help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0300
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, A.
Right arrow Articles by Vale, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, A.
Right arrow Articles by Vale, W.
Molecular Endocrinology 19 (2): 441-458
Copyright © 2005 by The Endocrine Society

Mouse Corticotropin-Releasing Factor Receptor Type 2{alpha} Gene: Isolation, Distribution, Pharmacological Characterization and Regulation by Stress and Glucocorticoids

Alon Chen, Marilyn Perrin, Bhawanjit Brar, Chien Li, Pauline Jamieson, Mike DiGruccio, Kathy Lewis and Wylie Vale

Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, La Jolla, California 92037

Address all correspondence and requests for reprints to: Wylie Vale, Ph.D., Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, California 92037. E-mail: vale{at}salk.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Effects of the corticotropin-releasing factor (CRF) family of peptides are mediated through activation of two receptors, CRF receptor (CRFR) 1 and CRFR2. Based on the homology between known mammalian CRFR genes, we have isolated a cDNA encoding the mouse CRFR2{alpha} (mCRFR2{alpha}) ortholog from brain. The isolated cDNA encodes a 411-amino acid protein with high identity to the rat (~97%) and human (~93%) receptors. Central and peripheral expression of mCRFR2{alpha}, determined by RT-PCR followed by Southern hybridization, revealed that mCRFR2{alpha} is restricted mainly to brain structures, with highest levels in the hypothalamus and olfactory bulb. In situ hybridization showed mCRFR2{alpha} localization in discrete brain regions, including the lateral septum and the ventromedial hypothalamus, whereas mCRFR2ß is found only in the choroid plexus. Binding and signaling of CRF-related ligands was studied using COS-M6 or HEK293T cells transiently transfected with mCRFR2{alpha}. Urocortins (Ucns) show different affinities for binding to mCRFR2{alpha}: Ucn 3 binds mCRFR2{alpha} with approximately 11-fold lower affinity than Ucn 2, which displays an affinity similar to Ucn 1 (~1 nM). Cyclase activation, determined by intracellular cAMP accumulation and cAMP response element-luciferase activity, showed no differences between CRFR2{alpha} and CRFR2ß in response to stimulation by Ucn 1, Ucn 2, and Ucn 3. Interestingly, Ucn 3 was less efficacious than Ucn 1 or Ucn 2 in activating MAPK (ERK1/2-p44/p42) via CRFR2{alpha}, but all three Ucns showed equivalent efficacy for activating MAPK through mCRFR2ß. We found a significant reduction in hypothalamic mCRFR2{alpha} mRNA levels after acute and chronic restraint stress in mice. Hypothalamic mCRFR2{alpha} gene transcription in mice was inhibited by glucocorticoid administration and elevated by adrenalectomy. In addition, we demonstrated that the mCRFR2{alpha} gene is increased in the hypothalamus of the CRFR1-null compared with wild type mice. The predicted mCRFR2{alpha} promoter region was isolated and fused to a luciferase reporter gene and found to be decreased by glucocorticoids in a dose and time-dependent manner when transfected into CATH.a cells. Computer analysis revealed the presence of 23 putative half-palindromic glucocorticoid response element sequences within 2.4 kb of the mCRFR2{alpha} 5' flanking region. Elucidation of the structure and processing of the mCRFR2 gene and examination of the mCRFR2{alpha} gene regulation in various conditions will enable better understanding of the involvement of this receptor in the central response to stress in normal and transgenic mice models.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE HYPOTHALAMIC-HYPOPHYSIOTROPIC peptide corticotropin-releasing factor (CRF), originally isolated from hypothalamus (1), plays an important and well-established role in the regulation of the hypothalamus-pituitary-adrenal axis under basal and stress conditions (2, 3), and in the integration of endocrine, autonomic and behavioral responses to stressors (4, 5, 6). In addition to CRF, the mammalian CRF-peptide family contains urocortin 1 (Ucn 1) (7), and the recently isolated peptides, Ucn 2, also known as stresscopin-related gene, (8, 9) and Ucn 3, also known as stresscopin (9, 10).

The effects of CRF-related peptides are mediated through activation of two high-affinity membrane-bound receptors, CRF receptor 1 (CRFR1) (11, 12, 13, 14) and CRFR2 (15, 16, 17, 18, 19). Both CRFR1 and CRFR2 belong to the class B1 subfamily of seven-transmembrane receptors that signal by coupling to G proteins. Structurally, CRFR1 and CRFR2 are approximately 70% identical at the amino acid level, but are divergent at the N terminus. The CRFR1 gene expresses one known functional variant, both in humans and rodents (CRFR1{alpha}, generated by deletion of exon 6) and several nonfunctional variants, which are produced by differential splicing of various exons (20, 21, 22). The CRFR2 has three functional splice variants in human ({alpha}, ß, and {gamma}) and two in rat ({alpha} and ß) that are produced by the use of alternate 5' exons (15, 16, 17, 18, 19, 23).

CRFR1 mRNA is widely expressed in mammalian brain and pituitary, with high levels in the anterior pituitary, cerebral cortex, cerebellum, amygdala, hippocampus,, and olfactory bulb (24). In the periphery, CRFR1 is expressed in testes, ovary, skin, and spleen. CRFR2 mRNA is expressed in a discrete pattern in the brain with highest densities in the lateral septal nucleus, bed nucleus of stria terminalis (BNST), ventromedial hypothalamic nucleus (VMH), olfactory bulb and mesencephalic raphe nuclei (24). The CRFR2{alpha} is the dominant CRFR2 splice variant expressed in the rat brain (25, 26). CRFR2ß mRNA is widely expressed in peripheral tissues, with highest levels in the skeletal muscle, heart, and skin (15). Interestingly, the CRFR2ß splice variant is peripherally expressed in rodents, whereas the CRFR2{alpha} is the predominant splice variant found in the periphery of human. Thus far, no significant functional differences between CRFR2 splice variants have been found.

The distributions of CRFR1 and CRFR2 in the central nervous system (CNS) and periphery are distinct and may imply diverse physiological functions, as demonstrated by the phenotypes of the CRFR1 or CRFR2 null mice. Although mice deficient for CRFR1 display decreased anxiety-like behavior and have an impaired stress response (27, 28), the CRFR2 mutant mice have increased anxiety-like behaviors and an accelerated hypothalamus-pituitary-adrenal response to stress (29, 30, 31). However, the responses to administration of CRFR2 agonists and antagonists into specific brain regions reveal both anxiolytic and anxiogenic-like roles for CRFR2 (31, 32, 33, 34 ; and for review see Ref.35).

Receptor binding and intracellular cAMP accumulation studies in cells stably transfected with CRFR2 or CRFR1 have demonstrated that CRFR1 and CRFR2 differ pharmacologically. CRF has relatively lower affinity for CRFR2 compared with its affinity for CRFR1 (7), Ucn 1 has equal affinities for both receptors and Ucn 2 and Ucn 3 appear to be selective for CRFR2 (7, 8, 10).

CRFR1 and CRFR2 signal largely, but not exclusively, by coupling to Gs, leading to the stimulation of adenylyl cyclase and activation of protein kinase A (PKA). However, the activation of specific CRFRs in distinct tissues or cell types by receptor-selective CRF peptides has been demonstrated to activate a variety of signaling pathways, including coupling to different G proteins, stimulation of protein kinase B, protein kinase C, intracellular calcium, and MAPK (for review see Refs.35, 36, 37, 38).

The levels of the CRFR2 gene expression in heart, skeletal muscle, and brain were shown to be regulated by stress, glucocorticoids, cytokines, bacterial endotoxin, and Ucn 1. In the hypothalamic VMH, the levels of CRFR2 mRNA were reported to be up-regulated by corticosterone (39) and leptin administration (39). Starvation (39), repeated immobilization stress (41), and maternal deprivation (42) decreased the expression level of CRFR2 mRNA in the rat VMH (45). Neither corticosterone administration, starvation, nor adrenalectomy (ADX) influenced the levels of CRFR2 mRNA levels in the hypothalamic paraventricular nucleus (39), suggesting that these receptors are differentially regulated in different hypothalamic nuclei. In the heart, the CRFR2 mRNA levels were demonstrated to be down-regulated by in vivo administration of the bacterial endotoxin lipopolysaccharide (43, 44, 45), and up-regulated in the skeletal muscle (43). Restraint stress, corticosterone, Ucn 1, or cytokines administration down-regulate CRFR2 mRNA in rat (44) and mice (45) hearts.

Here we present data on the isolation and characterization of the mouse CRFR2{alpha} (mCRFR2{alpha}) splice variant and a comparison of its central and peripheral distribution, pharmacological profile, and signaling with that of the mCRFR2ß isoform. In addition we determine the in vivo regulation of hypothalamic mCRFR2{alpha} mRNA by acute and chronic stress, glucocorticoids, adrenalectomy, and the basal expression in CRFR1-null mice.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of the mCRFR2{alpha} Ortholog
Based on the homology between known mammalian CRFR2 genes, oligonucleotide primers were designed to amplify a cDNA prepared from mouse whole brain poly (A)+ RNA using PCR. The amplified fragments were subcloned, sequenced, and found to encode a full-length mCRFR2{alpha} ortholog (Fig. 1AGo). The mCRFR2{alpha} cDNA encodes a 411-amino acid protein with approximately 97% and approximately 93% identity to the rat and the human proteins, respectively (Fig. 2Go). The protein is characterized by seven putative hydrophobic regions corresponding to seven transmembrane domains, a first extracellular domain (ECD1) containing six Cys residues and five putative N-linked glycosylation sites (Fig. 1AGo). Comparison of the mCRFR2{alpha} cDNA and genomic sequences, available in the public DNA database, revealed the structural organization of the mCRFR2 gene and the relevant exon arrangement for the two alternative splice isoforms mCRFR2{alpha} and mCRFR2ß (Fig. 1BGo and Table 1Go). The differences in the amino acid sequence of mCRFR2{alpha} vs. mCRFR2ß at the N terminus are the result of alternative splicing of the mCRFR2 gene and the use of different 5' exons. The mCRFR2ß isoform includes the first two exons, which are separated by a large 8996-bp intron, and omits the third exon, whereas the mCRFR2{alpha} begins with the third exon (Fig. 1BGo and Table 1Go).



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 1. Sequence and Schematic Structure Representation of CRFR2{alpha} Gene

A, Nucleotide and translated amino acid sequences of the CRF receptor type 2{alpha} (CRFR2{alpha}). Underlined amino acids indicate putative transmembrane domains. B, Schematic representation of the structure of the mCRFR2 gene (upper panel) and the two known functional transcripts in mouse, {alpha} (lower panel) and ß (middle panel) isoforms. The locations of the translation start sites (ATG) are indicated for {alpha} (lower panel) and ß (middle panel) isoforms. Exons coding for the N-terminal ECD, the seven transmembrane domains (7TM), and the C-terminal cytoplasmic domain (CD) are indicated. Boxed amino acids indicate putative N-linked glycosylation sites 5' and 3'-untranslated regions are indicated by hatched boxes, and open boxes represent coding regions.

 


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. Amino Acid Sequence Comparison of Mouse, Rat, and Human CRFR2{alpha} Proteins

The isolated mCRFR2{alpha} cDNA encodes a 411-amino acid protein with approximately 97% and approximately 93% identity to the rat and the human proteins, respectively.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Exon-Intron Organization of the Mouse CRFR2 Gene

 
Expression of CRFR2{alpha} and CRFR2ß mRNA in Mouse Central and Peripheral Tissues
Specific semiquantitative RT PCR followed by Southern hybridization analysis was performed to determine the central and peripheral tissue distribution of mCRFR2{alpha} and mCRFR2ß mRNA. Total RNA prepared from tissues encompassing several regions of the CNS (olfactory bulb, hypothalamus, cortex, cerebellum, hippocampus, midbrain, pons/medulla, and spinal cord) and a variety of peripheral tissues was reverse-transcribed to generate cDNAs. The cDNA products were used as templates for semiquantitative RT-PCR analysis, followed by Southern hybridization, using specific primers and probes for mCRFR2{alpha}, mCRFR2ß and for the ribosomal protein S16, which served as internal control (Fig. 3Go). Semiquantitative RT-PCR for mCRFR2{alpha} (Fig. 3Go, A and B, upper panels), CRFR2ß (Fig. 3Go, A and B, middle panels) and the ribosomal protein S16 (Fig. 3Go, A and B, lower panels) mRNAs were determined. Southern blot hybridization of amplified mCRFR2{alpha} (Fig. 3Go, A and B, mCRFR2{alpha} hyb.) and CRFR2ß (Fig. 3Go, A and B, CRFR2ß hyb.) cDNA fragments was also performed. The relative density of specific bands, quantified and normalized relative to the S16 expression are presented (Fig. 3CGo). Predicted mCRFR2{alpha} and mCRFR2ß cDNA fragments from selected tissues were isolated and subcloned, and the nucleotide sequences were determined. The mCRFR2ß sequences were compared with those in the GenBank database and the mCRFR2{alpha} sequences to our isolated sequence, and they were found to be identical. The RT-PCR and southern hybridization for mCRFR2{alpha} and mCRFR2ß demonstrate a specific tissue distribution pattern of mCRFR2{alpha} vs. mCRFR2ß (Fig. 3Go). The expression of mCRFR2{alpha} mRNA was found to be restricted mainly to brain structures with lower levels of expression in the heart and liver. The mCRFR2ß mRNA was found to be widely expressed in peripheral tissues, likely due to its expression in blood vesicles. We found the mCRFR2ß mRNA to be most highly expressed in skeletal muscle, heart, and skin tissues (Fig. 3CGo). Interestingly, total RNA obtained from d 12 of embryonic development shows relatively high levels of mCRFR2ß mRNA without any detectable levels of mCRFR2{alpha} mRNA (Fig. 3CGo). The high expression levels of mCRFR2ß in mammary glands obtained from virgin mice is most likely attributed to the high blood vesicle content (Fig. 3CGo). To further determine the mRNA distribution of mCRFR2{alpha} and mCRFR2ß in the mouse brain, we generated specific in situ probes for each of the isoforms based on their unique exons, e.g. exons one and two for mCRFR2ß and exon three for mCRFR2{alpha} (Fig. 4AGo). Positive hybridization signal for mCRFR2ß was found only in the choroid plexus, a rich capillary structure found within the ventricles, and not in any other neuronal or glial structures (Fig. 4BGo). Positive hybridization signal for mCRFR2{alpha} was detected in several brain nuclei, including the lateral septum (Fig. 4BGo), ventromedial hypothalamus, dorsal raphe and BNST. No positive hybridization signal for mCRFR2{alpha} was detected in the choroid plexus (Fig. 4BGo).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3. Expression of CRFR2{alpha} and CRFR2ß mRNA in Mouse Central and Peripheral Tissues

A and B, Representative image of electrophoretic analysis of the semiquantitative RT-PCR for mCRFR2{alpha} (A and B, upper panels), CRFR2ß (A and B, middle panels) and the ribosomal protein S16 (A and B, lower panels) mRNA. Southern blot hybridization of amplified mCRFR2{alpha} (A and B, mCRFR2{alpha} hyb.) and CRFR2ß (A and B, CRFR2ß hyb.). cDNA fragments were also performed. C, The radioactive bands were quantified by PhosphorImager, and normalized values (relative to the S16 expression) are presented as relative densitometry units. MamG-Vrg, Mammary glands obtained from virgin female; MamG-Lac10, mammary glands obtained from d 10 of lactation; MamG-Lac21, mammary gland obtained from d 21 of lactation; 2D brain, total brain obtained from 2-d-old pups; E12, Total embryo obtained from embryonic d 12; E18, embryo obtained from E18.

 


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 4. Mouse Brain in Situ Hybridization Using Specific Probes for CRFR2{alpha} and CRFR2ß

A, Schematic representation of the structure of the mCRFR2 functional transcripts and the location of the in situ hybridization probes specific for mCRFR2ß (upper panel) and mCRFR2{alpha} (lower panel) isoforms. B, Representative dark-field photomicrographs showing in situ hybridization for CRFR2{alpha} (a and c) and CRFR2ß (b and d) in the lateral septum (a and b) and the choroid plexus (c and d). In the lateral septum, positive hybridization signal was found with the CRFR2{alpha} (a) but not with the CRFR2ß (b) probe. In the choroid plexus, positive signal was detected with CRFR2ß (d), whereas no signal was found with CRFR2{alpha} probe (c). CP, Choroid plexus; LS, lateral septum; LV, lateral ventricle; MS, medial septum. Scale bar, 100 µm.

 
Pharmacological Characterization, Cyclase Activation, and MAPK Signaling of mCRFR2{alpha} and mCRFR2ß
The binding affinities and potencies for stimulating cAMP accumulation in cells expressing the mCRFR2{alpha} are shown in Table 2Go. Ucn 1 and Ucn 2 selectively bind mCRFR2{alpha} with higher affinity than Ucn 3 and CRF (Table 2Go). Ucn 3 binds to mCRFR2{alpha} with approximately 11- and 14-fold lower affinity compared with Ucn 2 and Ucn 1, respectively (Table 2Go). The affinity of CRF is approximately 6- and 7-fold lower than that of Ucn 1 or Ucn 2, respectively, for CRFR2{alpha}.


View this table:
[in this window]
[in a new window]
 
Table 2. Binding Properties and Functional Activities of CRF-Family Ligands

 
Intracellular cAMP accumulation in cells transfected with mCRFR2{alpha} was used as a measure of receptor activation. The potencies of Ucn 1, Ucn 2, and Ucn 3 in activating mCRFR2{alpha} are approximately equal (Table 2Go). To further investigate the activation of the cAMP signaling in mCRFR2{alpha} or mCRFR2ß expressing cells, we measured the activation of the cAMP response element (CRE) after treatment with the different Ucns (Fig. 5Go). The 293T cells were cotransfected with a luciferase reporter containing a fragment of the EVX1 gene that contains a potent CRE site, and the mCRFR2{alpha} or mCRFR2ß expression constructs. Cells were treated for 4 h with vehicle or with 0.3, 3, 30, and 300 nM Ucn 1, Ucn 2, or Ucn 3 and luciferase reporter activity was measured and normalized on the basis of ß-galactosidase (ß-gal) activity (Fig. 5Go). No differences in the potencies of Ucn 1, Ucn 2, and Ucn 3 in activating the CRE in mCRFR2{alpha} or mCRFR2ß expressing cells were observed (Fig. 5Go). It has been previously demonstrated that the Ucns can activate MAPK signaling; therefore, we measured the selectivity Ucn 1, Ucn 2, and Ucn 3 peptides to activate ERK1/2-p42, 44 through CRFR2ß or through CRFR2{alpha} (Fig. 6Go). Ucn 1 (Fig. 6Go, A and E), Ucn 2 (Fig. 6Go, B and F) and Ucn 3 (Fig. 6Go, C and G) at 0.3, 3, 30, and 300 nM were added to equilibrated cells expressing mCRFRß (A–D) or mCRFR2{alpha} (E–H). After 5 min of receptor stimulation, ERK activation was calculated by level of activation of phosphorylated ERK1/2-p42, 44/ total ERK2-p44 compared with that of the nontreated control (NT, Fig. 6Go). Interestingly, Ucn 3 was less efficient than Ucn 1 or Ucn 2 in activating MAPK (ERK1/2-p44/p42) via CRFR2{alpha}, whereas Ucn 2 and Ucn 3 showed equivalent efficacy for activating MAPK through mCRFR2ß (Fig. 6Go). Ucn 1 was the most efficient, compared with Ucn 2 and Ucn 3, in activating MAPK via both mCRFR2{alpha} and mCRFR2ß (Fig. 6Go).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. Activation of CRE-Luciferase Reporter by Ucn 1, Ucn 2, and Ucn 3 Peptides in 293T Cells Transiently Transfected with CRFR2{alpha} (A) or CRFR2ß (B)

Luciferase reporter containing fragment of the CRE promoter of the EVX1 gene was cotransfected into 293T cells with CRFR2ß or CRFR2{alpha} expression vectors. Luciferase activity was measured after treatment (4 h) with 0.3, 3, 30, and 300 nM Ucn 1, Ucn 2, or Ucn 3. Assays were normalized to cotransfected ß-gal activity. The mean ± SEM of three independent experiments is presented as relative activity. Fold induction over vehicle control for each treatment is shown.

 


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 6. Selectivity of Ucn 1, Ucn 2, and Ucn 3 peptides to activate ERK1/2-p42, 44 through CRFR2ß or CRFR2{alpha}

Ucn 1 (A and E), Ucn 2 (B and F), and Ucn 3 (C and G) at 0.3, 3, 30, and 300 nM were added to equilibrated 293T cells expressing CRFRß (A–D) or CRFR2{alpha} (E–H). After 5 min of receptor stimulation, cell lysates were harvested and subjected to SDS-PAGE immunoblot analysis using an antiphospho-ERK1/2-p42, 44 antibody, and ERK2p44 antibody. Stimulation of ERK activation was calculated by fold activation of phosphorylated ERK1/2-p42, 44/ total ERK2-p44, compared with the nontreatment control (NT, D, and H). The experiment was repeated three times in triplicate, and the representative of means of triplicates from one experiment is shown.

 
Hypothalamic mCRFR2{alpha} mRNA Expression Levels after Acute and Chronic Stress
The effects of acute and chronic restraint stress on the mCRFR2{alpha} mRNA levels in the hypothalamus were determined using quantitative RT PCR. We examined the effect of 30 min acute restraint stress on mCRFR2{alpha} mRNA levels in the hypothalamus. The mCRFR2{alpha} mRNA levels significantly decreased in the hypothalamus of animals killed 1, 3, 6, and 12 h after the stress paradigm, compared with nonstressed mice (Fig. 7AGo). A significant decrease in the hypothalamic mCRFR2{alpha} mRNA levels was also observed in mice subjected to the chronic restraint stress protocol for a consecutive 9 d compared with the levels in unstressed control mice (Fig. 7BGo).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7. Quantitative RT-PCR for Hypothalamic mCRFR2{alpha} mRNA Levels in Mice after Acute and Chronic Restraint Stress

A and B, Expression of mCRFR2{alpha} and S16 gene in the hypothalami of mice 1, 3, 6, and 12 h after acute (A) or 10 d of chronic (B) restraint stress. Southern blot hybridization of amplified mCRFR2{alpha} (middle panels, A and B) and the ribosomal protein S16 (lower panels, A and B) cDNA fragments were performed. The radioactive bands were quantified by PhosphorImager and the normalized values (relative to the control S16 expression) are presented (mean ± SD, the three lanes of each condition represent three independent RNA samples obtained from three different mice and the histograms represent three independent experiments with new RNA samples, graphs A and B) as relative densitometry units. The mRNA levels of the hypothalamic mCRFR2{alpha} were significantly down regulated 1, 3, 6, or 12 h after acute (A) or 9 d of chronic (B) restraint stress. *, P < 0.05 vs. control mice.

 
Regulation of mCRFR2{alpha} Expression in Mouse Hypothalamus by Dexamethasone and Adrenalectomy and in CRFR1-Null Mice
The hypothalamus is one of the major sites of mCRFR2{alpha} expression in the brain. Increases in circulating glucocorticoids in response to activation of pituitary CRFR1 feedback to the brain, including the hypothalamus, which expresses high levels of glucocorticoid receptors. We therefore examined hypothalamic mCRFR2{alpha} gene transcription after glucocorticoid administration in vivo, ADX and in the CRFR1-null mice.

We first determined the effect of dexamethasone injections on mCRFR2{alpha} mRNA levels in the hypothalamus. Dexamethasone (150 and 300 µg/kg body weight) significantly decreased the expression of mCRFR2{alpha} in the hypothalamus in animals killed 12 h after injections of the steroid (Fig. 8BGo). In animals killed 2 h after dexamethasone injection (Fig. 8AGo), only the higher dose of dexamethasone significantly decreased the expression of mCRFR2{alpha} in the hypothalamus.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 8. Quantitative RT-PCR for Hypothalamic mCRFR2{alpha} mRNA Levels in Mice after Dexamethasone Injections

A and B, Saline or dexamethasone (75, 150, or 300 µg/kg) were injected ip to C57BL/6 mice. The mice were killed 2 h (A), or 12 h (B) after injection and the hypothalami were dissected. Total RNA was extracted followed by DNase treatment and the mCRFR2{alpha} mRNA levels were determined using quantitative RT-PCR. Southern blot hybridization of amplified mCRFR2{alpha} (middle panels, A and B) and the ribosomal protein S16 (lower panels, A and B) cDNA fragments were performed. The radioactive bands were quantified by PhosphorImager and the normalized values (relative to the control S16 expression) are presented as relative densitometry units (mean ± SD, the three lanes of each condition represent three independent RNA samples obtained from three different mice and the histograms represent three independent experiments with new RNA samples, graphs A and B). A significant decrease in expression of hypothalamic mCRFR2{alpha} mRNA 12 h after dexamethasone injections was observed. *, P < 0.05 vs. saline injections.

 
Two weeks after ADX, mCRFR2{alpha} mRNA levels in the whole mouse hypothalamus were increased compared with sham operated and control mice (Fig. 9AGo). The effect was reversed by corticosterone replacement (Fig. 9AGo), as determined by RT-PCR. In addition, we demonstrated that the mCRFR2{alpha} gene is up-regulated in the hypothalamus of the CRFR1-null mice (Fig. 9BGo).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 9. Quantitative RT-PCR for Hypothalamic mCRFR2{alpha} mRNA Levels in Mice after ADX, ADX with Corticosterone (cort.) Replacement, and in CRFR1-Null Mice

A, Hypothalamus was isolated from control C57BL/6 mice and 2 wk after sham operated, ADX or ADX + cort treatment (A) and from CRFR1-null mice and their wild type (WT) littermates (B). Total RNA was extracted followed by DNase treatment and the mCRFR2{alpha} mRNA levels were determined using quantitative RT-PCR. Southern blot hybridization of amplified mCRFR2{alpha} (middle panels, A and B) and the ribosomal protein S16 (lower panels, A and B) cDNA fragments were performed. The radioactive bands were quantified by PhosphorImager and the normalized values (relative to the control S16 expression) are presented as relative densitometry units (mean ± SD, the three lanes of each condition represent three independent RNA samples obtained from three different mice and the histograms represent three independent experiments with new RNA samples, graphs A and B). A significant increase of hypothalamic mCRFR2{alpha} mRNA expression levels after ADX (A) was observed. The mCRFR2{alpha} mRNA level returned to normal levels after corticosterone administration (A). A significant increase of hypothalamic mCRFR2{alpha} mRNA expression levels was also observed in the CRFR1-null mice, which are glucocorticoid deficient, compared with their wild-type littermate (B). *, P < 0.05 vs. control mice.

 
Regulation of Endogenous mCRFR2{alpha} mRNA and Promoter Activity by Glucocorticoids in CATH.a Cells
To further examine the effects of glucocorticoids on mCRFR2{alpha} mRNA levels in vitro, we used quantitative RT-PCR and Southern blot hybridization to measure the mCRFR2{alpha} mRNA levels in CATH.a cells treated with dexamethasone. The mRNA levels of the mCRFR2{alpha} were significantly decreased after 16 h treatment with 10 nM and 100 nM dexamethasone (Fig. 10Go).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 10. Quantitative RT-PCR for the mCRFR2{alpha} mRNA Levels in CATH.a Cells Treated with Dexamethasone

This figure demonstrates the expression of mCRFR2{alpha} and S16 genes in CATH.a cells treated with increasing doses of dexamethasone (1–100 nM) for 16 h. Southern blot hybridization of amplified mCRFR2{alpha} (middle panel) and the ribosomal protein S16 (lower panels) cDNA fragments were performed. The radioactive bands were quantified by PhosphorImager and the normalized values (relative to the control S16 expression) are presented (mean ± SD of three independent experiments, graph) as relative densitometry units. The mRNA levels of the mCRFR2{alpha} were significantly down regulated after 16 h treatment of 10 nM and 100 nM dexamethasone. *, P < 0.05 vs. untreated cells.

 
To determine whether the effect of glucocorticoids in decreasing the mCRFR2{alpha} expression is promoter mediated, we screened the mCRFR2 gene for possible promoter sites using computer programs. A strong putative promoter sequence is found in the first kilobase pair sequence upstream to exon 3 (the 3' end of intron 2). A DNA fragment covering approximately 2.4 kb of the region 5' to exon 3 was amplified by PCR using a mouse genomic DNA clone isolated previously in our laboratory and subcloned into a luciferase reporter plasmid (Fig. 11AGo). The basal activity of this construct transfected into CATH.a cells, which express mCRFR2{alpha} endogenously, was found to be robust, suggesting that positive regulatory elements are located within this fragment (Fig. 11BGo). To demonstrate mCRFR2{alpha} promoter activity after dexamethasone treatment, CATH.a cells were transfected with 2.5 µg of the mCRFR2{alpha} reporter plasmid construct and 50 ng of ß-gal construct, and treated with different concentrations of dexamethasone (100 pM to 1 µM) for 24 h (Fig. 11CGo). Dexamethasone (1 nM) for 24 h was sufficient to reduce significantly the luciferase reporter gene activity in this construct compared with control (Fig. 11CGo). No significant differences were found in the luciferase activity of the empty vector with or without treatment with dexamethasone (Fig. 11BGo). A significant inhibition of the luciferase reporter gene activity was detected as early as 6 h after 10 nM dexamethasone treatment (Fig. 11DGo). The inhibitory effect was also detected 12 and 24 h after 10 nM dexamethasone treatment (Fig. 11DGo). To further demonstrate that the negative effect of dexamethasone on the expression of mCRFR2{alpha} mRNA is mediated by a mechanism involving GR, their binding sites were blocked with the nonspecific steroid hormone antagonist RU486. RU486 (10 µM) showed no effect on mCRFR2{alpha} promoter activation when given alone but essentially abolished the inhibition of mCRFR2{alpha} reporter construct by 10 nM dexamethasone (Fig. 11CGo). These results suggest that the effect of glucocorticoids on mCRFR2{alpha} promoter activity is mediated through a GR.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 11. Dexamethasone Responsiveness and Basal Activity of mCRFR2{alpha} Promoter Construct

A, Schematic demonstration of the mCRFR2{alpha} 5'-flanking region construct fused to the luciferase gene in PGL3 basic vector. B, Luciferase reporter gene assay of PGL3 empty vector and mCRFR2{alpha} promoter basal activity and response to dexamethasone (25 nM) in CATH.a cells. The cells were cultured and transfected with the reporter plasmid DNA. After 16 h, the luciferase basal activity and the response to dexamethasone were determined. A strong basal activity was observed for the 2.5 kb gene fragment as compared with the PGL3 control vector and a significant inhibition of the mCRFR2{alpha} promoter construct was observed after dexamethasone treatment. No significant differences were found in the luciferase activity of the empty vector without or after treatment with dexamethasone (the inset demonstrates the background level of PGL3 luciferase vector without or after treatment with 25 nM dexamethasone). *, P < 0.05 vs. basal promoter activity. C, CATH.a cells were transfected with the mCRFR2{alpha} reporter plasmid construct and parallel plates were treated for 24 h with vehicle (control), dexamethasone (0.1–1000 nM), RU486 (100 nM) and 10 nM dexamethasone/100 nM RU486 coincubation. The cells of all groups were harvested at the same time and luciferase activity was measured. The results, corrected to ß-gal values (mean ± SD of six independent experiments), are presented as relative activity compared with the basal activity of the specific promoter construct. Significant inhibition of the mCRFR2{alpha} promoter construct is observed after dexamethasone treatment. *, P < 0.05 vs. basal promoter activity. D, CATH.a cells were transfected with the mCRFR2{alpha} reporter plasmid construct and parallel plates were treated with vehicle (control) or 10 nM dexamethasone for 1, 3, 6, 12, or 24 h. The cells of all groups were harvested at the same time and luciferase activity was measured. The results, corrected to ß-gal values (mean ± SD of six independent experiments), are presented as relative activity compared with the basal activity of the specific promoter construct. Significant inhibition of the mCRFR2{alpha} promoter construct is observed as early as 6 h after dexamethasone treatment. *, P < 0.05 vs. basal promoter activity. **, P < 0.05 vs. promoter activity induced by 10 nM dexamethasone treatment.

 
To determine whether the approximately 2.4 kb of the mCRFR2{alpha} promoter contained a glucocorticoid response element (GRE) consensus site, we screened the promoter sequence for a GRE using Transcription Element Search Software (http://www.cbil.upenn.edu/tess/index.html). The sequence analysis revealed the presence of 23 putative half-palindrome GRE sequences, within the 2.4 kb of the mCRFR2{alpha} 5' flanking region at positions –263, –311, –405, –452, –506, –762, –790, –880, –946, –1053, –1111, –1200, –1783, –1797, –1876, –1935, –2028, –2033, –2140, –2279, –2369, and –2388 (Fig. 12Go).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 12. Genomic Sequence of mCRFR2{alpha} Promoter

Predicted half-palindrome GRE sequences are in open boxes, 5'-untranslated region is in bold, and the translation start site is underlined.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Both CRFR1 and CRFR2 belong to the class B1 subfamily of seven-transmembrane receptors that signal by coupling to G proteins. CRFR1 and CRFR2 are encoded by distinct genes and have several splice variants expressed in various central and peripheral tissues. The CRFR1 gene expresses one known functional variant, both in humans and rat (CRFR1{alpha}, generated by deletion of exon 6) and several nonfunctional variants, designated ß and c through h subtypes, which are produced by differential splicing of various exons (20, 21, 22). The CRFR2 has three functional splice variants in humans ({alpha}, ß, and {gamma}) and two in rats ({alpha} and ß) that are produced by the use of alternate 5' exons (15, 16, 17, 18, 19, 23). Based on the homology between known mammalian CRFR genes, we isolated a cDNA encoding for the mCRFR2{alpha} ortholog from brain. The mCRFR2 gene is composed of 14 known exons; the differences in the amino acid sequences of mCRFR2{alpha} vs. mCRFR2ß at the N terminus of the ECD1 are the result of alternative splicing of the mCRFR2 gene and the use of different 5' exons, similar to that reported for the rat and the human isoforms (18, 19). The structure of the human CRFR2 gene, composed of fifteen known exons and multiple promoters, has recently been reported (46).

The data from RT-PCR and southern hybridization for mCRFR2{alpha} and mCRFR2ß demonstrate a specific tissue distribution pattern of mCRFR2{alpha} vs. mCRFR2ß. The expression of mCRFR2{alpha} mRNA was found to be restricted mainly to brain structures whereas the mCRFR2ß mRNA was found to be most highly expressed in skeletal muscle, heart and skin tissues. Previous studies demonstrated that CRFR2 mRNA is widely expressed in peripheral tissues, mainly in heart, gastrointestinal tract, lung, ovary, and skeletal muscle (15, 16, 25). Interestingly, the CRFR2ß splice variant is the CRFR2 isoform that is expressed peripherally in rodents, whereas the CRFR2{alpha} is the major splice variant found in the periphery of human (37).

Specific in situ hybridization studies of mouse brain sections revealed positive hybridization signals for mCRFR2{alpha} in several brain nuclei, including the lateral septum, ventromedial hypothalamus, dorsal raphe, and BNST. A positive hybridization signal for mCRFR2ß was detected only in the choroid plexus, a rich capillary structure found within the ventricles, and not in any other neuronal or glial structures, similar to that reported for the rat isoforms (18, 25, 26).

The responses of CRF-related peptides are initiated at the cellular level by binding to specific, high-affinity membrane-bound receptors. The activation of CRFRs in distinct cell types by receptor-selective CRF peptides may activate selective signaling pathways. Activation of CRFRs results in coupling to different G proteins and the stimulation of a variety of signaling pathways including adenylyl cyclase/cAMP, PKA, protein kinase B, protein kinase C, intracellular calcium, cGMP and MAPK (for review see Ref.38). By comparing the binding affinities of the CRF ligands in cells expressing mCRFR2{alpha} we demonstrated that Ucn 1 and Ucn 2 bind with higher affinity than Ucn 3 and CRF. The cAMP/PKA pathway has been extensively studied with respect to the CRFR activation and has been used to discriminate subtype agonist selectivity. We therefore studied cAMP accumulation and the activation of cAMP response element (CRE) reporter gene in cells expressing the mCRFR2{alpha} or mCRFR2ß. We demonstrated that the potencies of Ucn 1, Ucn 2, and Ucn 3 in accumulation of cAMP or activating the CRE in mCRFR2{alpha} expressing cells are approximately equal. The binding affinities and EC50 values for camp activation are in good agreement with those reported by Dautzenberg et al. (47).

CRFR activation has been shown to stimulate the MAPK pathway, in particular, the ERK1/2-p42, 44 (for review see Ref.38). Activation of ERK1/2-p42, 44 by CRF family ligands varies according to both cell type and receptor type. CRFR-mediated activation of the ERK1/2-p42, 44 has been reported for sauvagine (48), CRF (49), Ucn 1 (49, 50, 51), and very recently for Ucn 2 and Ucn 3 (49). Activation of ERK1/2-p42, 44 in murine cardiac myocytes by Ucn 1 (52), Ucn 2 or Ucn 3 (53) results in cytoprotection against ischemia and ischemia reperfusion injury. The survival, promoted by Ucn 1 and CRF, of rat hippocampal neurons after oxidative and excitotoxic-induced cell death is mediated by activation of MAPK (51). CRF is reported to function as a differentiating factor in the immortalized noradrenergic neuronal CATH.a cells (54). The CRF-induced neurite outgrowth was blocked by ERK inhibitors (54). In the present study, we measured the selectivity of Ucn 1, Ucn 2, and Ucn 3 peptides to activate ERK1/2-p42, 44 through CRFR2ß or CRFR2{alpha}. Interestingly, unlike cAMP signaling, Ucn 3 was less efficacious than Ucn 1 or Ucn 2 in activating MAPK (ERK1/2-p44/p42) via CRFR2{alpha}, whereas Ucn 2 and Ucn 3 showed equivalent efficacy for activating MAPK through mCRFR2ß. Ucn 1 was the most efficient, compared with Ucn 2 and Ucn 3, in activating MAPK via both mCRFR2{alpha} and mCRFR2ß.

CRFR2 mRNA has been demonstrated to be highly expressed in the hypothalamus, specifically in the VMH, a region associated with the regulation of food intake and energy balance (18, 24). The CRFR2 has been proposed as a potential mediator of the effects of CRF ligands on food intake (55), as suggested by in vivo studies with CRFR2 ligands (for review see Ref.56). Understanding the regulation of hypothalamic CRFR2 may provide insight into the physiological function of this receptor. In the present study, we examined the expression of hypothalamic mCRFR2{alpha} after both acute and chronic restraint stress. We found a significant reduction in the hypothalamic mCRFR2{alpha} mRNA levels 3–6 h after acute restraint stress. Additionally, after 9 d of chronic stress, we found a significant reduction in the mCRFR2{alpha} transcript levels compared with control mice. Previous studies demonstrated a down-regulation of CRFR2 mRNA levels in the VMH of immature rats after 24 h maternal separation, a paradigm depriving the pup from food, maternal contact, and maternal licking (42). The down-regulation of CRFR2 mRNA levels in VMH of immature rats after maternal separation was fully restored by sensory inputs of grooming and handling, but not by food intake (57). Previous studies demonstrated that repeated immobilization stress lowered the VMH CRFR2 mRNA levels in rats (41). Acute restraint stress also reduces cardiac CRFR2ß mRNA expression both in rat (44) and mouse (45).

The hypothalamus expresses high levels of glucocorticoid receptors, which may influence the regulation of CRFR2{alpha} expression through circulating glucocorticoids. Therefore, we examined hypothalamic mCRFR2{alpha} gene transcription after in vivo glucocorticoid administration or adrenalectomy or in CRFR1-null mice. We showed that hypothalamic mCRFR2{alpha} gene transcription is inhibited by glucocorticoid administration in vivo and elevated by adrenalectomy. Administration of glucocorticoids to mice resulted in a decrease of mCRFR2{alpha} levels in the hypothalamus 12 h after ip injection. In addition, we demonstrated that the mCRFR2{alpha} gene is up-regulated in the hypothalamus of CRFR1-null mice. In contrast to our results, Makino et al. (39) reported an increase in CRFR2 mRNA levels in the VMH of rats after a high dose of corticosterone administration and a decrease after ADX. The same study also reported that the levels of CRFR2 mRNA in the paraventricular nucleus were not influenced by corticosterone administration or ADX (39), suggesting that these receptors are differentially regulated in different hypothalamic nuclei. The differences between our current data and those by Makino et al. could be explained by species differences used in these studies, the dose of corticosteroids, the duration of treatment, or the involvement of other hypothalamic nuclei in addition to VMH. Both our in vitro and in vivo studies consist of administration of one single dose of corticosteroids, compared with repeated injections or implanted corticosterone pellets used by Makino et al. (39). Other studies were shown that corticosterone administration in vivo and dexamethasone treatment in vitro caused a decrease in CRFR2ß mRNA levels in murine hearts (44, 45) and A7R5 cells, respectively (44).

To determine whether the effect of glucocorticoids on mCRFR2{alpha} expression is regulated at the level of transcription, we isolated a DNA fragment, upstream to exon 3, containing a putative promoter sequence for mCRFR2{alpha}. The robust basal activity of this construct in CATH.a cells suggests that positive regulatory elements are located within this fragment. The reporter activity of the mCRFR2{alpha} promoter construct was found to be decreased by glucocorticoids in a dose- and time-dependent manner. In addition, the nonspecific steroid hormone antagonist RU486 essentially abolished the inhibition of the mCRFR2{alpha} reporter construct by dexamethasone. These results suggest that the effect of glucocorticoids on mCRFR2{alpha} promoter activity may be mediated through glucocorticoid receptors. Computer analysis revealed the presence of 23 putative half-palindrome glucocorticoid response element sequences within 2.4 kb of the mCRFR2{alpha} 5' flanking region. Further detailed studies including promoter deletion experiments are needed to clarify the putative GRE sites necessary or sufficient to mediate the effects of glucocorticoids. Further examination of the regulation of CRFR2{alpha} in different brain regions may reveal the manner by which the CRFR2 pathway is involved in physiological responses to stress, in normal and transgenic mice models.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of the mCRFR2{alpha} Ortholog
PCR primers were designed based on the homology between known mammalian CRFR2 genes. The following oligonucleotide primers, 5' CCCCGAAGCTGCCCGACTGG 3' (sense) and 5' GGAAGGCTGTAAAGGATGGAGAAG 3' (antisense), were used to screen cDNA prepared from mouse whole brain poly(A)+ RNA (CLONTECH) which was reverse transcribed using oligo-deoxythymidine or random primers. PCR was performed at 62 C for 35 cycles with 90 sec extension at 72 C. The amplified fragments were subcloned into pCRIITOPO vector (Invitrogen Life Technologies, Carlsbad, CA), sequenced, and found to encode the full-length receptor. The homology between the amino acids sequence of the mouse, rat, and human isoforms of CRFR2 (Fig. 2Go) was determined using the DNASTAR Lasergene program. The mCRFR2{alpha} cDNA was subcloned from the pCRIITOPO vector into pCDNA3.0 expression vector (Invitrogen Life Technologies), using HindIII and XhoI. The sequences reported in this paper have been deposited in the GenBank database (accession no. AY445512).

RNA Preparation
Total RNA was extracted from mouse tissues using the Trizol RNA isolation reagent (Molecular Research Center, Cincinnati, OH) based on acid guanidinium thiocyanate-phenol-chloroform extraction method, according to the manufacturer’s recommendations. The following mouse peripheral and CNS tissues were dissected and directly subjected to total RNA isolation: stomach, duodenum, jejunum, ileum, colon, lung, heart, liver, kidney, spleen, thymus, brown fat, white fat, skin, ovary, uterus, testes, adrenal, skeletal muscle, pancreas, mammary glands from virgin females, mammary glands from d 10 and 21 of lactation, total brain from 2-d-old pups, placenta from embryonic d 12 and 18, total embryo obtain from embryonic d 12 and 18, total brain, olfactory bulb, hypothalamus, cortex, cerebellum, hippocampus, midbrain, pons/medulla oblongata, and spinal cord. Total RNA was also isolated from hypothalami of mice after acute and chronic stress procedure, adrenalectomized and CRFR1-null mice, and mice treated with dexamethasone at various doses and time points.

Semiquantitative and Quantitative RT-PCR
Total RNA preparations derived from mouse tissues were reverse transcribed to generate cDNA pools. The cDNA products were used as templates for semiquantitative and quantitative RT PCR analysis using specific primers for mCRFR2{alpha}, mCRFR2ß and the ribosomal protein S16. To avoid false positive results caused by DNA contamination, we performed a deoxyribonuclease (DNase) treatment for 30 min at 37 C using the RQ1 ribonuclease-free DNase (catalog no. M6101, Promega Corp., Madison, WI). We used semiquantitative RT-PCR to amplify the levels of endogenous mCRFR2{alpha} and mCRFR2ß present in the mouse tissues studied (Fig. 3Go). The expression of ribosomal protein S16 (58) served as internal control. The PCR conditions were as follows: cDNA equivalent to 200 ng of total RNA was amplified by PCR for 35 cycles at an annealing temperature of 62 C. The final MgCl2 concentration was 3 mM, and each reaction contained 2.5 U of Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK). We used quantitative RT-PCR (59) to amplify the levels of mCRFR2{alpha} mRNA present in the mouse hypothalamus after acute and chronic stress (Fig. 7Go), and in adrenalectomized and CRFR1-null mice (Fig. 8Go). mCRFR2{alpha} mRNA levels were also determined in mouse hypothalami and CATH.a cells treated with different doses of dexamethasone (Sigma Chemical, St. Louis, MO) and at different time points (Figs. 9Go and 10Go). The expression of the ribosomal protein, S16 (58), served as internal control. Each reaction contained four oligonucleotide primers, two for mCRFR2{alpha} and two for S16 internal control. The PCR conditions were: cDNA equivalent to 200 ng of RNA was amplified by PCR for 35 cycles (the exponential phase of amplification is 30–40 cycles); the annealing temperature was 62 C; the final primers concentration was 1 µM for mCRFR2{alpha} and 0.5 µM for S16; the final MgCl2 concentration was 3 mM; and each reaction contained a 2.5 U of Taq DNA polymerase (BIO-X-ACT DNA polymerase, Bioline UK Ltd., London, UK).

Southern Analysis
The PCR products were transferred onto a nylon membrane (Hybond-N, Amersham Pharmacia Biotech, Buckinghamshire, UK) by overnight capillary blotting in 20x saline sodium citrate (SSC) solution and the nylon was baked in a vacuum oven at 80 C for 2 h. Overnight hybridizations were performed (sequentially on the same membrane for the quantitative RT-PCR products) using Super Hyb Kit (Molecular Research Center Inc., Cincinnati, OH) in the presence of a 32P-labeled probe, specific to the mCRFR2{alpha}, mCRFR2ß or S16 cDNA. Hybridizations were performed at 60 C for mCRFR2{alpha} and mCRFR2ß and at 62 C for the S16 probe. The corresponding bands could be seen after exposure of the membranes to PhosphorImager plates (445 SI, Molecular Dynamics, Inc., Jersey City, NJ). Gels were also exposed to x-ray film (Fuji Photo Film Co., Ltd., Tokyo, Japan) for 2–16 h at –80 C and were developed in CURIX 60 processor (AGFA, Köln, Germany).

Oligonucleotide Primers
Sense and antisense primers were selected, when possible, to be located on different exons to avoid false-positive results caused by DNA contamination. The following specific mCRFR2{alpha}, mCRFR2ß and S-16 oligonucleotide primers were used in the PCRs: mCRFR2{alpha}-5'CCTGGACGGCTGGGGAGTG3' and 5'CAGAATGAAGGTGGTGATGAGGTT3' corresponding to nucleotides 208–229 (exon 3, sense) and 602–625 (exon 7, antisense) respectively (GenBank accession no. AY445512), the predicted size of the band is 418 bp; mCRFR2ß-5'CAGGCCAGGCACCCCAGGAC3' and 5'ACCACGCGATGTTTCTCAG3' corresponding to nucleotides 83–102 (exon 2, sense) and 541–559 (exon 7, antisense) respectively (GenBank accession no. MMU17858, the predicted size of the band is 477 bp; S-16–5'TGCGGTGTGGAGCTCGTGCTTGT3' and 5'GCTACCAGGCCTTTGAGATGGA3' corresponding to nucleotides 369–391 (sense) and 1968–1990 (antisense) respectively (GenBank accession no. M11408), the predicted size of the band is 309 bp.

DNA Sequencing
The appropriate cDNA fragments of mCRFR2{alpha} and mCRFR2ß obtained from the mouse tissues were extracted from the gels using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and subcloned into pGEM-T vector using the pGEM-T Easy Vector System I (Promega Corp.). Nucleotide sequencing of the specific PCR bands was performed by automated direct DNA sequencing, according to the manufacturers recommendations (model 377, PE Applied Biosystems, PerkinElmer Corp., Foster City, CA).

In Situ Hybridization
To generate a specific in situ probes for the two mCRFR2 isoforms, specific mCRFR2{alpha} or mCRFR2ß cDNA fragments were isolated, using RT PCR, from hypothalamic and heart cDNA, respectively, and were subcloned into pCRIITOPO vector (Invitrogen Life Technologies). The following specific oligonucleotide primers were used in the PCRs for the isolation of mCRFR2{alpha} or mCRFR2ß specific in situ probes: mCRFR2{alpha}-5'GCGGCCCCTCAGCTCCGCGAG3' (sense) and 5'TCGGGGTCCGGGGGCACTCCC3' corresponding to the exon three sequence (mCRFR2{alpha}-specific exon), and the size of the cDNA fragment is 315 bp; mCRFR2ß-5'GGGCTTTACCTTGGTGGGTAG3' (sense) and 5'CTGAAAAATTCCCAGTTGTGGTC3' (antisense) corresponding to exons one and exon two (mCRFR2ß-specific exons), and the size of the cDNA fragment is 294 bp. Mouse brains were quickly removed and frozen on dry ice. Frozen sections were cut to 20 µm-thick on a cryostat, thaw-mounted onto glass slides, and stored at –80 C until use. In situ hybridization was performed with 35S-labeled antisense and sense (control) cRNA probes transcribed from linearized plasmid (pCRIITOPO) containing the respective CRFR2 cDNA. Probes were labeled to specific activities of 1–3 x 108 dpm/µg, applied to slides and hybridized overnight at 55 C. Slides were washed in SSC with increasing stringency, followed by ribonuclease treatment at 37 C, and finally 0.1x SSC at 60 C. After dehydration, the slides were exposed to x-ray film (ß-Max; Kodak, Rochester, NY) for 4 d at 4 C and then coated with Kodak NTB-2 liquid emulsion and exposed at 4 C for 14 d.

Radioreceptor Assay
Peptides were synthesized by standard methods (60). Approximately 10 µg of this plasmid DNA corresponding to mCRFR2{alpha} were transfected into COS-M6 cells using the diethylaminoethyl dextran method. Two days later, the cells were detached and crude membrane fractions were prepared and used to measure binding by competitive displacement of [125I-Tyr0,Glu1,Nle17]sauvagine, as described (10). The displacement data were analyzed using the Prism program (GraphPad, San Diego, CA).

cAMP Stimulation in Transfected Cells
One day after transfection of mCRFR2{alpha} into COS-M6 cells, the cells were trypsinized, replated in DMEM with 10% fetal bovine serum (FBS) into 24- or 48-well tissue culture dishes (Costar, Corning, NY) and allowed to recover another 24 h. The medium was changed to DMEM with 0.1% FBS at least 2 h before treatments. The cells were preincubated for 30 min with 0.1 mM 3-isobutyl-1-methylxanthine and then exposed to rat/human CRF or other peptides for 30 min at 37 C. Intracellular cAMP was measured from triplicate wells using an RIA kit (Biomedical Technologies, Stoughton, MA).

ERK1/2 Assay
HEK 293 cells were grown in 5% CO2 to 60% confluence in DMEM supplemented with 10% vol/vol FBS, penicillin, streptomycin, and L-glutamine in 10 cm3 dishes (normal growth medium). For transfection, cells were washed once with opti-MEM (Invitrogen Life Technologies) media and incubated with 10 ml of opti-MEM media for 30 min. Cells were transfected using Quantum Prep Cytofectene Transfection Reagent Kit (Bio-Rad, Richmond, CA) whereby 6 µg of DNA for each receptor mCRFR2ß or mCRFR2{alpha} was mixed with 30 µl of transfection reagent and 600 µl of opti-MEM and incubated at room temperature for 30 min. Subsequently, the opti-MEM was removed from the cells and 5.4 ml of opti-MEM was mixed with the DNA transfection mix and then added to the HEK 293 cells overnight. The cells were incubated with normal growth medium for 16 h and then divided equally into one 24-well tissue culture plate for each receptor for an additional 16 h. The cells were then equilibrated with DMEM supplement with 900 µl 1% wt/vol BSA for 6 h and stimulated with 100 µl of 0.1% DMEM/BSA (no treatment control), 3, 30, 300, and 3000 nM mUcn 2 or mUcn 3 for 5 min to give final concentrations of 0, 0.3, 3, 30, and 300 nM respectively. Cells were harvested immediately in 100 µl of 1 x sample treatment buffer [STB, 50 mM Tris (pH 6.8), 100 mM dithiothreitol, 2% (wt/vol) sodium dodecyl sulfate, 0.1% (wt/vol) bromphenol blue, and 10% (wt/vol) glycerol]. The samples were boiled for 5 min, proteins were electrophoresed on a 4–12% sodium dodecyl sulfate-polyacrylamide gradient gel (Invitrogen Life Technologies), subsequently transferred onto Nitrocellulose membranes, and then probed for 2 h at room temperature using an antibody that detects phosphorylated ERK1/2-p42, 44 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The membranes were washed in PBS and 0.05% (vol/vol) Tween and incubated with horseradish peroxidase-conjugated mouse IgG raised in sheep (Amersham Biotech Pharmacia). Immunoreactive proteins were visualized using Super Signal West Pico Chemiluminescent substrate (Pierce, Rockford, IL). The relative protein levels were determined using densitometry (Image quant 1.2) by probing the membranes with an antibody directed against total ERK2, p44 protein (Santa Cruz Biotechnology, Inc.).

Construction of Luciferase Reporter Gene Plasmid
The mCRFR2{alpha} promoter has been predicted using the online PromoterInspector tool (Genomatrix Software GmbH, Munich, Germany), and predicted to be the intronic sequence, 5' to exon number 3. The mCRFR2{alpha} 5' flanking region construct (~2.5 kb of the 3' end of intron 2) was cloned by PCR using mouse genomic DNA. The primers that were used for the construct were designed to include an artificial restriction endonuclease site for XhoI and HindIII. The primers sequence were as follows. Sense primer [(–2475)-(2498)]: 5'CTTAGGCAGAGTTGGGGGAGACAT3'. Antisense primer [(+128)-(+149)]: 5'GCGCGACGAGGAGCAGCCAGAG3'. The PCR product was analyzed by agarose gel electrophoresis in 1xTAE buffer (0.04 M Tris-acetate, 0.001 M EDTA), and eluted from the gel. After digestion by the appropriate restriction enzymes, HindIII and XhoI, the DNA fragments were cloned into the luciferase reporter plasmid pGL3 (catalog no. E1751, Promega Corp.) and the sequence was verified using automated direct DNA sequencing.

Transient Transfections and Luciferase Assay
CATH.a and 293T cells were used for the mCRFR2{alpha} promoter studies and for the CRE activation studies, respectively. The cells were grown in DMEM (Invitrogen Life Tech-nologies), containing 10% charcoal-treated FBS supplemented with 100 µg/ml of penicillin/streptomycin (Invitrogen Life Technologies). For transfection, CATH.a cells (3x104) were plated in six-well plates. On the following day, the cells were transfected with 0.5–4.0 µg of the reporter gene construct and 50 ng ß-gal expression plasmid using the Gene PORTER 2 Transfection Reagent (Gene Therapy Systems Inc., San Diego, CA) according to manufacturer’s recommendations. Each experiment contained a transfection with a positive control reporter plasmid containing the cytomegalovirus promoter to permit estimation of transfection efficiencies and comparison of results obtained from different experiments. Cells were treated with different concentrations of dexamethasone (Sigma Chemical) for 24 h or treated with 10 nM dexamethasone at different time points. The 293T cells were transfected with a luciferase reporter containing a fragment of the EVX1 gene which contains a potent CRE site (Conkright M Mol Cell 2003, kindly provided by Marc Montminy, The Salk Institute), using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer’s instructions. Twenty hours post transfection, cells were treated for 4 h with vehicle or with 0.3, 3, 30, and 300 nM Ucn 1, Ucn 2, or Ucn 3. The cells were harvested and the luciferase reporter activity was assayed as follows. Cells were washed three times with PBS and lysed by resuspending in 100 µl of 100 mM KPO4 buffer (pH 7.8) containing 1 mM dithiothreitol and 0.5% (vol/vol) Triton X-100. The luciferase assay buffer contains 100 mM Tris acetate (pH 7.8), 10 mM MgOAc, 100 mM EDTA, 2 mM ATP (pH 7.0) and 74 µM luciferin. Activity tests were performed and luminescence was measured in a Biocounter M2500 luminometer (Lumac, Landgraaf, The Netherlands) for 20 sec immediately after addition of luciferin assay buffer. Transfections were performed at least six times (in triplicates) for each construct or treatment tested. To correct for variations in transfection efficiencies, luciferase activities were normalized to ß-gal activity.

Animals
Adult C57BL/6 male mice (27–30 g) were used in all experiments. Animals were housed three per cage in a room with controlled temperature and a fixed lighting schedule (lights on from 0600–1800 h). Food and water were given ad libitum. All experimental protocols were approved by the animal care and use committee of The Salk Institute for Biological Studies.

Acute and Chronic Restraint Stress
Adult C57BL/6 male mice, individually housed, were subjected to a restraint stress procedure. Mice were placed in a ventilated 50 ml conical tube for 30 min and were killed 1, 3, 6, or 12 h after 30 min of acute restraint stress. Control mice were killed without manipulation. The brains were isolated and the hypothalamus was dissected and subjected to RNA isolation. The restraint stress protocol was also employed in separate group of mice for a consecutive 9 d, and the mice were killed on d 10, 24 h after the last 30 min of chronic restraint stress. The brains were isolated and the hypothalamus was dissected and subjected to RNA isolation.

ADX, Corticosterone Replacement, and Dexamethasone Administration
ADX was performed through a dorsal incision under isoflurane anesthesia. Sham operation was performed by manipulating the animal in the same manner but without removing the adrenal gland. One group of ADX mice received a replacement of corticosterone (catalog no. C-2502, Sigma Chemical, St. Louis, MO) in the drinking water at final concentration of 25 µg/ml, immediately after ADX surgery. All mice were killed 2 wk after ADX surgery, and the brains were isolated and the hypothalamus was dissected and subjected to RNA isolation. Blood collected from control, ADX, and corticosterone replacement mice was assayed for plasma corticosterone using the Corticosterone 125I RIA Kit (MP Biomedicals, Orangeburg, NY).

Dexamethasone (75 mg/kg, 150 mg/kg, 300 mg/kg) or saline were injected ip to mice. The mice were killed 2 or 12 h post injection, the brains were isolated and the hypothalamus was dissected and used for RNA isolation.


    ACKNOWLEDGMENTS
 
We thank Dr. Marc Montminy (The Salk Institute) for kindly providing the EVX-CRE-luciferase construct, Joan Vaughan for critical reading of the manuscript, and Dave Dalton and S. Guerra for assistance in the preparation of this manuscript.


    FOOTNOTES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Program Project Grant DK 26741, The Robert J. and Helen C. Kleberg Foundation, The Adler Foundation, and the Foundation for Research (to W.V.). W.V. is a Senior Foundation for Research Investigator. The sequence data have been submitted to the GenBank databases under accession no. AY445512 on October 24, 2003.

During the preparation of this manuscript, a study describing the isolation and pharmacological characterization of the mCRFR2{alpha} splice variant was reported (Ref.47 ). Part of this work was previously presented at the 2004 Annual Meeting of The Endocrine Society.

First Published Online October 28, 2004

Abbreviations: ADX, Adrenalectomy; BNST, bed nucleus of stria terminalis; CNS, central nervous system; CRE, cAMP response element; CRF, corticotropin-releasing factor; CRFR, CRF receptor; DNase, deoxyribonuclease; ECD, extracellular domain; FBS, fetal bovine serum; ß-gal, ß-galactosidase; GRE, glucocorticoid response element; mCRFR2{alpha}; mouse CRFR2{alpha}; PKA, protein kinase A; SSC, saline sodium citrate; Ucn, urocortin; VMH, ventromedial hypothalamic nucleus.

Received for publication July 26, 2004. Accepted for publication October 22, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Vale W, Spiess J, Rivier C, Rivier J 1981 Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and ß-endorphin. Science 213:1394–1397[Free Full Text]
  2. Rivier C, Vale W 1983 Modulation of stress-induced ACTH release by corticotropin releasing factor, catecholamines and vasopressin. Nature 305:325–327[CrossRef][Medline]
  3. Muglia L, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373:427–432[CrossRef][Medline]
  4. Sutton RE, Koob GF, LeMoal M, Rivier J, Vale WW 1982 Corticotropin-releasing factor (CRF) produces behavioral activation in rats. Nature 297:331–333[CrossRef][Medline]
  5. Brown MR, Fisher LA, Spiess J, Rivier C, Rivier J, Vale WW 1982 Corticotropin-releasing factor (CRF): actions on the sympathetic nervous system and metabolism. Endocrinology 111:928–931[Abstract/Free Full Text]
  6. Koob GF, Heinrichs SC 1999 A role for corticotropin releasing factor and urocortin in behavioral responses to stressors. Brain Res 848:141–152[CrossRef][Medline]
  7. Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, Rivier J, Sawchenko PE, Vale W 1995 Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378:287–292[CrossRef][Medline]
  8. Reyes TM, Lewis K, Perrin MH, Kunitake KS, Vaughan J, Arias CA, Hogenesch JB, Gulyas J, Rivier J, Vale WW, Sawchenko PE 2001 Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 98:2843–2848[Abstract/Free Full Text]
  9. Hsu SY, Hsueh AJ 2001 Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat Med 7:605–611[CrossRef][Medline]
  10. Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, Vaughan J, Reyes TM, Gulyas J, Fischer W, Bilezikjian L, Rivier J, Sawchenko PE, Vale WW 2001 Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci USA 98:7570–7575[Abstract/Free Full Text]
  11. Chen R, Lewis KA, Perrin MH, Vale WW 1993 Expression cloning of a human corticotropin releasing factor (CRF) receptor. Proc Natl Acad Sci USA 90:8967–8971[Abstract/Free Full Text]
  12. Perrin MH, Donaldson CJ, Chen R, Lewis KA, Vale WW 1993 Cloning and functional expression of a rat brain corticotropin releasing factor (CRF) receptor. Endocrinology 133:3058–3061[Abstract/Free Full Text]
  13. Vita N, Laurent P, Lefort S, Chalon P, Lelias JM, Kaghad M, Le FG, Caput D, Ferrara P 1993 Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS Lett 335:1–5[CrossRef][Medline]
  14. Chang C-P, PearseII RV, O’Connell S, Rosenfeld MG 1993 Identification of a seven transmembrane helix receptor for corticotropin-releasing factor and sauvagine in mammalian brain. Neuron 11:1187–1195[CrossRef][Medline]
  15. Perrin M, Donaldson C, Chen R, Blount A, Berggren T, Bilezikjian L, Sawchenko P, Vale W 1995 Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc Natl Acad Sci USA 92:2969–2973[Abstract/Free Full Text]
  16. Stenzel P, Kesterson R, Yeung W, Cone RD, Rittenberg MB, Stenzel-Poore MP 1995 Identification of a novel murine receptor for corticotropin-releasing hormone expressed in the heart. Mol Endocrinol 9:637–645[Abstract/Free Full Text]
  17. Kishimoto T, Pearse 2nd RV, Lin CR, Rosenfeld MG 1995 A sauvagine/corticotropin-releasing factor receptor expressed in heart and skeletal muscle. Proc Natl Acad Sci USA 92:1108–1112[Abstract/Free Full Text]
  18. Lovenberg TW, Liaw CW, Grigoriadis DE, Clevenger W, Chalmers DT, De Souza EB, Oltersdorf T 1995 Cloning and characterization of a functionally distinct corticotropin-releasing factor receptor subtype from rat brain. Proc Natl Acad Sci USA 92:836–840[Abstract/Free Full Text]
  19. Liaw CW, Lovenberg TW, Barry G, Oltersdorf T, Grigoriadis DE, de Souza EB 1996 Cloning and characterization of the human corticotropin-releasing factor-2 receptor complementary deoxyribonucleic acid. Endocrinology 137:72–77[Abstract]
  20. Pisarchik A, Slominski A 2004 Molecular and functional characterization of novel CRFR1 isoforms from the skin. Eur J Biochem 271:2821–2830[Medline]
  21. Pisarchik A, Slominski AT 2001 Alternative splicing of CRH-R1 receptors in human and mouse skin: identification of new variants and their differential expression. FASEB J 15:2754–2756[Free Full Text]
  22. Grammatopoulos DK, Dai Y, Randeva HS, Levine MA, Karteris E, Easton AJ, Hillhouse EW 1999 A novel spliced variant of the type 1 corticotropin-releasing hormone receptor with a deletion in the seventh transmembrane domain present in the human pregnant term myometrium and fetal membranes. Mol Endocrinol 13:2189–2202[Abstract/Free Full Text]
  23. Kostich WA, Chen A, Sperle K, Largent BL 1998 Molecular identification and analysis of a novel human corti-cotropin-releasing factor (CRF) receptor: the CRF2{gamma} receptor. Mol Endocrinol 12:1077–1085[Abstract/Free Full Text]
  24. Van Pett K, Viau V, Bittencourt JC, Chan RKW, Li H-Y, Arias C, Prins GS, Perrin M, Vale W, Sawchenko PE 2000 Distribution of mRNAs encoding CRF receptors in brain and pituitary of rat and mouse. J Comp Neurol 428:191–212[CrossRef][Medline]
  25. Lovenberg TW, Chalmers DT, Liu C, De Souza EB 1995 CRF2 {alpha} and CRF2 ß receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology 136:4139–4142[Abstract]
  26. Chalmers DT, Lovenberg TW, De Souza EB 1995 Localization of novel corticotropin-releasing factor receptor (CRF2) mRNA expression to specific subcortical nuclei in rat brain: comparison with CRF1 receptor mRNA expression. J Neurosci 15:6340–6350
  27. Smith GW, Aubry JM, Dellu F, Contarino A, Bilezikjian LM, Gold LH, Chen R, Marchuk Y, Hauser C, Bentley CA, Sawchenko PE, Koob GF, Vale W, Lee KF 1998 Corticotropin releasing factor receptor 1-deficient mice display decreased anxiety, impaired stress response, and aberrant neuroendocrine development. Neuron 20:1093–1102[CrossRef][Medline]
  28. Timpl P, Spanagel R, Sillaber I, Kresse A, Reul JM, Stalla GK, Blanquet V, Steckler T, Holsboer F, Wurst W 1998 Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nat Genet 19:162–166[CrossRef][Medline]
  29. Bale TL, Contarino A, Smith GW, Chan R, Gold LH, Sawchenko PE, Koob GF, Vale WW, Lee KF 2000 Mice deficient for corticotropin-releasing hormone receptor-2 display anxiety-like behaviour and are hypersensitive to stress. Nat Genet 24:410–414[CrossRef][Medline]
  30. Coste SC, Kesterson RA, Heldwein KA, Stevens SL, Heard AD, Hollis JH, Murray SE, Hill JK, Pantely GA, Hohimer AR, Hatton DC, Phillips TJ, Finn DA, Low MJ, Rittenberg MB, Stenzel P, Stenzel-Poore MP 2000 Abnormal adaptations to stress and impaired cardiovascular function in mice lacking corticotropin-releasing hormone receptor-2. Nat Genet 24:403–409[CrossRef][Medline]
  31. Kishimoto T, Radulovic J, Radulovic M, Lin CR, Schrick C, Hooshmand F, Hermanson O, Rosenfeld MG, Spiess J 2000 Deletion of crhr2 reveals an anxiolytic role for corticotropin-releasing hormone receptor-2. Nat Genet 24:415–419[CrossRef][Medline]
  32. Valdez GR, Inoue K, Koob GF, Rivier J, Vale W, Zorrilla EP 2002 Human urocortin II: mild locomotor suppressive and delayed anxiolytic-like effects of a novel corticotropin-releasing factor related peptide. Brain Res 943:142–150[CrossRef][Medline]
  33. Pelleymounter MA, Joppa M, Ling N, Foster AC 2002 Pharmacological evidence supporting a role for central corticotropin-releasing factor(2) receptors in behavioral, but not endocrine, response to environmental stress. J Pharmacol Exp Ther 302:145–152[Abstract/Free Full Text]
  34. Radulovic J, Ruhmann A, Liepold T, Spiess J 1999 Modulation of learning and anxiety by corticotropin-releasing factor (CRF) and stress: differential roles of CRF receptors 1 and 2. J Neurosci 19:5016–5025[Abstract/Free Full Text]
  35. Bale TL, Vale WW 2004 CRF and CRF receptors: role in stress responsivity and other behaviors. Annu Rev Pharmacol Toxicol 44:525–557[CrossRef][Medline]
  36. Perrin MH, Vale WW 1999 Corticotropin releasing factor receptors and their ligand family. Ann NY Acad Sci 885:312–328[Medline]
  37. Dautzenberg FM, Hauger RL 2002 The CRF peptide family and their receptors: yet more partners discovered. Trends Pharmacol Sci 23:71–77[CrossRef][Medline]
  38. Brar BK, Vale W, Perrin M 2002 Corticotropin-releasing hormone receptor signaling. In: Henry HAN, ed. Encyclopedia of hormones, related cell regulators. San Diego: Academic Press; 313–325
  39. Makino S, Nishiyama M, Asaba K, Gold PW, Hashimoto K 1998 Altered expression of type 2 CRH receptor mRNA in the VMH by glucocorticoids and starvation. Am J Physiol 275:R1138–R1145
  40. Nishiyama M, Makino S, Asaba K, Hashimoto K 1999 Leptin effects on the expression of type-2 CRH receptor mRNA in the ventromedial hypothalamus in the rat. J Neuroendocrinol 11:307–314[CrossRef][Medline]
  41. Makino S, Asaba K, Nishiyama M, Hashimoto K 1999 Decreased type 2 corticotropin-releasing hormone receptor mRNA expression in the ventromedial hypothalamus during repeated immobilization stress. Neuroendocrinology 70:160–167[CrossRef][Medline]
  42. Eghbal-Ahmadi M, Hatalski CG, Avishai-Eliner S, Baram TZ 1997 Corticotropin releasing factor receptor type II (CRF2) messenger ribonucleic acid levels in the hypothalamic ventromedial nucleus of the infant rat are reduced by maternal deprivation. Endocrinology 138:5048–5051[Abstract/Free Full Text]
  43. Heldwein KA, Duncan JE, Stenzel P, Rittenberg MB, Stenzel-Poore MP 1997 Endotoxin regulates corticotropin-releasing hormone receptor 2 in heart and skeletal muscle. Mol Cell Endocrinol 131:167–172[CrossRef][Medline]
  44. Kageyama K, Gaudriault GE, Bradbury MJ, Vale WW 2000 Regulation of corticotropin-releasing factor receptor type 2 ß messenger ribonucleic acid in the rat cardiovascular system by urocortin, glucocorticoids, and cytokines. Endocrinology 141:2285–2293[Abstract/Free Full Text]
  45. Coste SC, Heldwein KA, Stevens SL, Tobar-Dupres E, Stenzel-Poore MP 2001 IL-1{alpha} and TNF{alpha} down-regulate CRH receptor-2 mRNA expression in the mouse heart. Endocrinology 142:3537–3545[Abstract/Free Full Text]
  46. Catalano RD, Kyriakou T, Chen J, Easton A, Hillhouse EW 2003 Regulation of corticotropin-releasing hormone type 2 receptors by multiple promoters and alternative splicing: identification of multiple splice variants. Mol Endocrinol 17:395–410[Abstract/Free Full Text]
  47. Dautzenberg FM, Higelin J, Wille S, Brauns O 2004 Molecular cloning and functional expression of the mouse CRF2(a) receptor splice variant. Regul Pept 121:89–97[CrossRef][Medline]
  48. Rossant CJ, Pinnock RD, Hughes J, Hall MD, McNulty S 1999 Corticotropin-releasing factor type 1 and type 2{alpha} receptors regulate phosphorylation of calcium/cyclic adenosine 3',5'-monophosphate response element-binding protein and activation of p42/p44 mitogen-activated protein kinase. Endocrinology 140:1525–1536[Abstract/Free Full Text]
  49. Brar BK, Chen A, Perrin MH, Vale W 2004 Specificity and regulation of extracellularly regulated kinase1/2 phosphorylation through corticotropin-releasing factor (CRF) receptors 1 and 2ß by the CRF/urocortin family of peptides. Endocrinology 145:1718–1729[Abstract/Free Full Text]
  50. Grammatopoulos DK, Randeva HS, Levine MA, Katsanou ES, Hillhouse EW 2000 Urocortin, but not corticotropin-releasing hormone (CRH), activates the mitogen-activated protein kinase signal transduction pathway in human pregnant myometrium: an effect mediated via R1{alpha} and R2ß CRH receptor subtypes and stimulation of Gq-proteins. Mol Endocrinol 14:2076–2091[Abstract/Free Full Text]
  51. Pedersen WA, Wan R, Zhang P, Mattson MP 2002 Urocortin, but not urocortin II, protects cultured hippocampal neurons from oxidative and excitotoxic cell death via corticotropin-releasing hormone receptor type I. J Neurosci 22:404–412[Abstract/Free Full Text]
  52. Brar BK, Jonassen AK, Stephanou A, Santilli G, Railson J, Knight RA, Yellon DM, Latchman DS 2000 Urocortin protects against ischemic and reperfusion injury via a MAPK-dependent pathway. J Biol Chem 275:8508–8514[Abstract/Free Full Text]
  53. Brar BK, Jonassen AK, Egorina EM, Chen A, Negro A, Perrin MH, Mjos OD, Latchman DS, Lee KF, Vale W 2004 Urocortin-II and urocortin-III are cardioprotective against ischemia reperfusion injury: an essential endogenous cardioprotective role for corticotropin releasing factor receptor type 2 in the murine heart. Endocrinology 145:24–35[Abstract/Free Full Text]
  54. Cibelli G, Corsi P, Diana G, Vitiello F, Thiel G 2001 Corticotropin-releasing factor triggers neurite outgrowth of a catecholaminergic immortalized neuron via cAMP and MAP kinase signalling pathways. Eur J Neurosci 13:1339–1348[CrossRef][Medline]
  55. Spina M, Merlo-Pich E, Chan RK, Basso AM, Rivier J, Vale W, Koob GF 1996 Appetite-suppressing effects of urocortin, a CRF-related neuropeptide. Science 273:1561–1564[Abstract]
  56. Zorrilla EP, Tache Y, Koob GF 2003 Nibbling at CRF receptor control of feeding and gastrocolonic motility. Trends Pharmacol Sci 24:421–427[CrossRef][Medline]
  57. Eghbal-Ahmadi M, Avishai-Eliner S, Hatalski CG, Baram TZ 1999 Differential regulation of the expression of corticotropin-releasing factor receptor type 2 (CRF2) in hypothalamus and amygdala of the immature rat by sensory input and food intake. J Neurosci 19:3982–3991[Abstract/Free Full Text]
  58. Wagner M, Perry RP 1985 Characterization of the multigene family encoding the mouse S16 ribosomal protein: strategy for distinguishing an expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA. Mol Cell Biol 5:3560–3576[Abstract/Free Full Text]
  59. Foley KP, Leonard MW, Engel JD 1993 Quantitation of RNA using the polymerase chain reaction. Trends Genet 9:380–385[CrossRef][Medline]
  60. Aguilera G, Harwood JP, Wilson JX, Morell J, Brown JH, Catt KJ 1983 Mechanisms of action of corticotropin-releasing factor and other regulators of corticotropin release in rat pituitary cells. J Biol Chem 258:8039–8045[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
R. T. Evans and A. F. Seasholtz
Soluble Corticotropin-Releasing Hormone Receptor 2{alpha} Splice Variant Is Efficiently Translated But Not Trafficked for Secretion
Endocrinology, September 1, 2009; 150(9): 4191 - 4202.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Y. Sztainberg, Y. Kuperman, O. Issler, S. Gil, J. Vaughan, J. Rivier, W. Vale, and A. Chen
A novel corticotropin-releasing factor receptor splice variant exhibits dominant negative activity: a putative link to stress-induced heart disease
FASEB J, July 1, 2009; 23(7): 2186 - 2196.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
A. F Seasholtz, M. Ohman, A. Wardani, and R. C Thompson
Corticotropin-releasing hormone receptor expression and functional signaling in murine gonadotrope-like cells
J. Endocrinol., February 1, 2009; 200(2): 223 - 232.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A. C Moss, P. Anton, T. Savidge, P. Newman, A. S Cheifetz, J. Gay, S. Paraschos, M. W. Winter, M. P Moyer, K. Karalis, et al.
Urocortin II mediates pro-inflammatory effects in human colonocytes via corticotropin-releasing hormone receptor 2{alpha}
Gut, September 1, 2007; 56(9): 1210 - 1217.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. V. Wu, P.-q. Yuan, L. Wang, Y. L. Peng, C.-Y. Chen, and Y. Tache
Identification and Characterization of Multiple Corticotropin-Releasing Factor Type 2 Receptor Isoforms in the Rat Esophagus
Endocrinology, April 1, 2007; 148(4): 1675 - 1687.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T. Nemoto, A. Iwasaki-Sekino, N. Yamauchi, and T. Shibasaki
Regulation of the expression and secretion of urocortin 2 in rat pituitary
J. Endocrinol., February 1, 2007; 192(2): 443 - 452.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Chen, B. Brar, C. S. Choi, D. Rousso, J. Vaughan, Y. Kuperman, S. N. Kim, C. Donaldson, S. M. Smith, P. Jamieson, et al.
Urocortin 2 modulates glucose utilization and insulin sensitivity in skeletal muscle
PNAS, October 31, 2006; 103(44): 16580 - 16585.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. M. Jamieson, C. Li, C. Kukura, J. Vaughan, and W. Vale
Urocortin 3 Modulates the Neuroendocrine Stress Response and Is Regulated in Rat Amygdala and Hypothalamus by Stress and Glucocorticoids
Endocrinology, October 1, 2006; 147(10): 4578 - 4588.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
E. W. Hillhouse and D. K. Grammatopoulos
The Molecular Mechanisms Underlying the Regulation of the Biological Activity of Corticotropin-Releasing Hormone Receptors: Implications for Physiology and Pathophysiology
Endocr. Rev., May 1, 2006; 27(3): 260 - 286.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. M. Chen, M. H. Perrin, M. R. DiGruccio, J. M. Vaughan, B. K. Brar, C. M. Arias, K. A. Lewis, J. E. Rivier, P. E. Sawchenko, and W. W. Vale
A soluble mouse brain splice variant of type 2{alpha} corticotropin-releasing factor (CRF) receptor binds ligands and modulates their activity
PNAS, February 15, 2005; 102(7): 2620 - 2625.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, A.
Right arrow Articles by Vale, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, A.
Right arrow Articles by Vale, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals