| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Gene: Isolation, Distribution, Pharmacological Characterization and Regulation by Stress and Glucocorticoids
Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, La Jolla, California 92037
Address all correspondence and requests for reprints to: Wylie Vale, Ph.D., Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, California 92037. E-mail: vale{at}salk.edu.
| ABSTRACT |
|---|
|
|
|---|
(mCRFR2
) ortholog from brain. The isolated cDNA encodes a 411-amino acid protein with high identity to the rat (
97%) and human (
93%) receptors. Central and peripheral expression of mCRFR2
, determined by RT-PCR followed by Southern hybridization, revealed that mCRFR2
is restricted mainly to brain structures, with highest levels in the hypothalamus and olfactory bulb. In situ hybridization showed mCRFR2
localization in discrete brain regions, including the lateral septum and the ventromedial hypothalamus, whereas mCRFR2ß is found only in the choroid plexus. Binding and signaling of CRF-related ligands was studied using COS-M6 or HEK293T cells transiently transfected with mCRFR2
. Urocortins (Ucns) show different affinities for binding to mCRFR2
: Ucn 3 binds mCRFR2
with approximately 11-fold lower affinity than Ucn 2, which displays an affinity similar to Ucn 1 (
1 nM). Cyclase activation, determined by intracellular cAMP accumulation and cAMP response element-luciferase activity, showed no differences between CRFR2
and CRFR2ß in response to stimulation by Ucn 1, Ucn 2, and Ucn 3. Interestingly, Ucn 3 was less efficacious than Ucn 1 or Ucn 2 in activating MAPK (ERK1/2-p44/p42) via CRFR2
, but all three Ucns showed equivalent efficacy for activating MAPK through mCRFR2ß. We found a significant reduction in hypothalamic mCRFR2
mRNA levels after acute and chronic restraint stress in mice. Hypothalamic mCRFR2
gene transcription in mice was inhibited by glucocorticoid administration and elevated by adrenalectomy. In addition, we demonstrated that the mCRFR2
gene is increased in the hypothalamus of the CRFR1-null compared with wild type mice. The predicted mCRFR2
promoter region was isolated and fused to a luciferase reporter gene and found to be decreased by glucocorticoids in a dose and time-dependent manner when transfected into CATH.a cells. Computer analysis revealed the presence of 23 putative half-palindromic glucocorticoid response element sequences within 2.4 kb of the mCRFR2
5' flanking region. Elucidation of the structure and processing of the mCRFR2 gene and examination of the mCRFR2
gene regulation in various conditions will enable better understanding of the involvement of this receptor in the central response to stress in normal and transgenic mice models. | INTRODUCTION |
|---|
|
|
|---|
The effects of CRF-related peptides are mediated through activation of two high-affinity membrane-bound receptors, CRF receptor 1 (CRFR1) (11, 12, 13, 14) and CRFR2 (15, 16, 17, 18, 19). Both CRFR1 and CRFR2 belong to the class B1 subfamily of seven-transmembrane receptors that signal by coupling to G proteins. Structurally, CRFR1 and CRFR2 are approximately 70% identical at the amino acid level, but are divergent at the N terminus. The CRFR1 gene expresses one known functional variant, both in humans and rodents (CRFR1
, generated by deletion of exon 6) and several nonfunctional variants, which are produced by differential splicing of various exons (20, 21, 22). The CRFR2 has three functional splice variants in human (
, ß, and
) and two in rat (
and ß) that are produced by the use of alternate 5' exons (15, 16, 17, 18, 19, 23).
CRFR1 mRNA is widely expressed in mammalian brain and pituitary, with high levels in the anterior pituitary, cerebral cortex, cerebellum, amygdala, hippocampus,, and olfactory bulb (24). In the periphery, CRFR1 is expressed in testes, ovary, skin, and spleen. CRFR2 mRNA is expressed in a discrete pattern in the brain with highest densities in the lateral septal nucleus, bed nucleus of stria terminalis (BNST), ventromedial hypothalamic nucleus (VMH), olfactory bulb and mesencephalic raphe nuclei (24). The CRFR2
is the dominant CRFR2 splice variant expressed in the rat brain (25, 26). CRFR2ß mRNA is widely expressed in peripheral tissues, with highest levels in the skeletal muscle, heart, and skin (15). Interestingly, the CRFR2ß splice variant is peripherally expressed in rodents, whereas the CRFR2
is the predominant splice variant found in the periphery of human. Thus far, no significant functional differences between CRFR2 splice variants have been found.
The distributions of CRFR1 and CRFR2 in the central nervous system (CNS) and periphery are distinct and may imply diverse physiological functions, as demonstrated by the phenotypes of the CRFR1 or CRFR2 null mice. Although mice deficient for CRFR1 display decreased anxiety-like behavior and have an impaired stress response (27, 28), the CRFR2 mutant mice have increased anxiety-like behaviors and an accelerated hypothalamus-pituitary-adrenal response to stress (29, 30, 31). However, the responses to administration of CRFR2 agonists and antagonists into specific brain regions reveal both anxiolytic and anxiogenic-like roles for CRFR2 (31, 32, 33, 34 ; and for review see Ref.35).
Receptor binding and intracellular cAMP accumulation studies in cells stably transfected with CRFR2 or CRFR1 have demonstrated that CRFR1 and CRFR2 differ pharmacologically. CRF has relatively lower affinity for CRFR2 compared with its affinity for CRFR1 (7), Ucn 1 has equal affinities for both receptors and Ucn 2 and Ucn 3 appear to be selective for CRFR2 (7, 8, 10).
CRFR1 and CRFR2 signal largely, but not exclusively, by coupling to Gs, leading to the stimulation of adenylyl cyclase and activation of protein kinase A (PKA). However, the activation of specific CRFRs in distinct tissues or cell types by receptor-selective CRF peptides has been demonstrated to activate a variety of signaling pathways, including coupling to different G proteins, stimulation of protein kinase B, protein kinase C, intracellular calcium, and MAPK (for review see Refs.35, 36, 37, 38).
The levels of the CRFR2 gene expression in heart, skeletal muscle, and brain were shown to be regulated by stress, glucocorticoids, cytokines, bacterial endotoxin, and Ucn 1. In the hypothalamic VMH, the levels of CRFR2 mRNA were reported to be up-regulated by corticosterone (39) and leptin administration (39). Starvation (39), repeated immobilization stress (41), and maternal deprivation (42) decreased the expression level of CRFR2 mRNA in the rat VMH (45). Neither corticosterone administration, starvation, nor adrenalectomy (ADX) influenced the levels of CRFR2 mRNA levels in the hypothalamic paraventricular nucleus (39), suggesting that these receptors are differentially regulated in different hypothalamic nuclei. In the heart, the CRFR2 mRNA levels were demonstrated to be down-regulated by in vivo administration of the bacterial endotoxin lipopolysaccharide (43, 44, 45), and up-regulated in the skeletal muscle (43). Restraint stress, corticosterone, Ucn 1, or cytokines administration down-regulate CRFR2 mRNA in rat (44) and mice (45) hearts.
Here we present data on the isolation and characterization of the mouse CRFR2
(mCRFR2
) splice variant and a comparison of its central and peripheral distribution, pharmacological profile, and signaling with that of the mCRFR2ß isoform. In addition we determine the in vivo regulation of hypothalamic mCRFR2
mRNA by acute and chronic stress, glucocorticoids, adrenalectomy, and the basal expression in CRFR1-null mice.
| RESULTS |
|---|
|
|
|---|
Ortholog
ortholog (Fig. 1A
cDNA encodes a 411-amino acid protein with approximately 97% and approximately 93% identity to the rat and the human proteins, respectively (Fig. 2
cDNA and genomic sequences, available in the public DNA database, revealed the structural organization of the mCRFR2 gene and the relevant exon arrangement for the two alternative splice isoforms mCRFR2
and mCRFR2ß (Fig. 1B
vs. mCRFR2ß at the N terminus are the result of alternative splicing of the mCRFR2 gene and the use of different 5' exons. The mCRFR2ß isoform includes the first two exons, which are separated by a large 8996-bp intron, and omits the third exon, whereas the mCRFR2
begins with the third exon (Fig. 1B
|
|
|
and CRFR2ß mRNA in Mouse Central and Peripheral Tissues
and mCRFR2ß mRNA. Total RNA prepared from tissues encompassing several regions of the CNS (olfactory bulb, hypothalamus, cortex, cerebellum, hippocampus, midbrain, pons/medulla, and spinal cord) and a variety of peripheral tissues was reverse-transcribed to generate cDNAs. The cDNA products were used as templates for semiquantitative RT-PCR analysis, followed by Southern hybridization, using specific primers and probes for mCRFR2
, mCRFR2ß and for the ribosomal protein S16, which served as internal control (Fig. 3
(Fig. 3
(Fig. 3
hyb.) and CRFR2ß (Fig. 3
and mCRFR2ß cDNA fragments from selected tissues were isolated and subcloned, and the nucleotide sequences were determined. The mCRFR2ß sequences were compared with those in the GenBank database and the mCRFR2
sequences to our isolated sequence, and they were found to be identical. The RT-PCR and southern hybridization for mCRFR2
and mCRFR2ß demonstrate a specific tissue distribution pattern of mCRFR2
vs. mCRFR2ß (Fig. 3
mRNA was found to be restricted mainly to brain structures with lower levels of expression in the heart and liver. The mCRFR2ß mRNA was found to be widely expressed in peripheral tissues, likely due to its expression in blood vesicles. We found the mCRFR2ß mRNA to be most highly expressed in skeletal muscle, heart, and skin tissues (Fig. 3C
mRNA (Fig. 3C
and mCRFR2ß in the mouse brain, we generated specific in situ probes for each of the isoforms based on their unique exons, e.g. exons one and two for mCRFR2ß and exon three for mCRFR2
(Fig. 4A
was detected in several brain nuclei, including the lateral septum (Fig. 4B
was detected in the choroid plexus (Fig. 4B
|
|
and mCRFR2ß
are shown in Table 2
with higher affinity than Ucn 3 and CRF (Table 2
with approximately 11- and 14-fold lower affinity compared with Ucn 2 and Ucn 1, respectively (Table 2
.
|
was used as a measure of receptor activation. The potencies of Ucn 1, Ucn 2, and Ucn 3 in activating mCRFR2
are approximately equal (Table 2
or mCRFR2ß expressing cells, we measured the activation of the cAMP response element (CRE) after treatment with the different Ucns (Fig. 5
or mCRFR2ß expression constructs. Cells were treated for 4 h with vehicle or with 0.3, 3, 30, and 300 nM Ucn 1, Ucn 2, or Ucn 3 and luciferase reporter activity was measured and normalized on the basis of ß-galactosidase (ß-gal) activity (Fig. 5
or mCRFR2ß expressing cells were observed (Fig. 5
(Fig. 6
(EH). After 5 min of receptor stimulation, ERK activation was calculated by level of activation of phosphorylated ERK1/2-p42, 44/ total ERK2-p44 compared with that of the nontreated control (NT, Fig. 6
, whereas Ucn 2 and Ucn 3 showed equivalent efficacy for activating MAPK through mCRFR2ß (Fig. 6
and mCRFR2ß (Fig. 6
|
|
mRNA Expression Levels after Acute and Chronic Stress
mRNA levels in the hypothalamus were determined using quantitative RT PCR. We examined the effect of 30 min acute restraint stress on mCRFR2
mRNA levels in the hypothalamus. The mCRFR2
mRNA levels significantly decreased in the hypothalamus of animals killed 1, 3, 6, and 12 h after the stress paradigm, compared with nonstressed mice (Fig. 7A
mRNA levels was also observed in mice subjected to the chronic restraint stress protocol for a consecutive 9 d compared with the levels in unstressed control mice (Fig. 7B
|
Expression in Mouse Hypothalamus by Dexamethasone and Adrenalectomy and in CRFR1-Null Mice
expression in the brain. Increases in circulating glucocorticoids in response to activation of pituitary CRFR1 feedback to the brain, including the hypothalamus, which expresses high levels of glucocorticoid receptors. We therefore examined hypothalamic mCRFR2
gene transcription after glucocorticoid administration in vivo, ADX and in the CRFR1-null mice.
We first determined the effect of dexamethasone injections on mCRFR2
mRNA levels in the hypothalamus. Dexamethasone (150 and 300 µg/kg body weight) significantly decreased the expression of mCRFR2
in the hypothalamus in animals killed 12 h after injections of the steroid (Fig. 8B
). In animals killed 2 h after dexamethasone injection (Fig. 8A
), only the higher dose of dexamethasone significantly decreased the expression of mCRFR2
in the hypothalamus.
|
mRNA levels in the whole mouse hypothalamus were increased compared with sham operated and control mice (Fig. 9A
gene is up-regulated in the hypothalamus of the CRFR1-null mice (Fig. 9B
|
mRNA and Promoter Activity by Glucocorticoids in CATH.a Cells
mRNA levels in vitro, we used quantitative RT-PCR and Southern blot hybridization to measure the mCRFR2
mRNA levels in CATH.a cells treated with dexamethasone. The mRNA levels of the mCRFR2
were significantly decreased after 16 h treatment with 10 nM and 100 nM dexamethasone (Fig. 10
|
expression is promoter mediated, we screened the mCRFR2 gene for possible promoter sites using computer programs. A strong putative promoter sequence is found in the first kilobase pair sequence upstream to exon 3 (the 3' end of intron 2). A DNA fragment covering approximately 2.4 kb of the region 5' to exon 3 was amplified by PCR using a mouse genomic DNA clone isolated previously in our laboratory and subcloned into a luciferase reporter plasmid (Fig. 11A
endogenously, was found to be robust, suggesting that positive regulatory elements are located within this fragment (Fig. 11B
promoter activity after dexamethasone treatment, CATH.a cells were transfected with 2.5 µg of the mCRFR2
reporter plasmid construct and 50 ng of ß-gal construct, and treated with different concentrations of dexamethasone (100 pM to 1 µM) for 24 h (Fig. 11C
mRNA is mediated by a mechanism involving GR, their binding sites were blocked with the nonspecific steroid hormone antagonist RU486. RU486 (10 µM) showed no effect on mCRFR2
promoter activation when given alone but essentially abolished the inhibition of mCRFR2
reporter construct by 10 nM dexamethasone (Fig. 11C
promoter activity is mediated through a GR.
|
promoter contained a glucocorticoid response element (GRE) consensus site, we screened the promoter sequence for a GRE using Transcription Element Search Software (http://www.cbil.upenn.edu/tess/index.html). The sequence analysis revealed the presence of 23 putative half-palindrome GRE sequences, within the 2.4 kb of the mCRFR2
5' flanking region at positions 263, 311, 405, 452, 506, 762, 790, 880, 946, 1053, 1111, 1200, 1783, 1797, 1876, 1935, 2028, 2033, 2140, 2279, 2369, and 2388 (Fig. 12
|
| DISCUSSION |
|---|
|
|
|---|
, generated by deletion of exon 6) and several nonfunctional variants, designated ß and c through h subtypes, which are produced by differential splicing of various exons (20, 21, 22). The CRFR2 has three functional splice variants in humans (
, ß, and
) and two in rats (
and ß) that are produced by the use of alternate 5' exons (15, 16, 17, 18, 19, 23). Based on the homology between known mammalian CRFR genes, we isolated a cDNA encoding for the mCRFR2
ortholog from brain. The mCRFR2 gene is composed of 14 known exons; the differences in the amino acid sequences of mCRFR2
vs. mCRFR2ß at the N terminus of the ECD1 are the result of alternative splicing of the mCRFR2 gene and the use of different 5' exons, similar to that reported for the rat and the human isoforms (18, 19). The structure of the human CRFR2 gene, composed of fifteen known exons and multiple promoters, has recently been reported (46).
The data from RT-PCR and southern hybridization for mCRFR2
and mCRFR2ß demonstrate a specific tissue distribution pattern of mCRFR2
vs. mCRFR2ß. The expression of mCRFR2
mRNA was found to be restricted mainly to brain structures whereas the mCRFR2ß mRNA was found to be most highly expressed in skeletal muscle, heart and skin tissues. Previous studies demonstrated that CRFR2 mRNA is widely expressed in peripheral tissues, mainly in heart, gastrointestinal tract, lung, ovary, and skeletal muscle (15, 16, 25). Interestingly, the CRFR2ß splice variant is the CRFR2 isoform that is expressed peripherally in rodents, whereas the CRFR2
is the major splice variant found in the periphery of human (37).
Specific in situ hybridization studies of mouse brain sections revealed positive hybridization signals for mCRFR2
in several brain nuclei, including the lateral septum, ventromedial hypothalamus, dorsal raphe, and BNST. A positive hybridization signal for mCRFR2ß was detected only in the choroid plexus, a rich capillary structure found within the ventricles, and not in any other neuronal or glial structures, similar to that reported for the rat isoforms (18, 25, 26).
The responses of CRF-related peptides are initiated at the cellular level by binding to specific, high-affinity membrane-bound receptors. The activation of CRFRs in distinct cell types by receptor-selective CRF peptides may activate selective signaling pathways. Activation of CRFRs results in coupling to different G proteins and the stimulation of a variety of signaling pathways including adenylyl cyclase/cAMP, PKA, protein kinase B, protein kinase C, intracellular calcium, cGMP and MAPK (for review see Ref.38). By comparing the binding affinities of the CRF ligands in cells expressing mCRFR2
we demonstrated that Ucn 1 and Ucn 2 bind with higher affinity than Ucn 3 and CRF. The cAMP/PKA pathway has been extensively studied with respect to the CRFR activation and has been used to discriminate subtype agonist selectivity. We therefore studied cAMP accumulation and the activation of cAMP response element (CRE) reporter gene in cells expressing the mCRFR2
or mCRFR2ß. We demonstrated that the potencies of Ucn 1, Ucn 2, and Ucn 3 in accumulation of cAMP or activating the CRE in mCRFR2
expressing cells are approximately equal. The binding affinities and EC50 values for camp activation are in good agreement with those reported by Dautzenberg et al. (47).
CRFR activation has been shown to stimulate the MAPK pathway, in particular, the ERK1/2-p42, 44 (for review see Ref.38). Activation of ERK1/2-p42, 44 by CRF family ligands varies according to both cell type and receptor type. CRFR-mediated activation of the ERK1/2-p42, 44 has been reported for sauvagine (48), CRF (49), Ucn 1 (49, 50, 51), and very recently for Ucn 2 and Ucn 3 (49). Activation of ERK1/2-p42, 44 in murine cardiac myocytes by Ucn 1 (52), Ucn 2 or Ucn 3 (53) results in cytoprotection against ischemia and ischemia reperfusion injury. The survival, promoted by Ucn 1 and CRF, of rat hippocampal neurons after oxidative and excitotoxic-induced cell death is mediated by activation of MAPK (51). CRF is reported to function as a differentiating factor in the immortalized noradrenergic neuronal CATH.a cells (54). The CRF-induced neurite outgrowth was blocked by ERK inhibitors (54). In the present study, we measured the selectivity of Ucn 1, Ucn 2, and Ucn 3 peptides to activate ERK1/2-p42, 44 through CRFR2ß or CRFR2
. Interestingly, unlike cAMP signaling, Ucn 3 was less efficacious than Ucn 1 or Ucn 2 in activating MAPK (ERK1/2-p44/p42) via CRFR2
, whereas Ucn 2 and Ucn 3 showed equivalent efficacy for activating MAPK through mCRFR2ß. Ucn 1 was the most efficient, compared with Ucn 2 and Ucn 3, in activating MAPK via both mCRFR2
and mCRFR2ß.
CRFR2 mRNA has been demonstrated to be highly expressed in the hypothalamus, specifically in the VMH, a region associated with the regulation of food intake and energy balance (18, 24). The CRFR2 has been proposed as a potential mediator of the effects of CRF ligands on food intake (55), as suggested by in vivo studies with CRFR2 ligands (for review see Ref.56). Understanding the regulation of hypothalamic CRFR2 may provide insight into the physiological function of this receptor. In the present study, we examined the expression of hypothalamic mCRFR2
after both acute and chronic restraint stress. We found a significant reduction in the hypothalamic mCRFR2
mRNA levels 36 h after acute restraint stress. Additionally, after 9 d of chronic stress, we found a significant reduction in the mCRFR2
transcript levels compared with control mice. Previous studies demonstrated a down-regulation of CRFR2 mRNA levels in the VMH of immature rats after 24 h maternal separation, a paradigm depriving the pup from food, maternal contact, and maternal licking (42). The down-regulation of CRFR2 mRNA levels in VMH of immature rats after maternal separation was fully restored by sensory inputs of grooming and handling, but not by food intake (57). Previous studies demonstrated that repeated immobilization stress lowered the VMH CRFR2 mRNA levels in rats (41). Acute restraint stress also reduces cardiac CRFR2ß mRNA expression both in rat (44) and mouse (45).
The hypothalamus expresses high levels of glucocorticoid receptors, which may influence the regulation of CRFR2
expression through circulating glucocorticoids. Therefore, we examined hypothalamic mCRFR2
gene transcription after in vivo glucocorticoid administration or adrenalectomy or in CRFR1-null mice. We showed that hypothalamic mCRFR2
gene transcription is inhibited by glucocorticoid administration in vivo and elevated by adrenalectomy. Administration of glucocorticoids to mice resulted in a decrease of mCRFR2
levels in the hypothalamus 12 h after ip injection. In addition, we demonstrated that the mCRFR2
gene is up-regulated in the hypothalamus of CRFR1-null mice. In contrast to our results, Makino et al. (39) reported an increase in CRFR2 mRNA levels in the VMH of rats after a high dose of corticosterone administration and a decrease after ADX. The same study also reported that the levels of CRFR2 mRNA in the paraventricular nucleus were not influenced by corticosterone administration or ADX (39), suggesting that these receptors are differentially regulated in different hypothalamic nuclei. The differences between our current data and those by Makino et al. could be explained by species differences used in these studies, the dose of corticosteroids, the duration of treatment, or the involvement of other hypothalamic nuclei in addition to VMH. Both our in vitro and in vivo studies consist of administration of one single dose of corticosteroids, compared with repeated injections or implanted corticosterone pellets used by Makino et al. (39). Other studies were shown that corticosterone administration in vivo and dexamethasone treatment in vitro caused a decrease in CRFR2ß mRNA levels in murine hearts (44, 45) and A7R5 cells, respectively (44).
To determine whether the effect of glucocorticoids on mCRFR2
expression is regulated at the level of transcription, we isolated a DNA fragment, upstream to exon 3, containing a putative promoter sequence for mCRFR2
. The robust basal activity of this construct in CATH.a cells suggests that positive regulatory elements are located within this fragment. The reporter activity of the mCRFR2
promoter construct was found to be decreased by glucocorticoids in a dose- and time-dependent manner. In addition, the nonspecific steroid hormone antagonist RU486 essentially abolished the inhibition of the mCRFR2
reporter construct by dexamethasone. These results suggest that the effect of glucocorticoids on mCRFR2
promoter activity may be mediated through glucocorticoid receptors. Computer analysis revealed the presence of 23 putative half-palindrome glucocorticoid response element sequences within 2.4 kb of the mCRFR2
5' flanking region. Further detailed studies including promoter deletion experiments are needed to clarify the putative GRE sites necessary or sufficient to mediate the effects of glucocorticoids. Further examination of the regulation of CRFR2
in different brain regions may reveal the manner by which the CRFR2 pathway is involved in physiological responses to stress, in normal and transgenic mice models.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Ortholog
cDNA was subcloned from the pCRIITOPO vector into pCDNA3.0 expression vector (Invitrogen Life Technologies), using HindIII and XhoI. The sequences reported in this paper have been deposited in the GenBank database (accession no. AY445512).
RNA Preparation
Total RNA was extracted from mouse tissues using the Trizol RNA isolation reagent (Molecular Research Center, Cincinnati, OH) based on acid guanidinium thiocyanate-phenol-chloroform extraction method, according to the manufacturers recommendations. The following mouse peripheral and CNS tissues were dissected and directly subjected to total RNA isolation: stomach, duodenum, jejunum, ileum, colon, lung, heart, liver, kidney, spleen, thymus, brown fat, white fat, skin, ovary, uterus, testes, adrenal, skeletal muscle, pancreas, mammary glands from virgin females, mammary glands from d 10 and 21 of lactation, total brain from 2-d-old pups, placenta from embryonic d 12 and 18, total embryo obtain from embryonic d 12 and 18, total brain, olfactory bulb, hypothalamus, cortex, cerebellum, hippocampus, midbrain, pons/medulla oblongata, and spinal cord. Total RNA was also isolated from hypothalami of mice after acute and chronic stress procedure, adrenalectomized and CRFR1-null mice, and mice treated with dexamethasone at various doses and time points.
Semiquantitative and Quantitative RT-PCR
Total RNA preparations derived from mouse tissues were reverse transcribed to generate cDNA pools. The cDNA products were used as templates for semiquantitative and quantitative RT PCR analysis using specific primers for mCRFR2
, mCRFR2ß and the ribosomal protein S16. To avoid false positive results caused by DNA contamination, we performed a deoxyribonuclease (DNase) treatment for 30 min at 37 C using the RQ1 ribonuclease-free DNase (catalog no. M6101, Promega Corp., Madison, WI). We used semiquantitative RT-PCR to amplify the levels of endogenous mCRFR2
and mCRFR2ß present in the mouse tissues studied (Fig. 3
). The expression of ribosomal protein S16 (58) served as internal control. The PCR conditions were as follows: cDNA equivalent to 200 ng of total RNA was amplified by PCR for 35 cycles at an annealing temperature of 62 C. The final MgCl2 concentration was 3 mM, and each reaction contained 2.5 U of Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK). We used quantitative RT-PCR (59) to amplify the levels of mCRFR2
mRNA present in the mouse hypothalamus after acute and chronic stress (Fig. 7
), and in adrenalectomized and CRFR1-null mice (Fig. 8
). mCRFR2
mRNA levels were also determined in mouse hypothalami and CATH.a cells treated with different doses of dexamethasone (Sigma Chemical, St. Louis, MO) and at different time points (Figs. 9
and 10
). The expression of the ribosomal protein, S16 (58), served as internal control. Each reaction contained four oligonucleotide primers, two for mCRFR2
and two for S16 internal control. The PCR conditions were: cDNA equivalent to 200 ng of RNA was amplified by PCR for 35 cycles (the exponential phase of amplification is 3040 cycles); the annealing temperature was 62 C; the final primers concentration was 1 µM for mCRFR2
and 0.5 µM for S16; the final MgCl2 concentration was 3 mM; and each reaction contained a 2.5 U of Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK).
Southern Analysis
The PCR products were transferred onto a nylon membrane (Hybond-N, Amersham Pharmacia Biotech, Buckinghamshire, UK) by overnight capillary blotting in 20x saline sodium citrate (SSC) solution and the nylon was baked in a vacuum oven at 80 C for 2 h. Overnight hybridizations were performed (sequentially on the same membrane for the quantitative RT-PCR products) using Super Hyb Kit (Molecular Research Center Inc., Cincinnati, OH) in the presence of a 32P-labeled probe, specific to the mCRFR2
, mCRFR2ß or S16 cDNA. Hybridizations were performed at 60 C for mCRFR2
and mCRFR2ß and at 62 C for the S16 probe. The corresponding bands could be seen after exposure of the membranes to PhosphorImager plates (445 SI, Molecular Dynamics, Inc., Jersey City, NJ). Gels were also exposed to x-ray film (Fuji Photo Film Co., Ltd., Tokyo, Japan) for 216 h at 80 C and were developed in CURIX 60 processor (AGFA, Köln, Germany).
Oligonucleotide Primers
Sense and antisense primers were selected, when possible, to be located on different exons to avoid false-positive results caused by DNA contamination. The following specific mCRFR2
, mCRFR2ß and S-16 oligonucleotide primers were used in the PCRs: mCRFR2
-5'CCTGGACGGCTGGGGAGTG3' and 5'CAGAATGAAGGTGGTGATGAGGTT3' corresponding to nucleotides 208229 (exon 3, sense) and 602625 (exon 7, antisense) respectively (GenBank accession no. AY445512), the predicted size of the band is 418 bp; mCRFR2ß-5'CAGGCCAGGCACCCCAGGAC3' and 5'ACCACGCGATGTTTCTCAG3' corresponding to nucleotides 83102 (exon 2, sense) and 541559 (exon 7, antisense) respectively (GenBank accession no. MMU17858, the predicted size of the band is 477 bp; S-165'TGCGGTGTGGAGCTCGTGCTTGT3' and 5'GCTACCAGGCCTTTGAGATGGA3' corresponding to nucleotides 369391 (sense) and 19681990 (antisense) respectively (GenBank accession no. M11408), the predicted size of the band is 309 bp.
DNA Sequencing
The appropriate cDNA fragments of mCRFR2
and mCRFR2ß obtained from the mouse tissues were extracted from the gels using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and subcloned into pGEM-T vector using the pGEM-T Easy Vector System I (Promega Corp.). Nucleotide sequencing of the specific PCR bands was performed by automated direct DNA sequencing, according to the manufacturers recommendations (model 377, PE Applied Biosystems, PerkinElmer Corp., Foster City, CA).
In Situ Hybridization
To generate a specific in situ probes for the two mCRFR2 isoforms, specific mCRFR2
or mCRFR2ß cDNA fragments were isolated, using RT PCR, from hypothalamic and heart cDNA, respectively, and were subcloned into pCRIITOPO vector (Invitrogen Life Technologies). The following specific oligonucleotide primers were used in the PCRs for the isolation of mCRFR2
or mCRFR2ß specific in situ probes: mCRFR2
-5'GCGGCCCCTCAGCTCCGCGAG3' (sense) and 5'TCGGGGTCCGGGGGCACTCCC3' corresponding to the exon three sequence (mCRFR2
-specific exon), and the size of the cDNA fragment is 315 bp; mCRFR2ß-5'GGGCTTTACCTTGGTGGGTAG3' (sense) and 5'CTGAAAAATTCCCAGTTGTGGTC3' (antisense) corresponding to exons one and exon two (mCRFR2ß-specific exons), and the size of the cDNA fragment is 294 bp. Mouse brains were quickly removed and frozen on dry ice. Frozen sections were cut to 20 µm-thick on a cryostat, thaw-mounted onto glass slides, and stored at 80 C until use. In situ hybridization was performed with 35S-labeled antisense and sense (control) cRNA probes transcribed from linearized plasmid (pCRIITOPO) containing the respective CRFR2 cDNA. Probes were labeled to specific activities of 13 x 108 dpm/µg, applied to slides and hybridized overnight at 55 C. Slides were washed in SSC with increasing stringency, followed by ribonuclease treatment at 37 C, and finally 0.1x SSC at 60 C. After dehydration, the slides were exposed to x-ray film (ß-Max; Kodak, Rochester, NY) for 4 d at 4 C and then coated with Kodak NTB-2 liquid emulsion and exposed at 4 C for 14 d.
Radioreceptor Assay
Peptides were synthesized by standard methods (60). Approximately 10 µg of this plasmid DNA corresponding to mCRFR2
were transfected into COS-M6 cells using the diethylaminoethyl dextran method. Two days later, the cells were detached and crude membrane fractions were prepared and used to measure binding by competitive displacement of [125I-Tyr0,Glu1,Nle17]sauvagine, as described (10). The displacement data were analyzed using the Prism program (GraphPad, San Diego, CA).
cAMP Stimulation in Transfected Cells
One day after transfection of mCRFR2
into COS-M6 cells, the cells were trypsinized, replated in DMEM with 10% fetal bovine serum (FBS) into 24- or 48-well tissue culture dishes (Costar, Corning, NY) and allowed to recover another 24 h. The medium was changed to DMEM with 0.1% FBS at least 2 h before treatments. The cells were preincubated for 30 min with 0.1 mM 3-isobutyl-1-methylxanthine and then exposed to rat/human CRF or other peptides for 30 min at 37 C. Intracellular cAMP was measured from triplicate wells using an RIA kit (Biomedical Technologies, Stoughton, MA).
ERK1/2 Assay
HEK 293 cells were grown in 5% CO2 to 60% confluence in DMEM supplemented with 10% vol/vol FBS, penicillin, streptomycin, and L-glutamine in 10 cm3 dishes (normal growth medium). For transfection, cells were washed once with opti-MEM (Invitrogen Life Technologies) media and incubated with 10 ml of opti-MEM media for 30 min. Cells were transfected using Quantum Prep Cytofectene Transfection Reagent Kit (Bio-Rad, Richmond, CA) whereby 6 µg of DNA for each receptor mCRFR2ß or mCRFR2
was mixed with 30 µl of transfection reagent and 600 µl of opti-MEM and incubated at room temperature for 30 min. Subsequently, the opti-MEM was removed from the cells and 5.4 ml of opti-MEM was mixed with the DNA transfection mix and then added to the HEK 293 cells overnight. The cells were incubated with normal growth medium for 16 h and then divided equally into one 24-well tissue culture plate for each receptor for an additional 16 h. The cells were then equilibrated with DMEM supplement with 900 µl 1% wt/vol BSA for 6 h and stimulated with 100 µl of 0.1% DMEM/BSA (no treatment control), 3, 30, 300, and 3000 nM mUcn 2 or mUcn 3 for 5 min to give final concentrations of 0, 0.3, 3, 30, and 300 nM respectively. Cells were harvested immediately in 100 µl of 1 x sample treatment buffer [STB, 50 mM Tris (pH 6.8), 100 mM dithiothreitol, 2% (wt/vol) sodium dodecyl sulfate, 0.1% (wt/vol) bromphenol blue, and 10% (wt/vol) glycerol]. The samples were boiled for 5 min, proteins were electrophoresed on a 412% sodium dodecyl sulfate-polyacrylamide gradient gel (Invitrogen Life Technologies), subsequently transferred onto Nitrocellulose membranes, and then probed for 2 h at room temperature using an antibody that detects phosphorylated ERK1/2-p42, 44 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The membranes were washed in PBS and 0.05% (vol/vol) Tween and incubated with horseradish peroxidase-conjugated mouse IgG raised in sheep (Amersham Biotech Pharmacia). Immunoreactive proteins were visualized using Super Signal West Pico Chemiluminescent substrate (Pierce, Rockford, IL). The relative protein levels were determined using densitometry (Image quant 1.2) by probing the membranes with an antibody directed against total ERK2, p44 protein (Santa Cruz Biotechnology, Inc.).
Construction of Luciferase Reporter Gene Plasmid
The mCRFR2
promoter has been predicted using the online PromoterInspector tool (Genomatrix Software GmbH, Munich, Germany), and predicted to be the intronic sequence, 5' to exon number 3. The mCRFR2
5' flanking region construct (
2.5 kb of the 3' end of intron 2) was cloned by PCR using mouse genomic DNA. The primers that were used for the construct were designed to include an artificial restriction endonuclease site for XhoI and HindIII. The primers sequence were as follows. Sense primer [(2475)-(2498)]: 5'CTTAGGCAGAGTTGGGGGAGACAT3'. Antisense primer [(+128)-(+149)]: 5'GCGCGACGAGGAGCAGCCAGAG3'. The PCR product was analyzed by agarose gel electrophoresis in 1xTAE buffer (0.04 M Tris-acetate, 0.001 M EDTA), and eluted from the gel. After digestion by the appropriate restriction enzymes, HindIII and XhoI, the DNA fragments were cloned into the luciferase reporter plasmid pGL3 (catalog no. E1751, Promega Corp.) and the sequence was verified using automated direct DNA sequencing.
Transient Transfections and Luciferase Assay
CATH.a and 293T cells were used for the mCRFR2
promoter studies and for the CRE activation studies, respectively. The cells were grown in DMEM (Invitrogen Life Tech-nologies), containing 10% charcoal-treated FBS supplemented with 100 µg/ml of penicillin/streptomycin (Invitrogen Life Technologies). For transfection, CATH.a cells (3x104) were plated in six-well plates. On the following day, the cells were transfected with 0.54.0 µg of the reporter gene construct and 50 ng ß-gal expression plasmid using the Gene PORTER 2 Transfection Reagent (Gene Therapy Systems Inc., San Diego, CA) according to manufacturers recommendations. Each experiment contained a transfection with a positive control reporter plasmid containing the cytomegalovirus promoter to permit estimation of transfection efficiencies and comparison of results obtained from different experiments. Cells were treated with different concentrations of dexamethasone (Sigma Chemical) for 24 h or treated with 10 nM dexamethasone at different time points. The 293T cells were transfected with a luciferase reporter containing a fragment of the EVX1 gene which contains a potent CRE site (Conkright M Mol Cell 2003, kindly provided by Marc Montminy, The Salk Institute), using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturers instructions. Twenty hours post transfection, cells were treated for 4 h with vehicle or with 0.3, 3, 30, and 300 nM Ucn 1, Ucn 2, or Ucn 3. The cells were harvested and the luciferase reporter activity was assayed as follows. Cells were washed three times with PBS and lysed by resuspending in 100 µl of 100 mM KPO4 buffer (pH 7.8) containing 1 mM dithiothreitol and 0.5% (vol/vol) Triton X-100. The luciferase assay buffer contains 100 mM Tris acetate (pH 7.8), 10 mM MgOAc, 100 mM EDTA, 2 mM ATP (pH 7.0) and 74 µM luciferin. Activity tests were performed and luminescence was measured in a Biocounter M2500 luminometer (Lumac, Landgraaf, The Netherlands) for 20 sec immediately after addition of luciferin assay buffer. Transfections were performed at least six times (in triplicates) for each construct or treatment tested. To correct for variations in transfection efficiencies, luciferase activities were normalized to ß-gal activity.
Animals
Adult C57BL/6 male mice (2730 g) were used in all experiments. Animals were housed three per cage in a room with controlled temperature and a fixed lighting schedule (lights on from 06001800 h). Food and water were given ad libitum. All experimental protocols were approved by the animal care and use committee of The Salk Institute for Biological Studies.
Acute and Chronic Restraint Stress
Adult C57BL/6 male mice, individually housed, were subjected to a restraint stress procedure. Mice were placed in a ventilated 50 ml conical tube for 30 min and were killed 1, 3, 6, or 12 h after 30 min of acute restraint stress. Control mice were killed without manipulation. The brains were isolated and the hypothalamus was dissected and subjected to RNA isolation. The restraint stress protocol was also employed in separate group of mice for a consecutive 9 d, and the mice were killed on d 10, 24 h after the last 30 min of chronic restraint stress. The brains were isolated and the hypothalamus was dissected and subjected to RNA isolation.
ADX, Corticosterone Replacement, and Dexamethasone Administration
ADX was performed through a dorsal incision under isoflurane anesthesia. Sham operation was performed by manipulating the animal in the same manner but without removing the adrenal gland. One group of ADX mice received a replacement of corticosterone (catalog no. C-2502, Sigma Chemical, St. Louis, MO) in the drinking water at final concentration of 25 µg/ml, immediately after ADX surgery. All mice were killed 2 wk after ADX surgery, and the brains were isolated and the hypothalamus was dissected and subjected to RNA isolation. Blood collected from control, ADX, and corticosterone replacement mice was assayed for plasma corticosterone using the Corticosterone 125I RIA Kit (MP Biomedicals, Orangeburg, NY).
Dexamethasone (75 mg/kg, 150 mg/kg, 300 mg/kg) or saline were injected ip to mice. The mice were killed 2 or 12 h post injection, the brains were isolated and the hypothalamus was dissected and used for RNA isolation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
During the preparation of this manuscript, a study describing the isolation and pharmacological characterization of the mCRFR2
splice variant was reported (Ref.47 ). Part of this work was previously presented at the 2004 Annual Meeting of The Endocrine Society.
First Published Online October 28, 2004
Abbreviations: ADX, Adrenalectomy; BNST, bed nucleus of stria terminalis; CNS, central nervous system; CRE, cAMP response element; CRF, corticotropin-releasing factor; CRFR, CRF receptor; DNase, deoxyribonuclease; ECD, extracellular domain; FBS, fetal bovine serum; ß-gal, ß-galactosidase; GRE, glucocorticoid response element; mCRFR2
; mouse CRFR2
; PKA, protein kinase A; SSC, saline sodium citrate; Ucn, urocortin; VMH, ventromedial hypothalamic nucleus.
Received for publication July 26, 2004. Accepted for publication October 22, 2004.
| REFERENCES |
|---|
|
|
|---|
receptor. Mol Endocrinol 12:10771085
and CRF2 ß receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology 136:41394142[Abstract]
and TNF
down-regulate CRH receptor-2 mRNA expression in the mouse heart. Endocrinology 142:35373545
receptors regulate phosphorylation of calcium/cyclic adenosine 3',5'-monophosphate response element-binding protein and activation of p42/p44 mitogen-activated protein kinase. Endocrinology 140:15251536
and R2ß CRH receptor subtypes and stimulation of Gq-proteins. Mol Endocrinol 14:20762091This article has been cited by other articles:
![]() |
Y. Sztainberg, Y. Kuperman, O. Issler, S. Gil, J. Vaughan, J. Rivier, W. Vale, and A. Chen A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease FASEB J, July 1, 2009; 23(7): 2186 - 2196. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F Seasholtz, M. Ohman, A. Wardani, and R. C Thompson Corticotropin-releasing hormone receptor expression and functional signaling in murine gonadotrope-like cells J. Endocrinol., February 1, 2009; 200(2): 223 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C Moss, P. Anton, T. Savidge, P. Newman, A. S Cheifetz, J. Gay, S. Paraschos, M. W. Winter, M. P Moyer, K. Karalis, et al. Urocortin II mediates pro-inflammatory effects in human colonocytes via corticotropin-releasing hormone receptor 2{alpha} Gut, September 1, 2007; 56(9): 1210 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Wu, P.-q. Yuan, L. Wang, Y. L. Peng, C.-Y. Chen, and Y. Tache Identification and Characterization of Multiple Corticotropin-Releasing Factor Type 2 Receptor Isoforms in the Rat Esophagus Endocrinology, April 1, 2007; 148(4): 1675 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nemoto, A. Iwasaki-Sekino, N. Yamauchi, and T. Shibasaki Regulation of the expression and secretion of urocortin 2 in rat pituitary J. Endocrinol., February 1, 2007; 192(2): 443 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chen, B. Brar, C. S. Choi, D. Rousso, J. Vaughan, Y. Kuperman, S. N. Kim, C. Donaldson, S. M. Smith, P. Jamieson, et al. Urocortin 2 modulates glucose utilization and insulin sensitivity in skeletal muscle PNAS, October 31, 2006; 103(44): 16580 - 16585. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Jamieson, C. Li, C. Kukura, J. Vaughan, and W. Vale Urocortin 3 Modulates the Neuroendocrine Stress Response and Is Regulated in Rat Amygdala and Hypothalamus by Stress and Glucocorticoids Endocrinology, October 1, 2006; 147(10): 4578 - 4588. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Hillhouse and D. K. Grammatopoulos The Molecular Mechanisms Underlying the Regulation of the Biological Activity of Corticotropin-Releasing Hormone Receptors: Implications for Physiology and Pathophysiology Endocr. Rev., May 1, 2006; 27(3): 260 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Chen, M. H. Perrin, M. R. DiGruccio, J. M. Vaughan, B. K. Brar, C. M. Arias, K. A. Lewis, J. E. Rivier, P. E. Sawchenko, and W. W. Vale A soluble mouse brain splice variant of type 2{alpha} corticotropin-releasing factor (CRF) receptor binds ligands and modulates their activity PNAS, February 15, 2005; 102(7): 2620 - 2625. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |