help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0298
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures and Legends
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shah, Y. M.
Right arrow Articles by Rowan, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shah, Y. M.
Right arrow Articles by Rowan, B. G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*L-SERINE
*TAMOXIFEN
Molecular Endocrinology 19 (3): 732-748
Copyright © 2005 by The Endocrine Society

The Src Kinase Pathway Promotes Tamoxifen Agonist Action in Ishikawa Endometrial Cells through Phosphorylation-Dependent Stabilization of Estrogen Receptor {alpha} Promoter Interaction and Elevated Steroid Receptor Coactivator 1 Activity

Yatrik M. Shah and Brian G. Rowan

Department of Biochemistry and Molecular Biology, Medical College of Ohio, Toledo, Ohio 43614-5804

Address all correspondence and requests for reprints to: Brian G. Rowan, Ph.D., Department of Biochemistry and Molecular Biology, Medical College of Ohio, 3035 Arlington Ave., Toledo, Ohio 43614-5804. E-mail: browan{at}mco.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tamoxifen is the most widely used selective estrogen receptor modulator for breast cancer in clinical use today. However, tamoxifen agonist action in endometrium remains a major hurdle for tamoxifen therapy. Activation of the nonreceptor tyrosine kinase src promotes tamoxifen agonist action, although the mechanisms remain unclear. To examine these mechanisms, the effect of src kinase on estrogen and tamoxifen signaling in tamoxifen-resistant Ishikawa endometrial adenocarcinoma cells was assessed. A novel connection was identified between src kinase and serine 167 phosphorylation in estrogen receptor (ER)-{alpha} via activation of AKT kinase. Serine 167 phosphorylation stabilized ER interaction with endogenous ER-dependent promoters. Src kinase exhibited the additional function of potentiating the transcriptional activity of Gal-steroid receptor coactivator 1 (SRC-1) and Gal-cAMP response element binding protein-binding protein in endometrial cancer cells while having no effect on Gal-p300-associated factor and Gal fusions of the other p160 coactivators glucocorticoid-interacting protein 1 (transcriptional intermediary factor 2/nuclear coactivator-2/SRC-2) and amplified in breast cancer 1 (receptor-associated coactivator 3/activator of transcription of nuclear receptor/SRC-3). Src effects on ER phosphorylation and SRC-1 activity both contributed to tamoxifen agonist action on ER-dependent gene expression in Ishikawa cells. Taken together, these data demonstrate that src kinase potentiates tamoxifen agonist action through serine 167-dependent stabilization of ER promoter interaction and through elevation of SRC-1 and cAMP response element binding protein-binding protein coactivation of ER.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ESTROGEN RECEPTOR-{alpha} (referred to as ER) is a member of the nuclear receptor superfamily of transcription factors that is activated by ligand binding of estrogenic and other ligands. ER is also activated by ligand-independent mechanisms that involve cross-talk from peptide and growth factor signal transduction pathways. In the ligand-dependent pathway, estrogen crosses the cell membrane and binds to the ligand-binding domain of the ER. Upon ligand binding, receptor interaction with heat shock protein-90 and other chaperone proteins is lost, and the ER dimerizes and binds to estrogen-responsive elements (EREs) in the promoters of ER-dependent genes (1, 2). ER activation results in recruitment of coactivators of the p160 family [steroid receptor coactivator 1 (SRC-1) (nuclear coactivator-1, NcoA-1) (3, 4), glucocorticoid receptor interacting protein 1 (GRIP1) (transcriptional intermediary factor (TIF-2)/NcoA-2/SRC-2) (5, 6), amplified in breast cancer 1 (AIB-1) (receptor associated coactivator (RAC-3)/activator of transcription of nuclear receptor (ACTR)/SRC-3) (7, 8, 9, 10, 11)] and cAMP response element binding protein (CREB)-binding protein (CBP) (12) that modify chromatin structure and facilitate mRNA transcription (13).

Both ligand-dependent and ligand-independent activation of ER is modulated by receptor phosphorylation. ER is a phosphoprotein and, upon ligand binding, receptor phosphorylation is enhanced (14, 15, 16). The major phosphorylation sites of ER reside in the N-terminal domain (NTD) at serines 104, 106, 118, and 167. Mutation of serines 104, 106, and 118 to alanine results in a general decrease in ER transcriptional activity (14). Phosphorylation at serine 167 was shown to be important in DNA binding by the receptor (17, 18, 19). Numerous signaling pathways regulate ER phosphorylation. Serines 104/106/118 are targets of the MAPK family (20, 21, 22), and serine 167 has been shown to be phosphorylated by AKT (22, 23, 24, 25).

In addition to ER, cellular signaling pathways phosphorylate coregulator proteins. SRC-1 is phosphorylated on seven sites in vivo, all of which contain a consensus sequence for proline-directed protein kinases (26). In addition, protein kinase A enhanced ligand-independent activation of progesterone receptor (PR) through phosphorylation of SRC-1 (27). GRIP-1 and AIB-1 are phosphorylated in vitro by MAPKs (28, 29). In breast cancer cells the transcriptional activity of AIB-1 is increased by MAPK phosphorylation, which stimulates the recruitment of histone acetyltransferases (28). In addition to coactivators, cellular signaling cascades also phosphorylate corepressors. Interaction of nuclear corepressor (N-CoR) and silencing mediator of retinoid and thyroid hormone receptor with PR decreased after incubation with 8-bromo-cAMP (30). In vitro phosphorylation by MAPK kinase kinase decreased the interaction of silencing mediator of retinoid and thyroid hormone receptor with thyroid receptor (31). Interaction of the corepressor N-CoR with the ER is decreased by treatment with forskolin and epidermal growth factor (32).

Coregulator interactions with ER are important mechanisms mediating selective ER modulator action. Tamoxifen inhibits coactivator recruitment and promotes corepressor association with ER to inhibit estrogen-dependent gene transcription in tamoxifen-sensitive breast cancer cells (33). With regard to this mechanism, elevation of coactivator proteins and reduction in corepressor proteins may be associated with the progression of breast cancer to a more malignant and tamoxifen-resistant phenotype. In a mouse model for human breast cancer, decreased levels of N-CoR correlated with the onset of resistance to tamoxifen therapy (32). Jepsen et al. (34) showed that the absence of N-CoR in mouse embryo fibroblasts isolated from the N-CoR null mouse allowed 4-hydroxytamoxifen to act as a full agonist for ER-dependent transcription. 4-Hydroxytamoxifen did not activate ER-dependent transcription in wild-type mouse embryo fibroblasts containing normal N-CoR levels. The hypothesis that elevated coactivator levels promote tamoxifen action may be relevant in the uterus because tamoxifen is an agonist in normal uterus (35, 36) and endometrial-derived cell lines (37, 38, 39). However in contrast to normal vs. malignant breast, we did not detect any distinct differences between coactivator and corepressor expression patterns in endometrium with both coactivator and corepressor levels increased during the progression from normal to malignant endometrium (40).

Several reports suggest activated cellular signaling pathways in the uterus may promote the tissue-specific agonist effects of tamoxifen. Phosphorylation at serine 118 in ER increased transcriptional activation in response to estrogen and tamoxifen (21). MAPK kinase kinase increased the agonistic activity of tamoxifen implicating downstream MAPKs in regulating tamoxifen agonist/antagonist action (41). Src kinase can enhance the transcriptional activity of the tamoxifen-ER complex through the MAPK pathway (42). Finally, although elevated Src kinase activity is detected in late-stage steroid-resistant breast cancer (43), we recently found that src kinase activity is higher in normal compared with malignant endometrium (44). This may indicate a role for activated Src kinase in promoting tamoxifen agonist action in normal endometrium

Src kinase is a nonreceptor tyrosine kinase and a protooncogene that is deregulated in several different cancers (45). Src kinase activates several signaling cascades including the MAPK and AKT pathways (46, 47, 48), both of which impact on ER-dependent signaling. Feng et al. (42) reported two independent pathways for src kinase potentiation of estrogen and tamoxifen signaling in HeLa cells: 1) an ER-dependent pathway that is partially dependent on phosphorylation of serine 118; and 2) an ER-independent pathway implicating src kinase effects on coregulators. However, the precise mechanisms and specific phosphorylation sites through which src kinase modulates ER signaling are incompletely defined, most likely because multiple proteins important for ER signaling are targeted by src. For a more thorough, mechanistic understanding of the role of src kinase in tamoxifen agonist action in the endometrium, the effect of src on both ER and coactivator activity and phosphorylation was investigated. This report describes src kinase-induced phosphorylation of ER serine 167 via AKT kinase as a major mechanism for src potentiation of ER signaling through stabilization of ER promoter interaction. Src kinase also specifically elevated SRC-1 activity through multiple phosphorylation sites. Finally, cell type-specific targeting of CBP by src kinase was demonstrated.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Src Kinase Modulates Estradiol and 4-Hydroxytamoxifen Action on ERE2e1b-Luciferase Reporter in an Endometrial-Derived Cell Line
Interest in src kinase potentiation of tamoxifen agonist activity in endometrium stemmed from our observation that tamoxifen-resistant endometrial cancer cell lines (Ishikawa and HEC1A) exhibited elevated active src compared with tamoxifen-sensitive breast cancer cell lines (MCF-7 and T47D) (Fig. 1AGo). To further confirm the role of endometrial src kinase in tamoxifen agonism, Ishikawa cells were transfected with an ERE2e1b-luciferase reporter and incubated either with SU6656, a specific src kinase inhibitor (Fig. 1BGo), or cotransfected with a dominant active mutant of src kinase (Fig. 1CGo) followed by measurement of luciferase expression. Incubation of Ishikawa cells with 4-hydroxytamoxifen resulted in similar activation of the reporter (1.5- to 2-fold relative to vehicle) as occurred after incubation of cells with estradiol (3- to 4-fold relative to vehicle) (Fig. 1BGo). Both 4-hydroxytamoxifen and estradiol activation of the reporter was significantly reduced in cells incubated with SU6656 (Fig. 1BGo, lanes 4 and 6). These data coincided with reduced src kinase activation in cells incubated with SU6656 as measured by Western blot analysis using a phospho-specific src kinase antibody (data not shown). Transfection with dominant active src kinase increased basal luciferase expression almost 2-fold, indicating ligand-independent activation of ER (Fig. 1CGo, lane 2). Dominant active src also potentiated estradiol- and 4-hydroxytamoxifen-stimulated luciferase expression 4- to 5-fold and 3-fold, respectively, relative to vehicle (Fig. 1CGo, lanes 4 and 6)). To confirm that the inhibition of src kinase down-regulates estradiol and 4-hydroxytamoxifen activation of the ERE2e1b-luciferase reporter, short interfering RNA (siRNA) was used to reduce src protein levels. Western blot analysis confirmed that src protein levels were reduced more than 65% in Ishikawa cells transfected with siRNA for src kinase (siRNA-src) (Fig. 1DGo). When siRNA-src was cotransfected with ERE2e1b-luciferase reporter, the basal activity was reduced by more than 50% (Fig. 1EGo, lane 2), and both the estradiol and 4-hydroxytamoxifen inductions of the reporter were decreased to levels equivalent to vehicle alone (Fig. 1EGo, lanes 4 and 6 vs. lane 1). To rule out nonspecific effects of SU6656, siRNA-src, and dominant active c-src on general transcription, these agents were incubated with or cotransfected into cells with a constitutively active rous sarcoma virus (RSV)-luciferase reporter (Fig. 1FGo). These agents had no significant effect on the RSV-luciferase reporter, suggesting that src kinase specifically modulates estradiol and 4-hydroxytamoxifen signaling. The requirement of ER for the src kinase effects on estradiol and 4-hydroxytamoxifen signaling was demonstrated by incubation of Ishikawa cells with the pure antiestrogen ICI 182,780. ICI 182,780 blocked dominant active src potentiation of estradiol and 4-hydroxytamoxifen activation of the reporter (data not shown). Furthermore, as previously reported (42), dominant active src potentiated estradiol and 4-hydroxytamoxifen activation of ERE2e1b-luciferase only in cells cotransfected with ER (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Src Kinase Regulates ER-Dependent Transcription of ERE2e1b-Luciferase in Ishikawa Cells

A, Increased expression of activated src kinase in endometrial- vs. breast-derived cell lines. MCF-7, T47D, HEC1A, and Ishikawa cells (2 x 106 cells per plate) were plated in 2% charcoal-stripped serum for 3 d. Protein extract was prepared from the cells and used for Western blot analysis to measure levels of activated src kinase as described in Material and Methods. Quantitation of the Western blot signal was normalized to the Western blot signal for total src and ß-actin levels (right panel). Each bar represents the mean value ± SD. *, P < 0.05 compared with MCF-7 and T47D cells. B and C, Ishikawa cells (2 x 105 cells per well) were transfected with ERE2e1b-luciferase reporter (0.5 µg/well). cells were incubated 24 h posttransfection with 1 µM SU6656, a specific src kinase inhibitor, for 2 h (panel A) or cells were cotransfected with dominant active src kinase (Dom) (0.5 µg /well) or empty vector pBABE (0.5 µg/well) (panel B). After incubation with inhibitor or 24 h posttransfection, cells were incubated with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- or tamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con). D, Western blot analysis of src kinase levels after transfection of a siRNA specific for src kinase (siRNA-src). The siRNA-src was constructed as described in Materials and Methods. Ishikawa cells (2 x 106 cells per plate) were transfected with siRNA-src (20 µg/plate). Protein extract was prepared from Ishikawa cells 72 h posttransfection and used for Western blot analysis to measure expression levels of src kinase as described in Materials and Methods. Quantitation of the Western blot signal was normalized to ß-actin (right panel). Each bar represents the mean value ± SD. * P < 0.05. E, siRNA-src decreases estradiol and 4-hydroxytamoxifen activation of ERE2e1b-luciferase reporter. Ishikawa cells were plated as described above and cotransfected with ERE2e1b-luciferase reporter (0.5 µg/well) and siRNA-src (0.5 µg/well) or empty vector (0.5 µg/well). Cells were incubated 72 h posttransfection with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- or tamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples. F, SU6656, dominant active src, or siRNA-src had no effect on a constitutively active RSV-luciferase reporter. Ishikawa cells were plated as described above and transfected with a RSV-luciferase reporter (0.5 µg/well) and incubated with 1 µM SU6656 or cotransfected with either siRNA-src (0.5 µg/well) or dominant active src (Dom). Twenty four hours after transfection or treatment, standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods.

 
Src Kinase Modulates Estradiol and 4-Hydroxytamoxifen Action on Endogenous ER-Regulated Genes
Real time RT-PCR was used to measure expression of two well-characterized ER-regulated genes, c-myc and pS2. The c-myc gene is regulated by ER through both a consensus ERE as well as a nonconsensus sequence hypothesized to be an activator protein 1 (AP1) site. ER indirectly associates with the AP1 site through direct binding with AP1 proteins (33, 49). The pS2 gene contains consensus EREs in the 5'-flanking region of the gene (50). c-myc and pS2 gene expression were measured after incubation with estradiol and 4-hydroxytamoxifen alone or in combination with the src kinase inhibitor SU6656. Both estradiol and 4-hydroxytamoxifen induced c-myc gene expression 2- to 3-fold and 4- to 5-fold relative to vehicle, respectively (Fig. 2AGo, lanes 3 and 5). The pS2 gene was regulated by ligands in a similar manner (Fig. 2BGo). Ligand-dependent induction of c-myc and pS2 was reduced more than 50% by coincubation of cells with SU6656 (Fig. 2Go, A and B, lanes 4 and 6).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. Activation or Inhibition of src Kinase Regulates Estradiol- and 4-Hydroxytamoxifen-Dependent c-myc and pS2 Gene Expression

Ishikawa cells (2 x 106 cells per plate) were incubated with 1 µM SU6656 for 2 h. After incubation with the inhibitor, cells were incubated with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 6 h. Expression of c-myc (panel A) and pS2 genes (panel B) was measured by real time RT-PCR as described in Materials and Methods. Expression was normalized to GAPDH, and each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- and 4-hydroxytamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples.

 
Cells that exhibit high transfection efficiency were needed to measure the role of dominant active src on endogenous ER-regulated genes. Although the Ishikawa cells were not appropriate for these experiments due to low transfection efficiency, the well-characterized ER-negative HeLa cells exhibited more than 90% transfection efficiency (data not shown) and were therefore useful to measure effects of both dominant active src and various ER{alpha} mutants. It should be noted that, unlike Ishikawa cells, HeLa cells transfected with ER expression plasmid do not exhibit tamoxifen agonist activity. High-efficiency transfection of HeLa cells with ER was sufficient to initiate estradiol, but not 4-hydroxytamoxifen, induction of endogenous c-myc and pS2 gene expression 6- to 7-fold and 4- to 5-fold relative to vehicle, respectively (supplemental Fig. 1, A and B, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Similar to results in Ishikawa cells, cotransfection of HeLa cells with dominant active src potentiated basal and estradiol-regulated c-myc and pS2 expression. Remarkably, although 4-hydroxytamoxifen alone had no effect on gene expression and dominant active src alone resulted in only 1.5-fold induction over vector-transfected cells, the combination of tamoxifen and dominant active src induced c-myc and pS2 gene expression to a level comparable to estradiol alone (supplemental Fig. 1). These data demonstrate that src kinase promotes tamoxifen agonist action on endogenous genes in a cellular context in which tamoxifen is an antagonist.

Although HeLa and Ishikawa cells differ with respect to tamoxifen agonism/antagonism, ER{alpha}-negative Ishikawa variants transfected with ER do not exhibit tamoxifen agonist activity and, in this regard, are similar to HeLa cells (41). Although tamoxifen agonism/antagonism cannot be directly compared in HeLa and Ishikawa cells, it is clear that, for each line, activation of the src pathway potentiates tamoxifen agonist activity above control.

Src Kinase Partially Mediates Its Effect on ER-Dependent Transcription through Phosphorylation at Both Serine 118 and Serine 167
As previously reported (42), src kinase-mediated effects on ER-regulated gene expression were localized to the NTD of ER (data not shown). Consequently, phosphorylation within this domain was measured using phospho-specific antibodies for serine 104/106, 118, and 167. In ER-transfected HeLa cells, estradiol increased phosphorylation at serines 118 and 167, an effect that was inhibited by coincubation with SU6656 (Fig. 3AGo). A band was not detected when Western blots were probed with the antibody specific for phospho-104/106 on ER (data not shown). Similar results were found in Ishikawa cells in which both estradiol and 4-hydroxytamoxifen consistently increased serine 118 and serine 167 phosphorylation, an effect that was blocked by coincubation with SU6656 (data not shown). To further confirm these results, point mutations of each phosphorylation site were prepared and cotransfected with ERE2e1b-luciferase into ER-negative HeLa cells to assess whether dominant active src could potentiate estradiol-mediated induction of the reporter. As previously described (14), mutation of the ER NTD phosphorylation sites decreased basal and estradiol-stimulated reporter activation (Fig. 3BGo), although the mutations did not affect ER protein levels (Fig. 3CGo). Dominant active src potentiated estradiol-stimulated luciferase expression by wild-type ER, ER/S104A, and ER/S106A mutants, but not the ER/S118A and ER/S167A mutants (Fig. 3BGo). S118A and ER/S167A also blocked the ability of dominant active src to induce tamoxifen activation of ERE2e1b-luciferase in HeLa cells (data not shown). Taken together, these data demonstrate that src kinase can mediate effects on ER-dependent gene transcription through phosphorylation of serine 118 as previously described (42) and also through phosphorylation at serine 167.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Src Kinase Induces Phosphorylation of Serines 118 and 167 of ER

A, HeLa cells (2 x 106 cells per plate) were transfected with ER (0.5 µg/plate). HeLa cells were incubated 24 h posttransfection with 1 µM SU6656 for 2 h. After incubation with the inhibitor the cells were incubated with 10–8 M estradiol (E2) for 30 min. Protein extract was prepared from HeLa cells and used for Western blot analysis to measure levels of phosphorylated serines 104/106, 118, and 167 on ER as described in Materials and Methods. Protein levels of total ER and ß-actin were used as loading controls. B, Mutation of serine 118 and serine 167 to alanine on ER inhibits dominant active src potentiation. HeLa cells (2 x 105 cells per well) were cotransfected with ERE2e1b-luciferase reporter (0.5 µg/well), either dominant active src (0.5 µg/well) (Dom) or empty vector pBABE (0.5 µg/well), and either wild-type ER or phosphorylation mutants ER/S104A, ER/S106A, ER/S118A, or ER/S167A (0.05 µg/well). Cells were incubated 24 h posttransfection with 10–8 M estradiol (E2) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol-incubated samples alone. C, The decrease in transcriptional activity of ER phosphorylation mutants was not due to ER expression levels. A portion of the extract used in panel B above was prepared for Western blot analysis for the detection of ER as described in Materials and Methods.

 
Inhibition of src Kinase Disrupts Interaction of ER with Endogenous Promoters
Previous work has established that src kinase increases serine 118 phosphorylation through activation of the ERK1/2 pathway in HeLa cells (42). However, there are no reports of src kinase modulating phosphorylation of ER serine 167, and no studies have examined regulation of ER signaling in endometrial-derived, tamoxifen-resistant cells. Because serine 167 is reported to regulate in vitro DNA binding by ER (17, 18, 19), the role of src kinase in ER interaction with endogenous promoters was assessed by chromatin immunoprecipitation (ChIP) assays. To assess several paradigms of ER-dependent gene expression, three promoter elements were examined: 5' consensus ERE on the pS2 promoter, the consensus ERE on the c-myc promoter (52), and the nonconsensus ERE on the c-myc promoter (33). In Ishikawa cells, estradiol and 4-hydroxytamoxifen increased ER recruitment to the ERE sequence in the pS2 promoter, and this ligand-dependent recruitment was blocked by coincubation with src kinase inhibitor SU6656 (Fig. 4Go, left panel). Conversely, SU6656 did not affect the well-characterized interaction of SP1 with the human (h) telomerase reverse transcriptase (TERT) promoter (53), demonstrating that the effect of SU6656 on ER was not a result of general inhibition of transcription factor binding to DNA (data not shown). Quantitative ChIP assays verified the increased promoter recruitment of ER by estradiol and 4-hydroxyamoxifen and the inhibition of this recruitment by SU6656 (Fig. 4Go, right panel). Identical results to those described in Fig. 4Go were found for the consensus ERE and the nonconsensus ERE on the c-myc promoter (supplemental Fig. 2 published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). These data indicate that src kinase modulates ligand-dependent ER promoter recruitment. Interestingly, estradiol resulted in quantitatively greater promoter recruitment of ER than 4-hydroxytamoxifen, an observation that has not been reported previously.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. The src Kinase Inhibitor SU6656 Disrupts ER Promoter Interaction Measured by ChIP

Ishikawa cells (2 x 106 cells per plate) were incubated with 1 µM SU6656 for 2 h. After incubation with the inhibitor the cells were incubated with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 2.5 h. Chromatin was prepared and immunoprecipitated with antibody against ER. The purified DNA was amplified by PCR and visualized by ethidium bromide staining (left panel). Relative levels of promoter interaction were measured by real time RT-PCR (right panel) using primers that span the ERE region of the pS2 gene as described in Materials and Methods. For quantitative ChIP assays, relative levels of promoter interaction were normalized to input, and each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- and 4-hydroxytamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples.

 
Src Kinase Partially Mediates Its Effect on ER-Dependent Transcription through Phosphoinositide 3-OH Kinase (PI3K)/AKT Kinase
Inhibition of AKT disrupts ER promoter interaction. Because src mediates its effects on ER through serine 167 phosphorylation, it was important to identify the downstream effectors of src that lead to altered serine 167 phosphorylation. Although src has been shown to activate AKT pathways (48) and in vitro phosphorylation of serine 167 by AKT has been reported (23, 24, 25), the connection between src kinase and serine 167 phosphorylation has not been demonstrated. Consequently, it was important to assess whether AKT could mediate src effects on ER-dependent gene transcription in Ishikawa cells. Western blot analysis revealed an increase in phospho-AKT when cells were incubated with estradiol and 4-hydroxytamoxifen (Fig. 5AGo left and right panel, lanes 3 and 5), and this induction was blocked by coincubation with SU6656 (Fig. 5AGo, left and right panel, lanes 4 and 6). To determine whether AKT inhibition would block the dominant active src potentiation of estradiol- and 4-hydroxytamoxifen-mediated gene transcription, Ishikawa cells were incubated with either a specific AKT inhibitor or an inhibitor of phosphoinositide 3-OH kinase (PI3K), a kinase upstream of AKT. Ishikawa cells were cotransfected with ERE2e1b-luciferase and dominant active src and incubated with wortmannin (PI3K inhibitor) or an AKT inhibitor alone or in combination with estradiol or 4-hydroxytamoxifen. Incubation with wortmannin or the AKT inhibitor completely blocked dominant active src potentiation of the estradiol and 4-hydroxytamoxifen-stimulated ERE2e1b-luciferase (Fig. 5BGo and C, lanes 8 and 12), suggesting that src kinase signals to ER through AKT. Control Western blots indicated that AKT activity was inhibited after incubation with PI3K inhibitor or the AKT inhibitor, and neither agent affected the constitutively active RSV-luciferase reporter in transfected Ishikawa cells (data not shown). To determine whether inhibition of AKT alters ER interaction with endogenous promoters, ChIP assays were performed in Ishikawa cells on the three promoter elements described in Fig. 4Go. The estradiol- and 4-hydroxytamoxifen-induced recruitment of ER to the ERE sequence in the pS2 was blocked by coincubation with wortmannin (Fig. 5DGo). Conversely, wortmannin did not affect SP1 interaction with the hTERT promoter (data not shown). Results identical to those described in Fig. 5Go were found for the consensus ERE and the nonconsensus ERE on the c-myc promoter (supplemental Fig. 3 published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Taken together, these data demonstrate that src kinase potentiates estradiol and 4-hydroxytamoxifen action by modulating ER promoter interaction via the PI3K/AKT pathway.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. Src Kinase Potentiation of ER-Dependent Transcription and Promoter Interaction Is Partially Mediated via the PI3K/AKT Pathway

A, Ishikawa cells (2 x 106 cells per plate) were incubated with 1 µM SU6656 for 2 h. After incubation with the inhibitor the cells were incubated with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 30 min. Protein extract was prepared from Ishikawa cells and used for Western blot analysis to measure levels of activated AKT as described in Materials and Methods. Quantitation of the Western blot signal was normalized to the Western blot signal for total AKT and ß-actin levels (right panel). Each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- and 4-hydroxytamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples. PI3K (panel B) or AKT (panel C) inhibition blocks the dominant active src potentiation of estradiol- and 4-hydroxytamoxifen-mediated gene transcription. Ishikawa cells (2 x 105 cells per well) were cotransfected with ERE2e1b-luciferase reporter (0.5 µg/well) and either dominant active src (0.5 µg/well) (Dom) or empty vector pBABE (0.5 µg/well). The cells were incubated 24 h posttransfection with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam). For the samples in which 1 µM wortmannin (WORT) or 10 µM AKT inhibitor (AKT INH) was used, the cells were incubated for 2 h with the inhibitor followed by incubation with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam). Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- and 4-hydroxytamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with estradiol and 4-hydroxytamoxifen in combination with dominant active src. D, Wortmannin disrupts ER promoter interaction. Ishikawa cells (2 x 106 cells per plate) were incubated with 1 µM wortmannin (WORT) for 2 h. After incubation with the inhibitor the cells were incubated with 10–8 M estradiol (E2) or 10–7 M 4-hydroxytamoxifen (Tam) for 2.5 h. Chromatin was prepared and immunoprecipitated with antibody against ER. The purified DNA was amplified by PCR and visualized by ethidium bromide staining (left panel) or relative levels of promoter interaction were measured by real time RT-PCR (right panel) using primers that span the ERE region of the pS2 gene (as described in Materials and Methods. For quantitative ChIP assays, relative levels of promoter interaction were normalized to input, and each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol- and 4-hydroxytamoxifen-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples.

 
Serine 167 of the ER Regulates Promoter Interaction by the Receptor
To directly investigate the role of ER phosphorylation in promoter interaction, quantitative ChIP assays were performed in ER-negative HeLa cells transfected with ER phosphorylation site mutants. HeLa cells were cotransfected with dominant active src and either wild-type ER, ER/S118A, or ER/S167A, and promoter interaction was measured as described above. There was a decrease in basal and estradiol-stimulated recruitment of ER/S167A to the pS2 promoter compared with wild-type ER and ER/S118A (Fig. 6Go). A previous report described a similar result for ER/S167A using in vitro interaction with a synthetic ERE sequence (19). Dominant active src increased basal level and estradiol-stimulated recruitment of wild type ER (Fig. 6Go, lanes 2 and 4) and ER/S118A (Fig. 6Go, lanes 6 and 8) to the pS2 promoter but had no effect on ER/S167A recruitment (Fig. 6Go, lanes 10 and 12). Similar results were found with the c-myc promoter (supplemental Fig. 4 published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). These results demonstrate that src kinase modulates ER promoter interaction through phosphorylation of serine 167. Interestingly, mutation of serine 118 to alanine had no effect on ER promoter interaction, suggesting that mechanisms other than DNA binding are responsible for regulation of ER signaling by serine 118 phosphorylation.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6. Src Kinase Modulates Promoter Interaction through Serine 167 Phosphorylation of ER

HeLa cells (2 x 106 cells per plate) were cotransfected with either dominant active src (0.5 µg/well) (Dom) or empty vector pBABE (3 µg/well) and either wild-type ER or phosphorylation mutants ER/S118A or ER/S167A (0.5 µg/well). The cells were incubated 24 h posttransfection with 10–8 M estradiol (E2) for 2.5 h. Chromatin was prepared and immunoprecipitated with antibody against ER. The purified DNA was amplified by real time RT-PCR using primers that span the ERE region of the pS2 gene, as described in Materials and Methods. Relative levels of promoter interaction were normalized to input, and each bar represents the mean value ± SD. *, P < 0.05 compared with estradiol-incubated samples alone. {dagger}, P < 0.05 compared with untreated (Con) samples.

 
Src Kinase Potentiates SRC-1 and CBP Transactivation in Endometrial-Derived Cell Lines
To measure the effects of src kinase on coactivator activity, SRC-1, SRC-2 (TIF-2/GRIP-1), SRC-3 (AIB-1/RAC-3/ACTR), p300-associated factor (PCAF), and CBP were fused to the GAL4-DNA-binding domain (DBD) expression plasmid and cotransfected with a Gal response element reporter (GalRE-luciferase) into Ishikawa and HEC-1A cells. All GAL constructs except GAL-PCAF activated GalRE-luciferase above activity of the GAL-DBD alone. When dominant active src or siRNA-src was cotransfected with the GAL-coactivator constructs, only GAL-SRC-1 and GAL-CBP transactivation function were both potentiated by dominant active src and inhibited by siRNA-src in Ishikawa cells (Fig. 7AGo). The effect of the src kinase inhibitor SU6656 on the GAL-coactivator activities was also assessed. The src inhibitor reduced GAL-SRC-1 and GAL-CBP activity but had no effect on GAL-SRC-2, GAL-SRC-3, and GAL-PCAF activity (Fig. 7BGo). These assays were performed in an additional endometrial-derived cell line, HEC1A. When the GAL-coactivator constructs were cotransfected with either the dominant active src or siRNA-src, only SRC-1 activity was potentiated with the dominant active src and repressed with the siRNA-src (Fig. 7CGo). Src kinase inhibitor SU6656 inhibited the activities of all the GAL-coactivator constructs, possibly through nonspecific effects because the GAL-DBD alone was also inhibited (Fig. 7CGo). Because src kinase selectively activated the p160 family coactivator SRC-1, it was of interest to determine whether specific SRC-1 phosphorylation sites were mediating the increased SRC-1 activity. Seven SRC-1 phosphorylation sites (26) were mutated to alanine (S372A, S395A, S517A, S569A, S1033A, and T1179A/S1185A), and each single phosphorylation site mutant was fused to the GAL4-DBD. Dominant active src kinase potentiated activity of each single-site SRC-1 phosphorylation mutant in both Ishikawa and HEC1A cells (data not shown). These findings argue against the notion that a single SRC-1 phosphorylation site mediates src kinase potentiation of SRC-1 activity, although the possibility of different combinations of sites was not examined. The preceding data confirm that src kinase specifically modulates the activity of SRC-1 and CBP in Ishikawa cells. Interestingly, CBP activity was not altered by src kinase in HEC1A cells, suggesting cell-specific targeting by src kinase (Fig. 7CGo).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7. Src Kinase Increases the Activity of SRC-1 and CBP

A and B, Ishikawa cells (2 x 105 cells per well) were cotransfected with GalRE-luciferase (0.5 µg/well), dominant active src (Dom) (0.5 µg/well), or siRNA-src (0.5 µg/well) and Gal-SRC-1, Gal-SRC-2, Gal-SRC-3, Gal-PCAF, Gal-CBP, or GAL-DBD (0.5 µg/well). standard luciferase assays were performed 48 h posttransfection on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with GAL-DBD. B, The samples receiving src kinase inhibitor 1 µM SU6656 (INH) were transfected with GalRE-luciferase and Gal-SRC-1, Gal-SRC-2, Gal-SRC-3, Gal-PCAF, Gal-CBP, or GAL-DBD (0.5 µg/well). the cells were incubated 24 h posttransfection with 1 µM SU6656 (INH) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with the GAL-DBD. C, Src kinase increases SRC-1 activity in HEC1A cells. HEC1A cells (2 x 105 cells per well) were cotransfected with GalRE-luciferase (0.5 µg/well), either dominant active src (Dom) (0.5 µg/well) or empty vector pBABE (0.5 µg/well), either siRNA-src (0.5 µg/well) or empty vector (0.5 µg/well), and either Gal-SRC-1, Gal-SRC-2, Gal-SRC-3, Gal-PCAF, Gal-CBP, or GAL-DBD (0.5 µg/well). For samples receiving the inhibitor, the cells were incubated 24 h posttransfection with 1 µM SU6656 (INH) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with the GAL-coactivator constructs alone.

 
Dominant Active src Kinase Potentiates the Coactivation Function of SRC-1 on ER-Dependent Gene Transcription
The experiments measuring the effect of src kinase on GAL-SRC-1 activity were performed in the absence of ER (as shown in Fig. 7Go). It was of interest to determine whether the src potentiation of SRC-1 activity contributed to the overall potentiation of ER-dependent transcription by src. To assess the SRC-1 contribution, SRC-1, ER, and ERE2e1b-luciferase were cotransfected in HeLa cells, and luciferase activity was measured. To specifically assess the contribution of SRC-1, the ER/S167A mutant, and not wild-type ER, was used because dominant active src does not potentiate the activity of this mutant in HeLa cells (see Fig. 3BGo). Therefore, any potentiation by dominant active src would be the result of SRC-1 coactivation and could not be attributed to ER. Although estradiol induced ER/S167A-dependent luciferase expression 2- to 3-fold relative to vehicle (Fig. 8AGo, lane 2), dominant active src kinase failed to potentiate the estradiol-stimulated luciferase expression (Fig. 8AGo, lane 4). HeLa cells express low levels of endogenous SRC-1 when compared with Ishikawa cells (data not shown). It was therefore likely that restoring SRC-1 levels in HeLa cells comparable to levels detected in Ishikawa cells might uncover a src kinase contribution to ER/S167A activity that occurred specifically through SRC-1. High efficiency transfection in HeLa cells resulted in SRC-1 levels comparable to levels detected in Ishikawa cells (data not shown). Basal level luciferase activity was increased 2-fold over vector-transfected cells, and SRC-1 coactivated estradiol-dependent reporter activation 5- to 6-fold over control (Fig. 8AGo, lanes 5–6). Only under conditions where SRC-1 was expressed did dominant active src potentiate reporter activation under both basal conditions (10- to 12-fold over control) and estradiol treatment (20-fold over control) (Fig. 8Go, lanes 7 and 8). These data confirm that src kinase elevation of SRC-1 activity contributes to the overall potentiation of ER-dependent gene transcription by specifically enhancing SRC-1 coactivation of ER.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8. Src Kinase Increases SRC-1 Coactivation on ER-Dependent Gene Transcription

HeLa cells (2 x 105 cells per well) were cotransfected with ER/S167A (0.05 µg/well), either dominant active src (Dom) (0.5 µg/well) or empty vector pBABE (0.5 µg/well), and either SRC-1 (0.5 µg/well) or empty vector pCR3.1 (0.5 µg /well). Cells were incubated 24 h posttransfection with 10–8 M estradiol (E2) for 24 h. Standard luciferase assays were performed on cell extracts in triplicate as described in Materials and Methods. Each bar represents the mean value ± SD. *, P < 0.05 compared with cells transfected with ER/S167A, dominant active src, and SRC-1. {dagger}, P < 0.05 compared with cells transfected with ER/S167A and SRC-1.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A major concern with tamoxifen therapy for breast cancer is acquired resistance as well as estrogen-like agonist action in the endometrium, resulting in an increased risk for development of endometrial cancer (35, 36, 54, 55). Tamoxifen resistance and tamoxifen agonist activity may result from the altered activity of cellular kinases that change the phosphorylation status of ER and coregulators. This study describes a mechanistic role of the nonreceptor tyrosine kinase, src, in promoting the agonist action of tamoxifen in the endometrium. In endometrial-derived Ishikawa cells, tamoxifen-dependent activation of reporter gene (ERE2e1b-luciferase) and endogenous gene (pS2, c-myc) transcription was inhibited or activated by using agents that reduce or elevate src kinase activity, respectively. The data demonstrated that src kinase modulates ER-dependent transcription by altering the phosphorylation of serines 118 and 167 of ER. Phosphorylation at serine 167 occurred via src-induced activation of the PI3K/AKT pathway, which, in turn, regulated promoter interaction at both consensus and nonconsesus EREs. Phosphorylation at serine 118 had no effect on ER promoter interaction. To our knowledge, this is the first report of the connection between activated src kinase and serine 167 phosphorylation of ER. This phosphorylation underlies a major mechanism for src kinase regulation of ER action by modulating ER interaction with endogenous promoters. Src kinase also elevated SRC-1 activity that was sufficient to enhance coactivation of the ER. Taken together, this report finds that src kinase potentiation of tamoxifen agonist action results from multiple phosphorylation and activity changes in receptor and coactivators rather than a single phosphorylation event in one protein.

When serine 118 or serine 167 was mutated to alanine, the transcriptional activity of ER was severely abrogated, and no src kinase-mediated potentiation of estradiol action was detected. However when these same ER mutants were assayed for promoter interaction by ChIP, only the serine 167 mutant exhibited a decrease in promoter interaction. These results indicate that although dephosphorylation at either site results in decreased ER-dependent transcription, the mechanisms through which each site regulates transcription are quite different. Previous reports and the present study have shown that phosphorylation of serine 167 promotes DNA binding (17, 18, 19), whereas serine 118 may have a role in coactivator binding. Dutertre and Smith (56) have shown that interaction of ER with SRC-1 or CBP is decreased when serines 104/106/118 are mutated to alanine. In addition Endoh et al. (57) has shown that phosphorylation at serine 118 increases the interaction of ER with p68 RNA helicase, providing direct evidence for serine 118 in coactivator binding. Thus, src kinase may affect two distinct modes of ER action: promoter recruitment and coactivator recruitment.

There is increasing evidence that bidirectional cross-talk between ER and cellular kinase pathways may lead to tamoxifen resistance (58, 59). We found an increased expression of activated src in tamoxifen-resistant endometrial cell lines when compared with tamoxifen-sensitive breast cancer cell lines (Fig. 1AGo). Furthermore, in HeLa cells in which tamoxifen is an antagonist (60, 61), increasing src activity promoted tamoxifen agonist action on gene transcription to a similar extent as estrogen treatment (supplemental Fig. 2). Although c-myc and pS2 genes where not induced by tamoxifen, transfection with a dominant active src promoted tamoxifen agonist action above that of the dominant active src alone. By comparison, incubation with src kinase inhibitor SU6656 further potentiated the antiestrogen effect of tamoxifen by reducing basal gene transcription. These findings suggest that src kinase may play an important role in the development of tamoxifen resistance.

In addition to receptor phosphorylation, src kinase impacts coactivator activity and increases SRC-1 coactivation of ER-dependent gene transcription (Figs. 7Go and 8Go). In Ishikawa cells, src kinase specifically enhanced SRC-1 and CBP activity but not the activities of SRC-2 (TIF-2/GRIP-1), SRC-3 (AIB-1/RAC-3/ACTR), and PCAF (Fig. 7Go, A and B). Src kinase-selective modulation of SRC-1 activity is interesting in light of a recent report by Shang and Brown (33), indicating that elevated SRC-1 in endometrial cancer cell lines was correlated with tamoxifen agonist activity when compared with breast cancer cell lines that express lower levels of SRC-1 and exhibit tamoxifen antagonist action. The authors further demonstrated that SRC-1, but not SRC-2 or SRC-3, was important for the tamoxifen agonist activity in Ishikawa cells. This report by Shang and Brown (33) and the present study suggest that SRC-1 is a key protein involved in tamoxifen agonist action in endometrium not only through elevated expression levels, but also as a selective target of src kinase pathways. These results, taken together with our recent finding of elevated src kinase activity in endometrium (44), suggest that SRC-1 may be a preferential substrate of src kinase in the endometrium possibly because of higher SRC-1 expression in this tissue.

CBP activity was also elevated by src kinase in a cell-specific manner. In Ishikawa cells, src kinase increased CBP activity (Fig. 7Go, A and B) whereas in HEC1A endometrial adenocarcinoma cells, CBP activity was not altered by src kinase (Fig. 7CGo). A number of proteins have been reported as substrates of src kinase (62, 63). Substrate specificity by src could simply be related to the relative expression levels of these substrates in a given tissue/cell line. It is likely that src kinase targets a distinct repertoire of coregulators in different tissues, and the effects of src on these coregulators could influence estrogen and tamoxifen signaling. This may also explain the differences between the present study examining coactivator activity in endometrial-derived cells and a previous report by Feng et al. (42) in which it was reported that src kinase increased the activities of SRC-2 (TIF-2/GRIP-1) and CBP in ER-negative HeLa cells.

Although src kinase increased the activity of SRC-1 and enhanced its coactivation function for the ER, no single SRC-1 phosphorylation site was responsible for the src potentiation of SRC-1 activity. Several possibilities may explain these results. Because all seven SRC-1 phosphorylation sites contain consensus sequences for serine/threonine-proline directed kinases (26), it is possible that only one or few kinases contribute to steady-state SRC-1 phosphorylation. In addition, six of seven SRC-1 sites can be phosphorylated in vitro by ERK-2 (26), a known downstream effector of src kinase (64). In this regard, it is likely that src kinase increases phosphorylation at multiple SRC-1 sites and that no single phosphorylation event is sufficient to reproduce the src kinase potentiation of ER-dependent gene transcription. Another possibility is that activation of src kinase mediates a dephosphorylation event on SRC-1 that is required for SRC-1 potentiation of tamoxifen agonist action. Finally, a different protein in the SRC-1 complex may be a direct or indirect substrate of src kinase. These possibilities are currently being assessed.

In summary, this report has demonstrated that multiple proteins and phosphorylation sites are substrates of src kinase during potentiation of tamoxifen agonist activity in endometrial-derived cells. The major mechanism by which src potentiates tamoxifen agonist action is likely through phosphorylation at serine 167 that stabilized interaction of ER with promoters of ER-dependent genes. Phosphorylation at ER serine 118 and phosphorylation of SRC-1 and possibly CBP also contribute to src potentiation of ER-dependent gene transcription (Fig. 9AGo). In the absence of src kinase activation, serine 167 phosphorylation is decreased, resulting in reduced ER promoter interaction. Dephosphorylation at serine 118 may lead to loss of other downstream transcriptional effects. Inhibition of src kinase also decreased the intrinsic activities of SRC-1 and CBP, further contributing to the reduction in ER-dependent gene transcription (Fig. 9BGo). Future work will focus on identifying the ER and coregulator phosphorylation fingerprints associated with tamoxifen agonist/antagonist effects on specific genes. These studies may provide the mechanistic groundwork for rational design of preclinical therapeutic strategies designed to inhibit src kinase to circumvent tamoxifen-resistant breast cancer and relieve the deleterious estrogen-like side effects of tamoxifen and other selective ER modulators in nontarget tissues.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 9. Model of src Kinase Potentiation of Estradiol- and 4-Hydroxytamoxifen-Dependent Gene Transcription

A, Activation of src kinase increases ERK1/2 and AKT activity that results in phosphorylation of ER on serines 118 and 167, respectively. Src kinase activation also increases the activity of coactivators SRC-1 and CBP through unknown pathways. B, In the absence of src kinase activation, serine 118 and 167 phosphorylation is decreased, resulting in reduced promoter interaction and transcriptional activity for ER. Inhibition of src kinase also decreases SRC-1 and CBP activity that is important for coactivation of estrogen- and tamoxifen-dependent gene transcription.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Lines
Ishikawa and HEC1A were grown at 37 C with 5% CO2 in DMEM (Cellgro, Herndon, VA) supplemented with 5% fetal bovine serum (FBS) (Life Technologies, Gaithersburg, MD) and 1% penicillin-streptomycin (Life Technologies). MCF-7 were grown at 37 C with 5% CO2 in DMEM supplemented with 10% FBS, 4 mM glutamine (Life Technologies), and 1% penicillin-streptomycin. HeLa cells were grown at 37 C with 5% CO2 in DMEM supplemented with 10% FBS, 4 mM glutamine, and 1% penicillin-streptomycin. T47D were grown at 37 C with 5% CO2 in RPMI 1640 (Life Technologies) supplemented with 10% FBS, 1% penicillin-streptomycin, and 5 µg/ml of insulin (Sigma Chemical Co., St. Louis, MO).

Plasmids
Mutagenesis of ER/S104A, ER/S106A, ER/S118A, and ER/S167A was performed using the Stratagene QuikChange Kit (Stratagene, La Jolla, CA). ER sequence and mutations were confirmed by DNA sequencing. ER-ABCD and ER-CDEF domain mutants were constructed by PCR amplifying nucleotides, which correspond to amino acids 1–302 for ABCD and 180–593 for CDEF. The resulting amplicons were subcloned into pCR3.1 vector. pBABE dominant active src (src Y527F) was a gift from Dr. Kavita Shah (Genomics Institute of the Novartis Research Foundation). SRC-1 and Gal-SRC-1 were constructed as previously described (27). Gal-SRC-2 and Gal-SRC-3 were gifts from Dr. Carolyn Smith (Baylor College of Medicine). Gal-SRC-1/S372A, Gal-SRC-1/S395A, Gal-SRC-1/S517A, Gal-SRC-1/S569A, Gal-SRC-1/S1033A, and Gal-SRC-1/T1179/S1185A were constructed by digesting pCR3.1-SRC-1/S372A, -SRC-1/S395A, -SRC-1/S517A, -SRC-1/S569A, -SRC-1/S1033A, and -SRC-1/T1179/S1185A at Acc1 sites and subcloning into Gal-SRC-1 expression vector. siRNA for c-src was constructed by annealing the sense oligo5'-GCAGACATA GAAGAGCCAATTCAAGAGATTGGCTC TTCTATGTCTGCTTTTTT-3' to the antisense oligo5'-AATTAAAAAAGCAGACATAGAAGAGCCAATCTCTTGAATTGGCTCTTCTATGTCTGCGGCC-3' and ligating the annealed oligos into the pSilencer 1.0 U6 vector (Ambion, Inc., Austin, TX).

Luciferase Assay
Ishikawa, HEC1A, or HeLa cells were plated in six-well plates (2 x 105 cells per well) and cultured in phenol red-free DMEM containing 2% FBS that was charcoal stripped to remove endogenous steroids. The cells were transfected with expression vector as indicated in the figure legends using Fugene transfection reagent (Roche Clinical Laboratories, Indianapolis, IN). The cells were incubated 24 h posttransfection with vehicle, estradiol (10–8 M) (Sigma), or 4-hydroxytamoxifen (10–7 M) (Sigma) for 24 h. In experiments in which 1 µM wortmannin (Upstate Biotechnology, Inc., Lake Placid, NY), 1 µM SU6656 (Calbiochem, La Jolla, CA), or 10 µM AKT inhibitor III (Calbiochem) was used, the cells were incubated for 2 h with the inhibitors followed by incubation with estradiol (10–8 M) and 4-hydroxytamoxifen (10–7 M) for 24 h. Luciferase expression was measured and normalized as described previously (51).

Real-Time RT-PCR
Ishikawa and HeLa cells were plated in 100-mm plates (2 x 106 cells per plate) in 2% stripped FBS in DMEM. Ishikawa cells were maintained in the stripped media for 3 d until 90% confluency. For HeLa cells, the cells were transfected 24 h post-plating with expression vector for hER (500 ng/plate), and dominant active src (3 µg/plate) or empty vector (3 µg/plate) and maintained in 2% stripped FBS in DMEM for an additional 48 h. The cells were incubated with vehicle, estradiol (10–8 M), or 4-hydroxytamoxifen (10–7 M) for 6 h. In experiments in which 1 µM SU6656 was used, the cells were incubated for 2 h with the inhibitor followed by incubation with estradiol (10–8 M) and 4-hydroxytamoxifen (10–7 M) for 6 h. Total mRNA was extracted from the cell pellet and reverse transcribed, and gene expression was measured by real-time RT-PCR as described previously (40). Briefly, total RNA was extracted using Trizol (Invitrogen, San Diego, CA) according to the manufacturer’s instructions. mRNA (200 ng) was reverse transcribed using Taqman Kit reagents (Applied Biosystems, Foster City, CA). Primers and probes for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed and manufactured by Applied Biosystems, and primers and probes for c-myc and pS2 were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA).

c-myc:

Forward (FWD)-5'-CGTCTCCACACATCAGCACAA-3'

Reverse (REV)-5'-TGTTGGCAGCAGGATAGTCCTT-3'

Probe-5'-56FAM/ACGCAGCGCCTCCCTCCACTC/3BHQ 1/-3'

pS2:

FWD-5'-CGTGAAAGACAGAATTGTGGTTTT-3'

REV-5'-CGTCGAAACAGCAGCCCTTA-3'

Probe-5'-/56FAM/ TGTCACGCCCTCCCAGTGTGCA/3BHQ-1/-3'

FWD primer, REV primer, and probe for c-myc, pS2, or GAPDH and Taqman Universal Master Mix (Applied Biosystems) were added to 200 ng cDNA. Real-time RT-PCR was performed using a GeneAmp 5700 Sequence Detection System (PerkinElmer Corp., Norwalk, CT).

ChIP Assay
Ishikawa and HeLa cells were plated in 100-mm plates (2 x 106 cells per plate) in 2% stripped FBS in DMEM. Ishikawa cells were maintained in the stripped media for 3 d until 90% confluent. Ishikawa cells were incubated with vehicle, estradiol (10–8 M), or 4-hydroxytamoxifen (10–7 M) for 2.5 h. In experiments in which 1 µM wortmannin or 1 µM SU6656 was used, the cells were incubated for 2 h with the inhibitor followed by incubation with estradiol (10–8 M) or 4-hydroxytamoxifen (10–7 M) for 2.5 h. Ishikawa cells were washed twice with ice-cold PBS and fixed with formaldehyde (1% final concentration) for 10 min at room temperature. The cells were washed twice with ice-cold PBS and then collected in 100 mM Tris-HCl (pH 9.0) and 10 mM dithiothreitol. Ishikawa cells were incubated at 30 C for 15 min. Cells were rinsed twice with ice-cold PBS, and a nuclear extraction was performed by swelling the cells on ice in 20 volumes of nuclei extraction buffer [5 mM piperazine-N,N'-bis 2-ethanesulfonic acid (pH 8.0), 85 mM KCl, 0.5% Nonidet P-40, and protease inhibitor cocktail (Sigma)] for 30 min. Nuclei were collected by centrifugation at 250 x g for 10 min. The nuclear pellet was washed once with nuclei extraction buffer and resuspended in 200 µl of ChIP lysis buffer [1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris-HCl (pH 8.1), and protease inhibitor cocktail]. For HeLa cells, the cells were transfected 24 h after plating with expression vector for either ER or ER phosphorylation mutants (500 ng/plate), and either dominant active src (3 µg/plate) or empty vector (3 µg/plate) and maintained in 2% stripped FBS in DMEM for an additional 48 h. The cells were incubated with vehicle, estradiol (10–8 M), or 4-hydroxytamoxifen (10–7 M) for 2.5 h. In experiments in which 1 µM SU6656 was used, the cells were incubated for 2 h with the inhibitor followed by incubation with estradiol (10–8 M) or 4-hydroxytamoxifen (10–7 M) for 2.5 h. HeLa cells were washed twice with ice-cold PBS and fixed with formaldehyde (1% final concentration) for 10 min at room temperature. The cells were washed twice with ice-cold PBS. The cells were then collected in 100 mM Tris-HCl (pH 9.0) and 10 mM dithiothreitol and incubated at 30 C for 15 min. After the 15-min incubation, the cells were rinsed twice with ice-cold PBS and lysed in ChIP lysis buffer. The soluble chromatin for Ishikawa and HeLa cells was sonicated three times for 10 sec at setting 4 (Fisher Sonic Dismembrator, model 550; Fisher Scientific, Pittsburgh, PA) and centrifuged at 20,000 x g for 15 min to remove cellular debris. The supernatant was diluted 10-fold in ChIP dilution buffer (1% Triton X-100; 2 mM EDTA; 150 mM NaCl; 20 mM Tris-HCl, pH 8.1; and protease cocktail inhibitor) followed by preclearing with 10 µl of normal mouse IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and 60 µl of a 50% gel slurry of protein A-sepharose beads (Amersham Biosciences, Arlington Heights, IL). The beads were prepared by reswelling in PBS and then blocking overnight in 0.1% BSA in PBS. To 1.5 ml of packed beads, 600 µg sonicated salmon sperm DNA and 1.5 mg BSA were added to a final volume of 3 ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 0.05% sodium azide, giving a final 50% gel slurry. After preclearing, the beads were microfuged for 1 min at 4000 x g and 20 µl supernatant were set aside for input. Anti-ER{alpha} D-12 antibody (10 µl) or SP1 antibody (Santa Cruz) was added to the supernatant, and the samples were immunoprecipitated overnight at 4 C. Precipitates were washed for 5 min each wash, first in low-salt buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1; 150 mM NaCl), and then in high-salt buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1; 500 mM NaCl), and finally in LiCl buffer (0.25 M LiCl; 1% Nonidet P-40; 1% deoxycholate; 1 mM EDTA; 10 mM Tris-HCl, pH 8.1). Precipitates were then washed three times for 5 min with TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA). Precipitated chromatin complexes were removed from the beads, and formaldehyde cross-linking was reversed by incubation for 6 h at 65 C in 100 µl of 1% SDS, 0.1 M NaHCO3 with vortexing several times throughout the incubation period. DNA was purified with a QIAquick Spin Kit (QIAGEN, Chatsworth, CA) according to manufacturer’s instructions. Extracted DNA (10 µl) was amplified using Accuprime taq polymerase (Invitrogen) and visualized by ethidium bromide-stained 1.5% agarose gels.

c-myc nonconsesus ERE region:

FWD-5'-AGGCGCGCGTAGTTAATTCAT-3'

REV-5'-CGCCCTCTGCTTTGGGA-3'

c-myc ERE region:

FWD-5'-GATCCTCTCTCGCTAATCTCC-3'

REV-5'-CGCTGAAATTACTACAGCGAG-3'

pS2 ERE region:

FWD-5'-GGCCATCTCTCACTATGAATCACTTCT-3'

REV-5'-GGCAGGCTCTGTTTGCTTAAAGAGCG-3'

HTERT SP1 region:

FWD-5'-TGCCCCTTCACCTTCCAG-3'

REV-5'-CAGCGCTGCCTGAAACTC-3

Quantitative ChIP Assays
Chromatin was prepared as described above. Extracted DNA (10 µl) was used in a real-time RT-PCR for the detection of c-myc and pS2 promoters.

c-myc nonconsesus ERE region:

FWD-5'-GGTAGGCGCGCGTAGTTAAT-3'

REV-5'-GGGCAGCCGAGCACTCT-3'

Probe-5'-56FAM/ATGCGGCTCTCTTACTCTGTTTACATCC TAGAGC/3BHQ-1/-3'

c-myc ERE region:

FWD-5'-GGCTTGGCGGGAAAAAGA-3'

REV-5'-GGGCAGCCGAGCACTCT-3'

Probe-5'-56FAM/ATGCGGCTCTCTTACTCTGTTTACATC CTAGAGC/3BHQ-1/-3'

pS2 ERE region:

FWD-5'-TCAGATCCCTCAGCCAAGATG-3'

REV-5'-TGGTCAAGCTACATGGAAGGATT-3'

Probe-5'-56FAM/CCTCACCACATGTCGTCTCTGTCT/3B HQ-1/-3'

Values were normalized to input samples.

Western Blot Analysis
Ishikawa and HeLa cells were plated and transfected as described above. For the detection of phospho-ER and phospho-AKT, Ishikawa cells were serum deprived for 24 h. After serum deprivation, the cells were stimulated by incubation with vehicle, estradiol (10–8 M), or 4-hydroxytamoxifen (10–7 M) for 30 min. In experiments in which 1 µM SU6656 was used, the cells were incubated for 2 h with the inhibitor followed by incubation with estradiol (10–8 M) and 4-hydroxytamoxifen (10–7 M) for 30 min. In experiments in which kinase inhibitor efficacy was assessed, Ishikawa cells were serum deprived for 24 h. After serum deprivation, cells were incubated with either vehicle, 1 µM SU6656, 1 µM wortmannin, or 10 µM AKT inhibitor, and then stimulated by incubation with FBS (20% final concentration) for 30 min. The cells were lysed in high-salt extraction buffer (10 mM Tris-HCl, pH 8; 0.4 M NaCl; 2 mM EDTA; 2 mM EGTA; 50 mM potassium phosphate; 50 mM sodium fluoride; 10 mM ß-mercaptoethanol; 0.1% Triton X-100; 0.2% protease inhibitor cocktail; and 0.1% phenylmethylsulfonyl fluoride). For detection of phospho-AKT and SRC-1 in Ishikawa cells, ER and SRC-1 in HeLa cells, and active src in MCF-7, T47D, HEC1A, and Ishikawa cells, whole-cell lysate was used by lysing the cells in high-salt extraction buffer. Whole-cell or nuclear lysates (50 µg) was prepared for Western blotting as previously described (44). Briefly, proteins were separated by electrophoresis on a SDS-PAGE gel. The gel was transferred to nitrocellulose membrane, and the membrane was blocked in 5% nonfat milk in Tris-buffered saline/Tween 20 (TBST) (10 mM Tris, pH 8; 150 mM NaCl; 0.1% Tween-20) for 1 h at room temperature, followed by washes with 1x TBST. The membranes were incubated with primary antibodies against ER (Novacastra), phospho-ER 104/106, phospho-ER 118, phospho-ER 167, non-phospho-527 src, phospho-AKT, AKT (Cell Signaling Technology, Beverly, MA) src (Upstate Biotechnology), and SRC-1 and ß-actin (Santa Cruz). After the primary antibody incubation, horseradish peroxidase-conjugated secondary antibody (Vector Laboratories, Inc., Burlingame, CA) was incubated for 1 h at room temperature in 5% nonfat milk in TBST. The signal was developed by addition of enhanced chemiluminescence solution. The membranes were exposed to Kodak XOMAT film (Eastman Kodak Co., Rochester, NY), and/or the signal from the membrane was quantitated using a Kodak Digital Science 1D image analysis software station 440 system.

Validation of siRNA-src
Ishikawa cells were plated in 100-mm plates (2 x 106 cells per plate) in 5% FBS in DMEM. Ishikawa cells were cultured until cells reached 90% confluency. Ishikawa were transfected with either siRNA-src or vector (20 µg/plate) using Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions. The cells were harvested 72 h posttransfection for Western blot analysis measuring src levels as described above.

Data Analysis
All data are expressed as ± SD. P values were calculated using ANOVA, Dunnett’s t test, and independent t test. P < 0.05 was considered significant.


    FOOTNOTES
 
This work was supported in part by National Institutes of Health Grant RO1 DK06832 (to B.G.R.) and by a Department of Defense Breast Cancer Research Program Idea Award (DAMD17-02-1-0531) and Career Development Award (DAMD17-02-1-0530) (to B.G.R.). Y.K.S. was supported by a Predoctoral Dissertation Award (DISS0100539) from the Susan G. Komen Breast Cancer Foundation.

First Published Online November 4, 2004

Abbreviations: ACTR, Activator of transcription of nuclear receptor; AIB-1, amplified in breast cancer 1; AP1, activator protein 1; CBP, cAMP response element-binding protein (CREB)-binding protein; ChIP, chromatin immunoprecipitation; DBD, DNA-binding domain; ER, estrogen receptor-{alpha}; ERE, estrogen-responsive element; FBS, fetal bovine serum; FWD, forward; GalRE, Gal response element; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GRIP, glucocorticoid receptor-interacting protein; NcoA1, nuclear coactivator-1; N-CoR, nuclear coreppressor; NTD, N-terminal domain; PCAF, p/300-associated factor; PI3K, phosphoinositide 3-OH kinase; RAC-3, receptor-associated coactivator 3; REV, reverse; RSV, rous sarcoma virus; SDS, sodium dodecyl sulfate; siRNA, short interfering RNA; SRC, steroid receptor coactivator; TBST, Tris-buffered saline/Tween 20; TERT, telomerase reverse transcriptase; TIF, transcriptional intermediary factor.

Received for publication July 23, 2004. Accepted for publication October 28, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Klinge CM 2001 Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res 29:2905–2919[Abstract/Free Full Text]
  2. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  3. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  4. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  5. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  6. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  7. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  8. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  9. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  10. Takeshita A, Yen PM, Misiti S, Cardona GR, Liu Y, Chin WW 1996 Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology 137:3594–3597[Abstract]
  11. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  12. Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H, Montminy M, Evans RM 1996 Role of CBP/P300 in nuclear receptor signalling. Nature 383:99–103[CrossRef][Medline]
  13. Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai MJ, O’Malley BW 1997 Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141–164; discussion 164–165
  14. Le Goff P, Montano MM, Schodin DJ, Katzenellenbogen BS 1994 Phosphorylation of the human estrogen receptor. Identification of hormone-regulated sites and examination of their influence on transcriptional activity. J Biol Chem 269:4458–4466[Abstract/Free Full Text]
  15. Lahooti H, White R, Danielian PS, Parker MG 1994 Characterization of ligand-dependent phosphorylation of the estrogen receptor. Mol Endocrinol 8:182–188[Abstract/Free Full Text]
  16. Ali S, Metzger D, Bornert JM, Chambon P 1993 Modulation of transcriptional activation by ligand-dependent phosphorylation of the human oestrogen receptor A/B region. EMBO J 12:1153–1160[Medline]
  17. Tzeng DZ, Klinge CM 1996 Phosphorylation of purified estradiol-liganded estrogen receptor by casein kinase II increases estrogen response element binding but does not alter ligand stability. Biochem Biophys Res Commun 223:554–560[CrossRef][Medline]
  18. Castano E, Vorojeikina DP, Notides AC 1997 Phosphorylation of serine-167 on the human oestrogen receptor is important for oestrogen response element binding and transcriptional activation. Biochem J 326:149–157
  19. Arnold SF, Obourn JD, Jaffe H, Notides AC 1995 Phosphorylation of the human estrogen receptor by mitogen-activated protein kinase and casein kinase II: consequence on DNA binding. J Steroid Biochem Mol Biol 55:163–172[CrossRef][Medline]
  20. Bunone G, Briand PA, Miksicek RJ, Picard D 1996 Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J 15:2174–2183[Medline]
  21. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, Masushige S, Gotoh Y, Nishida E, Kawashima H 1995 Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270:1491–1494.[Abstract/Free Full Text]
  22. Lannigan DA 2003 Estrogen receptor phosphorylation. Steroids 68:1–9[CrossRef][Medline]
  23. Sun M, Paciga JE, Feldman RI, Yuan Z, Coppola D, Lu YY, Shelley SA, Nicosia SV, Cheng JQ 2001 Phosphatidylinositol-3-OH kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor {alpha} (ER{alpha}) via interaction between ER{alpha} and PI3K. Cancer Res 61:5985–5991[Abstract/Free Full Text]
  24. Martin MB, Franke TF, Stoica GE, Chambon P, Katzenellenbogen BS, Stoica BA, McLemore MS, Olivo SE, Stoica A 2000 A role for Akt in mediating the estrogenic functions of epidermal growth factor and insulin-like growth factor I. Endocrinology 141:4503–4511[Abstract/Free Full Text]
  25. Campbell RA, Bhat-Nakshatri P, Patel NM, Constantinidou D, Ali S, Nakshatri H 2001 Phosphatidylinositol 3-kinase/AKT-mediated activation of estrogen receptor {alpha}: a new model for anti-estrogen resistance. J Biol Chem 276:9817–9824[Abstract/Free Full Text]
  26. Rowan BG, Weigel NL, O’Malley BW 2000 Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen-activated protein kinase pathway. J Biol Chem 275:4475–4483[Abstract/Free Full Text]
  27. Rowan BG, Garrison N, Weigel NL, O’Malley BW 2000 8-Bromo-cyclic AMP induces phosphorylation of two sites in SRC-1 that facilitate ligand-independent activation of the chicken progesterone receptor and are critical for functional cooperation between SRC-1 and CREB binding protein. Mol Cell Biol 20:8720–8730[Abstract/Free Full Text]
  28. Font dM, Brown M 2000 AIB1 is a conduit for kinase-mediated growth factor signaling to the estrogen receptor. Mol Cell Biol 20:5041–5047[Abstract/Free Full Text]
  29. Lopez GN, Turck CW, Schaufele F, Stallcup MR, Kushner PJ 2001 Growth factors signal to steroid receptors through mitogen-activated protein kinase regulation of p160 coactivator activity. J Biol Chem 276:22177–22182[Abstract/Free Full Text]
  30. Wagner BL, Norris JD, Knotts TA, Weigel NL, McDonnell DP 1998 The nuclear corepressors NCoR and SMRT are key regulators of both ligand- and 8-bromo-cyclic AMP-dependent transcriptional activity of the human progesterone receptor. Mol Cell Biol 18:1369–1378[Abstract/Free Full Text]
  31. Hong SH, Privalsky ML 2000 The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export. Mol Cell Biol 20:6612–6625[Abstract/Free Full Text]
  32. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, Del Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  33. Shang Y, Brown M 2002 Molecular determinants for the tissue specificity of SERMs. Science 295:2465–2468[Abstract/Free Full Text]
  34. Jepsen K, Hermanson O, Onami TM, Gleiberman AS, Lunyak V, McEvilly RJ, Kurokawa R, Kumar V, Liu F, Seto E, Hedrick SM, Mandel G, Glass CK, Rose DW, Rosenfeld MG 2000 Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753–763[CrossRef][Medline]
  35. Harper MJ, Walpole AL 1967 A new derivative of triphenylethylene: effect on implantation and mode of action in rats. J Reprod Fertil 13:101–119
  36. Terenius L 1971 Structure-activity relationships of anti-oestrogens with regard to interaction with 17-ß-oestradiol in the mouse uterus and vagina. Acta Endocrinol (Copenh) 66:431–447[Abstract/Free Full Text]
  37. Sakamoto T, Eguchi H, Omoto Y, Ayabe T, Mori H, Hayashi S 2002 Estrogen receptor-mediated effects of tamoxifen on human endometrial cancer cells. Mol Cell Endocrinol 192:93–104[CrossRef][Medline]
  38. Kleinman D, Karas M, Danilenko M, Arbell A, Roberts CT, LeRoith D, Levy J, Sharoni Y 1996 Stimulation of endometrial cancer cell growth by tamoxifen is associated with increased insulin-like growth factor (IGF)-I induced tyrosine phosphorylation and reduction in IGF binding proteins. Endocrinology 137:1089–1095[Abstract]
  39. Anzai Y, Holinka CF, Kuramoto H, Gurpide E 1989 Stimulatory effects of 4-hydroxytamoxifen on proliferation of human endometrial adenocarcinoma cells (Ishikawa line). Cancer Res 49:2362–2365[Abstract/Free Full Text]
  40. Kershah SM, Desouki MM, Koterba KL, Rowan BG 2004 Expression of estrogen receptor coregulators in normal and malignant human endometrium. Gynecol Oncol 92:304–313[CrossRef][Medline]
  41. Lee H, Jiang F, Wang Q, Nicosia SV, Yang J, Su B, Bai W 2000 MEKK1 activation of human estrogen receptor {alpha} and stimulation of the agonistic activity of 4-hydroxytamoxifen in endometrial and ovarian cancer cells. Mol Endocrinol 14:1882–1896[Abstract/Free Full Text]
  42. Feng W, Webb P, Nguyen P, Liu X, Li J, Karin M, Kushner PJ 2001 Potentiation of estrogen receptor activation function 1 (AF-1) by Src/JNK through a serine 118-independent pathway. Mol Endocrinol 15:32–45[Abstract/Free Full Text]
  43. Reissig D, Clement J, Sanger J, Berndt A, Kosmehl H, Bohmer FD 2001 Elevated activity and expression of Src-family kinases in human breast carcinoma tissue versus matched non-tumor tissue. J Cancer Res Clin Oncol 127:226–230[CrossRef][Medline]
  44. Desouki MM, Rowan BG 2004 SRC kinase and mitogen-activated protein kinases in the progression from normal to malignant endometrium. Clin Cancer Res 10:546–555[Abstract/Free Full Text]
  45. Irby RB, Yeatman TJ 2000 Role of Src expression and activation in human cancer. Oncogene 19:5636–5642[CrossRef][Medline]
  46. Thomas SM, Brugge JS 1997 Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol 13:513–609[CrossRef][Medline]
  47. Abram CL, Courtneidge SA 2000 Src family tyrosine kinases and growth factor signaling. Exp Cell Res 254:1–13[CrossRef][Medline]
  48. Krasilnikov MA 2000 Phosphatidylinositol-3 kinase dependent pathways: the role in control of cell growth, survival, and malignant transformation. Biochemistry (Mosc) 65:59–67[Medline]
  49. Dubik D, Shiu RP 1992 Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7:1587–1594[Medline]
  50. Stack G, Kumar V, Green S, Ponglikitmongkol M, Berry M, Rio MC, Nunez AM, Roberts M, Koehl C, Bellocq P 1988 Structure and function of the pS2 gene and estrogen receptor in human breast cancer cells. Cancer Treat Res 40:185–206[Medline]
  51. Coleman KM, Dutertre M, El Gharbawy A, Rowan BG, Weigel NL, Smith CL 2003 Mechanistic differences in the activation of estrogen receptor-{alpha} (ER{alpha})- and ERß-dependent gene expression by cAMP signaling pathway(s). J Biol Chem 278:12834–12845[Abstract/Free Full Text]
  52. Liu XF, Bagchi MK 2004 Recruitment of distinct chromatin-modifying complexes by tamoxifen-complexed estrogen receptor at natural target gene promoters in vivo. J Biol Chem 279:15050–15058[Abstract/Free Full Text]
  53. Won J, Yim J, Kim TK 2002 Sp1 and Sp3 recruit histone deacetylase to repress transcription of human telomerase reverse transcriptase (hTERT) promoter in normal human somatic cells. J Biol Chem 277:38230–38238[Abstract/Free Full Text]
  54. Fornander T, Rutqvist LE, Cedermark B, Glas U, Mattsson A, Silfversward C, Skoog L, Somell A, Theve T, Wilking N 1989 Adjuvant tamoxifen in early breast cancer: occurrence of new primary cancers. Lancet 1:117–120[Medline]
  55. Fisher B, Costantino JP, Redmond CK, Fisher ER, Wickerham DL, Cronin WM 1994 Endometrial cancer in tamoxifen-treated breast cancer patients: findings from the National Surgical Adjuvant Breast and Bowel Project (NSABP) B-14. J Natl Cancer Inst 86:527–537[Abstract/Free Full Text]
  56. Dutertre M, Smith CL 2003 Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-{alpha}: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol 17:1296–1314[Abstract/Free Full Text]
  57. Endoh H, Maruyama K, Masuhiro Y, Kobayashi Y, Goto M, Tai H, Yanagisawa J, Metzger D, Hashimoto S, Kato S 1999 Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor {alpha}. Mol Cell Biol 19:5363–5372[Abstract/Free Full Text]
  58. Nicholson RI, McClelland RA, Robertson JF, Gee JM 1999 Involvement of steroid hormone and growth factor cross-talk in endocrine response in breast cancer. Endocr Relat Cancer 6:373–387[Abstract]
  59. Schiff R, Massarweh S, Shou J, Osborne CK 2003 Breast cancer endocrine resistance: how growth factor signaling and estrogen receptor coregulators modulate response. Clin Cancer Res 9:447S–454S
  60. Smith CL, Conneely OM, O’Malley BW 1993 Modulation of the ligand-independent activation of the human estrogen receptor by hormone and antihormone. Proc Natl Acad Sci USA 90:6120–6124[Abstract/Free Full Text]
  61. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  62. Courtneidge SA 2003 Isolation of novel Src substrates. Biochem Soc Trans 31:25–28[Medline]
  63. Brown MT, Cooper JA 1996 Regulation, substrates and functions of src. Biochim Biophys Acta 1287:121–149[Medline]
  64. Schlaepfer DD, Jones KC, Hunter T 1998 Multiple Grb2-mediated integrin-stimulated signaling pathways to ERK2/mitogen-activated protein kinase: summation of both c-Src- and focal adhesion kinase-initiated tyrosine phosphorylation events. Mol Cell Biol 18:2571–2585[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα
Coregulators:   P/CAF  |  p300  |  SRC-1  |  GRIP1  |  AIB1  |  NCOR
Ligands:   17β-Estradiol



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
M. B. Miranda, R. L. Redner, and D. E. Johnson
Inhibition of Src family kinases enhances retinoic acid induced gene expression and myeloid differentiation
Mol. Cancer Ther., December 1, 2007; 6(12): 3081 - 3090.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. L. Weigel and N. L. Moore
Steroid Receptor Phosphorylation: A Key Modulator of Multiple Receptor Functions
Mol. Endocrinol., October 1, 2007; 21(10): 2311 - 2319.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. A. Kazi and R. D. Koos
Estrogen-Induced Activation of Hypoxia-Inducible Factor-1{alpha}, Vascular Endothelial Growth Factor Expression, and Edema in the Uterus Are Mediated by the Phosphatidylinositol 3-Kinase/Akt Pathway
Endocrinology, May 1, 2007; 148(5): 2363 - 2374.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. H. Al-Dhaheri and B. G. Rowan
Protein Kinase A Exhibits Selective Modulation of Estradiol-Dependent Transcription in Breast Cancer Cells that Is Associated with Decreased Ligand Binding, Altered Estrogen Receptor {alpha} Promoter Interaction, and Changes in Receptor Phosphorylation
Mol. Endocrinol., February 1, 2007; 21(2): 439 - 456.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Cui, I. Parra, M. Zhang, S. G. Hilsenbeck, A. Tsimelzon, T. Furukawa, A. Horii, Z.-Y. Zhang, R. I. Nicholson, and S. A.W. Fuqua
Elevated Expression of Mitogen-Activated Protein Kinase Phosphatase 3 in Breast Tumors: A Mechanism of Tamoxifen Resistance
Cancer Res., June 1, 2006; 66(11): 5950 - 5959.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Vivacqua, D. Bonofiglio, A. G. Recchia, A. M. Musti, D. Picard, S. Ando, and M. Maggiolini
The G Protein-Coupled Receptor GPR30 Mediates the Proliferative Effects Induced by 17{beta}-Estradiol and Hydroxytamoxifen in Endometrial Cancer Cells
Mol. Endocrinol., March 1, 2006; 20(3): 631 - 646.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Osipo, K. Meeke, H. Liu, D. Cheng, S. Lim, A. Weichel, and V. C. Jordan
Trastuzumab Therapy for Tamoxifen-Stimulated Endometrial Cancer
Cancer Res., September 15, 2005; 65(18): 8504 - 8513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures and Legends
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shah, Y. M.
Right arrow Articles by Rowan, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shah, Y. M.
Right arrow Articles by Rowan, B. G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*L-SERINE
*TAMOXIFEN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals