| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Medicine, Baylor Breast Center, Baylor College of Medicine, Houston, Texas 77030
Address all correspondence and requests for reprints to: Powel H. Brown, Associate Prof. M.D., Ph.D., Department of Medicine, Baylor Breast Center, Baylor College of Medicine, Houston, Texas 77030. E-mail: pbrown{at}breastcenter.tmc.edu.
| ABSTRACT |
|---|
|
|
|---|
B (NF
B). We hypothesized that many estrogen-induced genes are dependent on AP-1 for their expression and that these genes can be identified using genomic strategies. Using cells expressing an inducible cJun dominant negative, we studied the estrogen induction of genes under conditions in which AP-1 was normal or blocked. We show that the expression of AP-1-dependent genes was inhibited by the cJun dominant negative and that AP-1 blockade does not affect mRNA ER
expression or estrogen induction of estrogen-responsive element activity. Using a microarray approach, we then identified 20 new estrogen-induced/AP-1-dependent genes. These estrogen-induced/AP-1-dependent genes contain a higher frequency of consensus AP-1 sites in their promoters and have increased sensitivity to the AP-1 stimulant tetradecanoyl phorbol acetate when compared with estrogen-induced genes whose expression was not affected by AP-1 blockade. We also show estrogen and AP-1-dependent recruitment of ER, steroid receptor coactivator-1, and p300 to the promoter of these genes by chromatin immunoprecipitation. These studies demonstrate that microarrays can be used in a reverse genetics approach to predict the functional promoter structure of large numbers of genes that are regulated by multiple transcription factors. | INTRODUCTION |
|---|
|
|
|---|
and ß in the presence of the steroid hormone estrogen (3, 4). However, although ERs have been studied for many years, the exact molecular mechanism by which ER regulates growth is not fully understood. Estrogen signaling through ER occurs through three distinct pathways. In the classical model of ER action, ligand-activated ER binds specifically to DNA at estrogen-responsive elements (EREs) through its DNA binding domain and brings coactivators and corepressors to the transcription site via its activator function (AF)-1 and AF-2 domains. This is considered the classical pathway for ER action at ERE-containing promoters.
Estrogen also modulates gene expression by a second mechanism in which ER interacts with other transcription factors, through a process referred to as transcription factor cross talk. In this case, ER modulates the activities of other transcription factors such as activator protein (AP)-1, nuclear factor-
B (NF
B) or SP-1, by stabilizing their DNA binding and/or recruiting coactivators to the complex (5, 6, 7, 8, 9). Consistent with this coactivator-like function, ER
lacking a functional DNA binding domain has been shown to modulate AP-1 transcription machinery (10).
The AP-1 transcription factor transduces multiple mitogenic growth signals including those from peptide growth factors such as IGF, erbB2, and EGF and the steroid hormones estrogen and progesterone (5, 11, 12, 13). We have previously shown that AP-1 transcriptional activity is blocked in MCF-7 cells by an inducible cJun dominant-negative mutant (TAM67) (14). This cJun dominant-negative mutant lacks the transactivation domain of cJun but is still able to dimerize with Jun and Fos family members and bind DNA at AP-1 sequences (14, 15). Previous studies demonstrate that blockade of AP-1 inhibits estrogen-stimulated growth, but the exact mechanism by which this occurs is not known (16).
Another mechanism by which estrogen and the ER affect gene expression has been termed the nongenomic pathway. In the nongenomic pathway, estrogen binds to the ER localized outside of the cell nucleus. This cytoplasmic or membrane localized ER in turn activates signal transduction pathways in the cytosol. Through this mechanism, estrogen has been shown to rapidly activate MAPK, and also to induce signal transduction pathways leading to protein kinase C and protein kinase A activation (17, 18, 19, 20, 21, 22, 23). The estrogen-induced activation of these cytoplasmic protein kinases leads to induction of genes that are downstream of these kinases cascades. Morten et al. (24) have shown that ERK-induced phosphorylation of the cJun transactivation domain activates the AP-1 transcription factor. Thus, some of the estrogen-induced ERK-activated genes may be regulated by the AP-1 transcription factor. The genes activated by this nongenomic pathway, such as those induced by ERK activation, would not require ER to bind DNA or to be present in the transcription factor complex.
In this study, we used a dominant-negative cJun mutant to determine the set of estrogen-induced genes that require AP-1 transactivation for their induction. Blockade of AP-1 by TAM67 inhibits the ability of estrogen to activate an AP-1 luciferase reporter activity as well as to induce the expression of AP-1-dependent endogenous genes in MCF-7 breast cancer cells. However, AP-1 blockade does not affect ER
expression or ERE-dependent gene transcription in these cells. Using a microarray approach, we identified sets of estrogen-induced genes that are either dependent or independent of AP-1 for their expression. Further characterization of the promoters of two identified estrogen-induced/AP-1-dependent genes [fibronectin-1 (FN1) and the known AP-1-regulated gene collagenase (MMP-1; matrix metalloproteinase)], revealed that AP-1 proteins, ER
, and coactivators were recruited to their AP-1 sites. Thus, these genes were regulated by ER using the second mechanism mentioned above (through transcription factor cross talk). These studies also showed that the binding of Tam67 to AP-1 sites in these promoters prevented binding of ER
and ER
-associated coactivators, thus revealing how TAM67 inhibits gene expression.
These results show that genomic approaches can be used to address complex transcription factor interactions. Such techniques allow for the study of the affect of ER transcription factor cross talk on a genome-wide scale rather than on an individual gene basis. Studies such as these will allow for better understanding of the complex molecular mechanisms by which multiple transcription factors regulate gene expression.
| RESULTS |
|---|
|
|
|---|
|
cJun Dominant-Negative Inhibits Estrogens Ability to Induce the Expression of AP-1-Dependent Genes
MCF-7 tet-off Tam67 cells were cultured in the presence and absence of doxycycline and treated with estradiol or vehicle to determine whether AP-1 blockade inhibits the expression of known estrogen-induced genes. Measurement of the known AP-1-dependent gene MMP-1 by quantitative-RT-PCR (Q-RT-PCR) analysis in these cells shows that estradiol treatment induces the expression MMP-1 (1.53-fold, P = 0.05, two-sample t test) and that AP-1 blockade by Tam67 inhibits both basal (50% reduction; P = 0.05, two-sample t test) and estrogen-induced MMP-1 expression (47% reduction; P = 0.031, two-sample t test) (Fig. 2A
). Studies have suggested that ER
confers estrogen responsiveness to the progesterone receptor (PR) gene by enhancing Sp1 interaction with the Sp1 site in the 80/34 region of the human PR gene (27, 28). Q-RT-PCR analysis confirmed that estrogen stimulates PR mRNA expression (2.1-fold induction, P = 0.002, two-sample t test), and that estrogen-induction of PR expression, was not inhibited by AP-1 blockade by Tam67 (2.0-fold induction, P = 0.043, two-sample t test) (Fig. 2B
). We next determined the affect of AP-1 blockade on the estrogen-induced cell cycle regulator cyclin D1. Q-RT-PCR analysis confirmed that 6 h of estrogen treatment stimulates cyclin D1 expression (1.4-fold, P = 0.024), and that AP-1 blockade by Tam67 inhibits estrogen-induction of Cyclin D1 expression (Fig. 2C
).
|
mRNA and protein expression were not affected by Tam67 expression (data not shown).
Identification of Estrogen and TAM67-Modulated Genes
We next used a microarray approach to identify additional estrogen-induced genes that are either dependent or not dependent on AP-1 transactivation for their expression. We hypothesized that those genes that were dependent on AP-1 for their estrogen induction (and thus share the same expression profile as MMP-1), might show similar regulation by estrogen and AP-1 as the MMP-1 gene. To test this hypothesis, we performed oligonucleotide microarray analysis using RNA samples from MCF-7 tet-off Tam67 cells stimulated with either estrogen or vehicle in the absence or presence of the cJun dominant negative. Four experimental groups were studied at each of two time points (6 and 24 h): MCF-7 cells with 1) Normal AP-1 [+Dox (doxycycline)], treated with vehicle, 2) Normal AP-1 (+Dox), treated with estrogen; 3) AP-1 blocked (Dox), treated with vehicle; and 4) AP-1 blocked (Dox), treated with estrogen (Fig. 3
). Three independent RNA samples were prepared for each time point for each experimental group. These RNAs were used to prepare cDNA, which in turn was hybridized to Affymetrix (Santa Clara, CA) U95A microarrays (one array per RNA sample; thus, three arrays per time point (6 and 24 h), for four experimental groups to yield a total of 24 arrays). By comparing vehicle-treated and estrogen-treated samples in the presence of doxycycline (normal AP-1), we identified estrogen-modulated genes (see tables published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). By comparing doxycycline-treated samples (normal AP-1) to those not treated with doxycycline (AP-1 blocked) we identified genes modulated by AP-1 blockade (TAM67 expression). Analyzing the expression of genes across all four experimental groups allowed us to identify genes coregulated by both estrogen and AP-1.
|
By comparing vehicle-treated groups in the presence and absence of Tam67, we were able to identify AP-1-regulated genes. One hundred and one Tam67-modulated genes were identified at 6 h; 32 of these genes were down-regulated and 69 of them were up-regulated (see supplemental data). Fifteen Tam67-modulated genes were identified at 24 h; nine of these genes were down-regulated, and six of them were up-regulated (see supplemental data).
Identification of Estrogen and TAM67 Comodulated Genes
For the identification of estrogen and AP-1 comodulated genes, we focused our analysis on those genes induced by estrogen at the 6-h time point. To investigate how AP-1 blockade affects the expression of estrogen-induced genes, we identified two groups of genes: 1) estrogen-induced genes whose expression was independent of AP-1 blockade (estrogen-induced/AP-1 independent profile) and 2) estrogen-induced genes whose estrogen-induction was dependent on AP-1 activity (estrogen-induced/AP-1-dependent profile). Of the 12,625 genes represented on the array, 3592 genes were expressed (called present) in the estrogen-treated, + doxycycline group on all three arrays. Forty-three of these genes were found to be significantly increased after 6 h of estrogen treatment (Fig. 4A
). Of these 43 estrogen-induced genes, 21 were not induced by estrogen in the presence of the AP-1 inhibitor, and 20 were still induced in the presence of the AP-1 inhibitor (estrogen-induced/AP-1 independent). Two genes were up-regulated by AP-1 blockade and not used in further analysis (Fig. 4A
).
|
|
|
|
|
Predicting Promoter Occupation from Expression Profiles
We next investigated the transcription factors and coactivator occupancy of AP-1 sites in the promoters of two estrogen-induced/AP-1-dependent genes. We predicted that the known AP-1-regulated gene MMP-1 and the putative AP-1-dependent gene, FN1, identified by our microarray analysis, might share similar promoter occupation. Primers were designed around the AP-1 sites within both the MMP-1 and FN1 gene promoters, and chromatin immunoprecipitation (ChIP) experiments were performed to investigate whether ER
, AP-1 family members, and coactivators were bound to the promoters of these genes.
ChIP of the flag-tagged cJun dominant negative, Tam67, shows that this protein occupies the AP-1 site in the MMP-1 promoter only in the absence of doxycyclin (Fig. 7A
). Furthermore, immunoprecipitation of Fos and ER
shows that estrogen recruits these proteins to the MMP-1 promoter and that this recruitment is inhibited by the expression of Tam67 (Fig. 7A
).
|
and coactivators at the AP-1 site.
MMP-1 and FN1 share similar microarray and Q-RT-PCR expression profile in response to estrogen treatment and AP-1 blockade. Therefore, we predicted that the effect of Tam67 on ER
and coactivator recruitment to the AP-1 site in FN1 would be similar to that of the MMP-1 promoter. ChIP of the flag-tagged cJun dominant negative, Tam67, shows that this protein is recruited to the FN1 AP-1 site only in the absence of dox (Fig. 7B
). Immunoprecipitation of Fos shows that it is present at the FN1 promoter. ER
is also recruited after estrogen treatment to the FN1 promoter and this recruitment is blocked by the expression of Tam67 (Fig. 7B
). Similar to the MMP-1 promoter, p300, and SRC-1 are also recruited to the FN1 AP-1 site after estrogen treatment and the presence of TAM67 reduces both basal and estrogen-stimulated coactivator promoter occupation (Fig. 7B
). Thus, the expression of the Jun dominant-negative mutant can block estrogen-induced gene expression of these two AP-1-dependent genes by reducing the occupation of these promoters by ER
and coactivators.
The gene IGFBP4 exhibited the estrogen-induced/AP-1-independent profile and was not induced by TPA treatment (Fig. 6
). Therefore, we predicted that Tam67 would not occupy the IGFBP4 promoter and that AP-1 blockade would not affect ER and coactivator occupation of the IGFBP4 promoter. A ChIP assay was designed to measure recruitment to a Sp-1-rich region shown previously to be responsible for much of estrogens ability to induce this gene in MCF-7 cells (30). ChIP of the flag-tagged cJun dominant negative, Tam67, shows no detectable protein recruitment to the IGFBP4 promoter (Fig. 7C
). Immunoprecipitation of Fos also shows no detectable protein recruitment. ER
and SRC-1 are recruited after estrogen treatment to the IGFBP4 promoter, and this recruitment is not affected by Tam67 expression (Fig. 7C
). p300 Is also present at this promoter (Fig. 7C
). Thus, the expression of the Jun dominant-negative mutant blocks estrogen-induced expression of two estrogen-induced/AP-1-dependent genes (MMP-1, FN1) and the occupation of their promoters by ER
and coactivators. However, by contrast, Tam67 expression does not affect estrogens ability to stimulate the estrogen-induced/AP-1-independent gene IGFBP4 expression, nor does Tam67 affect ER
and coactivator occupation of the IGFBP4 promoter.
| DISCUSSION |
|---|
|
|
|---|
There are multiple mechanisms by which the ER can regulate transcription: 1) through a classical pathway in which ER binds directly to EREs, 2) through a nonclassical pathway in which ER functions as a coactivator (transcription factor cross talk), or 3) through activation of cytoplasmic kinase cascade pathways (Fig. 8
). Gene expression can be induced by the classical pathway in which the ER binds directly to DNA at an ERE, recruiting coactivators and inducing transcription. However, surprisingly few ERE-controlled genes have been identified (31). BCL-2 is one example of a known ERE-containing gene (estrogen-induced Bcl-2 gene expression is not blocked by Tam67, estrogen-induced/AP-1-independent, data not shown) (32). From our studies, we have identified four estrogen-induced/AP-1-independent genes that contain potential ERE sequences in their promoters (PCP4, GREB1, NT5C2, and SDF1) (Fig. 8A
).
|
AF-2 domain is known to be involved in coactivator recruitment (34). Our data on the MMP-1 and FN1 promoters shows that estrogen treatment can induce AP-1 site occupation by ER, p300 and the p160 coactivator SRC-1. Studies defining the molecular mechanism of estrogen-ER action at an AP-1 site by Kushner and Webb (5, 12, 35) have suggested that in response to estrogen, ER binds to p160 coactivators in existing AP-1/coactivator complexes and they hypothesize that this triggers coactivators into a higher state of activity. Our data, shown here, support this hypothesis. The expression of Tam67 blocks AP-1 activity and basal coactivator recruitment to the MMP-1 AP-1 site. However, Tam67 does not completely abolish the ability of estrogen to stimulate MMP-1 gene expression or the estrogen-induced recruitment of ER, SRC-1, and p300 to the MMP-1 or FN1 AP-1 sites. Our results agree with a model of estrogen-ER activation of AP-1 by interaction with existing coactivator complexes that in turn stabilizes the entire complex and/or induces this complex into a higher state of activity. Through our studies here we have identified 6 additional estrogen-induced/AP-1-dependent genes that might also fit this model. These genes include FN1, TRIMM44, PODXL, UBE1, JAK1, MFN2. Their promoters contain potential AP-1 sites but no ERE sequences (Fig. 8B
Another model of ER/AP-1 coregulation is through complex interactions between distinct ERE and AP-1 binding sites (Fig. 8B
). This model has been shown to be critical for the expression of the pS2 gene that contains both an ERE and an AP-1 site within its promoter (36). We have identified two estrogen-induced/AP-1-dependent genes that contain both an AP-1 site and a potential ERE site (EMS-1, CAXII).
It is important to also recognize that estrogen can activate gene expression through more complex mechanisms. Other possible mechanisms of estrogen-induced gene expression include nongenomic stimulation of kinases cascades and indirect pathways of induction of growth factors signaling pathways (Fig. 8C
) (21). Because we have not performed ChIP analysis on all of the estrogen-induced genes found in our study, it is possible that some of them are regulated by the nongenomic pathway of estrogen signaling. The set of genes that are activated specifically or solely by membrane ER activation of nongenomic pathways have not yet been identified. However, genes that are activated solely by the nongenomic pathway would not be expected to have ER bound to their promoters. As described, we performed ChIP analysis for several genes (MMP-1, FN-1, and IGFBP4) to show that ER is indeed present in the transcription factor complex. At least for those genes examined by ChIP analysis, the likely mechanism by which TAM67 interferes with gene expression is by blocking/destabilizing the ER/AP-1 interaction and not by interfering with estrogens cytoplasmic signaling cascades. Measurement of phosphorylated ERK in the MCF-7 tet-off Tam67 cell line under the conditions of estrogen treatment used in this study did not show significant amounts of estrogen-stimulated ERK phosphorylation; however, by contrast IGF treatment induced large amounts of ERK phosphorylation (data not shown). These results suggest that the cytoplasmic estrogen-induced ERK signaling cascade is not a dominant pathway in our cell line.
Many of the estrogen-induced genes identified in this study are involved in regulation of critical cellular processes such as cell proliferation, apoptosis and cell motility (see Tables 1
and 2
). In particular, the estrogen-induced/AP-1-dependent genes regulate cell proliferation and motility. Indeed, two estrogen-induced/AP-1-dependent genes identified here have been previously shown to be prognostic markers in breast cancer patient survival (FN1, CAXII) (37, 52).
Our lab and others (14, 15, 16, 38, 39, 40, 41) have shown that blockade of AP-1 by Tam67 inhibits breast cancer cell growth by inducing a cell cycle blockade, and down-regulating cyclin D1 expression. The analysis presented here confirmed that TAM67 expression blocked estrogen-induced cyclin D1 expression (consistent with the induction of a G1 cell cycle block). In addition, the array studies demonstrated that expression of TAM67 blocks the estrogen-induced expression of several other genes that could contribute to suppression of cell growththese include blocking estrogen-induced expression of growth regulatory proteins such as cMyc (a growth-regulating transcription factor and proto-oncogene), the membrane-bound transcription factor protease (MBTPS1; an important regulatory of lipid metabolism), and the regulatory subunit of protein kinase A (PRKAR1A, which is activated by the ret oncogene). The cumulative effect of changes in the expression of these genes is blockade of estrogen-induced breast cancer cell growth (16).
Our results also show that TAM67 can block estrogen-induction of several genes involved in cell motility and invasion, including FN1, EMS1, tropomyosin 1, and actinin
1 (see Table 2
). Thus, agents that block AP-1 can suppress both cell growth and invasion.
Modulation of AP-1 activity by nuclear receptors is not exclusive to the ER. Retinoids also effect gene expression by modulation of AP-1. Activation of the retinoid receptors, retinoic acid receptor and retinoic X receptor, have been shown to down-regulate AP-1 activity by binding to the AP-1 complex or squelching coactivators (42, 43). Glucocorticoids can also down-regulate AP-1 activity in several cell types by interaction of Jun and Fos family members with the glucocorticoid receptor or by competing for essential coactivators (44, 45, 46). The nuclear hormone receptor PR has also been shown to be capable of modulating AP-1 activity in response to progesterone (11, 47). Thus, cross talk between steroid hormone receptors and AP-1 transcription factors is a general mechanism by which hormones can modulate growth factor pathways to regulate gene expression.
Studies such as those reported here demonstrate the value of a genome-wide approach to the investigation of gene regulation. The experimental approach used here to investigate the complex regulation of gene expression by two different transcription factors is applicable to many systems in which multiple transcription factors collaborate to regulate gene expression. Using genomic approaches, it is now possible to investigate the complex interactions between the transcription factors, coactivators, and gene promoters that ultimately regulate gene expression and control cancer cell growth.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Western Blotting Analysis
Cell lysates were prepared by treating cells with lysis buffer [50 mM Tris-HCl (pH 8.0), 2% sodium dodecyl sulfate, and protein kinase inhibitor cocktail]. Lysates were sheared by 22-gauge needle on ice and centrifuged at 10,000 x g for 30 min. The protein concentration of the supernatant was measured by the Bradford method. Thirty micrograms of protein were resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel. The proteins were transferred to a nitrocellulose membrane, and the membrane was then blocked in 5% nonfat dry milk TBST [10 mM Tris (pH 8.0), 150 mM NaCl, 0.05% Tween 20] at room temperature for 1 h. Membranes were probed with primary antibody anti-Flag (Sigma, St. Louis, MO; 1:10,000) and then the membranes were probed with a corresponding horseradish peroxidase-conjugated secondary antibody in 1% nonfat dry milk/TBST. The blots were visualized using the ECL Western blot detection system (Amersham Bioscience, Piscataway, NJ).
Luciferase Assay to Measure AP-1 and ER Activity
AP-1 transcriptional activity in cells was measured using the Dual-Luciferase Reporter Assay (Promega, Madison, WI) according to manufacturers protocol. The cells were cotransfected with the Col-Z-Luc reporter gene containing the luciferase gene linked to 1100 bp of the human collagenase gene promoter which contains a single AP-1 binding site (TGAG/CTCA) and pRL-TK, a Renilla construct for normalizing of transfection efficiency. Cells were transfected using Fugene 6 reagent (Roche, Indianapolis, IN) according to manufacturers recommendations. Transfected cells were starved of estrogen for 48 h in phenol red-free medium with 5% charcoal-stripped serum before transfection. Cells were then treated with 17ß-estradiol (109 M) 24 h after transfection and lysed 24 h after treatment. Luciferase activity was measured with equal amounts of cell extract using a microplate luminometer (Labsystems, Helsinki, Finland) and normalized with the Renilla activity.
To measure ER activity, the Vit-ERE-TK-Luc construct was employed instead of Col-Z-Luc to perform the luciferase assay. The cells were starved of estrogen for 24 h in phenol red-free medium with 5% charcoal-stripped serum, and then treated with 17ß-estradiol (109 M) for 12 h to stimulate the ERE activity before harvest. Statistical significance of triplicate assays was determined using a Students t test.
RNA Isolation
Total RNA was isolated using the RNeasy RNA isolation kit from QIAGEN, Inc. (Valencia, CA) as recommended by the supplier. Triplicate RNA samples were independently prepared for each treatment group.
Q-RT-PCR
Q-RT-PCR assays of transcripts were carried out using gene-specific double fluorescence-labeled probes in an ABI PRISM 7700 Sequence Detector (Applied Biosystems, Foster City, CA). The PCR mixture consisted of 300 nM each of the primers; 100 nM probe; 0.025 U/µl of Taq polymerase; 125 µM each of deoxynucleotide triphosphate; 3 mM MgCl2; and 1x Taq polymerase buffer. Cycling conditions were 94 C for 1 min, followed by 40 cycles at 94 C for 12 sec and 60 C for 1 min. All primers and probes were designed with Primer Express 1.0 software (Applied Biosystems Foster City, CA). 6-Carboxy fluorescein was used as the 5' fluorescent reporter, whereas tetramethylrhodamine was added to the 3' end as quencher. Standard curves for the quantification of each transcript and ß-actin were generated using the serially diluted solution of synthetic templates and genome equivalent copies were calculated from the standard curve. For each sample, TaqMan PCRs were performed in triplicate for each gene of interest and reference gene (ß-actin) to normalize for input cDNA. The ratio between the values obtained provided relative gene expression levels. Statistical significance was determined on triplicate samples using a Students t test.
Microarray Analysis
cDNA synthesis and cRNA labeling.
Twenty micrograms of total RNA were used in the first strand cDNA synthesis with 100 pmol T7-(deoxythymidine)24 primer [5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(deoxythymidine)24-3'], and second-strand cDNA synthesis was carried out at 16 C by adding 10 U Escherichia coli DNA ligase, 40 U E. coli DNA polymerase I, and 2 U ribonuclease H to the reaction, followed by 10 U of T4 DNA polymerase to blunt the ends of newly synthesized cDNA. The double-strand cDNA was purified through phenol/chloroform and ethanol precipitation. An in vitro transcription reaction was done to synthesize biotin-labeled antisense cRNA using a BioArray HighYield RNA transcript labeling kit (Enzo Diagnostics, Farmingdale, NY). The labeled cRNA was then purified using a RNeasy mini kit (QIAGEN) according to the manufacturers protocol and ethanol precipitated. The purified cRNA was fragmented in 1x fragmentation buffer (40 mM Tris-acetate, 100 mM KOAc, 30 mM MgOAc) at 94 C for 35 min.
Hybridization and Scanning.
For hybridization with Affymetrix oligonucleotide human GeneChip U95Av2, 15 µg of fragmented cRNA probe was incubated with 50 pM control oligonucleotide B2, 1x eukaryotic hybridization control (1.5 pM BioB, 5 pM BioC, 25 pM BioD, and 100 pM cre), 0.1 mg/ml herring sperm DNA, 0.5 mg/ml acetylated BSA and 1x manufacturer recommended hybridization buffer in a 45 C rotisserie oven for 16 h. The chips were washed in a fluidic station and the phycoerythrin-stained array was scanned as a digital image file as described in the Affymetrix GeneChip protocol (Affymetrix, Inc.)
Data Analysis
Each treatment for each time point was done in triplicate. Thus, three independent RNA samples were prepared for each time point for each treatment group. These RNAs were used to prepare cDNA, which was, in-turn, hybridized to Affymetrix U95A microarrays (one array per RNA sample; thus, three arrays per time point, per treatment for a total of 24 arrays). These RNAs include, after four experimental groups for each time point: MCF-7 cells with 1) normal AP-1, treated with vehicle; 2) normal AP-1, treated with estrogen; 3) AP-1 blockade, treated with vehicle; and 4) AP-1 blockade, treated with estrogen (Fig. 3
). The scanned image was generated and quantitated using Microarray Suite 5.0 (Affymetrix). Quality control factors include: low noise (RawQ <15), low background (<600), low 3' to 5' ratio of ß-actin and GAPDH (ratio <1.5) and presence of control genes cre, BioD, and BioC. Arrays that met these quality control criteria were used in low level analysis using invariant set normalization (baseline chip was 24 h estrogen + doxycycline A) and estimation of expression using the MBEI (model-based expression index) algorithm (PM only) as implemented in the dChip Analysis software package (48, 49). Comparative analysis was also performed using dChip. When comparing treatment groups, genes with differences of ±1.2-fold with a two-sample t test P < 0.05 are reported. To identify estrogen-induced/AP-1-dependent or -independent genes in the 6-h estrogen treatment group, the genes on the array were filtered for a presence call in all three of the estrogen plus doxycycline arrays. Genes termed estrogen induced/AP-1 dependent were selected by querying for genes that were both estrogen induced (fold change >1.2 P < 0.05) and showed a significant down-regulation (fold change < 1.2, P < 0.05) by doxycycline withdraw in the estrogen-treatment groups. Genes termed estrogen induced/AP-1 independent were selected by querying for genes that were both estrogen induced (fold change >1.2 P < 0.05) and showed no significant down-regulation (no fold change >1.2 or < 1.2) by doxycycline withdraw in the estrogen-treatment groups. The average profile of these groups of genes was determined using their gene-wise standardized values (48, 49). Gene lists were queried for the Gene Ontologies containing cell cycle, cell growth, cell motility, apoptosis, metabolism, cell adhesion, and integral membrane protein were generated using dChip.
Promoter Analysis
Two thousand base pairs of the promoter region were obtained for each selected gene by mapping the gene to its genomic sequence using the UCSC Golden Path Genome Browser (http://genome.ucsc.edu). These sequences were queried using TESS [Transcription Element Search System (www.cbil.upenn.edu/tess/)], a system that uses TRANSFAC version 4.0. Sites identified as potential AP-1 sites were then inspected for the sequence TGANTCA. The total number of TGANTCA AP-1/CRE sites was divided by the number of promoters searched in each group to obtain the average number of sites/gene. Genes chosen at random from the array were done so by using a random number generator (Microsoft Excel) to generate a random numerical value from zero to one for every gene present on the array. The set of genes with the 50 lowest random numbers were selected for promoter analysis. Statistical analysis of differences in AP-1 site frequency between AP-1-dependent, and AP-1-independent gene groups was done using a t test done as contrasts, using error mean square from ANOVA. ERE were identified using the Dragon ERE finder version 2.0 (http://sdmc.lit.org.sg/ERE-V2/index) (50).
RT-PCR
Low cycle RT-PCR assay of transcripts was carried out using gene-specific PCR primers. Total RNA was deoxyribonuclease treated at a reaction concentration of 133.3 ng/µl. One microliter (133.3 ng) of this cDNA was added to a 50-µl PCR. PCR was run at multiple cycles (ranging from 2630) for each transcript measured. All PCR samples were run on a standard 1% agarose Tris-acetate EDTA gel and visualized using a GelDoc EQ system (Bio-Rad, Hercules, CA). The lowest possible PCR cycle number yielding high quality visualization was used for quantitation. Quantitation was done using the Alpha Imager software by measuring pixel density. Triplicate RNA samples were averaged, and SE were calculated.
ChIP
Soluble, sonicated chromatin was prepared as previously described (51). Chromatin fractions were immunoprecipitated with 12 µg of indicated antibodies and the immune complexes were recovered using protein-G agarose beads and processed as described (51). The antibodies used were as follows: mouse antihuman ER
(Santa Cruz, Santa Cruz, CA), mouse antihuman pan-Fos (Promega), mouse antihuman IgG (Santa Cruz), mouse antihuman SRC-1 (Santa Cruz), mouse anti-Flag epitope (Sigma), and mouse antihuman p300 (Santa Cruz). The immunoprecipitated and input DNA samples were assessed in low cycle PCR using specific oligos designed for genomic sequences around AP-1 sites contained in the promoters or intronic sequence contained in the genes. Three different PCR cycles (ranging from 2432) were used to evaluate each assay and the lowest possible cycle with good visualization was chosen for representation. Input and intergenic controls were run at the same PCR cycle numbers as the immunoprecipitated samples.
The primers used for MMP-1 promoter are as follows:
242 Forward TTGCAACACCAAGTGATTCCA,
3 Reverse CCCAGCCTCTTGCTACTCCA,
+2550 Forward GAGTACAACTTACATCGTGTTGCAG,
+2708 Reverse ATATGGCTTGGATGCCATCAATGTC.
The primers used for ChIP on the FN1 promoter are as follows:
1029 Forward GAGGGCAAGACAGTACATAGG,
929 Reverse GGAAAGTTGGACCAGCTGTG,
+7409 Forward TTGACCACTTGCGACTCTCG,
+7478 Reverse GGTGTCTCCAATTCTATAGGATGTCC.
The primers used for ChIP on the IGFBP4 promoter are as follows:
687 Forward TAAAGCGTACAGGCACAGCTAGG,
476 Reverse AACATCCAAGAAGGAAGAGGC,
+2768 Forward GGGAGTCTGAGATGAGAAGTTCAAGC,
+2953 Reverse ACGAGGTTTCACCATGTTGACCAG.
| FOOTNOTES |
|---|
First Published Online October 28, 2004
Abbreviations: AF, Activator function; AP, activator protein; CA, carbonic anhydrase; ChIP, chromatin immunoprecipitation assay; CRE, cAMP response element; ER, estrogen receptor; ERE, estrogen-responsive element; FN1, fibronectin 1; IGFBP4, IGF binding protein 4; MMP, matrix metalloproteinase; PR, progesterone receptor; Q-RT-PCR, quantitative RT-PCR; SDF-1, stromal cell-derived factor 1; SRC, steroid receptor coactivator; TPA, tetradecanoyl phorbol acetate.
Received for publication July 2, 2004. Accepted for publication October 22, 2004.
| REFERENCES |
|---|
|
|
|---|
B by the estrogen receptor repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-
B and C/EBPß. FEBS Lett 409:7985[CrossRef][Medline]
B and C/EBPß. Mol Cell Biol 15:49714979[Abstract]
and ß on cyclin D1 gene expression. J Biol Chem 277:2435324360
and Sp1 regulate progesterone receptor gene expression. Mol Cell Endocrinol 201:165175[CrossRef][Medline]
and activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF-7 breast cancer cells. Endocrinology 143:45834591
depends on the coactivator subtype, the type of estrogen response element, and the promoter context. Mol Endocrinol 16:25712581NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
L. Tian, Z. Wu, Y. Zhao, Y. Meng, Y. Si, X. Fu, Y. Mu, and W. Han Differential induction of LRP16 by liganded and unliganded estrogen receptor {alpha} in SKOV3 ovarian carcinoma cells J. Endocrinol., July 1, 2009; 202(1): 167 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Nott, Y. Huang, X. Li, B. R. Fluharty, X. Qiu, W. V. Welshons, S. Yeh, and M. Muyan Genomic Responses from the Estrogen-responsive Element-dependent Signaling Pathway Mediated by Estrogen Receptor {alpha} Are Required to Elicit Cellular Alterations J. Biol. Chem., May 29, 2009; 284(22): 15277 - 15288. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Muller, K. W Merrell, J. D Crofts, C. Ronnlund, C.-Y. Lin, J.-A. Gustafsson, and A. Strom Estrogen-dependent downregulation of hairy and enhancer of split homolog-1 gene expression in breast cancer cells is mediated via a 3' distal element J. Endocrinol., March 1, 2009; 200(3): 311 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Strecker, Q. Shen, Y. Zhang, J. L. Hill, Y. Li, C. Wang, H.-T. Kim, T. M. Gilmer, K. R. Sexton, S. G. Hilsenbeck, et al. Effect of Lapatinib on the Development of Estrogen Receptor-Negative Mammary Tumors in Mice J Natl Cancer Inst, January 21, 2009; 101(2): 107 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. P. Uray, Q. Shen, H.-S. Seo, H. Kim, W. W. Lamph, R. P. Bissonnette, and P. H. Brown Rexinoid-induced Expression of IGFBP-6 Requires RAR{beta}-dependent Permissive Cooperation of Retinoid Receptors and AP-1 J. Biol. Chem., January 2, 2009; 284(1): 345 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rotinen, J. Celay, M. M Alonso, A. Arrazola, I. Encio, and J. Villar Estradiol induces type 8 17{beta}-hydroxysteroid dehydrogenase expression: crosstalk between estrogen receptor {alpha} and C/EBP{beta} J. Endocrinol., January 1, 2009; 200(1): 85 - 92. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pancholi, A. E Lykkesfeldt, C. Hilmi, S. Banerjee, A. Leary, S. Drury, S. Johnston, M. Dowsett, and L.-A. Martin ERBB2 influences the subcellular localization of the estrogen receptor in tamoxifen-resistant MCF-7 cells leading to the activation of AKT and RPS6KA2 Endocr. Relat. Cancer, December 1, 2008; 15(4): 985 - 1002. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Safe and K. Kim Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Teng, Z.-Y. Wang, E. R. Prossnitz, and D. E. Bjorling The G Protein-Coupled Receptor GPR30 Inhibits Human Urothelial Cell Proliferation Endocrinology, August 1, 2008; 149(8): 4024 - 4034. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Shen, I. P. Uray, Y. Li, Y. Zhang, J. Hill, X.-C. Xu, M. R. Young, E. J. Gunther, S. G. Hilsenbeck, N. H. Colburn, et al. Targeting the Activator Protein 1 Transcription Factor for the Prevention of Estrogen Receptor-Negative Mammary Tumors Cancer Prevention Research, June 1, 2008; 1(1): 45 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ouyang, W. J. Jessen, H. Al-Ahmadie, A. M. Serio, Y. Lin, W.-J. Shih, V. E. Reuter, P. T. Scardino, M. M. Shen, B. J. Aronow, et al. Activator Protein-1 Transcription Factors Are Associated with Progression and Recurrence of Prostate Cancer Cancer Res., April 1, 2008; 68(7): 2132 - 2144. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Kleinman, M. R. Greives, S. S. Churgin, K. M. Blechman, E. I. Chang, D. J. Ceradini, O. M. Tepper, and G. C. Gurtner Hypoxia-Induced Mediators of Stem/Progenitor Cell Trafficking Are Increased in Children With Hemangioma Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2664 - 2670. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, D. Medina, A. Tsimelzon, S. K. Mohsin, S. Mao, Y. Wu, and D. C. Allred Alterations of Gene Expression in the Development of Early Hyperplastic Precursors of Breast Cancer Am. J. Pathol., July 1, 2007; 171(1): 252 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lin, S. Reierstad, C.-C. Huang, and S. E. Bulun Novel Estrogen Receptor-{alpha} Binding Sites and Estradiol Target Genes Identified by Chromatin Immunoprecipitation Cloning in Breast Cancer Cancer Res., May 15, 2007; 67(10): 5017 - 5024. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhao, J. Matthews, M. Tujague, J. Wan, A. Strom, G. Toresson, E. W-F. Lam, G. Cheng, J.-A. Gustafsson, and K. Dahlman-Wright Estrogen Receptor {beta}2 Negatively Regulates the Transactivation of Estrogen Receptor {alpha} in Human Breast Cancer Cells Cancer Res., April 15, 2007; 67(8): 3955 - 3962. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Kwon, I. Garcia-Bassets, K. R. Hutt, C. S. Cheng, M. Jin, D. Liu, C. Benner, D. Wang, Z. Ye, M. Bibikova, et al. Sensitive ChIP-DSL technology reveals an extensive estrogen receptor {alpha}-binding program on human gene promoters PNAS, March 20, 2007; 104(12): 4852 - 4857. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fan, P. S. Yan, C. Hartman-Frey, L. Chen, H. Paik, S. L. Oyer, J. D. Salisbury, A. S.L. Cheng, L. Li, P. H. Abbosh, et al. Diverse Gene Expression and DNA Methylation Profiles Correlate with Differential Adaptation of Breast Cancer Cells to the Antiestrogens Tamoxifen and Fulvestrant Cancer Res., December 15, 2006; 66(24): 11954 - 11966. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, L. L. Sullivan, S. S. Nair, C. C. Williams, A. K. Pandey, L. Marrero, R. K. Vadlamudi, and F. E. Jones Coregulation of Estrogen Receptor by ERBB4/HER4 Establishes a Growth-Promoting Autocrine Signal in Breast Tumor Cells Cancer Res., August 15, 2006; 66(16): 7991 - 7998. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kim, M. Kaneko, K. Arihiro, M. Emi, K. Tanabe, S. Murakami, A. Osaki, and K. Inai Extranuclear expression of hormone receptors in primary breast cancer Ann. Onc., August 1, 2006; 17(8): 1213 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. McChesney, S. E. Aiyar, O.-J. Lee, A. Zaika, C. Moskaluk, R. Li, and W. El-Rifai Cofactor of BRCA1: A Novel Transcription Factor Regulator in Upper Gastrointestinal Adenocarcinomas Cancer Res., February 1, 2006; 66(3): 1346 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
L-A Martin, S Pancholi, C M W Chan, I Farmer, C Kimberley, M Dowsett, and S R D Johnston The anti-oestrogen ICI 182,780, but not tamoxifen, inhibits the growth of MCF-7 breast cancer cells refractory to long-term oestrogen deprivation through down-regulation of oestrogen receptor and IGF signalling Endocr. Relat. Cancer, December 1, 2005; 12(4): 1017 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Kwekel, L. D. Burgoon, J. W. Burt, J. R. Harkema, and T. R. Zacharewski A cross-species analysis of the rodent uterotrophic program: elucidation of conserved responses and targets of estrogen signaling Physiol Genomics, November 17, 2005; 23(3): 327 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
V X Jin, H Sun, T T Pohar, S Liyanarachchi, S K Palaniswamy, T H-M Huang, and R V Davuluri ERTargetDB: an integral information resource of transcription regulation of estrogen receptor target genes J. Mol. Endocrinol., October 1, 2005; 35(2): 225 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kishimoto, Z. Wang, P. Bhat-Nakshatri, D. Chang, R. Clarke, and H. Nakshatri The p160 family coactivators regulate breast cancer cell proliferation and invasion through autocrine/paracrine activity of SDF-1{alpha}/CXCL12 Carcinogenesis, October 1, 2005; 26(10): 1706 - 1715. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |