Molecular Endocrinology, doi:10.1210/me.2004-0108
Molecular Endocrinology 19 (2): 516-526
Copyright © 2005 by The Endocrine Society
The Protein Phosphatase Calcineurin Determines Basal Parathyroid Hormone Gene Expression
Osnat Bell,
Elena Gaberman,
Rachel Kilav,
Ronen Levi,
Keith B. Cox,
Jeffery D. Molkentin,
Justin Silver and
Tally Naveh-Many
Minerva Center for Calcium and Bone Metabolism (O.B., E.G., R.K., R.L., J.S., T.N.-M.), Nephrology Services, The Hadassah Hebrew University Medical Center, Jerusalem 91120, Israel; and Department of Pediatrics (K.B.C., J.D.M.), University of Cincinnati, Childrens Hospital Medical Center, Cincinnati, Ohio 45229
Address all correspondence and requests for reprints to: Tally Naveh-Many, Ph.D., Nephrology Services, Hadassah Hospital, P.O. Box 12000, Jerusalem 91120, Israel. E-mail: tally{at}cc.huji.ac.il.
 |
ABSTRACT
|
|---|
Calcium and phosphate regulate PTH mRNA stability through differences in binding of parathyroid (PT) proteins to a minimal 63-nucleotide (nt) cis-acting instability element in its 3'-untranslated region. One of these proteins is adenosine-uridine-rich binding factor (AUF1), whose levels are not regulated in PT extracts from rats fed the different diets. However, two-dimensional gels showed posttranslational modification of AUF1 that included phosphorylation. There is no PT cell line, but in HEK 293 cells the 63-nt element is recognized as an instability element, and RNA interference for AUF1 decreased human PTH secretion in cotransfection experiments. Stably transfected cells with a chimeric GH gene containing the PTH 63-nt cis-acting element were used to study the signal transduction pathway that regulates AUF1 modification and chimeric gene mRNA stability. Cyclosporine A, the calcineurin inhibitor, regulated AUF1 posttranslationally, and this correlated with an increase in the stability of GH-PTH 63-nt mRNA but not of the control GH mRNA. Mice with genetic deletion of the calcineurin Aß gene had markedly increased PTH mRNA levels that were still regulated by low calcium and phosphorus diets. Therefore, calcineurin regulates AUF1 posttranslationally in vitro and PTH gene expression in vivo but still allows its physiological regulation by calcium and phosphate.
 |
INTRODUCTION
|
|---|
THE CALCIUM RECEPTOR (CaR) regulates the parathyroid (PT) at a number of levels: PTH secretion, both basally and in response to changes in serum Ca2+, PTH gene expression, and PT cell proliferation (1, 2, 3). The CaR activates the phospholipase C, A2, and D and then the MAPK pathway (1, 2, 4). The activation of the MAPK pathway has been shown using bovine PT cells in suspension and human embryonic kidney 293 (HEK 293) cells stably transfected with the CaR (5). There is little information on how the signal from the CaR is transduced to regulate PTH mRNA stability. The PT has a limited amount of preformed secretory granules containing mature PTH (6, 7, 8). In the face of persistent hypercalcemia, there is a rapid degradation of the mature PTH in the PT cell (7). With the stimulus of hypocalcemia, there is a rapid secretion of PTH that is renewed by the synthesis of new hormone together with a marked increase in PTH mRNA levels (9). We have shown that the mechanism of the increase in PTH mRNA levels in vivo is mainly posttranscriptional by an increase in PTH mRNA stability (10). In vivo, in the rat, dietary-induced hypophosphatemia decreases PTH mRNA stability (11). Therefore, a low Ca2+ increases and a low phosphate (P) decreases PTH gene expression posttranscriptionally.
By UV-cross-linking and RNA EMSA (REMSA), we showed that PT cytosolic proteins bind to the PTH mRNA 3'-untranslated region (UTR) (10). This binding was increased with PT proteins from rats with a low serum Ca2+, and decreased with PT proteins from low P rats, correlating with mRNA levels and serum PTH (11). The differences in binding were specific to the PT and were not seen in proteins from other tissues in the same rats. There is no PT cell line, but in vitro degradation showed that hypocalcemic rat PT extracts stabilized the PTH transcript and hypophosphatemic PT extracts destabilized the transcript correlating with binding and PTH mRNA levels in vivo. This rapid degradation by low P was dependent upon the presence of the terminal 60-nucleotide (nt) protein binding region of the PTH mRNA (10). These results suggested that the posttranscriptional regulation of PTH mRNA is dependent upon binding of proteins to sequences in the 3'-UTR, which are sensitive to degradation.
Within the terminal region of the PTH mRNA, a minimum cis-acting sequence of 26 nt was sufficient for RNA-protein binding (12). To study the functionality of the sequence in the context of another RNA, a 63-bp PTH cDNA sequence consisting of the 26-nt and flanking regions was fused to the GH cDNA. The in vitro degradation assay showed that the GH transcript was more stable than PTH RNA and was not affected by PT proteins from the different diets. The chimeric GH PTH 63-nt transcript, like the full-length PTH transcript, was stabilized by PT proteins from rats fed a low Ca2+ diet and destabilized by proteins from rats fed a low P diet. Therefore, the 63-nt protein binding region of the PTH mRNA 3'-UTR is both necessary and sufficient to regulate RNA stability and to confer responsiveness to changes in PT proteins by Ca2+ and P (12).
We also studied the function of the PTH 63-nt element in the heterologous cell line HEK 293. Plasmids containing the native GH gene or the chimeric GH PTH63 nt DNA were transiently transfected into HEK 293 cells and mRNA levels measured at 24 h by Northern blot. As a control, a chimeric GH plasmid containing a truncated 40-nt element that was shown not to bind PT proteins was also analyzed. There was a marked decrease in GH mRNA and secreted GH levels after transfection of the 63-nt chimeric construct but not with the truncated construct compared with the wt GH construct, and this effect was posttranscriptional (13).
One of the PTH RNA 3'-UTR binding proteins was identified as adenosine-uridine-rich binding factor 1 (AUF1) also referred to as heterogeneous nuclear ribononucleoprotein D. We have shown that AUF1 is a protein that binds to the PTH mRNA 3'-UTR and stabilizes the PTH transcript. Wilson et al. (14) recently showed that phosphorylation of p40AUF1 at Ser83 and Ser87 correlated with binding affinity to TNF
and its stability. They indicated that selective AUF1 phosphorylation may regulate ARE directed mRNA turnover by remodeling RNA structure.
We now show that AUF1 is modified posttranslationally in the PT by changes in serum Ca2+ and P, and these modifications include phosphorylation of AUF1. Modifications in AUF1 can also be induced in HEK 293 cells by inhibitors of the Ca2+-calmodulin dependent protein phosphatase calcineurin that also affect mRNA levels of GH reporter gene that contains the PTH mRNA 3'-UTR 63-nt cis element. Mice with genetic deletion of the calcineurin Aß gene showed a marked increase in PTH mRNA levels although they retained their responsiveness to calcium (Ca) and phosphate (P). Our results are the first to correlate gene expression with modifications in AUF1 protein in vivo in the rat under different physiologic conditions and to suggest a role for calcineurin in this process.
 |
RESULTS
|
|---|
To study the mechanisms by which Ca2+ and P regulate protein binding and PTH mRNA stability, we measured AUF1 protein levels by Western blots. Weanling rats were fed Ca2+- or P-deficient or normal diets for 2 wk, and PT proteins were run on SDS-PAGE and analyzed by a monoclonal antibody for AUF1. AUF1 has four isoforms (p37, p40, p42, and p45) (15) that are the result of alternative splicing. All four isoforms are recognized by the AUF1 antibody that we used and are seen in the Western blot. There was no difference in AUF1 protein levels by Western blots in PT extracts from rats fed the different diets (Fig. 1A
). There was also no difference in AUF1 levels in brain cytosolic extracts of the same rats (not shown). To study whether the differences in binding of AUF1 to PTH mRNA is due to posttranslational modification of the protein, cytosolic PT proteins from rats fed normal diets or diets deficient in Ca2+ or P, were run on two-dimensional (2D) gels and analyzed for AUF1. The distribution of spots was different among the three gels, suggesting that Ca2+ and P led to different modifications in AUF1 (Fig. 1B
, top panel). The difference in the p37 isoform may be particularly relevant because the most acidic spot (arrow) in the P PT proteins is reduced in the normal and even more so in the P, which may correlate with differences in PTH mRNA levels. Brain extracts from the same rats did not show any differences in AUF1 by 2D gels (Fig. 1C
). These results show that Ca2+ and P induce posttranslational modification of AUF1 specifically in the PT. To partially characterize the differences in AUF1 modifications, PT extracts were treated with calf intestinal phosphatase (CIP) and were analyzed by 2D gels in parallel with the untreated PT extracts (Fig. 1B
). CIP treatment, which removes P groups nonspecifically, led to changes in the pattern of AUF1 spots in the PT extracts (Fig. 1B
). These results indicate that AUF1 modifications induced by Ca2+ and P include at least in part, phosphorylation of AUF1.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 1. Ca2+ and P Have No Effect on AUF1 Protein Levels But Modify AUF1 Posttranslationally in the Parathyroid, Partly by AUF1 Phosphorylation
One-dimensional (A) and two-dimensional (B and C) Western blots of parathyroid extracts (A and B) and brain extracts (C) from rats fed a normal (N) low-Ca (Ca), or a low-P (P) diet, immunoblotted for AUF1. A, Equal PT cytoplasmic extracts were analyzed for AUF1 and AUF1 isoforms identified by there apparent molecular mass (left). There was no difference in AUF1 protein levels in the one-dimensional gel. B, 2D gels of equal amounts of parathyroid extracts. Upper panels (CIP) showed differences in AUF1 forms (indicated by the arrows), suggesting posttranslational modification of AUF1. Lower panels, (+CIP) PT extracts were pretreated with alkaline phosphatase. C, Brain extracts from the same Ca and P rats showed no difference in AUF1 forms. Molecular mass markers are shown on the left, and the acid-base direction is indicated above the gels. Similar findings were found in three repeat experiments.
|
|
We then separated the phosphorylated and nonphosphorylated fractions of PT cytosolic extracts from rats fed a low Ca2+ or a low P diet using a phosphoprotein purification system. This assay separates the phosphorylated fraction from the unphosphorylated cellular protein fraction by affinity chromatography. The two fractions and the input were analyzed by Western blot for AUF1 (Fig. 2A
). Most of the AUF1 protein was phosphorylated in both the low P PT protein extracts, as well as in the low Ca2+ protein extracts. There was no change in the amount of AUF1 in the input of PT extracts from both diets as shown above (Fig. 1A
) and in Fig. 2A
.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 2. The Phosphorylated Fractions of PT Extracts Are Enriched for AUF1 and Show Increased Binding to the PTH mRNA 3'-UTR Transcript that Is Still Regulated by Ca and P
PT extracts from rats fed a low Ca or low P diet were separated into nonphosphorylated () and phosphorylated (+) fractions. A, Phosphorylated and nonphosphorylated fractions from PTs of rats fed each diet and input were run on SDS-PAGE and analyzed by Western blots for AUF1 (top panel). Molecular mass markers are shown on the right, and the four isoforms of AUF1 are marked on the left. Ponceau staining of the membrane by scanning (lanes 14) and by photocopying (lanes 5 and 6) (bottom panel) shows the loaded proteins. B, REMSA using no protein (lane 1 and 18) and increasing concentrations of extract from each fraction as indicated and a labeled transcript to the PTH mRNA 3'-UTR. Lanes 5, 9, 13, and 17, protein extracts were preincubated with an antibody for AUF1 before addition of the PTH mRNA transcript, resulting in a supershift of the protein-RNA complex. In lane 19, the protein extract was preincubated with preimmune serum (*). Lane 20, incubation of the probe with AUF1 antibody with no added extract. The free probe that runs as two bands representing different conformations of the probe is shown by the arrows. C, UV cross-linking of the same extracts as in B and input using 10 mg of extract. Molecular mass markers are shown on the right, and protein-RNA complexes indicated by the arrows at left.
|
|
To study the binding properties of the phosphorylated and nonphosphorylated fractions to the PTH mRNA 3'-UTR, we performed REMSA and UV cross-linking assays. REMSA showed that the phosphorylated fractions from both Ca and P PT extracts bound the PTH mRNA 3'-UTR probe more than the nonphosphorylated fractions (Fig. 2B
). This could be due to differences in binding affinity or to the smaller amount of AUF1 in the nonphosphorylated fraction (Fig. 2A
). It should be noted that at higher concentrations of protein (1 µg), the nonphosphorylated fractions degraded the probe. This occurred in several repeat experiments for a reason that is not clear. Importantly, the binding of the Ca phosphorylated fractions was increased compared with the P phosphorylated fractions (Fig. 2B
). There were similar but less marked differences in binding of the nonphosphorylated fractions (Fig. 2B
). All binding complexes contained AUF1 as demonstrated by supershifted complexes from all fractions with an antibody to AUF1 (Fig. 2B
) but not with preimmune serum (Fig. 2B
, lane 19) or when the AUF1 antibody was incubated with the RNA probe and no protein extract. Therefore, despite the low levels of AUF1 shown in the Western blot (Fig. 2A
), the protein is present and is part of the binding complexes. UV cross-linking with these PT fractions and the PTH mRNA 3'-UTR probe also showed that the phosphorylated fractions from both Ca and P bound the probe more efficiently than the nonphosphorylated fractions (Fig. 2C
). In addition, there was always increased binding by both Ca fractions compared with the binding of the P fractions (Fig. 2C
). In contrast to REMSA that use native gels and show the intact protein complex, UV cross-linking gels demonstrate the individual RNA binding proteins because they involve ribonuclease A treatment of the cross-linked complexes and denaturing gel fractionations. Interestingly, the bands that run between 37 and 50 kDa and represent AUF1 (16) are only present in the input and phosphorylated fractions and are undetectable in the nonphosphorylated fractions (Fig. 2C
). This correlates with the small amount of AUF1 in the nonphosphorylated fractions by Western blot (Fig. 2A
). Because of the small amount of protein in the cytosolic fractions from the minute PTs (even in pools from 10 rats), we could not study the binding of AUF1 directly in each of the fractions by immunoprecipitation of AUF1. For this reason, it was not possible to run 2D gels of each of the fractions. The results of the binding assays therefore show that the phosphorylated fractions that contain more AUF1 bind the PTH RNA more efficiently in both Ca and P PT extracts. However, the increased binding by the Ca PT extract is maintained in both fractions.
There is no PT cell line; to study the signal transduction pathway that transfers the message of extracellular low Ca2+ and low P to PTH mRNA stability, we used HEK 293 cells. We first demonstrated the role of AUF1 also in these cells by depleting AUF1 protein by RNA interference (RNAi). We used oligonucleotides targeted to all four AUF1 isoforms and studied the effect on secreted human PTH (hPTH). HEK 293 cells were transiently cotransfected with the short interfering RNAs (siRNAs) and an expression plasmid containing the hPTH gene driven by a simian virus 40 promoter. After 72 h, there was a 60% reduction in AUF1 protein measured by Western blots as compared with the effect of a control nonspecific siRNA (Fig. 3
). There was also a 6-fold decrease in PTH secreted into the medium. These results show the importance of AUF1 to PTH gene expression also in these heterologous HEK 293 cells.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3. RNAi for AUF1 Decreases AUF1 Protein and hPTH Secretion
HEK 293 cells were transiently cotransfected with siRNAs for AUF1 using two AUF1 oligos (siRNAs 1 and 2) or a control oligo (C) and an expression plasmid for the hPTH gene. A, After 72 h, medium was collected and PTH secreted into the medium measured. The graph represents the results of four independent experiments. B, Cell extracts were run on gels and analyzed by Western blot for AUF1 RNAi led to an approximately 60% decrease in AUF1 protein levels and to a marked decrease in PTH production as measured by PTH secreted to the medium.
|
|
To characterize the signal transduction involved in translating the changes in serum Ca2+ and P to AUF1 and the PTH mRNA cis element, we used a reporter GH gene containing the PTH mRNA 3'-UTR 63-nt cis-acting instability element. The cis element targets GH mRNA to more rapid degradation, similar to its effect in the in vitrodegradation assay with PT extracts (10, 12, 13). To do this, we have now created stable HEK 293 cell lines that stably express S16 promoter driven chimeric forms of GH. These are the GH-PTH mRNA 3'-UTR 63- or 40-nt truncated nonfunctional element (13). We added agonists and inhibitors of classical signal transduction pathways and measured their effects on GH reporter gene mRNA levels and AUF1 modifications. We first tested a number of different pharmacological agents that affect the phospholipase A and C pathways for their effects on chimeric GH mRNA levels in the stably transfected cell lines expressing either the GH-PTH 63-nt or truncated 40-nt elements as summarized in Table 1
.
View this table:
[in this window]
[in a new window]
|
Table 1. The Effect of Mediators of Signal Transduction GH mRNA Levels in HEK293 Cells Stably Expressing the Chimeric GH-PTH mRNA 63-nt Functional cis-Acting Element or the GH-PTH 40-nt Truncated Nonfunctional PTH mRNA Element
|
|
The protein phosphatase type 1 and 2A inhibitor, okadaic acid, led to an increase in GH-PTH 63-nt mRNA levels (1 x 106 M) but not on the chimeric truncated transcript. It is noteworthy that okadaic acid (1 x 106 M) also has an effect to inhibit protein phosphatase (PP) type 2B. Calyculin, an inhibitor of PP2A, was not contributory. Cyclosporine A (CsA) (1 x 105 M for 6, 24, and 48 h) is a protein phosphatase type 2 calcineurin inhibitor (17). CsA reproducibly increased GH PTH 63 mRNA from the test cell line but not from the control cell line expressing the truncated PTH cis element (Fig. 4
). These results indicate that CsA regulates chimeric GH mRNA levels through its action on an intact cis-acting element of the PTH mRNA 3'-UTR in HEK 293 cells.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4. CsA Increases mRNA Levels for GH mRNA Containing the PTH 63 nt cis-Acting Element But Not a Truncated PTH 40-nt Nonfunctional Element
HEK 293 cells stably expressing the GH mRNA containing the PTH 63-nt cis-acting element or a truncated PTH 40 nt nonfunctional element were treated with CsA (1 x 105 M) or vehicle (control) for 6 h. RNA was analyzed for GH mRNA and L32 ribosomal protein as a control.
|
|
We then studied the posttranslational modification of AUF1 in cytosolic extracts from HEK 293 cells treated with CsA compared with controls. To simplify the analysis of the posttranslational modifications of AUF1, we transiently transfected HEK 293 cells with an expression plasmid for the myc tagged AUF1 of two of the four isoforms, the p37 (Fig. 5
) and p40 (not shown) isoforms. Transfected cells were treated with CsA for 24 h, cytosolic proteins extracted and analyzed by 2D gels with antibodies for AUF1, to detect endogenous AUF1, or for c-myc to detect the specific AUF1 isoform. After CsA, there was a different pattern of spots, both of endogenous AUF1 and myc-tagged AUF1p37 (Fig. 5
) by 2D Western blots, suggesting that CsA alters AUF1 posttranslationally. Addition of CIP led to a change in the 2D pattern and resulted in the same pattern for both the HEK 293 cell extracts without and with treatment with CsA, suggesting that these extracts manifest different levels of AUF1 phosphorylation that are eliminated after CIP (Fig. 5
). Taken together, these results suggest that the regulation of mRNA levels by calcineurin correlates with its effect on posttranslational modifications of AUF1 and is dependent upon the PTH mRNA 63-nt cis-acting element.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5. Posttranslational Modification of AUF1 by CsA in HEK 293 Cells
HEK 293 cells were transfected with a vector expressing myc-tag AUF1p37. Twenty-four hours after transfection CsA (+CsA) was added for additional 24 h and then cytosolic proteins were extracted and run on 2D gels. Western blots were performed using anti-myc antibody to show only the transfected AUF1 and then with anti-AUF1 antibody that showed the endogenous. Western blots using anti-myc antibody showed only the transfected AUF1p37 isoform. The anti-AUF1 antibody shows all isoforms expressed in these cells. Posttranslational modifications of AUF1 are shown by the arrows for the endogenous protein (CIP) and more clearly for the transfected protein. Cell extracts were treated with an nonspecific phosphatase (+CIP) and analyzed for endogenous AUF1. After CIP treatment, AUF1 forms were similar both without and with CsA.
|
|
The physiological relevance of calcineurin to PTH gene expression in vivo was demonstrated using mice with genetic deletion of the calcineurin Aß gene (calcineurin Aß/) (18, 19). Western blots of microdissected rat PT tissue showed the presence of calcineurin Aß (not shown). The PTs in mice are too small to microdissect but in all probability they also express calcineurin Aß. We then studied the expression of PTH mRNA in calcineurin Aß/ and wild-type mice fed a normal, Ca or P diets. The calcineurin Aß/ mice had much higher levels of PTH mRNA compared with the calcineurin Aß+/+ mice (Fig. 6
). PTH mRNA levels in the calcineurin Aß/ were increased by hypocalcemia and decreased by hypophosphatemia as for the wild-type mice but were always significantly higher than the PTH mRNA levels in the calcineurin Aß+/+ mice (Fig. 6
). The results in Fig. 6
represent pools of tissue from four mice for each lane. Similar results were obtained when individual mice (three in each group) were analyzed for PTH mRNA by Northern blot (not shown). These results show that calcineurin Aß is necessary for the setting of basal PTH gene expression but not for its regulation by Ca and P. This may be either because calcineurin Aß is not involved in the regulation by Ca or P at all or that in the absence of calcineurin Aß there are redundant signal transduction pathways.

View larger version (96K):
[in this window]
[in a new window]
|
Fig. 6. Mice with Deletion of the Calcineurin Aß Gene (calcineurin Ab/) Have Increased PTH mRNA Levels But Do Respond to Ca and P
Calcineurin Aß+/+ (CnAß+/+) and calcineurin Aß/ (CnAß+/) and mice were fed control or diets deficient in Ca and P after weaning for 2 wk and the thyroparathyroid tissue analyzed for PTH mRNA and 18S ribosomal RNA as a control. Each lane contains pooled tissue from four mice.
|
|
 |
DISCUSSION
|
|---|
PTH gene expression is posttranscriptionally regulated by Ca and P, and this involves trans-acting factors binding to a cis-acting element in the PTH mRNA 3'-UTR and thereby stabilizing the PTH mRNA. AUF1 is one of the trans-acting factors and we now show that Ca and P regulate AUF1 posttranslationally that was specific for the PT. 2D gels showed that these posttranslational changes of AUF1 include differences in phosphorylation.
The separation of PT cytosolic extracts to phosphorylated and nonphosphorylated fractions and REMSA and UV cross-linking assay showed increased binding by the phosphorylated fractions both from Ca and P PT extracts. The binding complexes contained AUF1 as shown by the supershifted complex with antibody to AUF1 in the REMSA and by visualization of the bands in the phosphorylated fractions by UV cross-linking. Western blots showed that the phosphorylated fraction was enriched for AUF1, and this may contribute to the increased binding by this fraction. However, in total cytosolic extracts the increased binding by Ca PT extracts, is not due to differences in the amount of AUF1 protein. Our results in Fig. 1
suggest posttranslational modification of AUF1 in the PT in response to Ca and P. The observation that both the phosphorylated and nonphosphorylated fractions from the Ca rat PTs have increased binding compared with the P PT extracts indicates that phosphorylation is not the only factor that regulates the binding of the PT proteins to PTH mRNA in response to Ca and P.
Phosphorylation of AUF1 has been studied by Wilson et al. (20) who showed that TPA treatment of monocytic leukemia cells altered the activity of ARE binding cytoplasmic complexes that include AUF1. Posttranslational modifications of p40AUF1, corresponded to changes in RNA binding activity and stabilization of ARE-containing mRNAs. They also showed (14) that phosphorylation of p40AUF1 at Ser83 and Ser87 regulated ARE-directed mRNA turnover possibly by remodeling local RNA structures. Therefore, phosphorylation of AUF1 is important to protein-RNA binding and mRNA stability in a monocytic leukemia cell line. We now show in vivo in the PT that phosphorylation and possibly other modifications are involved in the regulation of PTH mRNA stability. Our findings provide a physiological relevance to posttranslational modifications of AUF1 in the regulation of PTH mRNA stability by Ca and P.
There is no PT cell line; therefore we used HEK 293 cells as a heterologous cell system. HEK 293 cells were cotransfected with AUF1 siRNAs and an expression plasmid for the hPTH gene. This led to a marked decrease in PTH levels (Fig. 3
). Therefore, AUF1 is necessary for PTH gene expression also in HEK 293 cells. We have previously shown using rat PT extracts that the addition of recombinant AUF1 to the in vitro degradation assay stabilized the rat PTH mRNA transcript (16). In this present study, we show the same role for AUF1 in the regulation of hPTH mRNA stability. The core 26 nt of the cis element is conserved in human, canine, rat, murine, and feline PTH mRNA 3'-UTRs, suggesting a functional significance for the element (13). Our results with RNAi of AUF1 using the hPTH gene support the preservation of this stabilizing mechanism among these species.
HEK 293 cells therefore recognize the cis-acting instability element of the PTH mRNA 3'-UTR (13) and respond to AUF1. Accordingly, we used these cells to study the modifications of AUF1 and the signal transduction pathways involved in PTH mRNA stability. We could not use the hPTH expression system because PTH mRNA levels in the transfected cells were hardly detectable in Northern blots. This was very surprising because large amounts of PTH are secreted. This implies that the PTH mRNA is very unstable in these cells but is present long enough to be efficiently translated. This may very well be due to the cis-acting instability element in the PTH mRNA 3'-UTR. Similar results were obtained in Hela and HepG2 cells (not shown). When inserted into the GH gene, the PTH instability element also led to decay of the reporter mRNA but to levels that were easily detectable. This may be because of additional sequences in the PTH mRNA outside of the 63 nt that may be involved in directing the transcript for degradation. In the PT, PTH mRNA is readily detected under normal conditions but not in rats fed a low-P diet. Therefore, the cell lines tested represent a balance between the protecting and degrading factors in favor of a more rapid degradation of the PTH mRNA, similar to the PT proteins from rats fed P diet.
To study the signal transduction pathway that regulates the stability of the PTH element within the chimeric GH-PTH 63 nt mRNA, we used agonists and antagonists of potential pathways. Those compounds that regulate the MAPK pathway had been shown by Kifor et al. (5) to regulate the stimulation of ERK1/2 activity and the accompanying phosphorylation of cPLA2 in HEK 293 cells expressing the CaR and in bovine PT cells. The effect on PTH secretion was not studied (5). These agonists and antagonists had no effect on chimeric GH-PTH 63-nt mRNA stability in our system. In contrast, the calcineurin inhibitor CsA reproducibly increased GH-PTH 63 mRNA and not the GH-truncated PTH cis element mRNA (Fig. 4
). Therefore, these results indicate that calcineurin acts on a protein that recognizes the PTH mRNA cis element. Calcineurin is a protein phosphatase type 2B. CsA also changed the phosphorylation pattern of AUF1 in 2D gels of these cells (Fig. 5
) as confirmed by phosphatase treatment.
To study the role of calcineurin in vivo, we used mice with genetic deletions of the calcineurin Aß gene. These mice had been used to determine the role of calcineurin Aß in a mouse model of cardiac hypertrophy. Cardiac hypertrophy is associated with up-regulation of the MAPK signaling cascade, in particular the p38 kinases (21). p38 Signaling in the heart promotes myocyte growth through a mechanism involving enhanced calcineurin-nuclear factor of activated T cells transcription. In vitro (22) and in vivo in a mouse model of cardiac hypertrophy, genetic disruption of the calcineurin Aß gene rescued hypertrophic cardiomyopathy with (19) and without targeted inhibition of p38 MAPK (23).
We studied the expression of the PTH gene in the calcineurin Aß / mice. Basal levels of PTH mRNA were markedly increased in the mice with genetic deletion of the calcineurin Aß gene compared with wild-type mice. However, in these calcineurin Aß / mice, the regulation of PTH mRNA levels by Ca and P was retained. Therefore, calcineurin Aß is important for the setting of basal levels of PTH gene expression in vivo. The observation that calcineurin does not mediate the regulation of PTH mRNA levels by Ca and P may suggest that there are distinct phosphorylation sites on AUF1 that are controlled by calcineurin and by Ca/P. Indeed, the 2D gels comparing PT extracts of Ca vs. P and HEK 293 cell extracts with and without CsA imply that distinct spots are affected.
Basal levels of PTH expression are determined by the CaR. Inactivating mutations of the CaR, in patients with familial hypocalcuric hypercalcemia (24) and mice with deletions of the CaR gene (25), show markedly increased PTH secretion. The CaR activates phospholipase C and then protein kinase C that results in an increase in cytolosic Ca2+. Cytolosic Ca2+ binds calmodulin and the Ca2+-calmodulin complex is a potent activator of calcineurin. Calcineurin may then lead to a tonic decrease in PTH gene expression that is still regulated by changes in serum Ca and P by other pathways (5).
Similar to the responsiveness of calcineurin Aß / mice to Ca, patients with familial hypocalcuric hypercalcemia also respond to changes in serum Ca. In both cases, basal levels of PTH are increased. It is possible that in the absence of an intact CaR, or calcineurin, there are redundant signal transduction pathways by which Ca and P regulate PTH expression. Our in vivo studies with the calcineurin Aß / mice indicate that basal PTH mRNA levels are regulated through a mechanism involving calcineurin signaling. Together with the results in vitro using CsA-induced inhibition of calcineurin, they indicate that calcineurin controls AUF1 phosphorylation in vitro and PTH mRNA levels in vivo. Further studies are necessary to connect these two observations. This is a novel role for calcineurin in PTH gene expression.
 |
MATERIALS AND METHODS
|
|---|
Animals
Weanling male Sabra rats were fed a normal-Ca (0.6%), normal-phosphorus (0.3%) diet; a low-Ca (0.02%), normal-phosphorus (0.3%) diet; or a low-phosphorus (0.02%), normal-Ca (0.6%) diet (Teklad, Indianapolis, IL) for 2 wk. At 2 wk, the microdissected PT tissue was removed under pentobarbital anesthesia, and blood samples were taken for serum Ca and P. The low-Ca diet resulted in a serum Ca of 4.7 ± 0.5 mg/dl (control = 11.1 ± 0.4 mg/dl). The low-phosphorus diet resulted in a serum P of 4.2 ± 0.6 mg/dl (control = 9.9 ± 0.6 mg/dl) and serum Ca of 12.5 ± 0.7 mg/dl. Calcineurin Aß/ mice and wild type (19, 22, 23) were fed the same diets as above. All animal experiments were approved by the respective Institutional Animal Care and Use Committees.
Cytoplasmic Protein Purification
Cytoplasmic microdissected PT glands, a pool of 10 rats, and brain proteins (S100) were extracted. Tissues were removed from the rats and immediately washed in 1x cold PBS. The tissue was homogenized in S-100 buffer containing 50 mM Tris (pH 7.5), 25% glycerol, 50 mM KCl, 0.1 mM EDTA (pH 8), 0.5 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride. After centrifugation at 12,000 x g for 10 min (4 C), the supernatant was carefully decanted and centrifuged (4 C) at 100,000 x g for 1 h [Beckman (Fullerton, CA) type TL-100]. Protein concentration was determined by OD densitometery (595 µm wavelength) using a Bradford reagent (Bio-Rad, Hercules, CA). In some experiments, the proteins were treated with alkaline phosphatase (Roche, Mannheim, Germany), at 0.4 U/ µg protein extract for 1 h at 37 C before loading on the gel.
Isolation of Phosphorylated and Unphosphorylated Fractions of PT Extracts
PT phosphorylated and unphosphorylated fractions were separated using a PhosPhoprotein purification kit (QIAGEN, Hilden, Germany) according to the manufacturers instructions. Microdissected PTs from 10 rats from each diet were immediately homogenized by polytron in lysis buffer containing the supplied protease and phosphatase inhibitors. Extract (2.5 mg) was diluted to a final concentration of 0.1 mg/ml in the same buffer. The extracts were loaded on the column and the flow-through contained the nonphosphorylated fraction. The phosphorylated proteins were eluted in elution buffer. Both fractions were concentrated using the provided nanosep ultrafiltration columns and protein concentration determined.
2D Gel Electrophoresis
Glass pipettes (2 ml x 0.02) were cut to 17 cm-long tubes that were pretreated with 5% Cleaning compound AusiLab 104 (Carlo Erba, Italy) for 60 min, then with 60% ethanol, 40% HCl for 30 min, and then 20% KOH in 95% ethanol for an additional 30 min. Between each treatment, the tubes were washed in double-distilled water. The tubes were dried by high pressure air, coated with Sigmacote (Sigma, St. Louis, MO) and again dried by high pressure air. The bottom of the tubes were sealed with parafilm and then filled with the ampholine solution containing 60% urea, 2.4% Igepal CA 630 (Nonidet P-40) (Sigma), 4.8% acrylamide:/bis-acrylamide 29:1 (Biological Industries, Beit Haemek, Israel) and 300 µl of 3.510 Ampholine (Sigma) in a total volume of 5 ml for four tubes. For polymerization, 15 µl of 10% ammonium persulfate and 14 µl of tetramethyl ethylenediamine (Sigma) were added, and each tube was filled to 65% (11 cm) of its length. After 1 h, the parafilm was replaced by a gauze pad attached with adhesive tape, and the tubes placed in the running apparatus (Bio-Rad) filled with 2 liters of 20 mM NaOH so that the bottom of the tube was soaked in the buffer. Protein sample (50100 µg) at 4 C in a total volume of 100 µl S-100 buffer were supplemented with 50 µl of 3x sample loading buffer (0.6% Nonidet P-40, 1.3 M ß-mercaptoethanol, 12% of Ampholine, and a pinch of phenol red). To each sample, 80 mg urea were added and after the urea dissolved, the protein sample (50 µg) was loaded on to the tube and an equal volume of sample overlayer containing 1% Ampholine and 36% urea was added. The tube was filled to the top with 10 mM phosphoric acid and then the upper chamber of the tank was filled with the phosphoric acid buffer. The gels were run at room temperature for 5.5 h at 500 V and 15 mA, with the samples running from to +. At the end of the run, the strip was removed from the tube and stored at 80 C until used. For the second dimension fractionation, a 10% SDS-PAGE was prepared. The strips were allowed to dissolve at room temperature and were then gently rocked in 10 ml of denaturation buffer containing 10% glycerol, 62 mM Tris (pH 6.8), 2.3% sodium dodecyl sulfate (SDS), 0.7 M ßME, and a pinch of bromophenol blue. Each strip was glued with 2% agarose in 0.125 mM Tris (pH 6.8) to the preparative 10% SDS-polyacrylamide gel and the gels were run in 1x Laemmli running buffer at room temperature at 180 V and 40 mA for an overnight run or 70 mA for an 8 h run. For Western blots, the proteins were transferred to a 0.45 µM nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany) for 2 h at 4 C in 180 V and 400 mA in transfer buffer. The membranes were stain with Ponceau S and then probed with specific antibodies for Western blots.
REMSA
The PTH 3'-UTR RNA probe (5000 cpm) was incubated with microdissected PT extracts in a final volume of 10 µl containing 10 mM Tris (pH 7.5), 0.1 M K-acetate, 5 mM Mg-acetate, 2 mM dithiothreitol, 8 U RNasin, 2 µg tRNA, 50 µg heparin, and 1 µg BSA for 10 min at 4 C. In some experiments, an antibody for AUF1 was added after protein RNA incubation, for additional 30 min at 4 C. The samples were run on a native polyacrylamide gel [4% polyacrylamide:bisacrylamide (70:1)] in a cold room. RNA-protein binding was visualized by autoradiography of the dried gel.
Western Blots
The samples were run on SDS 10% polyacrylamide electrophoresis gel and transferred to a nitrocellulose membrane. Membranes were probed with a monoclonal antibody for AUF1 (heterogeneous nuclear ribononucleoprotein D) 5B9 diluted 1:2000. The antibody was kindly provided by G. Dreyfuss (Philadelphia, PA). The anti-myc antibody was purchased from Invitrogen Life Technologies (Carlsbad, CA). Western blots were analyzed with an EZ ECL kit (Biological Industries).
Plasmids
For the hPTH expression plasmid, a HpaII fragment including the three exons and two introns of the hPTH gene from plasmid pPTHg108 (26) was inserted downstream of the simian virus 40 promoter in the PSG5 expression plasmid (Stratagene, La Jolla, CA). The reporter genes for GH-PTH mRNA 3'-UTR 63- or 40-nt truncated element, downstream to the S16 ribosomal protein promoter, were prepared as previously described (13). Expression plasmid for myc-tagged AUF1 of p37 and p40 isoforms (27) were kindly provided by Ann Bin Shyu (Houston, TX).
Transfections
The HEK 293 cell lines stably transfected with the S16 promoter GH-PTH mRNA 3'-UTR 63- or 40-nt truncated element were created by cotransfection of the expression plasmid for the chimeric forms of GH and a puromicin selection plasmid using the Ca-P method. Three individual puromicin-resistant clones of each line were grown and one clone was used for our studies. Similar results were obtained with the two other clones (not shown). Transient transfection experiments were performed in 24-well plates, in triplicate using a Ca-P transfection kit (Sigma) according to the manufacturers instructions.
RNAi
Two siRNA duplexes targeted to AUF1 and a control siRNA were obtained from Dharmacon (Lafayette, CO). The sense sequences of the duplexes for AUF1 were for the siRNA1: GAUCCUAUCACAGGGCGAUCAdTdT; and for the siRNA2: UCGGAGAGUGUAGAUAAGGdTdT. The two AUF1 siRNAs targeted exon 3 that is common to all four AUF1 isoforms and therefore would be predicted to knock down all the isoforms. The control sense sequence was: AUUCUAUCACUAGCGUGACUU (catalog no. D-001206-10). The siRNAs were cotransfected with the hPTH expression plasmid in 24- or six-well plates using Lipofectamine 200 Reagent (Invitrogen Life Technologies) according to the manufacturers instructions. After 72 h, medium was collected for PTH immunoassay and cellular proteins were extracted for Western blots. Cotransfection of the siRNAs with a GFP expression plasmid confirmed more than 90% transfection efficiency as visualized by confocal microscopy (not shown).
Signal Transduction Pathway Regulators
The compounds were purchased from Sigma apart from FK506 (Fujisawa, Kerry, Ireland) and added to the cells in the indicated doses.
RNA Transcripts and Binding Assays
Labeled RNA was transcribed from linearized plasmids for the PTH mRNA 3'-UTR using an RNA production kit (Promega, Madison, WI) and UV cross-linking and REMSA performed as previously described (16).
Northern Blots
RNA was extracted with Tri-Reagent and run on a formaldehyde containing agarose gel. Northern blots were performed as previously described (13) with probes for GH, rat PTH, L32 ribosomal protein and 18S ribosomal RNA.
Secreted hPTH
hPTH was measured using the Immulite 2000 Intact PTH assay (Los Angeles, CA)
 |
NOTE ADDED IN PROOF
|
|---|
We have recently shown that calcineurin Aß specifically regulates the response of the renal Na+/P-cotransporter type II gene expression and transport activity to a low P [Moz et al. (28)]. Therefore, calcineurin has a crucial role in the signal transduction pathway regulating P homeostasis both in the kidney and in the parathyroid.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Ms. M. Offner for expert technical help, H. M. Kronenberg (Massachusetts General Hospital, Boston, MA) for the hPTH clone, A.-B. Shyu (Houston, TX) for the myc p40 and p37 AUF1 expression plasmids, G. Dreyfuss (Philadelphia, PA) for the AUF1 antibody, and T. Tuschl (New York, NY) for advice on the siRNAs.
 |
FOOTNOTES
|
|---|
This work was supported in part by grants from the Israel Academy of Sciences, Hadassah Research Fund for Womens Health and the Minerva Center for Calcium and Bone Metabolism. Minerva is funded through the Bundesministerium für Bildung und Forschung.
First Published Online October 28, 2004
Abbreviations: AUF1, Adenosine-uridine-rich binding factor; CaR, calcium receptor; CIP, calf intestinal phosphatase; CsA, cyclosporine A; 2D, two-dimensional; HEK 293, human embryonic kidney 293 cells; hPTH, human PTH; nt, nucleotide; P, phosphate; PT, parathyroid; REMSA, RNA EMSA; RNAi, RNA interference; SDS, sodium dodecyl sulfate; siRNA, short interfering RNA; UTR, untranslated region.
Received for publication March 16, 2004.
Accepted for publication October 20, 2004.
 |
REFERENCES
|
|---|
- Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert J 1993 Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature 366:575580[CrossRef][Medline]
- Hofer AM, Brown EM 2003 Extracellular calcium sensing and signalling. Nat Rev Mol Cell Biol 4:530538[CrossRef][Medline]
- Silver J, Naveh-Many T, Kronenberg HM 2002 Parathyroid hormone: molecular biology. In: Bilezikian JB, Raisz LG, Rodan GA, eds. Principles of bone biology. San Diego: Academic Press; 407422
- Kifor O, Diaz R, Butters R, Brown EM 1997 The Ca2+-sensing receptor (CaR) activates phospholipases C, A2, and D in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK 293) cells. J Bone Miner Res 12:715725[CrossRef][Medline]
- Kifor O, MacLeod RJ, Diaz R, Bai M, Yamaguchi T, Yao T, Kifor I, Brown EM 2001 Regulation of MAP kinase by calcium-sensing receptor in bovine parathyroid and CaR-transfected HEK 293 cells. Am J Physiol Renal Physiol 280:F291F302
- Wernerson A, Svensson O, Reinholt FP 1989 Parathyroid cell number and size in hypercalcemic rats: a stereologic study employing modern unbiased estimators. J Bone Miner Res 4:705713[Medline]
- Habener JF, Rosenblatt M, Potts JTJ 1984 Parathyroid hormone: biochemical aspects of biosynthesis, secretion, action, and metabolism. Physiol Rev 64:9851053[Free Full Text]
- Capen CC, Rosol TJ 1989 Recent advances in the structure and function of the parathyroid gland in animals and the effects of xenobiotics. Toxicol Pathol 17:333345[Medline]
- Naveh-Many T, Silver J 1990 Regulation of parathyroid hormone gene expression by hypocalcemia, hypercalcemia, and vitamin D in the rat. J Clin Invest 86:13131319
- Moallem E, Silver J, Kilav R, Naveh-Many T 1998 RNA protein binding and post-transcriptional regulation of PTH gene expression by calcium and phosphate. J Biol Chem 273:52535259[Abstract/Free Full Text]
- Kilav R, Silver J, Naveh-Many T 1995 Parathyroid hormone gene expression in hypophosphatemic rats. J Clin Invest 96:327333
- Kilav R, Silver J, Naveh-Many T 2001 A conserved cis-acting element in the parathyroid hormone 3'-untranslated region is sufficient for regulation of RNA stability by calcium and phosphate. J Biol Chem 276:87278733[Abstract/Free Full Text]
- Kilav R, Bell O, Le SY, Silver J, Naveh-Many T 2004 The parathyroid hormone mRNA 3'-untranslated region AU-rich element is an unstructured functional element. J Biol Chem 279:21092116[Abstract/Free Full Text]
- Wilson GM, Lu J, Sutphen K, Suarez Y, Sinha S, Brewer B, Villanueva-Feliciano EC, Ysla RM, Charles S, Brewer G 2003 Phosphorylation of p40AUF1 regulates binding to A + U-rich mRNA-destabilizing elements and protein-induced changes in ribonucleoprotein structure. J Biol Chem 278:3303933048[Abstract/Free Full Text]
- Buzby JS, Lee SM, Van Winkle P, DeMaria CT, Brewer G, Cairo MS 1996 Increased granulocyte-macrophage colony-stimulating factor mRNA instability in cord versus adult mononuclear cells is translation- dependent and associated with increased levels of A + U-rich element binding factor. Blood 88:28892897[Abstract/Free Full Text]
- Sela-Brown A, Silver J, Brewer G, Naveh-Many T 2000 Identification of AUF1 as a parathyroid hormone mRNA 3'-untranslated region binding protein that determines parathyroid hormone mRNA stability. J Biol Chem 275:74247429[Abstract/Free Full Text]
- Rusnak F, Mertz P 2000 Calcineurin: form and function. Physiol Rev 80:14831521[Abstract/Free Full Text]
- Bueno OF, Brandt EB, Rothenberg ME, Molkentin JD 2002 Defective T cell development and function in calcineurin A ß-deficient mice. Proc Natl Acad Sci USA 99:93989403[Abstract/Free Full Text]
- Bueno OF, Wilkins BJ, Tymitz KM, Glascock BJ, Kimball TF, Lorenz JN, Molkentin JD 2002 Impaired cardiac hypertrophic response in calcineurin A ß-deficient mice. Proc Natl Acad Sci USA 99:45864591[Abstract/Free Full Text]
- Wilson GM, Lu J, Sutphen K, Sun Y, Huynh Y, Brewer G 2003 Regulation of A + U-rich element-directed mRNA turnover involving reversible phosphorylation of AUF1. J Biol Chem 278:3302933038[Abstract/Free Full Text]
- De Windt LJ, Lim HW, Haq S, Force T, Molkentin JD 2000 Calcineurin promotes protein kinase C and c-Jun NH2-terminal kinase activation in the heart. Cross-talk between cardiac hypertrophic signaling pathways. J Biol Chem 275:1357113579[Abstract/Free Full Text]
- Taigen T, De Windt LJ, Lim HW, Molkentin JD 2000 Targeted inhibition of calcineurin prevents agonist-induced cardiomyocyte hypertrophy. Proc Natl Acad Sci USA 97:11961201[Abstract/Free Full Text]
- Braz JC, Bueno OF, Liang Q, Wilkins BJ, Dai YS, Parsons S, Braunwart J, Glascock BJ, Klevitsky R, Kimball TF, Hewett TE, Molkentin JD 2003 Targeted inhibition of p38 MAPK promotes hypertrophic cardiomyopathy through upregulation of calcineurin-NFAT signaling. J Clin Invest 111:14751486[CrossRef][Medline]
- Pollack MR, Brown EM, Chou Y-HW, Hebert SC, Marx SJ, Steinman B, Levi T, Seidman CE, Seidman JG 1993 Mutations in the human Ca2+-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 75:12971303[CrossRef][Medline]
- Ho C, Conner DA, Pollak MR, Ladd DJ, Kifor O, Warren HB, Brown EM, Seidman JG, Seidman CE 1995 A mouse model of human familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nat Genet 11:389394[CrossRef][Medline]
- Vasicek TJ, McDevitt BE, Freeman MW, Fennick BJ, Hendy GN, Potts JTJ, Rich A, Kronenberg HM 1983 Nucleotide sequence of the human parathyroid hormone gene. Proc Natl Acad Sci USA 80:21272131[Abstract/Free Full Text]
- Xu N, Chen CY, Shyu AB 2001 Versatile role for hnRNP D isoforms in the differential regulation of cytoplasmic mRNA turnover. Mol Cell Biol 21:69606971[Abstract/Free Full Text]
- Moz Y, Levi R, Lavi-Moshayoff V, Cox KB, Molkentin JD, Silver J, Naveh-Many T 2004 Calcineurin Aß is central to the expression of the renal type II Na/Pi co-transporter gene and to the regulation of renal phosphate transport. J Am Soc Nephrol 15:29722980[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Nechama, I. Z. Ben-Dov, P. Briata, R. Gherzi, and T. Naveh-Many
The mRNA decay promoting factor K-homology splicing regulator protein post-transcriptionally determines parathyroid hormone mRNA levels
FASEB J,
October 1, 2008;
22(10):
3458 - 3468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. V. Chakkalakal, P. Miura, G. Belanger, R. N. Michel, and B. J. Jasmin
Modulation of utrophin A mRNA stability in fast versus slow muscles via an AU-rich element and calcineurin signaling
Nucleic Acids Res.,
February 11, 2008;
36(3):
826 - 838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. H. Ing, D. A. Massuto, and L. A. Jaeger
Estradiol Up-regulates AUF1p45 Binding to Stabilizing Regions within the 3'-Untranslated Region of Estrogen Receptor {alpha} mRNA
J. Biol. Chem.,
January 18, 2008;
283(3):
1764 - 1772.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S Ritter, S. Pande, I. Krits, E. Slatopolsky, and A. J Brown
Destabilization of parathyroid hormone mRNA by extracellular Ca2+ and the calcimimetic R-568 in parathyroid cells: role of cytosolic Ca and requirement for gene transcription
J. Mol. Endocrinol.,
January 1, 2008;
40(1):
13 - 21.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Dinur, R. Kilav, A. Sela-Brown, H. Jacquemin-Sablon, and T. Naveh-Many
In Vitro Evidence that Upstream of N-ras Participates in the Regulation of Parathyroid Hormone Messenger Ribonucleic Acid Stability
Mol. Endocrinol.,
July 1, 2006;
20(7):
1652 - 1660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J V Warner, D R Nyholt, F Busfield, M Epstein, J Burgess, S Stranks, P Hill, D Perry-Keene, D Learoyd, B Robinson, et al.
Familial isolated hyperparathyroidism is linked to a 1.7 Mb region on chromosome 2p13.3-14.
J. Med. Genet.,
March 1, 2006;
43(3):
e12 - e12.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Levi, I. Z. Ben-Dov, V. Lavi-Moshayoff, M. Dinur, D. Martin, T. Naveh-Many, and J. Silver
Increased Parathyroid Hormone Gene Expression in Secondary Hyperparathyroidism of Experimental Uremia Is Reversed by Calcimimetics: Correlation with Posttranslational Modification of the Trans Acting Factor AUF1
J. Am. Soc. Nephrol.,
January 1, 2006;
17(1):
107 - 112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kawata, Y. Imanishi, K. Kobayashi, N. Onoda, Y. Takemoto, H. Tahara, S. Okuno, E. Ishimura, T. Miki, T. Ishikawa, et al.
Direct in Vitro Evidence of Extracellular Ca2+-Induced Amino-Terminal Truncation of Human Parathyroid Hormone (1-84) by Human Parathyroid Cells
J. Clin. Endocrinol. Metab.,
October 1, 2005;
90(10):
5774 - 5778.
[Abstract]
[Full Text]
[PDF]
|
 |
|