help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0267
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data Table
Right arrow All Versions of this Article:
19/2/362    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeNardo, D. G.
Right arrow Articles by Brown, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeNardo, D. G.
Right arrow Articles by Brown, P. H.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*12-O-TETRADECANOYLPHORBOL-13-ACETATE
Molecular Endocrinology 19 (2): 362-378
Copyright © 2005 by The Endocrine Society

Global Gene Expression Analysis of Estrogen Receptor Transcription Factor Cross Talk in Breast Cancer: Identification of Estrogen-Induced/Activator Protein-1-Dependent Genes

David G. DeNardo, Hee-Tae Kim, Susan Hilsenbeck, Valerie Cuba, Anna Tsimelzon and Powel H. Brown

Department of Medicine, Baylor Breast Center, Baylor College of Medicine, Houston, Texas 77030

Address all correspondence and requests for reprints to: Powel H. Brown, Associate Prof. M.D., Ph.D., Department of Medicine, Baylor Breast Center, Baylor College of Medicine, Houston, Texas 77030. E-mail: pbrown{at}breastcenter.tmc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
There is a growing body of literature supporting estrogen’s ability to affect gene expression through a nonclassical pathway, in which estrogen receptor (ER) modulates the activity of other transcription factors such as activator protein (AP)-1, specificity protein (Sp-1), or nuclear factor-{kappa}B (NF{kappa}B). We hypothesized that many estrogen-induced genes are dependent on AP-1 for their expression and that these genes can be identified using genomic strategies. Using cells expressing an inducible cJun dominant negative, we studied the estrogen induction of genes under conditions in which AP-1 was normal or blocked. We show that the expression of AP-1-dependent genes was inhibited by the cJun dominant negative and that AP-1 blockade does not affect mRNA ER{alpha} expression or estrogen induction of estrogen-responsive element activity. Using a microarray approach, we then identified 20 new estrogen-induced/AP-1-dependent genes. These estrogen-induced/AP-1-dependent genes contain a higher frequency of consensus AP-1 sites in their promoters and have increased sensitivity to the AP-1 stimulant tetradecanoyl phorbol acetate when compared with estrogen-induced genes whose expression was not affected by AP-1 blockade. We also show estrogen and AP-1-dependent recruitment of ER, steroid receptor coactivator-1, and p300 to the promoter of these genes by chromatin immunoprecipitation. These studies demonstrate that microarrays can be used in a reverse genetics approach to predict the functional promoter structure of large numbers of genes that are regulated by multiple transcription factors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
BREAST CANCER IS the leading cause of death among American women between the ages of 40 and 55 (1). Although the 5-yr survival rate has greatly increased with advances in detection and treatment, many breast cancer patients still die from metastatic disease. Therefore, more effective methods for prevention and treatment are greatly needed. Estrogen in particular has been well documented to play a critical role in the etiology and progression of breast cancer. The estrogen receptor (ER) mediates most of the actions of estrogen (2). ER is a member of the nuclear receptor superfamily of transcription factors, and its action has been characterized by the formation of homo- and heterodimers of ER{alpha} and ß in the presence of the steroid hormone estrogen (3, 4). However, although ERs have been studied for many years, the exact molecular mechanism by which ER regulates growth is not fully understood.

Estrogen signaling through ER occurs through three distinct pathways. In the classical model of ER action, ligand-activated ER binds specifically to DNA at estrogen-responsive elements (EREs) through its DNA binding domain and brings coactivators and corepressors to the transcription site via its activator function (AF)-1 and AF-2 domains. This is considered the classical pathway for ER action at ERE-containing promoters.

Estrogen also modulates gene expression by a second mechanism in which ER interacts with other transcription factors, through a process referred to as transcription factor cross talk. In this case, ER modulates the activities of other transcription factors such as activator protein (AP)-1, nuclear factor-{kappa}B (NF{kappa}B) or SP-1, by stabilizing their DNA binding and/or recruiting coactivators to the complex (5, 6, 7, 8, 9). Consistent with this coactivator-like function, ER{alpha} lacking a functional DNA binding domain has been shown to modulate AP-1 transcription machinery (10).

The AP-1 transcription factor transduces multiple mitogenic growth signals including those from peptide growth factors such as IGF, erbB2, and EGF and the steroid hormones estrogen and progesterone (5, 11, 12, 13). We have previously shown that AP-1 transcriptional activity is blocked in MCF-7 cells by an inducible cJun dominant-negative mutant (TAM67) (14). This cJun dominant-negative mutant lacks the transactivation domain of cJun but is still able to dimerize with Jun and Fos family members and bind DNA at AP-1 sequences (14, 15). Previous studies demonstrate that blockade of AP-1 inhibits estrogen-stimulated growth, but the exact mechanism by which this occurs is not known (16).

Another mechanism by which estrogen and the ER affect gene expression has been termed the nongenomic pathway. In the nongenomic pathway, estrogen binds to the ER localized outside of the cell nucleus. This cytoplasmic or membrane localized ER in turn activates signal transduction pathways in the cytosol. Through this mechanism, estrogen has been shown to rapidly activate MAPK, and also to induce signal transduction pathways leading to protein kinase C and protein kinase A activation (17, 18, 19, 20, 21, 22, 23). The estrogen-induced activation of these cytoplasmic protein kinases leads to induction of genes that are downstream of these kinases cascades. Morten et al. (24) have shown that ERK-induced phosphorylation of the cJun transactivation domain activates the AP-1 transcription factor. Thus, some of the estrogen-induced ERK-activated genes may be regulated by the AP-1 transcription factor. The genes activated by this nongenomic pathway, such as those induced by ERK activation, would not require ER to bind DNA or to be present in the transcription factor complex.

In this study, we used a dominant-negative cJun mutant to determine the set of estrogen-induced genes that require AP-1 transactivation for their induction. Blockade of AP-1 by TAM67 inhibits the ability of estrogen to activate an AP-1 luciferase reporter activity as well as to induce the expression of AP-1-dependent endogenous genes in MCF-7 breast cancer cells. However, AP-1 blockade does not affect ER{alpha} expression or ERE-dependent gene transcription in these cells. Using a microarray approach, we identified sets of estrogen-induced genes that are either dependent or independent of AP-1 for their expression. Further characterization of the promoters of two identified estrogen-induced/AP-1-dependent genes [fibronectin-1 (FN1) and the known AP-1-regulated gene collagenase (MMP-1; matrix metalloproteinase)], revealed that AP-1 proteins, ER{alpha}, and coactivators were recruited to their AP-1 sites. Thus, these genes were regulated by ER using the second mechanism mentioned above (through transcription factor cross talk). These studies also showed that the binding of Tam67 to AP-1 sites in these promoters prevented binding of ER{alpha} and ER{alpha}-associated coactivators, thus revealing how TAM67 inhibits gene expression.

These results show that genomic approaches can be used to address complex transcription factor interactions. Such techniques allow for the study of the affect of ER transcription factor cross talk on a genome-wide scale rather than on an individual gene basis. Studies such as these will allow for better understanding of the complex molecular mechanisms by which multiple transcription factors regulate gene expression.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of cJun Dominant-Negative Mutant Inhibits Estrogen-Stimulated AP-1 Activity
The cJun dominant-negative TAM67 (Fig. 1AGo) is a mutated form of c-Jun that has been shown to inhibit AP-1 activity in many different cell types (14, 15, 16, 25). Using this mutant, we previously isolated MCF-7 clones that express TAM67 under the control of a doxycycline repressible promoter (tet-off promoter) (16). In this study, we have used these MCF-7-Tet-Off-TAM67 cells to determine the effect of Tam67 on estrogen-induced AP-1 activity and gene expression. The expression of the Flag-TAM67 protein in response to doxycycline withdrawal is shown in Fig. 1AGo. No detectable Flag-TAM67 protein was expressed in the presence of doxycycline, whereas high levels of Flag-TAM67 protein were observed when the cells were cultured in the absence of doxycycline. No expression of Flag-Tam67 was detected in MCF-7 cells stably transfected with the empty vector (Fig. 1AGo).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. cJun Dominant-Negative, Tam67 Block Estrogen-Induced AP-1 Activity

A, Tam67 is a cJun mutant with a deletion of the trans-activation domain from amino acid 2–123. MCF-7 cells containing this Tam67 construct under control of a tet-repressible promoter express Tam67 only in the absence of doxycycline as measured by anti-flag-tag Western blot. B, Transfection of MCF-7 tet-off Tam67 cells with a collagenase luciferase reporter shows that the induction of Tam67 by doxycycline withdraw reduces both basal (P = 0.043) and estrogen-induced AP-1 activity (P = 0.009). C, Transfection of MCF-7 tet-off Tam67 cells with a vitellogenin ERE luciferase reporter shows that the induction of Tam67 (by doxycycline withdraw) does not affect either basal or estrogen-induced ERE activity.

 
To determine the ability of a Tam67 to block estrogen-induced AP-1 activity, we transfected the MCF-7-Tet-Off-TAM67 cell with an AP-1-luciferase reporter construct of the collagenase (MMP-1) promoter and measured luciferase activity after treatment with vehicle or estrogen. The results show that AP-1 blockade by Tam67 reduces basal AP-1 activity (P = 0.043, two-sample t test) as well as the estrogen-induced AP-1 activity (P = 0.009, two-sample t test) (Fig. 1BGo). To test the specificity of this AP-1 blockade, we measured the effect of Tam67 expression on ERE activity using a vitellogenin promoter luciferase construct, which contains the consensus ERE sequence (26). These results show that the Tam67 did not affect basal or estrogen-induced ERE activity (Fig. 1CGo).

cJun Dominant-Negative Inhibits Estrogen’s Ability to Induce the Expression of AP-1-Dependent Genes
MCF-7 tet-off Tam67 cells were cultured in the presence and absence of doxycycline and treated with estradiol or vehicle to determine whether AP-1 blockade inhibits the expression of known estrogen-induced genes. Measurement of the known AP-1-dependent gene MMP-1 by quantitative-RT-PCR (Q-RT-PCR) analysis in these cells shows that estradiol treatment induces the expression MMP-1 (1.53-fold, P = 0.05, two-sample t test) and that AP-1 blockade by Tam67 inhibits both basal (50% reduction; P = 0.05, two-sample t test) and estrogen-induced MMP-1 expression (47% reduction; P = 0.031, two-sample t test) (Fig. 2AGo). Studies have suggested that ER{alpha} confers estrogen responsiveness to the progesterone receptor (PR) gene by enhancing Sp1 interaction with the Sp1 site in the –80/–34 region of the human PR gene (27, 28). Q-RT-PCR analysis confirmed that estrogen stimulates PR mRNA expression (2.1-fold induction, P = 0.002, two-sample t test), and that estrogen-induction of PR expression, was not inhibited by AP-1 blockade by Tam67 (2.0-fold induction, P = 0.043, two-sample t test) (Fig. 2BGo). We next determined the affect of AP-1 blockade on the estrogen-induced cell cycle regulator cyclin D1. Q-RT-PCR analysis confirmed that 6 h of estrogen treatment stimulates cyclin D1 expression (1.4-fold, P = 0.024), and that AP-1 blockade by Tam67 inhibits estrogen-induction of Cyclin D1 expression (Fig. 2CGo).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. AP-1 Blockade Inhibits Estrogen Induction of AP-1-Dependent Genes

A, Q-RT-PCR measurement of mRNA of the known AP-1-regulated gene collagenase in MCF-7 tet-off Tam67 cell lines shows that collagenase is estrogen inducible and that both basal (P = 0.050) and estrogen-induced (P = 0.031) gene expression is inhibited by AP-1 blockade. B, Q-RT-PCR measurement of the PR mRNA in MCF-7 tet-off Tam67 cell lines shows that PR expression is estrogen inducible in both the presence (P = 0.002) and absence (P = 0.043) of AP-1 blockade. C, Q-RT-PCR measurement of Cyclin D1 mRNA in MCF-7 tet-off Tam67 cell lines shows that Cyclin D1 expression is estrogen inducible and that AP-1 blockade can block both basal (P = 0.055) and estrogen-induced (P = 0.023) gene expression.

 
To ensure that the effect of Tam67 was not simply due to down-regulation of ER expression, we also verified that ER{alpha} mRNA and protein expression were not affected by Tam67 expression (data not shown).

Identification of Estrogen and TAM67-Modulated Genes
We next used a microarray approach to identify additional estrogen-induced genes that are either dependent or not dependent on AP-1 transactivation for their expression. We hypothesized that those genes that were dependent on AP-1 for their estrogen induction (and thus share the same expression profile as MMP-1), might show similar regulation by estrogen and AP-1 as the MMP-1 gene. To test this hypothesis, we performed oligonucleotide microarray analysis using RNA samples from MCF-7 tet-off Tam67 cells stimulated with either estrogen or vehicle in the absence or presence of the cJun dominant negative. Four experimental groups were studied at each of two time points (6 and 24 h): MCF-7 cells with 1) Normal AP-1 [+Dox (doxycycline)], treated with vehicle, 2) Normal AP-1 (+Dox), treated with estrogen; 3) AP-1 blocked (–Dox), treated with vehicle; and 4) AP-1 blocked (–Dox), treated with estrogen (Fig. 3Go). Three independent RNA samples were prepared for each time point for each experimental group. These RNAs were used to prepare cDNA, which in turn was hybridized to Affymetrix (Santa Clara, CA) U95A microarrays (one array per RNA sample; thus, three arrays per time point (6 and 24 h), for four experimental groups to yield a total of 24 arrays). By comparing vehicle-treated and estrogen-treated samples in the presence of doxycycline (normal AP-1), we identified estrogen-modulated genes (see tables published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). By comparing doxycycline-treated samples (normal AP-1) to those not treated with doxycycline (AP-1 blocked) we identified genes modulated by AP-1 blockade (TAM67 expression). Analyzing the expression of genes across all four experimental groups allowed us to identify genes coregulated by both estrogen and AP-1.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Experimental Strategy

We studied four different experimental groups: 1) normal AP-1 treated with vehicle; 2) normal AP-1 treated with estrogen; 3) AP-1 blocked treated with vehicle; and 4) AP-1 blocked treated with estrogen. By comparing vehicle and estrogen-treated samples in the absence of Tam67 (normal AP-1), we identified estrogen-regulated genes. By comparing vehicle-treated samples in which Tam67 has been induced (AP-1 blockade) with samples in which there is no TAM67 expressed (normal AP-1), we identified genes modulated by Tam67 expression. By comparing all four experimental groups, we can identify estrogen and AP-1 coregulated genes.

 
Analysis to determine the sets of genes that are modulated by either estrogen or AP-1 was done at both the 6- and 24-h time points. Comparison of gene expression in vehicle- and estrogen-treated arrays in the absence of AP-1 blockade (no Tam67 expressed, +Dox) identified 96 genes that were modulated after 6 h of estrogen treatment (two sample t test P < 0.05 and fold change >1.2). Fifty-three of these genes were down-regulated and 43 were up-regulated (see tables published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Estrogen up-regulated genes show good overlap (>20%) with previously reported studies (29). Ninety-one estrogen-modulated genes were identified at 24 h after treatment; 66 of these genes were down-regulated, and 25 were up-regulated.

By comparing vehicle-treated groups in the presence and absence of Tam67, we were able to identify AP-1-regulated genes. One hundred and one Tam67-modulated genes were identified at 6 h; 32 of these genes were down-regulated and 69 of them were up-regulated (see supplemental data). Fifteen Tam67-modulated genes were identified at 24 h; nine of these genes were down-regulated, and six of them were up-regulated (see supplemental data).

Identification of Estrogen and TAM67 Comodulated Genes
For the identification of estrogen and AP-1 comodulated genes, we focused our analysis on those genes induced by estrogen at the 6-h time point. To investigate how AP-1 blockade affects the expression of estrogen-induced genes, we identified two groups of genes: 1) estrogen-induced genes whose expression was independent of AP-1 blockade (estrogen-induced/AP-1 independent profile) and 2) estrogen-induced genes whose estrogen-induction was dependent on AP-1 activity (estrogen-induced/AP-1-dependent profile). Of the 12,625 genes represented on the array, 3592 genes were expressed (called present) in the estrogen-treated, + doxycycline group on all three arrays. Forty-three of these genes were found to be significantly increased after 6 h of estrogen treatment (Fig. 4AGo). Of these 43 estrogen-induced genes, 21 were not induced by estrogen in the presence of the AP-1 inhibitor, and 20 were still induced in the presence of the AP-1 inhibitor (estrogen-induced/AP-1 independent). Two genes were up-regulated by AP-1 blockade and not used in further analysis (Fig. 4AGo).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4. Identification of AP-1-Dependent and -Independent Gene Expression Profiles

A, Analysis of the 6-h treatment groups shows of the 12625 genes represented on the array, 3592 genes that were called present in the estrogen + doxycycline treatment group on all three arrays. Forty-three of these genes are estrogen induced. Of these 43 estrogen-induced genes, 21 are down-regulated by AP-1 blockade in the presence of estrogen (AP-1 dependent), and 20 are not down-regulated by AP-1 blockade in the presence of estrogen (AP-1 independent). *, Two genes are up-regulated by AP-1 blockade and not used in further analysis. B, The average profiles for both AP-1-dependent and independent estrogen-induced genes are shown as the groups’ average SD from the mean of the expression values of the individual genes. C, Cluster analysis of the 20 genes in the estrogen-induced/AP-1-independent profile. D, Cluster analysis of the genes in the estrogen-induced/AP-1-dependent profile.

 
The genes termed estrogen-induced/AP-1-independent, shown in Table 1Go, are up-regulated by estrogen treatment but not affected by AP-1 blockade. The average profile of these 20 identified estrogen-induced/AP-1-independent genes shows that the expression of these genes is induced by estrogen in both the presence and absence of AP-1 blockade (Fig. 4BGo). Hierarchical cluster analysis shows that genes in this expression profile are similarly regulated in the three independent RNA sets (Fig. 4CGo).


View this table:
[in this window]
[in a new window]
 
Table 1. Estrogen-Induced/AP-1-Independent Genes

 
The estrogen-induced/AP-1-dependent genes were up-regulated by estrogen treatment under conditions of normal AP-1 but not up-regulated by estrogen when AP-1 was blocked (Table 2Go). This analysis yielded 21 genes whose average expression profile is shown in Fig. 4BGo. Hierarchical cluster analysis is shown in Fig. 4DGo.


View this table:
[in this window]
[in a new window]
 
Table 2. Estrogen-Induced/AP-1-Dependent Genes

 
Confirmation of the Gene Expression Profiles
We used Q-RT-PCR to validate the microarray results for 16 individual genes using three additional sets of RNA. Fourteen of sixteen of these genes showed the same profile as seen on the microarrays (88% confirmation rate) (data not shown). Several genes were chosen from the 6-h analysis for further study. We chose genes that were up-regulated by estrogen at the 6-h time point to identify genes that are directly regulated by the ER. The genes carbonic anhydrase XII (CA XII), EMS1, and FN1 were found to be estrogen-induced and AP-1-dependent using the above array analysis. Gene expression profile confirmations were done by Q-RT-PCR using the three independent RNA sets. CA XII, EMS1, and FN1, all show excellent agreement between the array expression profile and Q-RT-PCR results (Fig. 5Go, A–C). Estrogen induction of CA XII, EMS1, and FN1 was inhibited by AP-1 blockade (71%, 84%, and 54%, respectively). The genes stromal cell-derived factor 1 (SDF-1) and IGF binding protein 4 (IGFBP4) in contrast are estrogen-induced/AP-1-independent genes (i.e. they show no response to AP-1 blockade). The expression profiles of SDF-1 and IGFBP4 show excellent correlation between the array expression profile and Q-RT-PCR results (Fig. 5Go, D and E). Both genes show no reduction of estrogen-induced gene expression in the presence of AP-1 blockade. As a whole, the assessments of fold change by array analysis are markedly less that those determined by Q-RT-PCR. This may be because measurement of gene expression by array analysis is much less quantitative than Q-RT-PCR. Thus, the fold changes seen on the array analysis are likely an underestimation of the true differences in gene expression.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 5. Confirmation of the Gene Expression Profiles

A–C, The Q-RT-PCR analysis of mRNA for three identified estrogen-induced/AP-1-dependent genes (CA XII, EMS1, FN1). D and E, Q-RT-PCR analysis of mRNA on two identified estrogen-induced/AP-1-independent genes (SDF-1, IGFBP4).

 
Predicting Promoter Sequence and Function
We predicted that those genes that were found to be estrogen induced/AP-1 dependent would have an increased frequency of AP-1 sites in their promoters compared with those genes that were estrogen induced/AP-1 independent. To test this, we compared the frequency of consensus AP-1/CRE (cAMP response element) sites (TGANTCA) in the promoters of genes in the estrogen-induced/AP-1-dependent (n = 21) and AP-1-independent (n = 20) profiles as well as a set of 50 randomly selected genes from the array. Genes identified by expression profile as estrogen induced/AP-1 dependent have a 2.3-fold higher frequency (P = 0.058) of AP-1/CRE sites in their promoters than those genes who share the estrogen-induced/AP-1-independent expression profile and a 1.6-fold higher frequencies than genes randomly selected from the array (Fig. 6AGo). Genes in the estrogen-induced/AP-1-dependent profile were also enriched for predicted AP-1 sites when using either the TRANSFAC database or allowing a one-base wobble from the consensus AP-1 sequence (data not shown). This suggests that the estrogen-induced/AP-1-dependent expression profiles might be related to the presence of AP-1 sites in these genes’ promoters.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 6. AP-1 Regulation of Estrogen-Induced/AP-1-Dependent and Estrogen-Induced/AP-1-Independent Genes

A, Frequency of consensus AP-1/CRE sites per gene promoter in the first 2000 bp of promoter sequence that the genes in the AP-1-dependent cluster show a trend of enrichment for AP-1 sites as compared with either AP-1-independent gene expression cluster (P = 0.058) or a randomly selected gene set from the array. B, RT-PCR analysis shows that TPA does not affect the expression of estrogen-induced/AP-1-independent genes Pim-2, Supervillian, IGFBP4, and NT5C). C, RT-PCR analysis shows that TPA induces the expression of estrogen-induced/AP-1-dependent genes FN1, PODXL, PRKAR1A, and PCBP1 (P value for change is shown).

 
To further study the AP-1 dependence of genes identified from the array, we determined whether tetradecanoyl phorbol acetate (TPA) treatment (a known stimulant of AP-1-dependent genes) could induce the expression of genes identified by expression profile as estrogen induced/AP-1 dependent or estrogen induced/AP-1 independent. We hypothesized that genes containing functional AP-1 or CRE sites would be more sensitive to TPA treatment than those that did not. Semiquantitative RT-PCR on three sets of RNA from TPA-treated MCF-7 cells shows that those genes identified as AP-1 dependent (FN1, PODXL, PRKAR1A, and PCBP1) are induced by TPA treatment (Fig. 6CGo). In addition, RT-PCR analysis of genes identified as AP-1 independent found that the expression of PIM2, Supervillian, IGFBP4, and NT5C2 is unchanged by treatment with TPA (Fig. 6BGo). Q-RT-PCR also confirmed that TPA induces the expression of the estrogen-induced/AP-1-dependent gene FN1 [2.9-fold (P = 0.002)] and the known AP-1-dependent gene collagenase (MMP-1) greater than [3000-fold (P < 0.0001)] (data not shown). These results suggest that the classification as determined by expression profiling (AP-1 dependent or independent) is predictive of response to the AP-1 stimulant TPA.

Predicting Promoter Occupation from Expression Profiles
We next investigated the transcription factors and coactivator occupancy of AP-1 sites in the promoters of two estrogen-induced/AP-1-dependent genes. We predicted that the known AP-1-regulated gene MMP-1 and the putative AP-1-dependent gene, FN1, identified by our microarray analysis, might share similar promoter occupation. Primers were designed around the AP-1 sites within both the MMP-1 and FN1 gene promoters, and chromatin immunoprecipitation (ChIP) experiments were performed to investigate whether ER{alpha}, AP-1 family members, and coactivators were bound to the promoters of these genes.

ChIP of the flag-tagged cJun dominant negative, Tam67, shows that this protein occupies the AP-1 site in the MMP-1 promoter only in the absence of doxycyclin (Fig. 7AGo). Furthermore, immunoprecipitation of Fos and ER{alpha} shows that estrogen recruits these proteins to the MMP-1 promoter and that this recruitment is inhibited by the expression of Tam67 (Fig. 7AGo).




View larger version (80K):
[in this window]
[in a new window]
 
Fig. 7. ChIP Analysis

A, ChIP on the promoter of the known AP-1 controlled gene MMP-1 for the proteins ER{alpha}, Fos, Tam67, SRC-1, and p300 at an AP-1 site containing region –242 to –3 and a nonspecific +2555 to +2708 intergeneic region. B, ChIP on the promoter of the identified estrogen-induced/AP-1-dependent gene FN-1 for the proteins ER{alpha}, Fos, Tam67, SRC-1, and p300 at an AP-1 site containing rejoin –1029 to –929 and a nonspecific +7409 to +7478 intergeneic site. C, ChIP on the promoter of the identified estrogen-induced/AP-1-independent gene IGFBP4 for the proteins ER{alpha}, Fos, Tam67, SRC-1, and p300 at an SP-1 site-rich region –687 to –476 and a nonspecific +2759 to +2952 intergeneic site.

 
We next investigated how Tam67 affected coactivator recruitment. As shown in Fig. 7AGo, estrogen treatment induces the recruitment of the ER-associated coactivators steroid receptor coactivator (SRC)-1 and p300 to the MMP-1 promoter. However, the expression of Tam67 inhibits this recruitment of SRC-1 and p300 (Fig. 7AGo). These observations explain how Tam67 blocks estrogen-induced MMP-1 gene expression by reducing promoter occupation by ER{alpha} and coactivators at the AP-1 site.

MMP-1 and FN1 share similar microarray and Q-RT-PCR expression profile in response to estrogen treatment and AP-1 blockade. Therefore, we predicted that the effect of Tam67 on ER{alpha} and coactivator recruitment to the AP-1 site in FN1 would be similar to that of the MMP-1 promoter. ChIP of the flag-tagged cJun dominant negative, Tam67, shows that this protein is recruited to the FN1 AP-1 site only in the absence of dox (Fig. 7BGo). Immunoprecipitation of Fos shows that it is present at the FN1 promoter. ER{alpha} is also recruited after estrogen treatment to the FN1 promoter and this recruitment is blocked by the expression of Tam67 (Fig. 7BGo). Similar to the MMP-1 promoter, p300, and SRC-1 are also recruited to the FN1 AP-1 site after estrogen treatment and the presence of TAM67 reduces both basal and estrogen-stimulated coactivator promoter occupation (Fig. 7BGo). Thus, the expression of the Jun dominant-negative mutant can block estrogen-induced gene expression of these two AP-1-dependent genes by reducing the occupation of these promoters by ER{alpha} and coactivators.

The gene IGFBP4 exhibited the estrogen-induced/AP-1-independent profile and was not induced by TPA treatment (Fig. 6Go). Therefore, we predicted that Tam67 would not occupy the IGFBP4 promoter and that AP-1 blockade would not affect ER and coactivator occupation of the IGFBP4 promoter. A ChIP assay was designed to measure recruitment to a Sp-1-rich region shown previously to be responsible for much of estrogen’s ability to induce this gene in MCF-7 cells (30). ChIP of the flag-tagged cJun dominant negative, Tam67, shows no detectable protein recruitment to the IGFBP4 promoter (Fig. 7CGo). Immunoprecipitation of Fos also shows no detectable protein recruitment. ER{alpha} and SRC-1 are recruited after estrogen treatment to the IGFBP4 promoter, and this recruitment is not affected by Tam67 expression (Fig. 7CGo). p300 Is also present at this promoter (Fig. 7CGo). Thus, the expression of the Jun dominant-negative mutant blocks estrogen-induced expression of two estrogen-induced/AP-1-dependent genes (MMP-1, FN1) and the occupation of their promoters by ER{alpha} and coactivators. However, by contrast, Tam67 expression does not affect estrogen’s ability to stimulate the estrogen-induced/AP-1-independent gene IGFBP4 expression, nor does Tam67 affect ER{alpha} and coactivator occupation of the IGFBP4 promoter.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In present study, we have identified estrogen and AP-1 coregulated genes using a genome-wide approach. We hypothesized that the expression profile observed in response to transcriptional modulators such as estrogen or a cJun dominant-negative mutant (Tam67) can be related to differences in functional AP-1 sites. We demonstrated that Tam67 can block the ability of estrogen to activate the AP-1 transcription factor and that Tam67 inhibits the estrogen-induced MMP-1 and Cyclin D1 expression. We next used microarray expression analysis to identify sets of estrogen-induced genes that were either dependent on, or independent of, AP-1 for their estrogen induction. The genes identified as estrogen induced/AP-1 dependent have a greater frequency of AP-1 sites in their promoters and increased sensitivity to the AP-1 stimulant TPA, compared with the estrogen induced/AP-1 independent genes. We then investigated the promoter occupancy of a known AP-1-regulated gene collagenase (MMP-1) and a newly identified estrogen-induced/AP-1-dependent gene FN1. The genes MMP-1 and FN1 showed that at AP-1 sites in their respective promoters, estrogen was capable of stabilizing ER, and coactivator recruitment (p300, SRC-1), whereas the binding of Tam67 to these sites coincided with decreased ER and coactivator occupation. These results were not seen on the promoter of the estrogen-induced/AP-1-independent gene IGFBP4. Our results demonstrate that genomic wide expression analysis using microarrays can dissect complex interaction between multiple transcription factors.

There are multiple mechanisms by which the ER can regulate transcription: 1) through a classical pathway in which ER binds directly to EREs, 2) through a nonclassical pathway in which ER functions as a coactivator (transcription factor cross talk), or 3) through activation of cytoplasmic kinase cascade pathways (Fig. 8Go). Gene expression can be induced by the classical pathway in which the ER binds directly to DNA at an ERE, recruiting coactivators and inducing transcription. However, surprisingly few ERE-controlled genes have been identified (31). BCL-2 is one example of a known ERE-containing gene (estrogen-induced Bcl-2 gene expression is not blocked by Tam67, estrogen-induced/AP-1-independent, data not shown) (32). From our studies, we have identified four estrogen-induced/AP-1-independent genes that contain potential ERE sequences in their promoters (PCP4, GREB1, NT5C2, and SDF1) (Fig. 8AGo).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 8. Mechanisms by which Genomic ER Can Regulate Gene Expression

A, Classical mechanism: single direct interaction. Estrogen binds ER, which in turn binds to DNA at an ERE site. Coactivators are recruited and transcription is activated. B, ER as a coactivator: 1) single coactivator-like interaction. Estrogen binds ER, which in turn binds to the AP-1 transcriptional coactivator complex, stabilizing coactivators such as SRC-1 and cointegrators such as p300. 2) Other interaction: There are several other possible mechanisms by which ER can act as a coactivator on other transcription factors. 3) Complex multiple interactions. Interaction between transcriptional complexes formed on an ERE and an AP-1 site in close proximity can interact through cointegrators to regulate gene transcription concomitantly. C, Nongenomic action: kinase cascade activation. Estrogen binds ER and activates cytoplasmic kinase cascades.

 
The ER can also act as coactivator to enhance the activity of other transcription factors such as AP-1 (5, 33). Previous studies have shown that estrogen-induced MMP-1 promoter activity is mediated by estrogen activation of AF-2 domain of ER (5, 12). The ER{alpha} AF-2 domain is known to be involved in coactivator recruitment (34). Our data on the MMP-1 and FN1 promoters shows that estrogen treatment can induce AP-1 site occupation by ER, p300 and the p160 coactivator SRC-1. Studies defining the molecular mechanism of estrogen-ER action at an AP-1 site by Kushner and Webb (5, 12, 35) have suggested that in response to estrogen, ER binds to p160 coactivators in existing AP-1/coactivator complexes and they hypothesize that this triggers coactivators into a higher state of activity. Our data, shown here, support this hypothesis. The expression of Tam67 blocks AP-1 activity and basal coactivator recruitment to the MMP-1 AP-1 site. However, Tam67 does not completely abolish the ability of estrogen to stimulate MMP-1 gene expression or the estrogen-induced recruitment of ER, SRC-1, and p300 to the MMP-1 or FN1 AP-1 sites. Our results agree with a model of estrogen-ER activation of AP-1 by interaction with existing coactivator complexes that in turn stabilizes the entire complex and/or induces this complex into a higher state of activity. Through our studies here we have identified 6 additional estrogen-induced/AP-1-dependent genes that might also fit this model. These genes include FN1, TRIMM44, PODXL, UBE1, JAK1, MFN2. Their promoters contain potential AP-1 sites but no ERE sequences (Fig. 8BGo).

Another model of ER/AP-1 coregulation is through complex interactions between distinct ERE and AP-1 binding sites (Fig. 8BGo). This model has been shown to be critical for the expression of the pS2 gene that contains both an ERE and an AP-1 site within its promoter (36). We have identified two estrogen-induced/AP-1-dependent genes that contain both an AP-1 site and a potential ERE site (EMS-1, CAXII).

It is important to also recognize that estrogen can activate gene expression through more complex mechanisms. Other possible mechanisms of estrogen-induced gene expression include nongenomic stimulation of kinases cascades and indirect pathways of induction of growth factors signaling pathways (Fig. 8CGo) (21). Because we have not performed ChIP analysis on all of the estrogen-induced genes found in our study, it is possible that some of them are regulated by the nongenomic pathway of estrogen signaling. The set of genes that are activated specifically or solely by membrane ER activation of nongenomic pathways have not yet been identified. However, genes that are activated solely by the nongenomic pathway would not be expected to have ER bound to their promoters. As described, we performed ChIP analysis for several genes (MMP-1, FN-1, and IGFBP4) to show that ER is indeed present in the transcription factor complex. At least for those genes examined by ChIP analysis, the likely mechanism by which TAM67 interferes with gene expression is by blocking/destabilizing the ER/AP-1 interaction and not by interfering with estrogen’s cytoplasmic signaling cascades. Measurement of phosphorylated ERK in the MCF-7 tet-off Tam67 cell line under the conditions of estrogen treatment used in this study did not show significant amounts of estrogen-stimulated ERK phosphorylation; however, by contrast IGF treatment induced large amounts of ERK phosphorylation (data not shown). These results suggest that the cytoplasmic estrogen-induced ERK signaling cascade is not a dominant pathway in our cell line.

Many of the estrogen-induced genes identified in this study are involved in regulation of critical cellular processes such as cell proliferation, apoptosis and cell motility (see Tables 1Go and 2Go). In particular, the estrogen-induced/AP-1-dependent genes regulate cell proliferation and motility. Indeed, two estrogen-induced/AP-1-dependent genes identified here have been previously shown to be prognostic markers in breast cancer patient survival (FN1, CAXII) (37, 52).

Our lab and others (14, 15, 16, 38, 39, 40, 41) have shown that blockade of AP-1 by Tam67 inhibits breast cancer cell growth by inducing a cell cycle blockade, and down-regulating cyclin D1 expression. The analysis presented here confirmed that TAM67 expression blocked estrogen-induced cyclin D1 expression (consistent with the induction of a G1 cell cycle block). In addition, the array studies demonstrated that expression of TAM67 blocks the estrogen-induced expression of several other genes that could contribute to suppression of cell growth—these include blocking estrogen-induced expression of growth regulatory proteins such as cMyc (a growth-regulating transcription factor and proto-oncogene), the membrane-bound transcription factor protease (MBTPS1; an important regulatory of lipid metabolism), and the regulatory subunit of protein kinase A (PRKAR1A, which is activated by the ret oncogene). The cumulative effect of changes in the expression of these genes is blockade of estrogen-induced breast cancer cell growth (16).

Our results also show that TAM67 can block estrogen-induction of several genes involved in cell motility and invasion, including FN1, EMS1, tropomyosin 1, and actinin {alpha}1 (see Table 2Go). Thus, agents that block AP-1 can suppress both cell growth and invasion.

Modulation of AP-1 activity by nuclear receptors is not exclusive to the ER. Retinoids also effect gene expression by modulation of AP-1. Activation of the retinoid receptors, retinoic acid receptor and retinoic X receptor, have been shown to down-regulate AP-1 activity by binding to the AP-1 complex or squelching coactivators (42, 43). Glucocorticoids can also down-regulate AP-1 activity in several cell types by interaction of Jun and Fos family members with the glucocorticoid receptor or by competing for essential coactivators (44, 45, 46). The nuclear hormone receptor PR has also been shown to be capable of modulating AP-1 activity in response to progesterone (11, 47). Thus, cross talk between steroid hormone receptors and AP-1 transcription factors is a general mechanism by which hormones can modulate growth factor pathways to regulate gene expression.

Studies such as those reported here demonstrate the value of a genome-wide approach to the investigation of gene regulation. The experimental approach used here to investigate the complex regulation of gene expression by two different transcription factors is applicable to many systems in which multiple transcription factors collaborate to regulate gene expression. Using genomic approaches, it is now possible to investigate the complex interactions between the transcription factors, coactivators, and gene promoters that ultimately regulate gene expression and control cancer cell growth.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Transfection
The generation of the MCF-7 Tet-Off TAM67 clones #62 and vector clones #1 has been previously described (40). The cells were maintained in Improved MEM (high zinc option, Invitrogen Life Technologies, Grand Island, NY) with 100 µg/ml of geniticin and 100 µg/ml of hygromycin.

Western Blotting Analysis
Cell lysates were prepared by treating cells with lysis buffer [50 mM Tris-HCl (pH 8.0), 2% sodium dodecyl sulfate, and protein kinase inhibitor cocktail]. Lysates were sheared by 22-gauge needle on ice and centrifuged at 10,000 x g for 30 min. The protein concentration of the supernatant was measured by the Bradford method. Thirty micrograms of protein were resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel. The proteins were transferred to a nitrocellulose membrane, and the membrane was then blocked in 5% nonfat dry milk TBST [10 mM Tris (pH 8.0), 150 mM NaCl, 0.05% Tween 20] at room temperature for 1 h. Membranes were probed with primary antibody anti-Flag (Sigma, St. Louis, MO; 1:10,000) and then the membranes were probed with a corresponding horseradish peroxidase-conjugated secondary antibody in 1% nonfat dry milk/TBST. The blots were visualized using the ECL Western blot detection system (Amersham Bioscience, Piscataway, NJ).

Luciferase Assay to Measure AP-1 and ER Activity
AP-1 transcriptional activity in cells was measured using the Dual-Luciferase Reporter Assay (Promega, Madison, WI) according to manufacturer’s protocol. The cells were cotransfected with the Col-Z-Luc reporter gene containing the luciferase gene linked to 1100 bp of the human collagenase gene promoter which contains a single AP-1 binding site (TGAG/CTCA) and pRL-TK, a Renilla construct for normalizing of transfection efficiency. Cells were transfected using Fugene 6 reagent (Roche, Indianapolis, IN) according to manufacturer’s recommendations. Transfected cells were starved of estrogen for 48 h in phenol red-free medium with 5% charcoal-stripped serum before transfection. Cells were then treated with 17ß-estradiol (10–9 M) 24 h after transfection and lysed 24 h after treatment. Luciferase activity was measured with equal amounts of cell extract using a microplate luminometer (Labsystems, Helsinki, Finland) and normalized with the Renilla activity.

To measure ER activity, the Vit-ERE-TK-Luc construct was employed instead of Col-Z-Luc to perform the luciferase assay. The cells were starved of estrogen for 24 h in phenol red-free medium with 5% charcoal-stripped serum, and then treated with 17ß-estradiol (10–9 M) for 12 h to stimulate the ERE activity before harvest. Statistical significance of triplicate assays was determined using a Student’s t test.

RNA Isolation
Total RNA was isolated using the RNeasy RNA isolation kit from QIAGEN, Inc. (Valencia, CA) as recommended by the supplier. Triplicate RNA samples were independently prepared for each treatment group.

Q-RT-PCR
Q-RT-PCR assays of transcripts were carried out using gene-specific double fluorescence-labeled probes in an ABI PRISM 7700 Sequence Detector (Applied Biosystems, Foster City, CA). The PCR mixture consisted of 300 nM each of the primers; 100 nM probe; 0.025 U/µl of Taq polymerase; 125 µM each of deoxynucleotide triphosphate; 3 mM MgCl2; and 1x Taq polymerase buffer. Cycling conditions were 94 C for 1 min, followed by 40 cycles at 94 C for 12 sec and 60 C for 1 min. All primers and probes were designed with Primer Express 1.0 software (Applied Biosystems Foster City, CA). 6-Carboxy fluorescein was used as the 5' fluorescent reporter, whereas tetramethylrhodamine was added to the 3' end as quencher. Standard curves for the quantification of each transcript and ß-actin were generated using the serially diluted solution of synthetic templates and genome equivalent copies were calculated from the standard curve. For each sample, TaqMan PCRs were performed in triplicate for each gene of interest and reference gene (ß-actin) to normalize for input cDNA. The ratio between the values obtained provided relative gene expression levels. Statistical significance was determined on triplicate samples using a Student’s t test.

Microarray Analysis
cDNA synthesis and cRNA labeling.
Twenty micrograms of total RNA were used in the first strand cDNA synthesis with 100 pmol T7-(deoxythymidine)24 primer [5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(deoxythymidine)24-3'], and second-strand cDNA synthesis was carried out at 16 C by adding 10 U Escherichia coli DNA ligase, 40 U E. coli DNA polymerase I, and 2 U ribonuclease H to the reaction, followed by 10 U of T4 DNA polymerase to blunt the ends of newly synthesized cDNA. The double-strand cDNA was purified through phenol/chloroform and ethanol precipitation. An in vitro transcription reaction was done to synthesize biotin-labeled antisense cRNA using a BioArray HighYield RNA transcript labeling kit (Enzo Diagnostics, Farmingdale, NY). The labeled cRNA was then purified using a RNeasy mini kit (QIAGEN) according to the manufacturer’s protocol and ethanol precipitated. The purified cRNA was fragmented in 1x fragmentation buffer (40 mM Tris-acetate, 100 mM KOAc, 30 mM MgOAc) at 94 C for 35 min.

Hybridization and Scanning.
For hybridization with Affymetrix oligonucleotide human GeneChip U95Av2, 15 µg of fragmented cRNA probe was incubated with 50 pM control oligonucleotide B2, 1x eukaryotic hybridization control (1.5 pM BioB, 5 pM BioC, 25 pM BioD, and 100 pM cre), 0.1 mg/ml herring sperm DNA, 0.5 mg/ml acetylated BSA and 1x manufacturer recommended hybridization buffer in a 45 C rotisserie oven for 16 h. The chips were washed in a fluidic station and the phycoerythrin-stained array was scanned as a digital image file as described in the Affymetrix GeneChip protocol (Affymetrix, Inc.)

Data Analysis
Each treatment for each time point was done in triplicate. Thus, three independent RNA samples were prepared for each time point for each treatment group. These RNAs were used to prepare cDNA, which was, in-turn, hybridized to Affymetrix U95A microarrays (one array per RNA sample; thus, three arrays per time point, per treatment for a total of 24 arrays). These RNAs include, after four experimental groups for each time point: MCF-7 cells with 1) normal AP-1, treated with vehicle; 2) normal AP-1, treated with estrogen; 3) AP-1 blockade, treated with vehicle; and 4) AP-1 blockade, treated with estrogen (Fig. 3Go). The scanned image was generated and quantitated using Microarray Suite 5.0 (Affymetrix). Quality control factors include: low noise (RawQ <15), low background (<600), low 3' to 5' ratio of ß-actin and GAPDH (ratio <1.5) and presence of control genes cre, BioD, and BioC. Arrays that met these quality control criteria were used in low level analysis using invariant set normalization (baseline chip was 24 h estrogen + doxycycline A) and estimation of expression using the MBEI (model-based expression index) algorithm (PM only) as implemented in the dChip Analysis software package (48, 49). Comparative analysis was also performed using dChip. When comparing treatment groups, genes with differences of ±1.2-fold with a two-sample t test P < 0.05 are reported. To identify estrogen-induced/AP-1-dependent or -independent genes in the 6-h estrogen treatment group, the genes on the array were filtered for a presence call in all three of the estrogen plus doxycycline arrays. Genes termed estrogen induced/AP-1 dependent were selected by querying for genes that were both estrogen induced (fold change >1.2 P < 0.05) and showed a significant down-regulation (fold change < –1.2, P < 0.05) by doxycycline withdraw in the estrogen-treatment groups. Genes termed estrogen induced/AP-1 independent were selected by querying for genes that were both estrogen induced (fold change >1.2 P < 0.05) and showed no significant down-regulation (no fold change >1.2 or < –1.2) by doxycycline withdraw in the estrogen-treatment groups. The average profile of these groups of genes was determined using their gene-wise standardized values (48, 49). Gene lists were queried for the Gene Ontologies containing cell cycle, cell growth, cell motility, apoptosis, metabolism, cell adhesion, and integral membrane protein were generated using dChip.

Promoter Analysis
Two thousand base pairs of the promoter region were obtained for each selected gene by mapping the gene to its genomic sequence using the UCSC Golden Path Genome Browser (http://genome.ucsc.edu). These sequences were queried using TESS [Transcription Element Search System (www.cbil.upenn.edu/tess/)], a system that uses TRANSFAC version 4.0. Sites identified as potential AP-1 sites were then inspected for the sequence TGANTCA. The total number of TGANTCA AP-1/CRE sites was divided by the number of promoters searched in each group to obtain the average number of sites/gene. Genes chosen at random from the array were done so by using a random number generator (Microsoft Excel) to generate a random numerical value from zero to one for every gene present on the array. The set of genes with the 50 lowest random numbers were selected for promoter analysis. Statistical analysis of differences in AP-1 site frequency between AP-1-dependent, and AP-1-independent gene groups was done using a t test done as contrasts, using error mean square from ANOVA. ERE were identified using the Dragon ERE finder version 2.0 (http://sdmc.lit.org.sg/ERE-V2/index) (50).

RT-PCR
Low cycle RT-PCR assay of transcripts was carried out using gene-specific PCR primers. Total RNA was deoxyribonuclease treated at a reaction concentration of 133.3 ng/µl. One microliter (133.3 ng) of this cDNA was added to a 50-µl PCR. PCR was run at multiple cycles (ranging from 26–30) for each transcript measured. All PCR samples were run on a standard 1% agarose Tris-acetate EDTA gel and visualized using a GelDoc EQ system (Bio-Rad, Hercules, CA). The lowest possible PCR cycle number yielding high quality visualization was used for quantitation. Quantitation was done using the Alpha Imager software by measuring pixel density. Triplicate RNA samples were averaged, and SE were calculated.

ChIP
Soluble, sonicated chromatin was prepared as previously described (51). Chromatin fractions were immunoprecipitated with 1–2 µg of indicated antibodies and the immune complexes were recovered using protein-G agarose beads and processed as described (51). The antibodies used were as follows: mouse antihuman ER{alpha} (Santa Cruz, Santa Cruz, CA), mouse antihuman pan-Fos (Promega), mouse antihuman IgG (Santa Cruz), mouse antihuman SRC-1 (Santa Cruz), mouse anti-Flag epitope (Sigma), and mouse antihuman p300 (Santa Cruz). The immunoprecipitated and input DNA samples were assessed in low cycle PCR using specific oligos designed for genomic sequences around AP-1 sites contained in the promoters or intronic sequence contained in the genes. Three different PCR cycles (ranging from 24–32) were used to evaluate each assay and the lowest possible cycle with good visualization was chosen for representation. Input and intergenic controls were run at the same PCR cycle numbers as the immunoprecipitated samples.

The primers used for MMP-1 promoter are as follows:

–242 Forward TTGCAACACCAAGTGATTCCA,

–3 Reverse CCCAGCCTCTTGCTACTCCA,

+2550 Forward GAGTACAACTTACATCGTGTTGCAG,

+2708 Reverse ATATGGCTTGGATGCCATCAATGTC.

The primers used for ChIP on the FN1 promoter are as follows:

–1029 Forward GAGGGCAAGACAGTACATAGG,

–929 Reverse GGAAAGTTGGACCAGCTGTG,

+7409 Forward TTGACCACTTGCGACTCTCG,

+7478 Reverse GGTGTCTCCAATTCTATAGGATGTCC.

The primers used for ChIP on the IGFBP4 promoter are as follows:

–687 Forward TAAAGCGTACAGGCACAGCTAGG,

–476 Reverse AACATCCAAGAAGGAAGAGGC,

+2768 Forward GGGAGTCTGAGATGAGAAGTTCAAGC,

+2953 Reverse ACGAGGTTTCACCATGTTGACCAG.


    FOOTNOTES
 
This work was supported by a grant from Department of Defense Breast Cancer DAMD17-02-1-0279.

First Published Online October 28, 2004

Abbreviations: AF, Activator function; AP, activator protein; CA, carbonic anhydrase; ChIP, chromatin immunoprecipitation assay; CRE, cAMP response element; ER, estrogen receptor; ERE, estrogen-responsive element; FN1, fibronectin 1; IGFBP4, IGF binding protein 4; MMP, matrix metalloproteinase; PR, progesterone receptor; Q-RT-PCR, quantitative RT-PCR; SDF-1, stromal cell-derived factor 1; SRC, steroid receptor coactivator; TPA, tetradecanoyl phorbol acetate.

Received for publication July 2, 2004. Accepted for publication October 22, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Harris JMM, Bodadonna G 1993 Cancer of the breast. In: Cancer of the breast. Philadelphia: J. B. Lippincott Co.; 1264–1332
  2. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  3. Ribeiro RC, Kushner PJ, Baxter JD 1995 The nuclear hormone receptor gene superfamily. Annu Rev Med 46:443–453[CrossRef][Medline]
  4. Katzenellenbogen BS 1996 Estrogen receptors: bioactivities and interactions with cell signaling pathways. Biol Reprod 54:287–293[Abstract]
  5. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P 2000 Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74:311–317[CrossRef][Medline]
  6. Wang W, Dong L, Saville B, Safe S 1999 Transcriptional activation of E2F1 gene expression by 17ß-estradiol in MCF-7 cells is regulated by NF-Y-Sp1/estrogen receptor interactions. Mol Endocrinol 13:1373–1387[Abstract/Free Full Text]
  7. Safe S 2001 Transcriptional activation of genes by 17ß-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm 62:231–252[Medline]
  8. Ray P, Ghosh SK, Zhang DH, Ray A, Stein B, Yang MX 1997 Repression of interleukin-6 gene expression by 17ß-estradiol: inhibition of the DNA-binding activity of the transcription factors NF-IL6 and NF-{kappa}B by the estrogen receptor repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-{kappa}B and C/EBPß. FEBS Lett 409:79–85[CrossRef][Medline]
  9. Stein B, Yang MX 1995 Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-{kappa}B and C/EBPß. Mol Cell Biol 15:4971–4979[Abstract]
  10. Jakacka M, Ito M, Weiss J, Chien PY, Gehm BD, Jameson JL 2001 Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway. J Biol Chem 276:13615–13621[Abstract/Free Full Text]
  11. Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:6169–6174[Abstract/Free Full Text]
  12. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S, Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  13. Johnson AC, Murphy BA, Matelis CM, Rubinstein Y, Piebenga EC, Akers LM, Neta G, Vinson C, Birrer M 2000 Activator protein-1 mediates induced but not basal epidermal growth factor receptor gene expression. Mol Med 6:17–27[Medline]
  14. Brown PH, Kim SH, Wise SC, Sabichi AL, Birrer MJ 1996 Dominant-negative mutants of cJun inhibit AP-1 activity through multiple mechanisms and with different potencies. Cell Growth Differ 7:1013–1021[Abstract]
  15. Brown PH, Chen TK, Birrer MJ 1994 Mechanism of action of a dominant-negative mutant of c-Jun. Oncogene 9:791–799[Medline]
  16. Liu Y, Ludes-Meyers J, Zhang Y, Munoz-Medellin D, Kim HT, Lu C, Ge G, Schiff R, Hilsenbeck SG, Osborne CK, Brown PH 2002 Inhibition of AP-1 transcription factor causes blockade of multiple signal transduction pathways and inhibits breast cancer growth. Oncogene 21:7680–7689[CrossRef][Medline]
  17. Tesarik J, Mendoza C 1995 Nongenomic effects of 17ß-estradiol on maturing human oocytes: relationship to oocyte developmental potential. J Clin Endocrinol Metab 80:1438–1443[Abstract]
  18. Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. Proc Natl Acad Sci USA 91:8517–8521[Abstract/Free Full Text]
  19. Le Mellay V, Grosse B, Lieberherr M 1997 Phospholipase Cß and membrane action of calcitriol and estradiol. J Biol Chem 272:11902–11907[Abstract/Free Full Text]
  20. Kelly MJ, Lagrange AH, Wagner EJ, Ronnekleiv OK 1999 Rapid effects of estrogen to modulate G protein-coupled receptors via activation of protein kinase A and protein kinase C pathways. Steroids 64:64–75[CrossRef][Medline]
  21. Levin ER 1999 Cellular functions of the plasma membrane estrogen receptor. Trends Endocrinol Metab 10:374–377[CrossRef][Medline]
  22. Kelly MJ, Wagner EJ 1999 Estrogen modulation of G-protein-coupled receptors. Trends Endocrinol Metab 10:369–374[CrossRef][Medline]
  23. Migliaccio A, Di Domenico M, Castoria G, de Falco A, Bontempo P, Nola E, Auricchio F 1996 Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO J 15:1292–1300[Medline]
  24. Morton S, Davis RJ, McLaren A, Cohen P 2003 A reinvestigation of the multisite phosphorylation of the transcription factor c-Jun. EMBO J 22:3876–3886[CrossRef][Medline]
  25. Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price Jr RH, Pestell RG, Kushner PJ 2002 Opposing action of estrogen receptors {alpha} and ß on cyclin D1 gene expression. J Biol Chem 277:24353–24360[Abstract/Free Full Text]
  26. Tremea F, Batistuzzo de Medeiros SR, ten Heggeler-Bordier B, Germond JE, Seiler-Tuyns A, Wahli W 1989 Identification of two steroid-responsive promoters of different strength controlled by the same estrogen-responsive element in the 5'-end region of the Xenopus laevis vitellogenin gene A1. Mol Endocrinol 3:1596–1609[Abstract]
  27. Schultz JR, Petz LN, Nardulli AM 2003 Estrogen receptor {alpha} and Sp1 regulate progesterone receptor gene expression. Mol Cell Endocrinol 201:165–175[CrossRef][Medline]
  28. Petz LN, Ziegler YS, Loven MA, Nardulli AM 2002 Estrogen receptor {alpha} and activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF-7 breast cancer cells. Endocrinology 143:4583–4591[Abstract/Free Full Text]
  29. Frasor J, Stossi F, Danes JM, Komm B, Lyttle CR, Katzenellenbogen BS 2004 Selective estrogen receptor modulators: discrimination of agonistic versus antagonistic activities by gene expression profiling in breast cancer cells. Cancer Res 64:1522–1533[Abstract/Free Full Text]
  30. Qin C, Singh P, Safe S 1999 Transcriptional activation of insulin-like growth factor-binding protein-4 by 17ß-estradiol in MCF-7 cells: role of estrogen receptor-Sp1 complexes. Endocrinology 140:2501–2508[Abstract/Free Full Text]
  31. Klinge CM 2001 Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res 29:2905–2919[Abstract/Free Full Text]
  32. Perillo B, Sasso A, Abbondanza C, Palumbo G 2000 17ß-Estradiol inhibits apoptosis in MCF-7 cells, inducing bcl-2 expression via two estrogen-responsive elements present in the coding sequence. Mol Cell Biol 20:2890–2901[Abstract/Free Full Text]
  33. Kushner PJ, Agard D, Feng WJ, Lopez G, Schiau A, Uht R, Webb P, Greene G 2000 Oestrogen receptor function at classical and alternative response elements. Novartis Found Symp 230:20–26; discussion 27–40[Medline]
  34. Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai MJ, O’Malley BW 1997 Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–64; discussion 164–165
  35. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol Endocrinol 12:1605–1618[Abstract/Free Full Text]
  36. Barkhem T, Haldosen LA, Gustafsson JA, Nilsson S 2002 Transcriptional synergism on the pS2 gene promoter between a p160 coactivator and estrogen receptor-{alpha} depends on the coactivator subtype, the type of estrogen response element, and the promoter context. Mol Endocrinol 16:2571–2581[Abstract/Free Full Text]
  37. Ioachim E, Charchanti A, Briasoulis E, Karavasilis V, Tsanou H, Arvanitis DL, Agnantis NJ, Pavlidis N 2002 Immunohistochemical expression of extracellular matrix components tenascin, fibronectin, collagen type IV and laminin in breast cancer: their prognostic value and role in tumour invasion and progression. Eur J Cancer 38:2362–2370
  38. Hennigan RF, Stambrook PJ 2001 Dominant negative c-jun inhibits activation of the cyclin D1 and cyclin E kinase complexes. Mol Biol Cell 12:2352–2363[Abstract/Free Full Text]
  39. Dhar A, Hu J, Reeves R, Resar LM, Colburn NH 2004 Dominant-negative c-Jun (TAM67) target genes: HMGA1 is required for tumor promoter-induced transformation. Oncogene 23:4466–4476[CrossRef][Medline]
  40. Ludes-Meyers JH, Liu Y, Munoz-Medellin D, Hilsenbeck SG, Brown PH 2001 AP-1 blockade inhibits the growth of normal and malignant breast cells. Oncogene 20:2771–2780[CrossRef][Medline]
  41. Brown PH, Alani R, Preis LH, Szabo E, Birrer MJ 1993 Suppression of oncogene-induced transformation by a deletion mutant of c-jun. Oncogene 8:877–886[Medline]
  42. Agadir A, Shealy YF, Hill DL, Zhang X 1997 Retinyl methyl ether down-regulates activator protein 1 transcriptional activation in breast cancer cells. Cancer Res 57:3444–3450[Abstract/Free Full Text]
  43. Schule R, Rangarajan P, Yang N, Kliewer S, Ransone LJ, Bolado J, Verma IM, Evans RM 1991 Retinoic acid is a negative regulator of AP-1-responsive genes. Proc Natl Acad Sci USA 88:6092–6096[Abstract/Free Full Text]
  44. Uht RM, Anderson CM, Webb P, Kushner PJ 1997 Transcriptional activities of estrogen and glucocorticoid receptors are functionally integrated at the AP-1 response element. Endocrinology 138:2900–2908[Abstract/Free Full Text]
  45. Yang-Yen HF, Chambard JC, Sun YL, Smeal T, Schmidt TJ, Drouin J, Karin M 1990 Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62:1205–1215[CrossRef][Medline]
  46. Jonat C, Rahmsdorf HJ, Park KK, Cato AC, Gebel S, Ponta H, Herrlich P 1990 Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189–1204[CrossRef][Medline]
  47. Dai D, Litman ES, Schonteich E, Leslie KK 2003 Progesterone regulation of activating protein-1 transcriptional activity: a possible mechanism of progesterone inhibition of endometrial cance