luciferase Fusion Gene Expression

A, The WT HNF-1, CRE 1, CRE 2, and HNF-4 sequences in the G6Pase promoter and the SDMs introduced into each element, indicated in bold lowercase letters, are shown. B, H4IIE cells were transiently cotransfected, as described in Materials and Methods, with various G6Pase-luciferase fusion genes (15 µg) and expression vectors encoding Renilla luciferase (0.15 µg) and GR (5.0 µg). The G6Pase-luciferase fusion genes incorporated either the WT promoter sequence, located between –231 and +66 (–231 WT), or contained the same promoter fragment with site-directed mutations in the indicated elements. After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone (Dex). The cells were then harvested and luciferase and protein assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as fold induction). Results represent the mean ± SEM of three to 15 experiments, in which each sample was assayed in duplicate. *, P < 0.05 vs. –231 WT. There was a statistically significant decrease in basal G6Pase-luciferase fusion gene expression when the HNF-1 (40 ± 4%; n = 3), CRE 1 (18 ± 3%; n = 6) or CRE 2 (23 ± 6%; n = 6) element was mutated.

 
Identification of Multiple FKHR and HNF-3ß Binding Elements in the Proximal G6Pase Promoter
Binding sites for the forkhead transcription factors FKHR (54, 61, 62) and HNF-3 (55) have also been previously identified in the proximal G6Pase promoter. Moreover, as with HNF-1, HNF-4, CREB, and C/EBP, these factors have also been shown to play a role in the glucocorticoid-induced transcription of other genes (see introductory text and Refs.63 and 64). However, before assessing whether FKHR and/or HNF-3 play accessory factor roles in glucocorticoid-stimulated G6Pase gene transcription, binding elements for these factors in the proximal G6Pase promoter were studied more extensively. This was because sequence analyses suggested that these factors may bind additional elements other than those previously identified. To directly determine whether additional FKHR and HNF-3 binding sites exist in the proximal G6Pase promoter, in vitro DNase I footprinting analyses were performed. Increasing concentrations of His-FKHR (Fig. 4AGo) or GST-HNF-3ß (Fig. 4BGo) were incubated with 32P-radiolabeled G6Pase promoter fragments and the samples were subjected to DNase I digestion.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4. Identification of FKHR and HNF-3ß Binding Elements in the Proximal G6Pase Promoter

A, End-labeled sense and antisense fragments of the G6Pase promoter were incubated with 0–10 µg of His-FKHR protein extract and an in vitro DNase I footprinting analysis was performed as described in Materials and Methods. Representative experiments, which indicate the nucleotide positions of the predicted FKHR binding elements, are shown. IRS 3, which does not bind FKHR (54 ), is indicated in gray. {diamondsuit}, Nucleotides protected from DNase I digestion by His-FKHR. B, End-labeled sense and antisense fragments of the G6Pase promoter were incubated with 0–6.0 µg (sense) or 0–60 µg (antisense) of GST-HNF-3ß protein extract and an in vitro DNase I footprinting analysis was performed as described in Materials and Methods. Representative experiments, which indicate the nucleotide positions of the predicted HNF-3ß binding elements, are shown. {blacksquare}, Nucleotides protected from DNase I digestion by GST-HNF-3ß. C, Sequence of the G6Pase promoter with summary of in vitro DNase I footprinting results. Nucleotides protected from DNase I digestion by His-FKHR ({diamondsuit}) or GST-HNF-3ß ({blacksquare}).

 
FKHR protected multiple nucleotides from DNase I digestion (Fig. 4AGo) and results from the sense and antisense strand analyses were consistent in that they both suggest the presence of four different FKHR binding elements (Fig. 4Go, A and C). The predicted locations of the FKHR binding sites are based on the DNase I footprinting data as well as comparison with the consensus FKHR sequence (Fig. 4CGo). We have previously shown that FKHR binds two IRSs in the G6Pase promoter, designated IRS 1 and IRS 2 (54). IRS 1 is located between –188 and –183, whereas IRS 2 is located between –174 and –168. Both elements match the core FKHR consensus sequence at 6/6 bases (65, 66). As expected, FKHR binding to these elements was detected using the DNase I footprinting assay (Fig. 4Go, A and C). The G6Pase promoter also contains a third IRS, designated IRS 3, which is located between –166 and –160. However, extensive analysis of this element indicates that it does not bind FKHR (54). FKHR does contact one nucleotide in the IRS 3 binding element (Fig. 4Go, A and C). However, this is likely due to the limited resolution of the DNase I footprinting assay because IRS 2 is adjacent to IRS 3. Interestingly, the DNase I footprinting analyses also reveal two FKHR binding elements downstream of IRS 2, designated FKHR B and FKHR C (Fig. 4Go, A and C). FKHR B is located between –141 and –135 and it matches the core FKHR consensus element at 6/7 bases, whereas FKHR C is located between –110 and –104 and it matches the core FKHR consensus element at four of seven bases.

Although three different HNF-3 isoforms, HNF-3{alpha}, ß, and {gamma}, have been identified (67, 68, 69), HNF-3ß (FOXA2) was the predominant isoform that bound the G6Pase promoter in gel retardation analyses using H4IIE nuclear extract (data not shown). Therefore, HNF-3ß was the isoform used in the footprinting (Fig. 4BGo) and overexpression (Fig. 5Go) analyses in this study. HNF-3ß protected multiple nucleotides from DNase I digestion (Fig. 4BGo), and results from the sense and antisense strand studies were consistent in that they both suggest the presence of two HNF-3ß binding elements, designated HNF-3 B and HNF-3 C (Fig. 4Go, B and C). When 10-fold more HNF-3ß was used in the footprinting analysis an additional HNF-3ß binding site, designated HNF-3 A, was detected on the antisense strand (Fig. 4Go, B and C), although no additional binding elements were apparent on the sense strand (data not shown). This result suggests that HNF-3ß binds the HNF-3 A motif with a low affinity. The predicted location of each HNF-3 binding site is based on the DNase I footprinting data as well as comparison with the consensus HNF-3 sequence (Fig. 4CGo). HNF-3 A overlaps IRS 1 and IRS 2, is located between –185 and –174, and matches the HNF-3 consensus sequence at eight of 12 bases (70). The HNF-3 B and HNF-3 C binding elements are downstream of IRS 2. HNF-3 B is located between –144 and –133, whereas HNF-3 C is located between –117 and –106. Both match the HNF-3 consensus sequence at eight of 12 bases.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5. FKHR and HNF-3ß Are Required for Full Glucocorticoid Activation of G6Pase-Luciferase Fusion Gene Expression

A, The consensus binding elements for HNF-3ß (70 ) and FKHR (65 66 ), the WT IRS 1, IRS 2, HNF-3 A, HNF-3 B/FKHR B, and HNF-3 C/FKHR C sequences in the G6Pase promoter, and SDMs introduced into each element, indicated in bold lowercase letters, are shown. B, H4IIE cells were transiently cotransfected, as described in Materials and Methods, with various G6Pase-luciferase fusion genes (15 µg) and expression vectors encoding Renilla luciferase (0.15 µg) and either pcDNA3 (1.0 µg), FKHR-pcDNA3 (1.0 µg), or HNF-3ß-pcDNA3 (1.0 µg). The G6Pase-luciferase fusion genes incorporated either the WT promoter sequence, located between –231 and +66 (–231 WT), or contained the same promoter fragment with site-directed mutations in the indicated elements. After transfection, cells were incubated for 18–24 h in serum-free medium. The cells were then harvested and luciferase assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for Renilla luciferase activity in the cell lysate, in FKHR/HNF-3 ß-stimulated vs. control cells (expressed as a percentage of the fold induction obtained with the –231 WT G6Pase-luciferase fusion gene, which ranged from ~2- to 6-fold). Results represent the mean ± SEM of three to five experiments in which each sample was assayed in quadruplicate. *, P < 0.05 vs. –231 WT + FKHR; **, P < 0.05 vs. –231 WT + HNF-3ß. C, H4IIE cells were transiently cotransfected, as described in Materials and Methods, with the same plasmids as described above and expression vectors encoding Renilla luciferase (0.15 (Legend continues on next page.) µg) and GR (5.0 µg). After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase and protein assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as a percentage of the fold induction obtained with the –231 WT G6Pase-luciferase fusion gene, which ranged from approximately 20- 50-fold (data not shown). Results represent the mean ± SEM of six to 12 experiments, in which each sample was assayed in duplicate. ***, P < 0.05 vs. –231 WT. There was a significant decrease in basal fusion gene expression when IRS 1 (29 ± 2%; n = 4), HNF-3 B/FKHR B (18 ± 7%; n = 3), or HNF-3 C/FKHR C (42 ± 3%; n = 4) was mutated. Furthermore, there was a significant increase in basal fusion gene expression when IRS 2 (12 ± 8%; n = 3) or HNF-3 A (19 ± 4%; n = 5) was mutated. D, H4IIE cells were transiently cotransfected, as described in Materials and Methods, with various TK-luciferase fusion genes (15 µg) and expression vectors encoding Renilla luciferase (0.15 µg), GR (5.0 µg) and either pcDNA3 (1.0 µg) or FKHR-pcDNA3 (1.0 µg). The fusion gene plasmids represented either the basic TK-luciferase vector or constructs in which two copies of oligonucleotides representing a consensus GRE or GRE B (Table 1Go) had been ligated into the HindIII site of the vector. After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase assays were performed as described in Materials and Methods. The fold induction of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells, was calculated. The results represent the ratio of this fold induction in FKHR-pcDNA3 vs. pcDNA3 transfected cells (expressed as fold enhancement) and are the mean ± SEM of three to four experiments in which each sample was assayed in duplicate.

 
FKHR and HNF-3ß Stimulate G6Pase- Luciferase Fusion Gene Transcription through Multiple Elements
A number of the FKHR and HNF-3ß binding elements that were detected using DNase I footprinting analysis (Fig. 4Go) have not been previously characterized. Therefore, although FKHR and HNF-3ß bind these sites in the G6Pase promoter in vitro (Fig. 4Go), it was important to determine whether FKHR and/or HNF-3ß can bind these elements in situ. A comparison of the location of the four FKHR and three HNF-3ß binding sites in the proximal G6Pase promoter indicates that the HNF-3 A element lies between and partially overlaps IRS 1 and IRS 2 (Fig. 5AGo). In contrast, the HNF-3 B/FKHR B and HNF-3 C/FKHR C elements overlap completely (Fig. 5AGo). Therefore, for the mutational analyses of these binding elements, IRS 1, IRS 2, and HNF3 A were mutated individually, whereas HNF-3 B/FKHR B and HNF-3 C/FKHR C were mutated together (Fig. 5AGo). Importantly, previous studies have shown that the point mutations introduced into the IRSs completely disrupt FKHR binding (54). Also, because the HNF-3 A element overlaps both GRE A and GRE B and the HNF-3 B element overlaps both GRE C and CRE 2, only limited mutation of these elements was possible.

To determine whether FKHR and/or HNF-3ß can stimulate G6Pase-luciferase fusion gene expression through each of the identified forkhead binding elements, H4IIE cells were cotransfected with either the WT or one of the mutated fusion genes, and an expression vector encoding either FKHR or HNF-3ß. There was a significant decrease in FKHR-stimulated fusion gene expression when IRS 1, IRS 2, HNF-3 A, HNF-3 B/FKHR B, and HNF-3 C/FKHR C were mutated individually (Fig. 5BGo). The FKHR overexpression studies were consistent with the DNase I footprinting data, which indicated that FKHR can bind IRS 1, IRS 2, FKHR B, and FKHR C in vitro (Fig. 4Go, A and C). The one exception is that FKHR activation decreased when HNF-3 A was mutated, but this may be due to mutation of the 5' end of the core IRS 2 sequence in the HNF-3 A-mutated fusion gene (Fig. 5AGo).

Similarly, there was a significant decrease in HNF-3ß activation of the –231 G6Pase-luciferase fusion gene when HNF-3 A, HNF-3 B, and HNF-3 C were mutated individually (Fig. 5BGo). However, there was no significant change in HNF-3ß activation of the –231 G6Pase-luciferase fusion gene when IRS 1 and IRS 2 were mutated individually (Fig. 5BGo), which is consistent with the observation that the mutations in these elements lie outside the HNF-3 A motif (Fig. 5AGo). These results are also consistent with the DNase I footprinting data, which indicated that HNF-3ß can bind HNF-3 A, HNF-3 B, and HNF-3 C in vitro (Fig. 4Go, B and C).

FKHR Binding to IRS 1 Is Probably Required for Full Glucocorticoid Induction of G6Pase-Luciferase Fusion Gene Expression
To assess the ability of the FKHR and HNF-3ß binding elements to contribute to dexamethasone induction of G6Pase-luciferase fusion gene expression, the fusion genes containing mutations in each of these elements (Fig. 5AGo) were transfected into H4IIE cells and the ability of dexamethasone to stimulate expression of each was determined. When IRS 2, HNF-3 A, and HNF-3 B/FKHR B were mutated individually, there was either no change or an increase in dexamethasone-stimulated fusion gene expression compared with that of the –231 WT fusion gene (Fig. 5CGo). These results suggest that the factors that bind IRS 2, HNF-3 A, and HNF-3 B/FKHR B do not contribute to glucocorticoid activation of G6Pase-luciferase fusion gene expression. In contrast, when IRS 1 was mutated there was a significant decrease in dexamethasone-stimulated fusion gene expression compared with that of the –231 WT fusion gene (Fig. 5CGo). This suggests that FKHR binding to IRS 1 contributes to dexamethasone-stimulated G6Pase-luciferase fusion gene expression. However, the IRS 1 motif completely overlaps with the 3' half site of GRE A (Figs. 2BGo and 4BGo). Therefore, although only a single base has been mutated in IRS 1, we cannot exclude the possibility that the decrease in dexamethasone induction seen upon mutation of IRS 1 is due to reduced GR binding. To further assess the potential for FKHR to serve as an accessory factor, we investigated the ability of FKHR to enhance dexamethasone-stimulated fusion gene expression in a heterologous context. An oligonucleotide representing the G6Pase promoter sequence from –188 to –160 (Table 1Go) was ligated into a heterologous thymidine kinase (TK)-luciferase vector. This oligonucleotide includes the IRS 1 element, the adjacent GRE B motif, but only the 3' half site of GRE A. Expression of the resulting fusion gene was not induced by glucocorticoids (1.14 ± 0.12; n = 4) and overexpression of FKHR had no affect alone (1.14 ± 0.09; n = 4). However, after overexpression of FKHR, glucocorticoids now induced fusion gene expression (Fig. 5DGo). In contrast, luciferase expression directed by the TK vector was not induced by glucocorticoids (1.14 ± 0.05; n = 3), overexpression of FKHR had no affect alone (0.97 ± 0.01; n = 4), and after overexpression of FKHR glucocorticoids still failed to induce fusion gene expression (Fig. 5DGo). When an oligonucleotide representing the consensus GRE sequence (Table 1Go) was ligated into a heterologous TK-luciferase vector, expression of the resulting fusion gene was markedly induced by glucocorticoids (42.53 ± 10.55; n = 4), but overexpression of FKHR had no affect alone (1.21 ± 0.19; n = 4). In addition, the glucocorticoid-stimulated expression of this fusion gene was not enhanced by overexpression of FKHR (Fig. 5DGo). These results suggest that FKHR binding to IRS 1 has the potential to contribute to dexamethasone-stimulated G6Pase-luciferase fusion gene expression. However, this result cannot exclude the possibility that, in the context of the G6Pase promoter, binding of GR to GRE A precludes binding of FKHR to IRS 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Oligonucleotides Used in Gel Retardation Assays

 
There was also a significant decrease in dexamethasone-stimulated fusion gene expression, compared with that of the –231 WT fusion gene, when the HNF-3 C/FKHR C element was mutated (Fig. 5CGo). However, the effect of this mutation was relatively minor (Fig. 5CGo). In addition, the HNF-3 C/FKHR C binding element overlaps a previously identified HNF-6 binding site (71), so we cannot exclude the possibility that the decrease in dexamethasone induction seen upon mutation of the HNF-3 C/FKHR C element is due to reduced HNF-6 binding. Interestingly, overexpression of HNF-6 inhibits glucocorticoid-stimulated PEPCK gene expression (72), but it does not affect glucocorticoid activation of G6Pase fusion gene expression (Streeper, R.S., and Richard M. O’Brien, unpublished data). This suggests that FKHR and/or HNF-3ß, rather than HNF-6, contribute to glucocorticoid activation of G6Pase gene transcription through this element.

The Regulation of Promoter Occupancy Supports the Role of FKHR as an Accessory Factor in Glucocorticoid Stimulation of Endogenous G6Pase Gene Transcription
The heterologous TK fusion gene studies described above (Fig. 5DGo) suggest that FKHR binding to IRS 1 has the potential to contribute to dexamethasone-stimulated G6Pase-luciferase fusion gene expression. But as an alternative approach to investigate the potential accessory factor role of FKHR chromatin immunoprecipitation (ChIP) assays were performed. If FKHR is an accessory factor for glucocorticoid stimulation of G6Pase gene transcription, its promoter occupancy would be predicted to increase in the presence of dexamethasone because assembly of a GRU involves recruitment of GR and its accessory factors to the promoter (32).

To determine whether there is an increase in GR and FKHR binding to the endogenous G6Pase promoter upon glucocorticoid treatment, fragmented chromatin from formaldehyde-cross-linked H4IIE cells, which were treated in the absence and presence of dexamethasone, was subjected to immunoprecipitation with a GR or FKHR antibody. The presence of the G6Pase promoter in the immunoprecipitates was then analyzed by PCR using primers representing the proximal G6Pase promoter sequence. Figure 6AGo shows results of a representative ChIP assay visualized by agarose gel electrophoresis, and Fig. 6BGo shows quantitated results from three independent real-time PCR analyses. The results indicate there is a significant increase in GR and FKHR binding to the endogenous G6Pase promoter upon treatment of the cells with dexamethasone. To test the specificity of the antibody-chromatin interactions, the immunoprecipitates were also analyzed for the presence of exon 5 of the G6Pase gene using PCR primers that represent G6Pase exon 5 coding sequence (Fig. 6CGo). Approximately 10 kb of genomic DNA separates the rat G6Pase promoter and exon 5 (12), so given that the average chromatin fragment size is approximately 500 bp in this assay, immunoprecipitates of GR and FKHR bound to the proximal G6Pase promoter should not include exon 5 genomic sequence. Figure 6CGo shows that the background levels of GR and FKHR binding to exon 5 were not regulated by dexamethasone ,which suggests that the increase in GR and FKHR binding seen at the G6Pase promoter upon dexamethasone treatment is specific. This result is consistent with a role for FKHR as an accessory factor for the glucocorticoid response.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. The Regulation of FKHR and HNF-3ß Promoter Occupancy Supports Their Role as Accessory Factors in Glucocorticoid Stimulation of Endogenous G6Pase Gene Transcription

GR, FKHR, and HNF-3ß binding to the endogenous G6Pase promoter were analyzed in situ in control or dexamethasone-treated (for 60 min) H4IIE cells using the ChIP assay, as described in Materials and Methods. Chromatin from formaldehyde-treated H4IIE cells was immunoprecipitated using an anti-GR, anti-FKHR, or anti-HNF-3ß antibody. An anti-IgG antibody was used as a negative control. The presence of the G6Pase promoter in the chromatin preparation before immunoprecipitation (Input) and in the immunoprecipitates was then assayed using PCR, as described in Materials and Methods. A, Samples were separated on an agarose gel and a representative result is shown. B, The presence of the G6Pase promoter and (C) G6Pase exon 5 in the immunoprecipitates was assayed using real-time PCR analysis, as described in Materials and Methods. Quantitated results from three independent experiments, in which each sample was assayed in duplicate, are shown. Results are presented as the fold enrichment over the IgG control in the presence and absence of dexamethasone, normalized to the value obtained with the corresponding dexamethasone control. The fold enrichment was variable (see panel B), which may reflect the variable fold induction of G6Pase gene transcription by dexamethasone (~20- to 50-fold; Fig. 5Go). Therefore, for statistical analysis, the data were normalized to the value obtained with the corresponding + dexamethasone sample. *, P < 0.05 vs. corresponding antibody fold enrichment – dexamethasone.

 
The ChIP assay also revealed that there is a significant increase in HNF-3ß binding to the endogenous G6Pase promoter upon treatment of the cells with dexamethasone (Fig. 6Go, A and B) whereas the background level of HNF-3ß binding to exon 5 was not regulated (Fig. 6CGo). This result suggests a potential role for HNF-3ß as an accessory factor even though mutation of the three HNF-3 binding sites had a minimal effect on the glucocorticoid response (Fig. 5CGo).

The G6Pase Promoter Contains a nGRE
To determine whether promoter elements upstream of –231 contribute to glucocorticoid regulation of G6Pase gene transcription, a series of 5'-truncated G6Pase-luciferase fusion genes ranging from –484 to –231 were generated. These fusion genes were transfected into H4IIE cells, and the ability of dexamethasone to stimulate expression of each was assessed. Surprisingly, there were significant increases in dexamethasone-stimulated fusion gene expression when the promoter was deleted from –271 to –252 and from –252 to –231 (Fig. 7AGo). This result suggests there are multiple factors that bind the promoter region between –271 and –231 that inhibit glucocorticoid stimulation of G6Pase-luciferase fusion gene expression.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 7. The G6Pase Promoter Contains a nGRE

A, H4IIE cells were transiently transfected, as described in Materials and Methods, with a series of 5'-truncated G6Pase-luciferase fusion genes, and expression vectors encoding Renilla luciferase (0.15 µg) and GR (5.0 µg). After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase and protein assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as % –231-fold induction, which ranged from ~20- to 40-fold). Results represent the mean ± SEM of three to seven experiments, in which each sample was assayed in duplicate. *, P < 0.05 vs. –271; **, P < 0.05 vs. –252. There was a statistically significant decrease in basal G6Pase-luciferase fusion gene expression when the promoter was truncated from –484 to –374 (37 ± 0.3%; n = 3), from –484 to –271 (72 ± 1%; n = 3), from –271 to –252 (8 ± 2%; n = 4), and from –484 to –231 (66 ± 2%; n = 3). B, End-labeled sense and antisense fragments of the G6Pase promoter were incubated with 0–2.0 µg of GR-DBD protein extract and an in vitro DNase I footprinting analysis was performed as described in Materials and Methods. Representative experiments, which indicate the nucleotide position of the predicted nGRE, are shown. {bullet}, Nucleotides protected from DNase I digestion by the GR. C, Sequence of the G6Pase promoter with summary of in vitro DNase I footprinting results. {bullet}, Nucleotides protected from DNase I digestion by the GR. D, Oligonucleotide representing a consensus GRE, nGRE D and GRE B (Table 1Go) were labeled to a similar specific activity and incubated with purified GR-DBD (10 or 1000 ng). Protein binding was then analyzed as described in Materials and Methods. Representative autoradiographs are shown. E, The labeled consensus GRE oligonucleotide probe (Table 1Go) was incubated in the absence (–) or presence of the indicated molar excess of the unlabeled

consensus GRE, nGRE D, or GRE B oligonucleotide competitors before the addition of purified GR-DBD (10 ng). Protein binding was then analyzed as described in Materials and Methods. Protein binding was quantified by using a Packard Instant Imager to count 32P associated with the retarded GR-DBD dimer complex. The upper panel shows a representative autoradiograph, whereas the lower panel shows the mean data ± SEM of three to four experiments. The HNF-1 oligonucleotide has been previously described and represents the HNF-1 binding site in the mouse ß-fibrinogen gene (56 ). F, H4IIE cells were transiently transfected, as described in Materials and Methods, with various TK-luciferase fusion genes (15 µg) and expression vectors encoding Renilla luciferase (0.15 µg) and GR (5.0 µg). The fusion gene plasmids represented either the basic TK-luciferase vector or constructs in which one or two copies of oligonucleotides representing the indicated GRE sequences, as shown in Table 1Go, had been ligated into the HindIII site of the TK vector. After transfection, cells were incubated for 18–24 h in serum-free medium in the presence or absence of 500 nM dexamethasone. The cells were then harvested and luciferase assays were performed as described in Materials and Methods. Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as fold induction). Results represent the mean ± SEM of three to eight experiments in which each sample was assayed in duplicate. *, P < 0.05 vs. TK.

 
To ascertain whether the G6Pase promoter region between –271 and –231 contains an nGRE, in vitro DNase I footprinting analyses were performed over both the sense and antisense strands of the G6Pase promoter (Fig. 7BGo). Increasing concentrations of GR-DBD were incubated with 32P-radiolabeled G6Pase promoter fragments and the samples were subjected to DNase I digestion. The GR-DBD protected multiple nucleotides between –252 and –231 from DNase I digestion, indicating that GR directly binds this region of the G6Pase promoter (Fig. 7BGo). Results from the sense and antisense strand analyses were consistent in that they both suggest the presence of one nGRE, designated nGRE D (Fig. 7Go, B and C). The predicted location of nGRE D is based on the DNase I footprinting data as well as comparison with the consensus GRE sequence (Fig. 7CGo). nGRE D is located between –239 and –225 and it matches the GRE consensus sequence at 6/12 total bases and four of five critical bases. Importantly, in order for a GRE to be functional, both half sites must be intact (29). Therefore, the increase in dexamethasone induction seen when the promoter was truncated from –252 to –231 (Fig. 7AGo), can be attributed to the partial deletion of nGRE D.

GR-DBD binding to the nGRE D element was analyzed further using the gel retardation assay. As a positive control, we first labeled an oligonucleotide containing a consensus GRE motif (Table 1Go). When this labeled oligonucleotide was incubated with 10 ng purified GR-DBD two protein-DNA complexes were detected (Fig. 7DGo). Based on previous work from Chalepakis et al. (73), we interpret this result to indicate that the slower migrating complex represents the binding of a GR-DBD dimer, whereas the faster migrating complex represents the binding of a GR-DBD monomer. In contrast, when labeled oligonucleotides representing the WT G6Pase promoter sequence from –244 to –212 (Table 1Go and Fig. 7CGo), that encompasses nGRE D, or the WT G6Pase promoter sequence from –188 to –160 that encompasses GRE B (Table 1Go and Fig. 2CGo), were incubated with 10 ng purified GR-DBD only binding of the GR-DBD monomer was detected (Fig. 7DGo, left panel). However, when incubated with 1000 ng purified GR-DBD both the labeled nGRE D and the GRE B probes bound the GR-DBD dimer, although binding of the monomer still predominated (Fig. 7DGo, right panel). These results are consistent with the DNase I footprinting analyses that initially defined nGRE D and GRE B (Figs. 2AGo and 7BGo). The low affinity of GR-DBD dimer binding to these elements is also consistent with the fact that their sequences do not perfectly match that of the consensus element (Table 1Go).

Competition experiments, in which a varying molar excess of unlabeled DNA was included with the labeled consensus GRE probe, were used to compare the relative affinity of GR-DBD binding to the consensus GRE, nGRE D and GRE B. The results demonstrate that oligonucleotides representing either nGRE D or GRE B, but not an HNF-1 binding site, can compete with the labeled consensus GRE probe for binding of the GR-DBD (Fig. 7EGo). But as expected, the unlabeled consensus GRE oligonucleotide competed with the labeled consensus GRE probe for binding of the GR-DBD at much lower concentrations (Fig. 7EGo).

To compare the ability of the consensus GRE, nGRE D and GRE B to mediate an effect of dexamethasone in a heterologous context, the same oligonucleotides as used in the gel retardation experiments were ligated into the HindIII site of a heterologous TK-luciferase vector. Dexamethasone had almost no effect on luciferase expression directed by the TK-luciferase vector alone, whereas the consensus GRE was able to confer a strong glucocorticoid response (Fig. 7FGo). Consistent with the low affinity of GR-DBD dimer binding to the nGRE (Fig. 7DGo), this element was only able to mediate a weak glucocorticoid response when multimerized (Fig. 7FGo). And in the context of the heterologous TK-luciferase vector, it mediated a stimulatory glucocorticoid response, rather than the negative glucocorticoid response seen in the context of the G6Pase promoter (Fig. 7FGo). GRE B, which binds the GR-DBD dimer with a slightly lower affinity than nGRE D (Fig. 7EGo), failed to mediate a glucocorticoid response even when multimerized (Fig. 7FGo). These results are consistent with the idea that accessory factors are required to stabilize GR binding to GRE B in the G6Pase promoter to promote a robust glucocorticoid response. In addition, these results show that the negative effect of glucocorticoids mediated through nGRE D is determined by the context of the G6Pase promoter rather than being an inherent feature of GR binding to this element.

The G6Pase Promoter Also Contains a Negative Accessory Factor Element
There was also a significant increase in dexamethasone-stimulated fusion gene transcription when the promoter was deleted from –271 to –252 (Fig. 7AGo), suggesting that there is at least one additional binding element, in addition to nGRE D, that contributes to the inhibition of glucocorticoid-stimulated G6Pase-luciferase fusion gene expression. To begin to elucidate which element(s) in this region of the promoter contributes to the inhibition of the dexamethasone response, two fusion genes, designated –271 SDM (site-directed mutation) 1 and –271 SDM 2, were generated. Each fusion gene contains a 6-bp block mutation in sequences that are 100% conserved between the human, mouse, and rat promoter in the –271/–252 region (Figs. 8AGo and 9Go). These fusion genes were transfected into H4IIE cells and the ability of dexamethasone to stimulate expression of each was determined. Although dexamethasone-induced –271 SDM 2 fusion gene expression was not different from that of the –271 WT fusion gene, dexamethasone-induced –271 SDM 1 fusion gene expression was significantly greater than that of the –271 WT fusion gene (Fig. 8BGo). This suggests that a binding element that contributes to the inhibition of the dexamethasone response was inactivated by the SDM 1 mutation, or in other words, that a G6Pase promoter element that encompasses or overlaps the sequence between –260 and –255 binds a protein that plays a negative accessory factor role in the regulation of G6Pase-luciferase fusion gene expression.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 8. The G6Pase Promoter Contains a Negative Accessory Factor Element

A, The WT sequence of the G6Pase promoter from –260 to –239 and the SDMs introduced in this region, indicated in bold lowercase letters, are shown. B, H4IIE cells were transiently transfected as described in panel A, except the G6Pase luciferase fusion genes incorporate either the WT promoter sequence located between –271 and +66 (–271 WT), between –231 and +66 (–231 WT), or contain the –271 to +66 promoter sequence with mutations in the region between –260 and –239 (–271 SDM 1 and –271 SDM 2). Results are presented as the ratio of firefly luciferase activity, corrected for the protein concentration in the cell lysate, in dexamethasone-treated vs. control cells (expressed as fold induction). Results represent the mean ± SEM of three to seven experiments, in which each sample was assayed in duplicate. *, P < 0.05 vs. –271 WT. The –271 SDM1 mutation was associated with a statistically significant decrease in basal fusion gene expression relative to the –271 WT fusion gene (16 ± 2%; n = 3). C, A labeled oligonucleotide probe representing the WT G6Pase promoter sequence between –271 and –231 was incubated in the absence (–) or presence of a 100-fold molar excess of the unlabeled WT, –271/–231 MUT1 or –271/–231 MUT2 oligonucleotide competitors (Table 1Go) before the addition of H4IIE cell nuclear extract. Protein binding was then analyzed as described in Materials and Methods. In the representative autoradiograph shown, only the retarded complexes are visible and not the free probe, which was present in excess. The arrows point to complexes 1, 5, 6, and 7, which represent specific protein-DNA interactions whose formation correlates with the activity of the negative accessory factor.

 


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 9. The G6Pase GRU

Alignment of the rat, mouse, and human proximal G6Pase promoter sequences. The elements that play a role in glucocorticoid regulation of G6Pase gene transcription are indicated.

 
We next analyzed protein binding to this element using the gel retardation assay. When a labeled oligonucleotide representing the WT G6Pase promoter sequence from –271 to –231 (Table 1Go), which encompasses the negative accessory factor element, was incubated with nuclear extract prepared from H4IIE cells, 8 protein-DNA complexes were detected (Fig. 8CGo). Competition experiments, in which a 100-fold molar excess of unlabeled DNA was included with the labeled probe, were used to correlate protein binding with the effect of mutations on the activity of the negative accessory factor. The WT –271/–231 oligonucleotide competed effectively for the formation of six of these protein-DNA complexes, designated 1, 2, 3, 5, 6, and 7 (Fig. 8CGo), indicating that complexes 4 and 8 must represent nonspecific protein-DNA interactions. By contrast, an oligonucleotide, designated –271/–231 MUT 1, which contains a mutation identical to that described in the –271 SDM 1 fusion gene (Fig. 8AGo), only competed effectively for the formation of complex 3 (Fig. 8CGo). An oligonucleotide, designated –271/–231 MUT 2, that contains a mutation identical to that described in the –271 SDM 2 fusion gene (Fig. 8AGo), competed effectively for the formation of complexes 1, 5, 6, and 7 (Fig. 8CGo). Taken together, these data indicate that complexes 1, 5, 6, and 7 (Fig. 8CGo) represent specific protein-DNA interactions and that their formation correlates with the activity of the negative accessory factor. In contrast, complex 2 represents a protein-DNA interaction with an element that is disrupted by both the MUT 1 and MUT 2 mutations, whereas complex 3 represents a protein-DNA interaction with an element that is disrupted selectively by the MUT 2 mutation. Further analysis will be required to determine whether one or all of the four complexes associated with the MUT1 region represent the binding of the negative accessory factor.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The G6Pase GRU
The results presented above demonstrate that glucocorticoid induction of mouse G6Pase gene transcription requires the coordinated action of four GREs and multiple accessory factor elements. An alignment of the rat, mouse, and human sequences of the proximal G6Pase promoter is shown in Fig. 9Go, and the DNA binding elements that are involved in glucocorticoid regulation of G6Pase gene transcription are indicated. Importantly, this region of the G6Pase promoter is highly conserved between species. The G6Pase GRU is particularly complex because it contains both elements that contribute to and elements that inhibit glucocorticoid stimulation of gene transcription. The GRU contains three positive GREs (GRE A, GRE B, and GRE C) (Fig. 2Go) and multiple positive accessory factor elements, including binding sites for HNF-1, HNF-4, CRE binding proteins and FKHR (Figs. 3–5GoGoGo). Interestingly, the G6Pase promoter also contains one negative GRE (nGRE D) (Fig. 7Go, A–C) and one negative accessory factor element, which binds several unidentified factors (Figs. 7AGo and 8Go, A–C).

Multiple Promoter Elements Contribute to Glucocorticoid Activation of G6Pase Gene Transcription
DNase I footprinting studies demonstrate that GR binds all three positive GREs in vitro (Fig. 2AGo) and mutational analyses support the involvement of all three elements in glucocorticoid-stimulated G6Pase-luciferase fusion gene expression (Fig. 2DGo). Based on sequence analysis, a previous report predicted the presence of GRE B and GRE C, but only GRE B was found to contribute to glucocorticoid-stimulated G6Pase gene transcription (10). The mutation that was introduced to disrupt the GRE C element in the previous study would actually be predicted to create a higher affinity GRE than the WT GRE C element because its resulting sequence conformed more closely to the GRE consensus sequence (10). This is likely the reason the authors did not see a decrease in glucocorticoid induction of G6Pase gene transcription upon mutation of GRE C.

The mechanisms by which the positive accessory factors mediate their action at the G6Pase promoter are not known at this time, but previous studies on other genes provide insight into this issue. First, HNF-1 can recruit the general transcription machinery to specific gene promoters and it can also promote chromatin remodeling and the demethylation of individual promoters (74, 75, 76). These effects are mediated, in part, through interactions between HNF-1 and the coactivators CREB-binding protein (CBP), p300/CBP-associated factor, steroid receptor coactivator-1 (SRC-1), and receptor-associated coactivator 3 (75). Similarly, HNF-4 can interact with the coactivators CBP, p300, SRC-1, and glucocorticoid receptor-interacting protein-1. One result of such interactions is that HNF-4 can stabilize GR binding to gene promoters (45, 77, 78, 79). Finally, CRE binding proteins have been shown to interact with GR and the coactivators CBP and p300 and they can also stabilize GR binding to gene promoters (46, 80, 81, 82).

Importantly, this is the first report that an FKHR binding element contributes to glucocorticoid induction of G6Pase gene transcription. However, the involvement of this factor in G6Pase gene transcription is complex because multiple FKHR binding elements are present in the G6Pase promoter. FKHR had previously been shown to bind IRS 1 and IRS 2 (54), but DNase I footprinting and overexpression analyses reveal that FKHR binds two additional elements in the G6Pase promoter, namely FKHR B, and FKHR C (Figs. 4AGo and 5BGo). Interestingly, although there are multiple FKHR binding elements in the G6Pase promoter, only the IRS 1 and HNF-3/FKHR C binding sites are required for induction of G6Pase-luciferase fusion gene expression by glucocorticoids, with IRS 1 playing the quantitatively more important role (Fig. 5CGo). The interpretation of the IRS 1 mutagenesis experiment (Fig. 5CGo) is complex because this element completely overlaps with the 3' half site of GRE A (Figs. 2BGo and 4BGo). However, the results of heterologous fusion gene experiments (Fig. 5DGo) and ChIP assays (Fig. 6Go) both support the conclusion that FKHR plays an accessory factor role in the induction of G6Pase gene transcription by glucocorticoids. The mechanism of FKHR accessory factor action at the G6Pase promoter remains to be determined, but FKHR has been shown to interact with the coactivators SRC-1 and CBP (63, 64).

Interestingly, we have previously shown that insulin inhibits basal G6Pase gene transcription by inhibiting FKHR binding (54). The data presented here suggest that the same mechanism could also explain, at least in part, how insulin inhibits glucocorticoid-stimulated G6Pase gene transcription. This conclusion is consistent with a recent report that shows FKHR and FKHRL1 play an accessory factor role in glucocorticoid stimulation of pyruvate dehydrogenase kinase-4 (PDK4) gene transcription, and that insulin signaling blocks this induction by inhibiting FKHR and FKHRL1 function (64). Similarly, combined glucocorticoid and cAMP treatment has been shown to stimulate FKHR binding to the PEPCK and G6Pase promoters, whereas insulin treatment has been shown to decrease FKHR binding (83).

The data supporting the involvement of HNF-3ß in glucocorticoid-stimulated G6Pase gene transcription are less clear. HNF-3ß binds three elements in the G6Pase promoter, designated HNF-3 A, HNF-3 B, and HNF-3 C (Figs. 4BGo and 5BGo). Lin and colleagues (55) previously identified the HNF-3 A and HNF-3 B binding elements in gel retardation studies. In addition to these two elements, HNF-3 C was identified using DNase I footprinting analysis (Fig. 4BGo). Of these three elements, only the HNF-3 C site was required for full induction of G6Pase-luciferase fusion gene expression by glucocorticoids (Fig. 5CGo); however, the effect of mutating this element was relatively minor (Fig. 5CGo). Furthermore, the mutation introduced into this element disrupts not only HNF-3ß, but also FKHR (Fig. 5BGo) and HNF-6 binding (71). It should be noted that the mutations introduced into the HNF-3 A and HNF-3 B binding elements had to be limited to avoid disrupting overlapping elements (Fig. 5AGo). So it could be argued that these mutations were insufficient to disrupt HNF-3ß binding sufficiently to reveal accessory factor activity. However, that conclusion is at odds with the observation that these mutations were sufficient to blunt HNF-3ß-stimulated G6Pase fusion gene expression (Fig. 5BGo). Despite the absence of convincing mutagenesis data to support an accessory factor role for HNF-3ß in glucocorticoid-stimulated G6Pase gene transcription, the ChIP assay results showed that HNF-3ß binding to the endogenous G6Pase promoter does increase upon glucocorticoid treatment (Fig. 6Go). In addition, HNF-3ß has been shown to interact with GR in vitro and to stabilize GR binding to a low-affinity GRE (45, 84), and experiments with truncated HNF-3ß constructs suggested that it contributes to glucocorticoid stimulation of endogenous G6Pase gene expression in H4IIE cells (43). Further studies will therefore be required to definitively establish whether HNF-3ß acts as an accessory factor for glucocorticoid-stimulated G6Pase gene transcription.

An interesting aspect of the ChIP assay results is that fairly high levels of basal occupancy of the promoter by GR, FKHR, and HNF-3 were detected in H4IIE cells (Fig. 6AGo). This observation is consistent with the results of transfection experiments that suggest that each factor contributes to basal G6Pase fusion gene expression. Specifically, there were statistically significant decreases in basal expression when GRE A, GRE B, IRS 1, HNF-3 B/FKHR B, and HNF-3 C/FKHR C were mutated (see legends to Figs. 2Go and 5Go). Similarly, we have previously shown that, in HepG2 cells, insulin inhibits basal G6Pase gene expression by inhibiting binding of FKHR to IRS 1 (54). Both FKHR and HNF-3 reside in the nucleus in the basal state, although insulin can stimulate the nuclear exclusion of both proteins (85, 86), but many studies have shown that GR is found in the cytoplasm in the absence of glucocorticoids. Although the ChIP experiments were performed in serum-free media, it is possible that glucocorticoids present in serum during cell culture had not been fully depleted. Alternatively, it is possible that the complex machinery that regulates the intracellular location of GR (87) is altered in H4IIE cells because Wang et al. (88) also detected GR binding to the endogenous PEPCK promoter in the absence of glucocorticoids.

Two Promoter Elements Inhibit Glucocorticoid Activation of G6Pase Gene Transcription
The G6Pase promoter also contains binding elements that inhibit glucocorticoid stimulation of gene transcription (Fig. 7Go). A negative GRE, nGRE D, was identified in the G6Pase promoter between –239 and –225 (Fig. 7Go, A and B). To the best of our knowledge, this is the first report of a promoter that contains both positive and negative GREs that function in the same cellular environment. Interestingly, nGRE D only matches the GRE consensus sequence at six of 12 bases, which is consistent with previous findings that nGREs often do not closely match this consensus (see introductory text).

A negative accessory factor element was identified in the G6Pase promoter just upstream of nGRE D (Figs. 7AGo and 8Go, A–C). Although the identity of the factor that binds this site is unknown, MatInspector transcription factor binding analysis (89) indicates that the sequence is similar to an Ets factor binding element. Ets factors bind a purine-rich GGA(A/T) core sequence, often in cooperation with other transcription factors, and their activity can be regulated by their phosphorylation status (90, 91). Ets factors have been shown to contribute to glucocorticoid activation of the MMTV and TAT promoters (see introductory text), as well as glucocorticoid repression of matrix metalloproteinase-9 gene expression (92). Based on this sequence analysis and the precedent for their role in glucocorticoid regulation of gene transcription, this suggested that an Ets transcription factor was a primary candidate for the negative accessory factor that binds the G6Pase promoter. Gel retardation assays using the negative accessory factor element as the labeled probe revealed four specific protein-DNA complexes whose formation correlate with negative accessory factor activity (Fig. 8CGo). There are more than nine subfamilies of Ets transcription factors (91), but expression profiling studies suggest that Ets-2 and PEA3 are the most abundant Ets factors in liver cells (93). However, antisera to these factors, as well as to Ets-1, that have previously been shown to disrupt binding in gel retardation assays, did not affect the formation of any of the four specific complexes detected (data not shown).

The Potential Role of Positive and Negative Elements in the G6Pase GRU
We hypothesize that the positive and negative elements within the G6Pase GRU provide a mechanism for a graded and tightly regulated response to glucocorticoid induction of gene transcription, rather than a simple all-or-none hormone response. Indeed, there are many examples of glucocorticoid-stimulated promoters that contain binding elements that modulate glucocorticoid induction of gene transcription. For instance, CCAAT displacement protein (94) and the transcription enhancer factor-1 family of transcription factors (95) have been shown to inhibit glucocorticoid-induced MMTV transcription. Similarly, the TAT promoter contains an activator element, a negative element, and a neutralizer element, in addition to the GREs and positive accessory factor elements that mediate glucocorticoid stimulation of TAT gene transcription. These three elements all serve to provide flexibility to the glucocorticoid response (96, 97). Finally, the HNF-6 binding element in the PEPCK promoter inhibits glucocorticoid stimulation of PEPCK gene transcription (72). As for the G6Pase promoter, a key question that remains to be addressed is whether there are signaling pathways that selectively modulate the activity of the positive and negative accessory factors which bind the promoter.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
[{gamma}-32P]ATP (>5000 Ci mmol–1) was obtained from Amersham Pharmacia Biotech (Piscataway, NJ). Dexamethasone 21-phosphate was purchased from Sigma Chemical Co. (St. Louis, MO), and DNase I was purchased from Roche Diagnostics Corp. (Indianapolis, IN). Specific antisera to GR (sc-1004), FKHR (sc-11350), HNF-3ß, (sc-6554) and rabbit IgG (sc-2027) were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

Plasmid Construction
The generation of mouse G6Pase-luciferase fusion genes, containing promoter sequence located between –484/+66, –271/+66 and –158/+66, –85/+66 and –35/+66, relative to the transcription start site, in the pGL3 MOD vector has been previously described (57). This vector is based on the pGL3 Basic firefly luciferase vector (Promega, Madison, WI) but contains a modified polylinker (98). Additional G6Pase promoter fragments, containing sequence between –374/+66 and –252/+66, were generated by digestion using Bbv II or PCR, respectively, and were also cloned into the pGL3 MOD vector.

G6Pase-chloramphenicol acetyltransferase (CAT) fusion genes containing promoter sequence between –231/+66, –198/+66 and –129/+66 have been previously described (14, 56). G6Pase-CAT fusion genes containing SDMs in two CRE motifs (–231 CRE1 SDM and –231 CRE 2 SDM), an HNF-1 motif (–231 HNF-1 SDM), and in two insulin response sequence (IRS) motifs (–231 IRS 1 SDM and –231 IRS 2 SDM) have also been previously described (8, 54, 56). These promoter fragments were all subcloned into the pGL3 MOD vector.

A three-step PCR strategy (99) was used to introduce mutations into GREs A, B, and C (Fig. 2Go), a HNF-4 motif (Fig. 3Go), and HNF-3 motifs A, B, and C (Fig. 5Go). The resulting constructs, designated –231 GRE A, B or C SDM, –231 HNF-4 SDM, –231 HNF-3 A SDM, –231 HNF-3 B/FKHR B SDM and –231 HNF-3 C/FKHR C SDM, respectively, were generated within the context of the –231 to +66 G6Pase promoter fragment. Briefly, two complementary PCR primers were designed to mutate nucleotides within each of these motifs. The sequence of the sense strand oligonucleotides were as follows (mutated nucleotides are in bold lowercase letters): For –231 GRE A SDM: 5'-TGGCTCTGCCAATGGatcgacttaTGTTTTTGTGTGCCTGTTTTG-3'. For –231 GRE B SDM: 5'-ATCAGGCTGTTTTTGatgctCTGTTTTGaTATTTTACGTAAATCA-3'. For –231 GRE C SDM: 5'-TTTGCTATTTTACGTAccgactgcgtccagTGTTTGCATCAACCT-3'. For –231 HNF-4 SDM: 5'-GTGGTTTTTTGAGTCaccctATCAGGGCTGGGTTG-3'. For –231 HNF-3 A SDM: 5'-GATCAGGCTGTTTTTcTGTGCCgGTTTTGCTATTTTAC-3'. For –231 HNF-3 B/ FKHR B SDM: 5'-CACCCTGAACATcTTTGCATCAACC-3'. For –231 HNF-3 C/FKHR C SDM: 5'-GATGATGCACCTTTGgatccaAGATTTTAGACAAAAGTGG-3'. These sense strand oligonucleotides were used in conjunction with a 3' PCR primer to generate the 3' half of the G6Pase promoter whereas the complementary antisense strand oligonucleotides were used in conjunction with a 5' PCR primer to generate the 5' half of the G6Pase promoter. These 5' and 3' primers were designed to maintain the 5' and 3' junctions of the G6Pase promoter fragment to be the same as those in the WT –231 to +66 G6Pase-luciferase fusion gene construct. The PCR products from these two reactions were then combined and used themselves as both primer and template in a second PCR to generate a small amount of the full-length, mutated G6Pase promoter fragment. Finally, the 5' and 3' PCR primers were then used to amplify this fragment. These promoter fragments were all subcloned into the pGL3 MOD vector.

Two separate mutations were introduced into the –260 to –239 G6Pase promoter region using PCR with the following oligonucleotides as the 5' primers and the –271 to +66 promoter fragment as the template: 5'-CCGCTCGAG(–271)AAGGACCAGGActtcttGCAGCCTCTAGCACT-3' and 5'-CCGCTCGAG (–271)AAGGACCAGGAAGGAGGGCAGCCTCTAtacagtTCAAGCAGTGTGCCC-3'. The mutated nucleotides are in bold lowercase letters, and XhoI sites used for cloning purposes are underlined. The 5' and 3' primers were designed to conserve the junctions between the G6Pase promoter and luciferase reporter gene to be the same as those in the WT –271 G6Pase-luciferase fusion gene construct. These promoter fragments were subcloned into the pGL3 MOD vector and the resulting constructs were designated –271 SDM 1 and –271 SDM 2. All promoter fragments generated by PCR were completely sequenced to ensure the absence of polymerase errors.

The TK-luciferase plasmid contains the herpes simplex virus thymidine kinase (TK) promoter sequence from –105 to +51 ligated to the luciferase reporter gene and has a unique HindIII site in the polylinker at –105. It was generated by subcloning the TK promoter as a HindIII-BglII fragment from TKCAT (100) into pGL3MOD. Various double-stranded complementary oligonucleotides, representing a consensus GRE, nGRE D, or GRE B (Table 1Go), were synthesized with HindIII compatible ends and were ligated in one or two copies into HindIII-cleaved TK-luciferase.

For protein expression in H4IIE cells, vectors encoding the rat glucocorticoid receptor [pRSV-GR; (101)] and human FKHR [pcDNA3-FKHR; (102)] were generously provided by Drs. Keith Yamamoto and Frederic Barr, respectively. A vector encoding full-length rat HNF-3ß was constructed by isolating an EcoRI fragment from pCMV-HNF-3ß, a generous gift from Dr. James Darnell (69), and ligating it into pcDNA3 (Invitrogen, Hercules, CA).

For protein expression in bacterial cells, a vector encoding a glutathione-S-transferase (GST)-mouse HNF-3ß fusion protein [pGEX2T-HNF-3ß; (103)], was generously provided by Dr. David Powell. A vector encoding a histidine-tagged variant of human FKHR (His-FKHR) was constructed by isolating the FKHR open reading frame as a KpnI-XbaI fragment from pcDNA3-FKHR (102). This fragment was blunt ended using Klenow and ligated into XhoI digested, blunt ended pET-15b (Novagen, San Diego, CA).

Recombinant Protein Overexpression and Purification
The expression and purification of the DNA binding domain of GR (GR DBD), a generous gift from Dr. Keith Yamamoto, was as previously described (104). GST-HNF-3ß and His-FKHR proteins were expressed in the Rosetta(DE3) Escherichia coli strain (Novagen, San Diego, CA). One liter cultures were grown to OD600 = 0.4 at 37 C and were temperature-shifted to 25 C for 30 min. Cultures were then induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside. Four hours after induction, cells were harvested by centrifugation at 8000 x g for 15 min. Thirty-five milliliters of lysis buffer [20 mM Tris HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA] and lysozyme (100 µg/ml) was added to each sample and incubated on ice for 15 min. The cells were lysed by sonicating for 2 min (cycles of 5 sec pulse, 5 sec rest). Cell debris was removed by centrifugation at 35,000 x g. The GST-HNF-3ß fusion protein was purified over glutathione Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ). PBS [140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4 (pH 7.3)] was used for column equilibration and wash buffer. The cell lysate was loaded onto the column and washed with four column volumes of PBS. GST-HNF-3ß was then eluted using a three column-volume gradient from PBS to 50 mM Tris (pH 8.0), 10 mM reduced glutathione. His-FKHR was purified using Ni2+-nitrilotriacetic acid (Ni2+-NTA) (QIAGEN, Valencia, CA). A mixture of 20 mM Tris (pH 8.0), 150 mM NaCl, 5 mM ß-mercaptoethanol, and 25 mM imidazole was used for column equilibration and wash buffer. The cell lysate was loaded onto a 20-ml column and washed with four column volumes of wash buffer. His-FKHR protein was then eluted using a seven column-volume linear gradient of imidazole (from 25–300 mM). Purified proteins were dialyzed against 50 mM HEPES (pH 7.8), 20 mM NaCl to exchange the buffer. GST-HNF-3ß and His-FKHR protein concentrations were determined using the Bradford assay (Bio-Rad, Hercules, CA).

In Vitro DNase I Footprinting Analysis
To study protein binding to the proximal region of the G6Pase promoter by DNase I footprinting, the –484 to +66 G6Pase-luciferase fusion gene was used as a template in a PCR with the following primers: For sense strand analysis: 5' to 3'; (–274)TTCAAGGACCAGGAAGGAGG (–255) and (+72)TTGGTACCTCAGGAAGCTGC(+53) and for antisense strand analysis: 5' to 3'; (–406)CTTAAAAGGTCACTTCCGGC(–387) and (–58)CAGCCCTGATCTTTGGACTC(–77). One hundred picomoles of the –274/–255 or the –58/–77 primer was end-labeled with [{gamma}-32P]ATP to visualize the sense or antisense strand of the promoter, respectively. The probe was generated by PCR amplification using 10 ng of template DNA, 100 pmol of each primer, and the following reaction conditions: 94 C, 30 sec; 54 C (sense strand)/60 C (antisense strand), 30 sec; 72 C, 30 sec for 35 cycles. Eighteen microliters of probe cocktail [20 mM HEPES (pH 7.8), 2 mM dithiothreitol (DTT), 50 mM NaCl, 30 ng/µl poly- (deoxyinosine-deoxycytosine) poly(dI-dC)·poly(dI-dC), 50,000 cpm probe/sample] was incubated with 18 µl of increasing concentrations of recombinant protein. The protein samples were brought to a volume of 18 µl using the following buffers: GR [10 mM potassium phosphate (pH 7.4), 5 mM DTT, 0.1 mM EDTA, 10 mM sodium molybdate, 10% glycerol], GST-HNF-3ß and His-FKHR [50 mM HEPES (pH 7.8), 20 mM NaCl, 0.2 µg/µl BSA). 4.0 µl of diluted (1:1000–1:1250 dilution of original 10 U/µl stock) DNase I (DNase I dilution buffer = 20 mM HEPES, 2 mM DTT, 37.5 mM MgCl2, and 18.75 mM CaCl2) was added to each sample for 2 min at room temperature. DNase I (125 µl) stop solution [100 mM Tris (pH 7.4), 15 mM EDTA, 0.4% SDS, 100 mM NaCl, 0.1 µg/µl tRNA] and 20 µl of proteinase K (20 µg/µl) were then added to each sample and they were incubated for 2 h-overnight at 65 C. The DNA was precipitated, resuspended in 8.0 µl of loading buffer (95% formamide, 0.025% xylene cyanol and bromophenol blue, 18 mM EDTA, 0.025% SDS), and 5.0 µl of each sample was separated on a 5% polyacrylamide gel. The results were visualized by autoradiography. To determine the identity of the protected nucleotides, G and G+A chemical sequencing reactions (105, 106) were performed using the labeled promoter fragment and DNA fragments were separated on the polyacrylamide gel alongside the DNase I-treated samples.

Cell Culture, Transient Transfection, and Luciferase Assay
Rat H4IIE hepatoma cells were grown in DMEM containing 2.5% (vol/vol) fetal calf serum and 2.5% (vol/vol) newborn calf serum. Cells were transiently transfected in suspension with the plasmids indicated in the figure legends using the calcium phosphate-DNA coprecipitation method as previously described (107, 108). Luciferase assays were performed using the Promega Dual-Luciferase Reporter Assay System according to the manufacturer’s instructions. For comparisons of basal gene expression and forkhead-stimulated gene expression, firefly luciferase activity directed by the various fusion gene constructs was expressed relative to SV40-Renilla luciferase activity in the same sample. Because dexamethasone inhibits SV40-Renilla expression about 2-fold in H4IIE cells (data not shown), for comparisons of the effect of dexamethasone on fusion gene expression, firefly luciferase activity from control, and dexamethasone-treated cells was corrected for the protein concentration in the cell lysate, as measured by the Pierce BCA assay (Rockford, IL). Each construct was analyzed in duplicate or in quadruplicate in multiple transfections, as specified in the figure legends, using at least three independent plasmid preparations.

ChIP Assay and Real-Time PCR Analysis
PCR amplification of the rat G6Pase promoter fragment, visualized by gel electrophoresis in Fig. 6AGo, was performed as previously described (54). Real-time PCR analyses, shown in Fig. 6Go, B and C, were performed using a Bio-Rad iCycler (Hercules, CA). Real-time PCR primers were designed to amplify the rat G6Pase promoter [5' to 3'; (–257)CACCCCTTAGCACTGTCAAGCCGTGTG(–231) and (–39)GGATTCAGTCTGTAGGTCAACCTAGCCC(–66)] and exon 5 (5' to 3'; (+686)AATGCCAGCCTCAAGAAATATTTTCTC (+712) and (+861)AGGCTGGCAAAGGGTGTGGTGTCAATG (+835)]. The rat G6Pase promoter and exon 5 fragments were amplified using the Bio-Rad iQ SYBR Green Supermix (Hercules, CA) and the following reaction conditions: 95 C, 30 sec; 60 C, 30 sec; 72 C, 30 sec for 40 cycles. Standard curve analyses were performed for each set of samples to determine the efficiencies of the promoter and exon 5 PCRs, which ranged from 87–95% efficiency. The fold enrichment over the IgG negative control was determined using the CT method (109) and the following calculation: fold enrichment = [1+ (PCR efficiency)(0.01)]n; where n = (CT IgG antibody) – (CT experimental antibody), and CT = threshold cycle.

Gel Retardation Assay
Labeled Probes.
Oligonucleotides representing the sense and antisense strands of a consensus GRE, nGRE D, GRE B and the G6Pase promoter sequence from –271 to –231 were synthesized with HindIII or BamHI compatible ends (Table 1Go), gel purified, annealed and then labeled with [{alpha}-32P]deoxy-ATP using the Klenow fragment of Escherichia coli DNA polymerase I to a specific activity of approximately 2.5 µCi/pmol.

Nuclear Extract Preparation.
H4IIE nuclear extracts were prepared exactly as previously described (110).

GR-DBD Binding Assay.
Labeled GRE oligonucleotides (~7 fmol, ~30,000 cpm) were incubated with purified GR-DBD (10–1000 ng) (104) in a final reaction volume of 20 µl containing 20 mM HEPES (pH 7.8), 50 mM NaCl, 0.38 mM spermidine, 0.08 mM spermine, 0.1 mM EDTA, 1 mM EGTA, 2 mM DTT, 12.5% glycerol (vol/vol), 250 ng of poly(dI-dC)·poly(dI-dC) and 100 ng BSA. After incubation for 10 min at room temperature and then 10 min on ice, the reactants were loaded onto a 6% polyacrylamide gel containing 0.25x TBE (22.5 mM Tris base, 22.5 mM boric acid, 0.5 mM EDTA) and 2.5% (vol/vol) glycerol. Samples were electrophoresed at 4 C for 150 min in 0.25x TBE. After electrophoresis, the gels were dried, exposed to Kodak XAR5 film (Eastman Kodak, Rochester, NY), and binding was analyzed by autoradiography.

Negative Accessory Factor Binding Assay.
When the G6Pase –271/–231 oligonucleotide was used as the labeled probe, the binding conditions were identical with those described for GR-DBD except that H4IIE nuclear extract (5 µg) was used, BSA was omitted and poly(dI-dC)·poly(dI-dC) was increased to 0.5 µg. In addition, after incubation for 10 min at room temperature, the reactants were loaded onto a 6% polyacrylamide gel containing 1x TGE (25 mM Tris Base, 190 mM glycine, 1 mM EDTA) and 2.5% (vol/vol) glycerol. Samples were electrophoresed at room temperature for 90 min in 1x TGE.

Competition Experiments.
For competition experiments (Figs. 7EGo and 8CGo), the indicated unlabeled double-stranded oligonucleotides (100- to 500-fold molar excess) were mixed with the labeled oligomer before addition of nuclear extract or GR-DBD. Binding was then analyzed by acrylamide gel electrophoresis as described above. Data were quantitated through the use of a Packard Instant Imager.

Statistical Analysis
The transfection data and ChIP assay data were analyzed for differences from the control values, as specified in the figure legends. Statistical comparisons were calculated using an unpaired Student’s t test. The level of significance was P < 0.05 (two-sided test).


    ACKNOWLEDGMENTS
 
We thank Jen-Chywan Wang (University of California-San Francisco), Keith Yamamoto (University of California-San Francisco), Frederic Barr (University of Pennsylvania, Philadelphia, PA), David Powell (Baylor College of Medicine, Houston, TX), James Darnell (The Rockefeller University, New York, NY), and Daryl Granner (Vanderbilt University), for providing critical reagents. We also thank Thierry Grange (Centre National de la Recherche Scientifique, Paris, France) and Roger Colbran (Vanderbilt University) for helpful comments and discussion on the work presented and James Hagman (National Jewish Medical and Research Center, Denver, CO), Barbara Graves (Universirty of Utah, Salt Lake City, UT), Juergen Dittmer (University of Halle-Wittenberg, Halle, Germany), Dennis K. Watson (Medical University of South Carolina, Charleston, SC) and Tsuneyuki Oikawa (Sasaki Institute, Kandra-Surugadai, Chiyoda-ku, Tokyo, Japan) for advice on the study of Ets factors.


    FOOTNOTES
 
Research in the laboratory of R.O’B. was supported by National Institutes of Health (NIH) Grant DK56374 and by NIH Grant P60 DK20593, which supports the Vanderbilt Diabetes Center Core Laboratory. B.V.K. was supported by the Vanderbilt Molecular Endocrinology Training Program (5T32 DK07563). Research in the laboratory of W.J.C. was supported by NIH Grant GM65484 and C.V.K. was supported by the Vanderbilt Molecular Biophysics Training Program (5T32 GM08320).

First Published Online July 21, 2005

Abbreviations: CAT, Chloramphenicol acetyltransferase; CBP, CREB-binding protein; C/EBP, CCAAT/enhancer binding protein; ChIP, chromatin immunoprecipitation; CRE, cAMP response element; CREB, CRE binding protein; poly- (dI-dC), poly(deoxyinosine-deoxycytosine); DNase, deoxyribonuclease; DTT, dithiothreitol; G6P, glucose-6-phosphate; G6Pase, glucose-6-phosphatase catalytic subunit; GR, glucocorticoid receptor; GRE, glucocorticoid response elements; GRU, glucocorticoid response unit; GST, glutathione-S-transferase; HNF, hepatocyte nuclear factor; IRS, insulin response sequence; MMTV, mouse mammary tumor virus; nGRE, negative GRE; PEPCK, phosphoenolpyruvate carboxykinase; SDM, site-directed mutation; SRC, steroid receptor coactivator; TAT, tyrosine aminotransferase; TK, thymidine kinase.

Received for publication December 8, 2004. Accepted for publication July 13, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. van de Werve G, Lange A, Newgard C, Mechin MC, Li Y, Berteloot A 2000 New lessons in the regulation of glucose metabolism taught by the glucose 6-phosphatase system. Eur J Biochem 267:1533–1549[Medline]
  2. Van Schaftingen E, Gerin I 2002 The glucose-6-phosphatase system. Biochem J 362:513–532[CrossRef][Medline]
  3. Rajas F, Bruni N, Montano S, Zitoun C, Mithieux G 1999 The glucose-6 phosphatase gene is expressed in human and rat small intestine: regulation of expression in fasted and diabetic rats. Gastroenterology 117:132–139[CrossRef][Medline]
  4. Arden SD, Zahn T, Steegers S, Webb S, Bergman B, O’Brien RM, Hutton JC 1999 Molecular cloning of a pancreatic islet-specific glucose-6-phosphatase catalytic subunit-related protein. Diabetes 48:531–542[Abstract]
  5. Khan A, Zong-Chao L, Efendic S, Landau BR 1998 Glucose-6-phosphatase activity in the hypothalamus of the ob/ob mouse. Metabolism 47:627–629[CrossRef][Medline]
  6. Lei KJ, Shelly LL, Pan CJ, Sidbury JB, Chou JY 1993 Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a. Science 262:580–583[Abstract/Free Full Text]
  7. Gerin I, Veiga-da-Cunha M, Achouri Y, Collet JF, Van Schaftingen E 1997 Sequence of a putative glucose 6-phosphate translocase, mutated in glycogen storage disease type Ib. FEBS Lett 419:235–238[CrossRef][Medline]
  8. Streeper RS, Svitek CA, Goldman JK, O’Brien RM 2000 Differential role of hepatocyte nuclear factor-1 in the regulation of glucose-6-phosphatase catalytic subunit gene transcription by cAMP in liver- and kidney-derived cell lines. J Biol Chem 275:12108–12118[Abstract/Free Full Text]
  9. Lange AJ, Argaud D, el-Maghrabi MR, Pan W, Maitra SR, Pilkis SJ 1994 Isolation of a cDNA for the catalytic subunit of rat liver glucose-6- phosphatase: regulation of gene expression in FAO hepatoma cells by insulin, dexamethasone and cAMP. Biochem Biophys Res Commun 201:302–309[CrossRef][Medline]
  10. Lin B, Morris DW, Chou JY 1998 Hepatocyte nuclear factor 1{alpha} is an accessory factor required for activation of glucose-6-phosphatase gene transcription by glucocorticoids. DNA Cell Biol 17:967–974[Medline]
  11. Hornbuckle LA, Edgerton DS, Ayala JE, Svitek CA, Oeser JK, Neal DW, Cardin S, Cherrington AD, O’Brien RM 2001 Selective, tonic inhibition of G6Pase catalytic subunit but not G6P transporter gene expression by insulin in vivo. Am J Physiol 281:E713–E725
  12. Argaud D, Zhang Q, Pan W, Maitra S, Pilkis SJ, Lange AJ 1996 Regulation of rat liver glucose-6-phosphatase gene expression in different nutritional and hormonal states: gene structure and 5'-flanking sequence. Diabetes 45:1563–1571[Abstract]
  13. Schmoll D, Allan BB, Burchell A 1996 Cloning and sequencing of the 5' region of the human glucose-6-phosphatase gene: transcriptional regulation by cAMP, insulin and glucocorticoids in H4IIE hepatoma cells. FEBS Lett 383:63–66[CrossRef][Medline]
  14. Streeper RS, Svitek CA, Chapman S, Greenbaum LE, Taub R, O’Brien RM 1997 A multicomponent insulin response sequence mediates a strong repression of mouse glucose-6-phosphatase gene transcription by insulin. J Biol Chem 272:11698–11701[Abstract/Free Full Text]
  15. Kumar R, Thompson EB 1999 The structure of the nuclear hormone receptors. Steroids 64:310–319[CrossRef][Medline]
  16. Newton R 2000 Molecular mechanisms of glucocorticoid action: what is important? Thorax 55:603–613[Free Full Text]
  17. Adcock IM 2000 Molecular mechanisms of glucocorticosteroid actions. Pulm Pharmacol Ther 13:115–126[CrossRef][Medline]
  18. Jenkins BD, Pullen CB, Darimont BD 2001 Novel glucocorticoid receptor coactivator effector mechanisms. Trends Endocrinol Metab 12:122–126[CrossRef][Medline]
  19. Deroo BJ, Archer TK 2001 Glucocorticoid receptor-mediated chromatin remodeling in vivo. Oncogene 20:3039–3046[CrossRef][Medline]
  20. Hebbar PB, Archer TK 2003 Chromatin remodeling by nuclear receptors. Chromosoma 111:495–504[Medline]
  21. Payvar F, Firestone GL, Ross SR, Chandler VL, Wrange O, Carlstedt-Duke J, Gustafsson JA, Yamamoto KR 1982 Multiple specific binding sites for purified glucocorticoid receptors on mammary tumor virus DNA. J Cell Biochem 19:241–247[CrossRef][Medline]
  22. Scheidereit C, Geisse S, Westphal HM, Beato M 1983 The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature 304:749–752[CrossRef][Medline]
  23. Payvar F, DeFranco D, Firestone GL, Edgar B, Wrange O, Okret S, Gustafsson JA, Yamamoto KR 1983 Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region. Cell 35:381–392[CrossRef][Medline]
  24. Jantzen HM, Strahle U, Gloss B, Stewart F, Schmid W, Boshart M, Miksicek R, Schutz G 1987 Cooperativity of glucocorticoid response elements located far upstream of the tyrosine aminotransferase gene. Cell 49:29–38[CrossRef][Medline]
  25. Grange T, Roux J, Rigaud G, Pictet R 1989 Two remote glucocorticoid responsive units interact cooperatively to promote glucocorticoid induction of rat tyrosine aminotransferase gene expression. Nucleic Acids Res 17:8695–8709[Abstract/Free Full Text]
  26. Imai E, Stromstedt PE, Quinn PG, Carlstedt-Duke J, Gustafsson JA, Granner DK 1990 Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 10:4712–4719[Abstract/Free Full Text]
  27. Beato M, Chalepakis G, Schauer M, Slater EP 1989 DNA regulatory elements for steroid hormones. J Steroid Biochem 32:737–747[CrossRef][Medline]
  28. Strahle U, Klock G, Schutz G 1987 A DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression. Proc Natl Acad Sci USA 84:7871–7875[Abstract/Free Full Text]
  29. Nordeen SK, Suh BJ, Kuhnel B, Hutchison CD 1990 Structural determinants of a glucocorticoid receptor recognition element. Mol Endocrinol 4:1866–1873[Abstract/Free Full Text]
  30. Lucas PC, Granner DK 1992 Hormone response domains in gene transcription. Annu Rev Biochem 61:1131–1173[CrossRef][Medline]
  31. Aranda A, Pascual A 2001 Nuclear hormone receptors and gene expression. Physiol Rev 81:1269–1304[Abstract/Free Full Text]
  32. Grange T, Cappabianca L, Flavin M, Sassi H, Thomassin H 2001 In vivo analysis of the model tyrosine aminotransferase gene reveals multiple sequential steps in glucocorticoid receptor action. Oncogene 20:3028–3038[CrossRef][Medline]
  33. Cato AC, Skroch P, Weinmann J, Butkeraitis P, Ponta H 1988 DNA sequences outside the receptor-binding sites differently modulate the responsiveness of the mouse mammary tumour virus promoter to various steroid hormones. EMBO J 7:1403–1410[Medline]
  34. Buetti E, Kuhnel B, Diggelmann H 1989 Dual function of a nuclear factor I binding site in MMTV transcription regulation. Nucleic Acids Res 17:3065–3078[Abstract/Free Full Text]
  35. Truss M, Chalepakis G, Beato M 1992 Interplay of steroid hormone receptors and transcription factors on the mouse mammary tumor virus promoter. J Steroid Biochem Mol Biol 43:365–378[CrossRef][Medline]
  36. Prefontaine GG, Walther R, Giffin W, Lemieux ME, Pope L, Hache RJ 1999 Selective binding of steroid hormone receptors to octamer transcription factors determines transcriptional synergism at the mouse mammary tumor virus promoter. J Biol Chem 274:26713–26719[Abstract/Free Full Text]
  37. Aurrekoetxea-Hernandez K, Buetti E 2000 Synergistic action of GA-binding protein and glucocorticoid receptor in transcription from the mouse mammary tumor virus promoter. J Virol 74:4988–4998[Abstract/Free Full Text]
  38. Grange T, Roux J, Rigaud G, Pictet R 1991 Cell-type specific activity of two glucocorticoid responsive units of rat tyrosine aminotransferase gene is associated with multiple binding sites for C/EBP and a novel liver-specific nuclear factor. Nucleic Acids Res 19:131–139[Abstract/Free Full Text]
  39. Espinas ML, Roux J, Ghysdael J, Pictet R, Grange T 1994 Participation of Ets transcription factors in the glucocorticoid response of the rat tyrosine aminotransferase gene. Mol Cell Biol 14:4116–4125[Abstract/Free Full Text]
  40. Roux J, Pictet R, Grange T 1995 Hepatocyte nuclear factor 3 determines the amplitude of the glucocorticoid response of the rat tyrosine aminotransferase gene. DNA Cell Biol 14:385–396[Medline]
  41. Wang JC, Stromstedt PE, O’Brien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the stimulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Mol Endocrinol 10:794–800[Abstract/Free Full Text]
  42. Wang JC, Stromstedt PE, Sugiyama T, Granner DK 1999 The phosphoenolpyruvate carboxykinase gene glucocorticoid response unit: identification of the functional domains of accessory factors HNF3 ß (hepatic nuclear factor-3ß) and HNF4 and the necessity of proper alignment of their cognate binding sites. Mol Endocrinol 13:604–618[Abstract/Free Full Text]
  43. Wang JC, Stafford JM, Scott DK, Sutherland C, Granner DK 2000 The molecular physiology of hepatic nuclear factor 3 in the regulation of gluconeogenesis. J Biol Chem 275:14717–14721[Abstract/Free Full Text]
  44. Hall RK, Sladek FM, Granner DK 1995 The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci USA 92:412–416[Abstract/Free Full Text]
  45. Stafford JM, Wilkinson JC, Beechem JM, Granner DK 2001 Accessory factors facilitate the binding of glucocorticoid receptor to the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 276:39885–39891[Abstract/Free Full Text]
  46. Yamada K, Duong DT, Scott DK, Wang JC, Granner DK 1999 CCAAT/enhancer-binding protein beta is an accessory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 274:5880–5887[Abstract/Free Full Text]
  47. Rogatsky I, Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq CM, Darimont BD, Garabedian MJ, Yamamoto KR 2003 Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor. Proc Natl Acad Sci USA 100:13845–13850[Abstract/Free Full Text]
  48. Beale EG, Tishler EJ 1992 Expression and regulation of cytosolic phosphoenolpyruvate carboxykinase in 3T3-L1 adipocytes. Biochem Biophys Res Commun 189:925–930[CrossRef][Medline]
  49. Franckhauser-Vogel S, Antras-Ferry J, Robin D, Robin P, Forest C 1997 Transcriptional and posttranscriptional mechanisms of glucocorticoid-mediated repression of phosphoenolpyruvate carboxykinase gene expression in adipocytes. J Cell Biochem 66:386–393[CrossRef][Medline]
  50. Arizmendi C, Liu S, Croniger C, Poli V, Friedman JE 1999 The transcription factor CCAAT/enhancer-binding protein ß regulates gluconeogenesis and phosphoenolpyruvate carboxykinase (GTP) gene transcription during diabetes. J Biol Chem 274:13033–13040[Abstract/Free Full Text]
  51. Olswang Y, Blum B, Cassuto H, Cohen H, Biberman Y, Hanson RW, Reshef L 2003 Glucocorticoids repress transcription of phosphoenolpyruvate carboxykinase (GTP) gene in adipocytes by inhibiting its C/EBP-mediated activation. J Biol Chem 278:12929–12936[Abstract/Free Full Text]
  52. Drouin J, Trifiro MA, Plante RK, Nemer M, Eriksson P, Wrange O 1989 Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9:5305–5314[Abstract/Free Full Text]
  53. Chatterjee VK, Madison LD, Mayo S, Jameson JL 1991 Repression of the human glycoprotein hormone {alpha}-subunit gene by glucocorticoids: evidence for receptor interactions with limiting transcriptional activators. Mol Endocrinol 5:100–110[Abstract/Free Full Text]
  54. Vander Kooi BT, Streeper RS, Svitek CA, Oeser JK, Powell DR, O’Brien RM 2003 The Three insulin response sequences in the glucose-6-phosphatase catalytic subunit gene promoter are functionally distinct. J Biol Chem 278:11782–11793[Abstract/Free Full Text]
  55. Lin B, Morris DW, Chou JY 1997 The role of HNF1{alpha}, HNF3{gamma}, and cyclic AMP in glucose-6-phosphatase gene activation. Biochemistry 36:14096–14106[CrossRef][Medline]
  56. Streeper RS, Eaton EM, Ebert DH, Chapman SC, Svitek CA, O’Brien RM 1998 Hepatocyte nuclear factor-1 acts as an accessory factor to enhance the inhibitory action of insulin on mouse glucose-6-phosphatase gene transcription. Proc Natl Acad Sci USA 95:9208–9213[Abstract/Free Full Text]
  57. Boustead JN, Stadelmaier BT, Eeds AM, Wiebe PO, Svitek CA, Oeser JK, O’Brien RM 2003 Hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}) mediates the stimulatory effect of peroxisome proliferator activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) on glucose-6-phosphatase catalytic subunit gene transcription in H4IIE cells. Biochem J 369:17–22[CrossRef][Medline]
  58. Schmoll D, Wasner C, Hinds CJ, Allan BB, Walther R, Burchell A 1999 Identification of a cAMP response element within the glucose-6-phosphatase hydrolytic subunit gene promoter which is involved in the transcriptional regulation by cAMP and glucocorticoids in H4IIE hepatoma cells. Biochem J 338:457–463
  59. Hornbuckle LA, Everett CA, Martin CC, Gustavson SS, Svitek CA, Oeser JK, Neal DW, Cherrington AD, O’Brien RM 2004 Selective stimulation of G-6-Pase catalytic subunit but not G-6-P transporter gene expression by glucagon in vivo and cAMP in situ. Am J Physiol Endocrinol Metab 286:E795–E808
  60. Suh DS, Rechler MM 1997 Hepatocyte nuclear factor 1 and the glucocorticoid receptor synergistically activate transcription of the rat insulin-like growth factor binding protein-1 gene. Mol Endocrinol 11:1822–1831[Abstract/Free Full Text]
  61. Ayala JE, Streeper RS, Desgrosellier JS, Durham SK, Suwanichkul A, Svitek CA, Goldman JK, Barr FG, Powell DR, O’Brien RM 1999 Conservation of an insulin response unit between mouse and human glucose-6-phosphatase catalytic subunit gene promoters: transcription factor FKHR binds the insulin response sequence. Diabetes 48:1885–1889[Abstract]
  62. Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther R, Unterman TG 2000 Regulation of glucose-6-phosphatase gene expression by protein kinase B{alpha} and the forkhead transcription factor FKHR: evidence for insulin response unit-dependent and -independent effects of insulin on promoter activity. J Biol Chem 275:36324–36333[Abstract/Free Full Text]
  63. Nasrin N, Ogg S, Cahill CM, Biggs W, Nui S, Dore J, Calvo D, Shi Y, Ruvkun G, Alexander-Bridges MC 2000 DAF-16 recruits the CREB-binding protein coactivator complex to the insulin-like growth factor binding protein 1 promoter in HepG2 cells. Proc Natl Acad Sci USA 97:10412–10417[Abstract/Free Full Text]
  64. Kwon HS, Huang B, Unterman TG, Harris RA 2004 Protein kinase B-{alpha} inhibits human pyruvate dehydrogenase kinase-4 gene induction by dexamethasone through inactivation of FOXO transcription factors. Diabetes 53:899–910[Abstract/Free Full Text]
  65. Furuyama T, Nakazawa T, Nakano I, Mori N 2000 Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. Biochem J 349:629–634[CrossRef][Medline]
  66. Biggs 3rd WH, Cavenee WK, Arden KC 2001 Identification and characterization of members of the FKHR (FOX O) subclass of winged-helix transcription factors in the mouse. Mamm Genome 12:416–425[CrossRef][Medline]
  67. Costa RH, Grayson DR, Darnell Jr JE 1989 Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and {alpha} 1-antitrypsin genes. Mol Cell Biol 9:1415–1425[Abstract/Free Full Text]
  68. Lai E, Prezioso VR, Smith E, Litvin O, Costa RH, Darnell Jr JE 1990 HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev 4:1427–1436[Abstract/Free Full Text]
  69. Lai E, Prezioso VR, Tao WF, Chen WS, Darnell Jr JE 1991 Hepatocyte nuclear factor 3 {alpha} belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev 5:416–427[Abstract/Free Full Text]
  70. Overdier DG, Porcella A, Costa RH 1994 The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix. Mol Cell Biol 14:2755–2766[Abstract/Free Full Text]
  71. Streeper RS, Hornbuckle LA, Svitek CA, Goldman JK, Oeser JK, O’Brien RM 2001 Protein kinase A phosphorylates hepatocyte nuclear factor-6 and stimulates glucose-6-phosphatase catalytic subunit gene transcription. J Biol Chem 276:19111–19118[Abstract/Free Full Text]
  72. Pierreux CE, Stafford J, Demonte D, Scott DK, Vandenhaute J, O’Brien RM, Granner DK, Rousseau GG, Lemaigre FP 1999 Antiglucocorticoid activity of hepatocyte nuclear factor-6. Proc Natl Acad Sci USA 96:8961–8966[Abstract/Free Full Text]
  73. Chalepakis G, Schauer M, Cao XA, Beato M 1990 Efficient binding of glucocorticoid receptor to its responsive element requires a dimer and DNA flanking sequences. DNA Cell Biol 9:355–368[Medline]
  74. Pontoglio M, Faust DM, Doyen A, Yaniv M, Weiss MC 1997 Hepatocyte nuclear factor 1{alpha} gene inactivation impairs chromatin remodeling and demethylation of the phenylalanine hydroxylase gene. Mol Cell Biol 17:4948–4956[Abstract]
  75. Soutoglou E, Papafotiou G, Katrakili N, Talianidis I 2000 Transcriptional activation by hepatocyte nuclear factor-1 requires synergism between multiple coactivator proteins. J Biol Chem 275:12515–12520[Abstract/Free Full Text]
  76. Parrizas M, Maestro MA, Boj SF, Paniagua A, Casamitjana R, Gomis R, Rivera F, Ferrer J 2001 Hepatic nuclear factor 1-{alpha} directs nucleosomal hyperacetylation to its tissue-specific transcriptional targets. Mol Cell Biol 21:3234–3243[Abstract/Free Full Text]
  77. Yoshida E, Aratani S, Itou H, Miyagishi M, Takiguchi M, Osumu T, Murakami K, Fukamizu A 1997 Functional association between CBP and HNF4 in trans-activation. Biochem Biophys Res Commun 241:664–669[CrossRef][Medline]
  78. Wang JC, Stafford JM, Granner DK 1998 SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 273:30847–30850[Abstract/Free Full Text]
  79. Torres-Padilla ME, Sladek FM, Weiss MC 2002 Developmentally regulated N-terminal variants of the nuclear receptor hepatocyte nuclear factor 4{alpha} mediate multiple interactions through coactivator and corepressor-histone deacetylase complexes. J Biol Chem 277:44677–44687[Abstract/Free Full Text]
  80. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353–5356[Abstract/Free Full Text]
  81. Savoldi G, Fenaroli A, Ferrari F, Rigaud G, Albertini A, Di Lorenzo D 1997 The glucocorticoid receptor regulates the binding of C/EPBß on the {alpha}-1-acid glycoprotein promoter in vivo. DNA Cell Biol 16:1467–1476[Medline]
  82. Mink S, Haenig B, Klempnauer KH 1997 Interaction and functional collaboration of p300 and C/EBPß. Mol Cell Biol 17:6609–6617[Abstract]
  83. Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y, Altomonte J, Dong H, Accili D, Spiegelman BM 2003 Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1{alpha} interaction. Nature 423:550–555[CrossRef][Medline]
  84. Sugiyama T, Scott DK, Wang JC, Granner DK 1998 Structural requirements of the glucocorticoid and retinoic acid response units in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 12:1487–1498[Abstract/Free Full Text]
  85. Kops GJ, Burgering BM 1999 Forkhead transcription factors: new insights into protein kinase B (c-akt) signaling. J Mol Med 77:656–665[CrossRef][Medline]
  86. Wolfrum C, Besser D, Luca E, Stoffel M 2003 Insulin regulates the activity of forkhead transcription factor Hnf-3ß/Foxa-2 by Akt-mediated phosphorylation and nuclear/cytosolic localization. Proc Natl Acad Sci USA 100:11624–11629[Abstract/Free Full Text]
  87. DeFranco DB, Ramakrishnan C, Tang Y 1998 Molecular chaperones and subcellular trafficking of steroid receptors. J Steroid Biochem Mol Biol 65:51–58[CrossRef][Medline]
  88. Wang XL, Herzog B, Waltner-Law M, Hall RK, Shiota M, Granner DK 2004 The synergistic effect of dexamethasone and all-trans-retinoic acid on hepatic phosphoenolpyruvate carboxykinase gene expression involves the coactivator p300. J Biol Chem 279:34191–34200[Abstract/Free Full Text]
  89. Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878–4884[Abstract/Free Full Text]
  90. Tootle TL, Rebay I 2005 Post-translational modifications influence transcription factor activity: a view from the ETS superfamily. Bioessays 27:285–298[CrossRef][Medline]
  91. Oikawa T, Yamada T 2003 Molecular biology of the Ets family of transcription factors. Gene 303:11–34[CrossRef][Medline]
  92. Eberhardt W, Schulze M, Engels C, Klasmeier E, Pfeilschifter J 2002 Glucocorticoid-mediated suppression of cytokine-induced matrix metalloproteinase-9 expression in rat mesangial cells: involvement of nuclear factor-{kappa}B and Ets transcription factors. Mol Endocrinol 16:1752–1766[Abstract/Free Full Text]
  93. Hollenhorst PC, Jones DA, Graves BJ 2004 Expression profiles frame the promoter specificity dilemma of the ETS family of transcription factors. Nucleic Acids Res 32:5693–5702[Abstract/Free Full Text]
  94. Zhu Q, Dudley JP 2002 CDP binding to multiple sites in the mouse mammary tumor virus long terminal repeat suppresses basal and glucocorticoid-induced transcription. J Virol 76:2168–2179[Abstract/Free Full Text]
  95. Maeda T, Maeda M, Stewart AF 2002 TEF-1 transcription factors regulate activity of the mouse mammary tumor virus LTR. Biochem Biophys Res Commun 296:1279–1285[CrossRef][Medline]
  96. Collier CD, Oshima H, Simons Jr SS 1996 A negative tyrosine aminotransferase gene element that blocks glucocorticoid modulatory element-regulated modulation of glucocorticoid-induced gene expression. Mol Endocrinol 10:463–476[Abstract/Free Full Text]
  97. Jackson DA, Collier CD, Oshima H, Simons Jr SS 1998 Modulation of TAT gene induction by glucocorticoids involves a neutralizing sequence. J Steroid Biochem Mol Biol 66:79–91[CrossRef][Medline]
  98. Martin CC, Oeser JK, Svitek CA, Hunter SI, Hutton JC, O’Brien RM 2002 Identification and characterization of a human cDNA and gene encoding a ubiquitously expressed glucose-6-phosphatase catalytic subunit-related protein. J Mol Endocrinol 29:205–222[Abstract]
  99. Higuchi R, Krummel B, Saiki RK 1988 A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:7351–7367[Abstract/Free Full Text]
  100. Luckow B, Schutz G 1987 CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
  101. Miesfeld R, Rusconi S, Godowski PJ, Maler BA, Okret S, Wikstrom AC, Gustafsson JA, Yamamoto KR 1986 Genetic complementation of a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46:389–399[CrossRef][Medline]
  102. Durham SK, Suwanichkul A, Scheimann AO, Yee D, Jackson JG, Barr FG, Powell DR 1999 FKHR binds the insulin response element in the insulin-like growth factor binding protein-1 promoter. Endocrinology 140:3140–3146[Abstract/Free Full Text]
  103. Allander SV, Durham SK, Scheimann AO, Wasserman RM, Suwanichkul A, Powell DR 1997 Hepatic nuclear factor 3 and high mobility group I/Y proteins bind the insulin response element of the insulin-like growth factor-binding protein-1 promoter. Endocrinology 138:4291–4300[Abstract/Free Full Text]
  104. Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB 1991 Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497–505[CrossRef][Medline]
  105. Maxam AM, Gilbert W 1977 A new method for sequencing DNA. Proc Natl Acad Sci USA 74:560–564[Abstract/Free Full Text]
  106. Maxam AM, Gilbert W 1980 Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol 65:499–560[Medline]
  107. O’Brien RM, Noisin EL, Granner DK 1994 Comparison of the effects of insulin and okadaic acid on phosphoenolpyruvate carboxykinase gene expression. Biochem J 303:737–742
  108. O’Brien RM, Lucas PC, Yamasaki T, Noisin EL, Granner DK 1994 Potential convergence of insulin and cAMP signal transduction systems at the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter through CCAAT/enhancer binding protein (C/EBP). J Biol Chem 269:30419–30428[Abstract/Free Full Text]
  109. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-{Delta}{Delta} C(T)) method. Methods 25:402–408[CrossRef][Medline]
  110. Streeper RS, Chapman SC, Ayala JE, Svitek CA, Goldman JK, Cave A, O’Brien RM 1998 A phorbol ester-insensitive AP-1 motif mediates the stimulatory effect of insulin on rat malic enzyme gene transcription. Mol Endocrinol 12:1778–1791[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   GR
Ligands:   Dexamethasone



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. Lee, D.-H. Kim, Y. H. Goo, Y. C. Lee, S.-K. Lee, and J. W. Lee
Crucial Roles for Interactions between MLL3/4 and INI1 in Nuclear Receptor Transactivation
Mol. Endocrinol., May 1, 2009; 23(5): 610 - 619.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
N. Nader, G. P. Chrousos, and T. Kino
Circadian rhythm transcription factor CLOCK regulates the transcriptional activity of the glucocorticoid receptor by acetylating its hinge region lysine cluster: potential physiological implications
FASEB J, May 1, 2009; 23(5): 1572 - 1583.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kato, J. Ding, E. Pisck, U. S. Jhala, and K. Du
COP1 Functions as a FoxO1 Ubiquitin E3 Ligase to Regulate FoxO1-mediated Gene Expression
J. Biol. Chem., December 19, 2008; 283(51): 35464 - 35473.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Kola, M. Christ-Crain, F. Lolli, G. Arnaldi, G. Giacchetti, M. Boscaro, A. B. Grossman, and M. Korbonits
Changes in Adenosine 5'-Monophosphate-Activated Protein Kinase as a Mechanism of Visceral Obesity in Cushing's Syndrome
J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4969 - 4973.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C. C Martin, B. P Flemming, Y. Wang, J. K Oeser, and R. M O'Brien
Foxa2 and MafA regulate islet-specific glucose-6-phosphatase catalytic subunit-related protein gene expression
J. Mol. Endocrinol., November 1, 2008; 41(5): 315 - 328.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. S. Waddell, L. M. Baehr, J. van den Brandt, S. A. Johnsen, H. M. Reichardt, J. D. Furlow, and S. C. Bodine
The glucocorticoid receptor and FOXO1 synergistically activate the skeletal muscle atrophy-associated MuRF1 gene
Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E785 - E797.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Christ-Crain, B. Kola, F. Lolli, C. Fekete, D. Seboek, G. Wittmann, D. Feltrin, S. C. Igreja, S. Ajodha, J. Harvey-White, et al.
AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: a novel mechanism in Cushing's syndrome
FASEB J, June 1, 2008; 22(6): 1672 - 1683.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
X. Huang, B. Jiao, C. K. Fung, Y. Zhang, W. K K Ho, C. B. Chan, H. Lin, D. Wang, and C. H K Cheng
The presence of two distinct prolactin receptors in seabream with different tissue distribution patterns, signal transduction pathways and regulation of gene expression by steroid hormones
J. Endocrinol., August 1, 2007; 194(2): 373 - 392.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. K. Lovgren, M. Kovarova, and B. H. Koller
cPGES/p23 Is Required for Glucocorticoid Receptor Function and Embryonic Growth but Not Prostaglandin E2 Synthesis
Mol. Cell. Biol., June 15, 2007; 27(12): 4416 - 4430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. B. Pedersen, P. Zhang, C. Doumen, M. Charbonnet, D. Lu, C. B. Newgard, J. W. Haycock, A. J. Lange, and D. K. Scott
The promoter for the gene encoding the catalytic subunit of rat glucose-6-phosphatase contains two distinct glucose-responsive regions
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E788 - E801.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. K. Hall, X. L. Wang, L. George, S. R. Koch, and D. K. Granner
Insulin Represses Phosphoenolpyruvate Carboxykinase Gene Transcription by Causing the Rapid Disruption of an Active Transcription Complex: A Potential Epigenetic Effect
Mol. Endocrinol., February 1, 2007; 21(2): 550 - 563.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Onuma, B. T. Vander Kooi, J. N. Boustead, J. K. Oeser, and R. M. O'Brien
Correlation between FOXO1a (FKHR) and FOXO3a (FKHRL1) Binding and the Inhibition of Basal Glucose-6-Phosphatase Catalytic Subunit Gene Transcription by Insulin
Mol. Endocrinol., November 1, 2006; 20(11): 2831 - 2847.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vander Kooi, B. T.
Right arrow Articles by O’Brien, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vander Kooi, B. T.
Right arrow Articles by O’Brien, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals