Molecular Endocrinology, doi:10.1210/me.2004-0227
Molecular Endocrinology 19 (4): 1035-1048
Copyright © 2005 by The Endocrine Society
Role of G Protein-Coupled Receptor Kinases in the Homologous Desensitization of the Human and Mouse Melanocortin 1 Receptors
Jesús Sánchez-Más,
Lidia A. Guillo,
Paola Zanna,
Celia Jiménez-Cervantes and
José C. García-Borrón
Department of Biochemistry and Molecular Biology (J.S.-M., C.J.-C., J.C.G.-B.), School of Medicine, University of Murcia, 30100 Murcia, Spain; Department of Physiological Sciences (L.A.G.), Institute of Biological Sciences, Federal University of Goiás, 74001-970 Goiania, Brazil; and Department of Medical Biochemistry and Medical Biology (P.Z.), School of Medicine, University of Bari, 70124 Bari, Italy
Address all correspondence and requests for reprints to: J. C. García-Borrón, Department of Biochemistry and Molecular Biology, School of Medicine, University of Murcia, Murcia 30100, Spain. E-mail: gborron{at}um.es.
 |
ABSTRACT
|
|---|
The melanocortin 1 receptor, a G protein-coupled receptor positively coupled to adenylyl cyclase, is a key regulator of epidermal melanocyte proliferation and differentiation and a determinant of human skin phototype and skin cancer risk. Despite its potential importance for regulation of pigmentation, no information is available on homologous desensitization of this receptor. We found that the human melanocortin 1 receptor (MC1R) and its mouse ortholog (Mc1r) undergo homologous desensitization in melanoma cells. Desensitization is not dependent on protein kinase A, protein kinase C, calcium mobilization, or MAPKs, but is agonist dose-dependent. Both melanoma cells and normal melanocytes express two members of the G protein-coupled receptor kinase (GRK) family, GRK2 and GRK6. Cotransfection of the receptor and GRK2 or GRK6 genes in heterologous cells demonstrated that GRK2 and GRK6 impair agonist-dependent signaling by MC1R or Mc1r. However, GRK6, but not GRK2, was able to inhibit MC1R agonist-independent constitutive signaling. Expression of a dominant negative GRK2 mutant in melanoma cells increased their cAMP response to agonists. Agonist-stimulated cAMP production decreased in melanoma cells enriched with GRK6 after stable transfection. Therefore, GRK2 and GRK6 seem to be key regulators of melanocortin 1 receptor signaling and may be important determinants of skin pigmentation.
 |
INTRODUCTION
|
|---|
THE FIVE MELANOCORTIN receptors (MCRs) known to date form a subfamily of the seven transmembrane-fragment G protein-coupled receptors (GPCRs) superfamily. MCRs regulate a wide variety of processes, including skin pigmentation, adrenal gland function, feeding and energy homeostasis, sexual function, and others (1, 2, 3). All MCRs are positively coupled to adenylyl cyclase via the Gs protein. The melanocortin 1 receptor (MC1R) is expressed preferentially in epidermal melanocytes and is a key regulator of mammalian pigmentation (4, 5). Its activation by the proopiomelanocortin-derived
-MSH and ACTH stimulates the rate-limiting enzyme in melanin synthesis, tyrosinase. MC1R activation also increases the ratio of the black and strongly photoprotective eumelanins to the yellowish and poorly photoprotective pheomelanin pigments (5, 6, 7). These actions are mediated by cAMP-dependent activation of protein kinase A (PKA) (8), although multiple signaling including activation of protein kinase C (PKC) (9) and MAPKs (8, 10) has been proposed.
In mice, the gene coding for Mc1r maps to the extension locus (11, 12), for which several natural alleles have been found. The recessive yellow (e) loss-of-function allele is causally associated with a yellow, pheomelanic phenotype. Conversely, the gain-of-function somber (Eso and Eso-3J) and tobacco (Etob) alleles are associated with darker eumelanic coats (12). Human MC1R is highly polymorphic, and several variants are associated with fair skin, red hair (13, 14, 15, 16), a high number of freckles (17), and increased skin cancer risk (16, 18, 19, 20, 21). Mouse Mc1r and human MC1R are relatively small GPCRs with 315 and 317 amino acids, respectively. Despite their similar structures, they display quite different functional properties. MC1R is activated equally well by ACTH and
-MSH. Conversely, Mc1r discriminates efficiently between
-MSH and the less potent ACTH (11, 22, 23). Moreover, MC1R displays a stronger agonist-independent constitutive activity than mouse Mc1r (23).
For most GPCRs, signaling activity is tightly regulated to ensure that agonist binding elicits an intracellular response of appropriate duration and magnitude, and that the various signals reaching the cell membrane are adequately integrated. Different levels of regulation of the melanocortin 1 receptors have been described. In human melanocytes, MC1R mRNA is up-regulated by a variety of hormones and paracrine factors, including
-MSH (24). Interestingly, the response of human melanoma cells to long treatments with various melanocortins is heterogeneous: certain melanoma cell lines display a strong up-regulation of the number of binding sites after 2 d of treatment, whereas others show a moderate decrease in receptor density or are unresponsive (25). In mouse melanocytes,
-MSH and its antagonist agouti signal protein influence the structure of the 5' untranslated region of Mc1r mRNA, and the melanocortin also up-regulates mRNA and protein levels (26). Moreover, UV radiation moderately and transiently down-regulates MC1R mRNA in human melanocytes but up-regulates Mc1r at the mRNA and protein levels in mouse melanoma cells (24, 27). These regulatory mechanisms are slow and operate mainly at the transcriptional level.
However, there are no data on other regulatory processes mediating a faster modulation of the signaling activity of preexisting receptor molecules. For most GPCRs, signaling is strongly reduced within minutes of agonist exposure. This process is termed homologous desensitization (28, 29). On the other hand, in heterologous desensitization the signaling activity of a receptor is attenuated by agents acting on different, unrelated receptors. Heterologous and homologous desensitization involve receptor phosphorylation by two classes of serine/threonine kinases: the second-messenger activated kinases such as PKA or PKC, and a family of specific kinases termed GPCR kinases (GRKs) (28, 29). GRKs specifically recognize and phosphorylate agonist-occupied GPCRs. Phosphorylated receptors then become unable to couple to their transduction pathways. Moreover, receptor phosphorylation is most often followed by internalization and contributes to trigger new signals via activation of cytosolic kinases (29, 30, 31, 32).
Our aim was to study and compare the desensitization behavior of human MC1R and mouse Mc1r. We used melanoma cells of defined genotype and heterologous cells transfected with the wild-type genes. We show, for the first time, that the melanocortin 1 receptors are desensitized upon exposure to melanocortins. Our data point to GRK2 and GRK6 as the kinases involved in this homologous desensitization process.
 |
RESULTS
|
|---|
Human and Mouse Melanocortin 1 Receptors Exhibit a Similar Agonist-Induced Desensitization Pattern
The effect of continuous exposure to melanocortin 1 receptor agonists on intracellular cAMP levels was analyzed. We used HBL (human) and B16 (mouse) melanoma cells as appropriate models, because these cell lines have been widely used to study melanocortin 1 receptor function. Moreover, HBL cells are homozygous for wild-type MC1R and express several thousands of receptors per cell (23, 33). B16 melanoma cells are also homozygous for wild-type Mc1r and display approximately 20,000
-MSH binding sites per cell (34). The study was performed with two agonists, ACTH139 (Fig. 1A
) and the
-MSH analog norleucine4 D-phenylalanine7-MSH (NDP-MSH) (Fig. 1B
). This synthetic melanocortin was used instead of the natural hormone
-MSH because it displays a higher resistance to proteolysis and is therefore suitable for longer incubation times. Continuous exposure to both agonists desensitized human MC1R and mouse Mc1r with similar kinetics. In the absence of phosphodiesterase (PDE) inhibitors, maximal levels of cAMP were obtained after 30 min of agonist treatment. Desensitization was evident by 1 h and gradually progressed up to 3 h, with reductions of cAMP levels to about 2030% of the maximal values for HBL cells, and lower for B16 cells. In HBL cells, signaling remained inhibited for up to 24 h (data not shown). LND1 human melanoma cells, also homozygous for wild-type MC1R, exhibited the same trend (data not shown). According to this kinetics, the concentration of cAMP at 30 min and 3 h was routinely measured in additional experiments.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1. Desensitization of the Endogenous Melanocortin 1 Receptors in Human (HBL) and Mouse (B16) Melanoma Cells in Response to Melanocortins
A and B, Evolution of cAMP level in human HBL (open bars) and mouse B16 (filled bars) melanoma cells continuously exposed to agonists. Cells were serum-deprived for 24 h before stimulation with 107 M ACTH (A) or NDP-MSH (B) for the times shown. C, Evolution of cAMP levels in HBL human melanoma cells treated with forskolin (105 M) for times ranging from 30 min to 6 h. D, Forskolin-mediated cAMP synthesis is not dependent on desensitization of melanocortin receptors. HBL cells (open bars) and B16 cells (filled bars) were pretreated for 3 h with 107 M NDP-MSH, before additional stimulation with 105 M forskolin for 30 min or 3 h, as indicated. E, Attenuation of cAMP formation in HBL cells pretreated with NDP-MSH. Cells were preexposed for 15 min to 107 M NDP-MSH, washed twice with serum-free culture medium, and rechallenged with the same concentration of agonist before determination of their cAMP contents at the times shown. For all panels, data are given as mean ± SEM (n = 4 or 6). C, Control.
|
|
We verified that the drop in cAMP was not due primarily to postreceptor responses. cAMP levels were measured in HBL cells after different times of treatment with the adenylyl cyclase activator forskolin (Fig. 1C
). After 30-min treatment, cAMP concentrations were approximately 10-fold higher than those achieved by agonists, and remained roughly stable for up to 6 h. Moreover, HBL cells pretreated for 3 h with NDP-MSH still responded to forskolin with a potent increase in cAMP levels (Fig. 1D
). These results exclude down-regulation of adenylyl cyclase as the main cause of the drops of cAMP levels observed in the continuous presence of the agonist. On the other hand, it has been demonstrated that activation of PKA after cAMP leads to phosphorylation and activation of certain PDE isoenzymes responsible for cAMP hydrolysis (reviewed in Ref.35). Thus, PKA-mediated activation of PDEs is part of the cellular mechanisms of down-regulation of cAMP signaling and can mimic, at least partially, receptor desensitization. In our experimental protocol, a contribution of PDE activation to the drop of cAMP cannot be ruled out, particularly for long incubation times. Therefore, we wished to validate our approach by analyzing MC1R desensitization using a standard protocol. Because the behavior of the human and mouse receptor was very similar, according to the previous data, this series of experiments were performed only with MC1R (Fig. 1E
). HBL cells were pretreated for 15 min with 107 M NDP-MSH in the absence of PDE inhibitors, washed twice, and rechallenged under identical conditions. Their cAMP contents were measured for times ranging from 10 min to 3 h. cAMP levels were lower in pretreated cells throughout the time course of the experiment, with maximal values less than 50% of nonpretreated controls. Therefore, preexposure to the agonist caused a marked attenuation of cAMP formation by a second agonist challenge, consistent with MC1R desensitization.
Desensitization of the Melanocortin 1 Receptor Is Independent of PKA, MAPK, Ca2+ Mobilization, and PKC
The MCRs may display multiple signaling involving primarily the cAMP/PKA pathway, but also other kinases such as PKC, Ca2+-activated kinases (9), and MAPKs (8, 10). We studied the possible effects of these kinases on receptor desensitization by pretreating melanoma cells with specific inhibitors or activators, before stimulation with 107 M NDP-MSH. In a first set of experiments, HBL and B16 cells were pretreated with the PKA inhibitor H-89 (at a final concentration of 0.1 µM that blocked 70% of the forskolin-mediated activation of tyrosinase in HBL cells), the Ca2+ channel blocker verapamil, and the MAPK inhibitor PD 98,059 (Fig. 2
). These inhibitors did not block or impair desensitization of human MC1R or mouse Mc1r. The only statistically significant change in cells pretreated with the kinase inhibitors was a small increase of the maximal response in the presence of the MAPK inhibitor PD 98,059, which was not analyzed further. A possible role of PKC was analyzed in deeper detail, because this kinase has been shown to stimulate pigmentation in cultured human melanocytes and to participate in the pigmentogenic response to UV radiation (reviewed in Ref.36), which is also a major regulator of receptor expression (24, 27). We used two protein kinase inhibitors, staurosporine and Ro-318425. Staurosporine is a broad spectrum inhibitor that, at nanomolar concentrations, inhibits CaM kinase, myosin light chain kinase, PKA, and PKG, in addition to PKC. Ro-318425 is a selective inhibitor of the different PKC isoenzymes. Treatment of HBL or B16 melanoma cells with these inhibitors failed to affect NDP-MSH-dependent cAMP evolution, at least for 30 min and 3 h treatment times (Fig. 3
). Melanoma cells were also treated with 12-O-tetradecanoylphorbol-13-acetate (TPA) for 30 min, before stimulation with the agonist. Under these conditions PKC should be fully activated, but no effect on desensitization was observed (Fig. 3C
). Treatment of the cells with TPA for 24 h, which likely results in PKC down-regulation, was also without effect (data not shown). LND1 human melanoma cells also exhibited a normal pattern of cAMP evolution in the presence of staurosporine and Ro-318425 (data not shown). Accordingly, the classical second messenger-activated protein kinases, particularly PKA and PKC, do not seem involved in the desensitization of MC1R or Mc1r.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2. Lack of Involvement of PKA, MAPKs, and Calcium-Activated Kinases in MC1R and Mc1r Desensitization
HBL (A) and B16 (B) cells were pretreated for 1 h with the PKA inhibitor H-89 (final concentration, 0.1 µM in the culture medium), the calcium channel blocker verapamil (2 h, 1 µM), or the specific MAPK inhibitor PD 98,059 (30 min, 10 µM) before stimulation with NDP-MSH (107 M). cAMP levels in control nonstimulated cells (open bars) and in cells stimulated for 30 min (hatched bars) or 3 h (filled bars) were measured. Data are means ± SEM (n = 4). *, P < 0.05.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3. PKC Is Not Required for MC1R and Mc1r Desensitization
A, HBL cells were pretreated for 1 h with the PKC inhibitors Ro-318425 (final concentration, 5 nM) or staurosporine (30 nM) before stimulation with a saturating concentration of NDP-MSH (107 M). cAMP levels in nonstimulated cells (open bars) and in cells stimulated for 30 min (hatched bars) or 3 h (filled bars) were measured. Control refers to cells that were not submitted to a previous treatment with the PKC inhibitors. B, Same as in A, but experiments were performed with B16 mouse melanoma cells. C, HBL (open bars) and B16 (filled bars) cells were pretreated with 0.5 µM TPA for 30 min before stimulation with NDP-MSH for the times shown and measurement of cAMP. Data are means ± SEM (n = 4 or 6).
|
|
The inability of the second messenger-regulated kinases to desensitize the melanocortin 1 receptors suggested that receptor adaptation could be mediated by a protein of the GRK family. One distinctive feature of this family of protein kinases is that they phosphorylate preferentially agonist-occupied receptors, with little effect on free, inactive receptors (28). We studied the concentration dependence of homologous desensitization by constructing cAMP dose-response curves for melanoma cells treated with NDP-MSH for 30 min or 3 h (Fig. 4
). For low agonist doses, up to approximately 0.5 nM, cAMP levels were higher in HBL cells stimulated for 3 h than for 30 min. Conversely, for higher concentrations, cells contained significantly more cAMP at 30 min than after a 3-h treatment. This indicates that human MC1R desensitization is more effective at agonist concentrations corresponding to high fractional occupancies. The behavior of mouse Mc1r was somewhat different because desensitization in B16 cells was evident at agonist concentrations corresponding to very low receptor occupancy.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4. Concentration Dependence of Melanocortin 1 Receptor Desensitization
Human HBL cells (A) and mouse B16 (B) melanoma cells grown in six-well plates were serum-deprived for 24 h and subsequently treated for 30 min (squares) or 3 h (triangles) with the indicated concentrations of NDP-MSH. Data are means ± SEM (n = 4).
|
|
Identification of GRKs Expressed in Melanoma Cells
The repertoire of GRKs expressed in human HBL and LND1 and mouse B16 cells, as well as in HEK 293T cells, was analyzed by RT-PCR. Given the similarity of melanocortin 1 receptor desensitization kinetics in human and mouse melanoma cells, we aimed at identifying those GRKs expressed in cells from both species. For human cells, we used primer sets specific for all the members of the family, except GRK3. No additional attempts to study the expression of this kinase in human melanoma cells were made, because GRK3 is not expressed in mouse melanoma cells (see below). For mouse B16 cells GRK1 and GRK7 were not considered because their expression is restricted to the retina (28) and they were not found in human melanocytes or melanoma cells. HBL, LND1, and B16 cells were positive for GRK2 and GRK6 (Fig. 5A
), but B16 mouse melanoma cells were negative for Grk3, Grk4, and Grk5. Because the expression of these kinases is ubiquitous, we performed positive controls demonstrating the suitability of the primer sets and reaction conditions. These were performed with total RNA from mouse tissues known to express the kinases under study, namely testis for Grk3 and Grk4, and lung and heart for Grk5 (Fig. 5B
). On the other hand, a faint band was observed in RT-PCR amplification reactions of human GRK5, using RNAs from HBL and LND1 melanoma cells and HEK 293 cells, a cell line in which no expression of the protein has been detected by Western blot (37). This suggests that GRK5 may be expressed in human melanoma cells, although probably at lower levels than the related GRK6. In the light of these results, we focused our study on GRK2 and GRK6, because these seem the only GRKs expressed simultaneously in both human and mouse melanoma cells.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 5. GRK2 and GRK6 Are Expressed in Melanoma Cells and Normal Melanocytes
A, RT-PCR analysis of GRK expression in HBL and LDN1 human melanoma cells, HEK 293T cells, and B16 mouse melanoma cells. Total RNA was reverse-transcribed, and the resulting cDNA was amplified with the primer pairs and reaction conditions specified in Table 1 . GAPDH mRNA was amplified with a commercial primer set as a control of RNA quality and comparable loading. In this case, Blank stands for an amplification reaction performed with non-reverse-transcribed RNA from HBL cells. The negative of the image is shown for a clearer reproduction. B, Efficient amplification of Grk3, Grk4, and Grk5 in mouse tissues. Freshly excised tissues from a Swiss CD1 mouse were used to extract total RNA. Reverse transcription of RNA from testes (for amplification of Grk3 and Grk4) and lung (for amplification of Grk5), as well as PCR, were performed exactly as for B16 melanoma cells, using the Grk-specific forward primers and the common degenerated reverse primer described in Table 1 . C, Restriction mapping confirmation of GRK2 expression in melanoma cells. The amplification product obtained with primers specific for GRK2 was purified and digested with MluI, for the samples of human origin, or with BglII for samples from B16 mouse melanoma cells. The digestion reactions were resolved by electrophoresis in 2% agarose gels. Bands of the expected size (indicated on the margins) were visualized by ethidium bromide staining. D, GRK2 and GRK6 gene expression in normal human melanocytes (NHM). Two primary cultures of NHM from different donors (2P7 and WC) were used to extract total RNA and check for GRK2 and GRK6 gene expression by RT-PCR.
|
|
For GRK2, the identity of the PCR products was ascertained by restriction mapping of the amplification product (Fig. 5C
). Expression of GRK6 in human melanoma cells was verified by amplification of the full-length product with primers designed for its cloning. The amplification product was cloned into pcDNA3, sequenced, and found to correspond to the GRK6A splice variant (NCBI nucleotide database accession no. NM_001004106). This variant results from the use of an alternate acceptor splice site in the last exon of the GRK6 gene. GRK2 and GRK6 were also expressed in two normal human melanocyte cultures (Fig. 5D
) and in a panel of six different human melanoma cell lines (data not shown).
GRK2 and GRK6 expression was further analyzed at the protein level. Extracts of LND1 and HBL human melanoma cells, B16 mouse melanoma cells, and heterologous CHO and HEK 293T cells contained a band of the expected size (
80 kDa) in Western blots probed with an anti-GRK2 antibody recognizing the human and mouse protein. The identity of the immunoreactive band was further established by its increase in HEK 293T cells transiently transfected with a GRK2 expression construct (Fig. 6A
). The cell lines under study also expressed the GRK6 protein, as shown by similar Western blot experiments. Overall, these results pointed to GRK2 and GRK6 as candidates for the melanocortin 1 receptor desensitizing kinases.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6. Western Blot Analysis of GRK2 and GRK6 Expression in Melanoma Cells and HEK 293T Cells Transiently Transfected with the GRK2 and GRK6 Genes
Solubilized extracts of the cells indicated on top of each lane were resolved by SDS-PAGE, transferred to polyvinylidene difluoride membranes and probed with specific anti-GRK2 (A) or anti-GRK6 (B) antibodies. Lanes labeled HEK+ refer to extracts of HEK 293T cells transiently transfected with the kinase genes for overexpression of the protein. The position of molecular mass markers is indicated on the left. Protein load was kept constant at 15 µg/lane.
|
|
GRK2 Is Able to Desensitize MC1R and Mc1r in Heterologous Systems and Melanoma Cells
The ability of GRK2 to desensitize the melanocortin 1 receptors was demonstrated by cotransfection of the receptor genes and GRK2 in HEK 293T cells. GRK2 strongly and significantly inhibited MC1R-dependent agonist-induced cAMP accumulation but had little effect on basal cAMP levels (Fig. 7A
). Consistent with the rapid effect of the GRKs on receptor substrates, a statistically significant reduction of cAMP accumulation in agonist-treated cells was observed at the shortest time analyzed (5 min), in the presence of the kinase. A similar inhibition of mouse Mc1r signaling was found after 30-min or 3-h incubation with the agonist (Fig. 7B
), although in this case a complete kinetic study was not performed. GRK2-mediated inhibition of receptor signaling was not due to decreased receptor expression as shown by flow cytometric analysis of cells cotransfected with GRK2 and a functional MC1R receptor construct tagged with a FLAG epitope (Fig. 7C
). Thus GRK2 is able to rapidly desensitize human MC1R and mouse Mc1r in a heterologous system.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7. Effect of GRK2 on Signaling by MC1R and Mc1r Expressed in HEK 293T Cells
A, HEK 293T cells were transfected with an MC1R construct and empty vector (squares) or the receptor gene and an equivalent amount of GRK2 (triangles), using 0.75 µg/dish of each plasmid. cAMP levels were measured at the times shown after stimulation with 107 M NDP-MSH. Data are means ± SEM (n = 68). B, Same as in A, except that the experiments were performed with the mouse Mc1r expression construct, and cAMP levels were measured after a 0.5- or 3-h challenge with the agonist. Data given as mean ± SEM (n = 6). **, P < 0.01; and ***, P < 0.001, for paired time points. C, Overlay flow cytometry histograms of HEK 293T cells transfected with a FLAG epitope-labeled MC1R construct and empty vector, or an equivalent amount of the GRK2 construct, as indicated.
|
|
We wished to extend these observations to a melanocytic environment. HBL and LND1 melanoma cells were transfected with a dominant negative mutant of GRK2. This mutant, GRK2-K220R, is able to bind to GPCRs but lacks kinase activity and prevents receptor phosphorylation by shielding the substrates (32, 38). Melanoma cells stably transfected with the dominant negative mutant were selected with geneticin. To avoid artifacts in a particular clone, several independent clones were analyzed, as well as nonclonal pools of cells enriched in transfectants by growth in geneticin-containing medium. For clones derived from HBL cells, receptor responsiveness to NDP-MSH was increased without significant changes in adenylyl cyclase activity as determined by measurements of cAMP levels after a 30-min stimulation with 105 M forskolin (5.04 ± 1.2 pmol cAMP/µg protein for HBL cells, vs. 6.13 ± 0.91 and 4.4 ± 0.63 pmol cAMP/µg protein for clones 5 and 9, respectively). The same trend was observed in most LND1-derived clones and, in this case, also in nonclonal cultures (Fig. 8
).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8. Expression of a Dominant Negative Mutant of GRK2 Increases Responsiveness of Human Melanoma Cells to NDP-MSH
HBL (A) and LND1 (B) human melanoma cells were transfected with an expression construct for the dominant negative mutant GRK2-K220R. Individual clones were selected on the basis of their resistance to geneticin and analyzed for agonist-induced cAMP production after a 30-min or 3-h stimulation with 107 M NDP-MSH. HBL and LND1 refer to the parental cell lines. Pool designates nonclonal cultures enriched in transfectants by a 48-h incubation in the presence of the selection antibiotic, but without selection of individual clones. Data are means ± SEM (n = 4). *, P < 0.05; **, P < 0.01; and ***, P < 0.001, for paired time points.
|
|
GRK6 Overexpression Inhibits Basal and Agonist-Induced MC1R Signaling
In cotransfection experiments, GRK6 inhibited human MC1R agonist-independent and agonist-induced signaling (Fig. 9A
). The kinase rapidly blocked agonist-induced cAMP increases, as shown by similar cAMP levels after a 5-min or a 3-h treatment with the agonist. This inhibition was not due to decreased receptor density as shown by flow cytometric analysis of cells transfected with the tagged receptor and GRK6 (Fig. 9B
). Similar results were obtained for mouse Mc1r (Fig. 9C
). The effect of the kinase on basal signaling was further investigated by cotransfecting HEK 293T cells with a fixed amount of MC1R or Mc1r and increasing amounts of GRK6, resulting in increased levels of expression of the kinase (Fig. 9D
). Inhibition of MC1R basal signaling was much more marked for MC1R than for mouse Mc1r (Fig. 9E
). Due to the high level of expression of GRK6 (Fig. 9D
), a very strong inhibition of MC1R signaling was already seen at the lowest concentration of GRK6 plasmid in the transfection medium (0.25 µg/dish). However, the basal cAMP levels were significantly lower (P = 0.0078) when the concentration of the plasmid was increased to 0.50 µg or higher, relative to the values obtained for 0.25 µg of plasmid. This suggests that inhibition of MC1R signaling was dependent on the concentration of GRK6.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 9. Effect of GRK6 on Basal and Agonist-Induced Signaling by MC1R and Mc1r Transiently Expressed in HEK 293T Cells
A, HEK 293T cells were transfected with human MC1R and empty vector (squares) or MC1R and a GRK6 construct (tri angles) and probed for their cAMP response to NDP-MSH, as indicated in the legend to Fig. 7 . B, Flow cytometric analysis of HEK 293T cells transfected with the FLAG epitope-labeled MC1R construct and empty vector or an equivalent amount of the GRK6 construct, as indicated. C, GRK6-mediated inhibition of agonist-induced cAMP production in HEK 293T cells transfected with Mc1r. Experiments were performed as described in A, except that mouse Mc1r instead of the human protein were transiently expressed in HEK 293T cells. ***, P < 0.001, for paired time points. D, Expression of GRK6 in HEK 293T cells transfected with different amounts of plasmid. Cells grown in six-well plates were transfected with the indicated amounts of GRK6 expression plasmid and the necessary amount of empty vector to achieve a final concentration of 1.5 µg DNA/dish. Expression of GRK6 was analyzed by Western blot. E, GRK6 concentration-dependent inhibition of basal signaling by the melanocortin 1 receptors. HEK 293T cells were cotransfected with a fixed amount (0.75 µg/dish) of MC1R (squares) or Mc1r (triangles) and increasing amounts of GRK6 plasmid DNA, as indicated. Basal cAMP levels were measured in cells deprived of serum for 24 h before the assay. Data are means ± SEM (n = 46).
|
|
To study the possible effect of GRK6 in a melanocytic environment, HBL cells were transfected with the GRK6 construct, geneticin-resistant clones were selected, and the functional status of MC1R was analyzed. Agonist-dependent cAMP production was significantly impaired in GRK6-overexpressing clones (Fig. 10A
). Overexpression of GRK6 was verified at the protein level by Western blot (Fig. 10B
) and ranged from 220% relative to control cells for clone 4 to 360% for clone 11. As an additional control, it was verified that overexpression of the kinase does not down-regulate MC1R mRNA (Fig. 10C
). Therefore, GRK6 can mediate the desensitization of MC1R in heterologous cells, as well as in melanoma cells.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 10. Overexpression of GRK6 Inhibits Agonist-Induced cAMP Production in HBL Human Melanoma Cells, without Affecting MC1R Gene Expression
A, Agonist-induced cAMP levels in clones of HBL cells stably expressing GRK6. The indicated clones were challenged with 107 M NDP-MSH for the times shown, and their cAMP concentration was then measured. HBL refers to the parental cell line. cAMP levels in cells stimulated with 105 M forskolin were 5.04 ± 1.2 pmol cAMP/µg protein for HBL cells, and 6.56 ± 0.74, 6.34 ± 0.96, and 5.08 ± 0.43 pmol/µg for clones 2, 4, and 11, respectively. Data are means ± SEM (n = 4). For the three clones, cAMP levels were significantly lower than controls (P < 0.001, for the 10-min, 30-min, and 1-h time points). B, Overexpression of GRK6 in the stable clones under study. Extracts of the clones analyzed in A were compared for GRK6 expression by Western blot. The protein load was kept constant at 10 µg/lane. C, Lack of effect of GRK6 overexpression on MC1R gene expression in HBL cells. MC1R mRNA levels were compared by Northern blot of total RNA (20 µg/lane) from the parental HBL cell line and seven independent clones transfected with the GRK6 construct, including those analyzed for cAMP response and GRK6 expression in A and B. The blots were also probed for GAPDH to ensure comparable loading and transfer.
|
|
 |
DISCUSSION
|
|---|
The functional status of melanocortin 1 receptors is critical for normal pigmentation and skin biology, as shown by the effects of mutant Mc1r alleles on mouse coat color (12) and of MC1R loss-of-function mutations on the human cutaneous phenotype (13, 14, 15, 16, 17). Therefore, the regulation of melanocortin 1 receptor function should also have important phenotypic implications. Desensitization is a widespread mechanism of regulation of signaling by membrane receptors. Homologous desensitization is defined as a transient inhibition of receptor responsiveness to its agonists and is mediated, at least partially, by a family of specific serine/threonine kinases termed GRKs that recognize the occupied receptor. The phosphorylated receptor then interacts with proteins of the arrestin family, which uncouple the complex from the G protein effectors and very often target it for sequestration. Arrestins and other proteins of the internalization machinery act as scaffolds able to recruit new partners, often leading to activation of new signaling events (28, 29, 30, 31). Therefore, GRKs not only act as signal termination devices, but also determine part of the GPCRs-mediated intracellular response to external signals.
Although desensitization is a key mechanism of GPCR functional regulation, no data are available on its occurrence in human MC1R or mouse Mc1r. Moreover, this behavior has only been studied for two of the five members of the MCRs subfamily, Mc2r expressed in mouse adrenocortical Y1 cells (39) and Mc4r expressed in mouse hypothalamic GT1-7 cells (40), whose desensitization mechanisms appeared somewhat atypical. Accordingly, we undertook a study of MC1R and Mc1r desensitization, using well-characterized melanoma cell lines homozygous for the wild-type receptor genes and heterologous systems expressing the cloned genes. To our knowledge, this is the first study of the desensitization of a human melanocortin receptor in its homologous cellular environment.
We have used an experimental protocol based on cAMP measurements after various treatment times in the continuous presence of agonists, in the absence of PDE inhibitors. Because desensitization should lower the rate of cAMP synthesis, this would lead to a biphasic curve in which the initial phase of increase in the levels of the second messenger would be followed by a slow decrease back to basal concentrations, reflecting residual signaling activity. This kinetics was observed for human and mouse melanoma cells (Fig. 1
). The mechanisms of down-regulation of cAMP signaling are complex and include inhibition of adenylyl cyclase and activation of certain PDE isoenzymes in addition to receptor desensitization (35). In our case, a contribution of postreceptor events to the biphasic kinetics, particularly PDE activation, is likely. However, several lines of evidence prove that the observed time-dependent decrease in cAMP levels is primarily a result of bona fide receptor desensitization. When HBL cells were stimulated with forskolin, cAMP levels stayed high and approximately constant throughout the time course of the experiment, for up to 6 h. This suggests that changes in adenylyl cyclase or PDE activity are not sufficient to account for the drop of cAMP levels back to basal values observed for cells stimulated with the MC1R agonist. Major postreceptor events were further excluded by pretreating HBL or B16 cells with agonist for times sufficient to achieve desensitization, followed by stimulation of cAMP production with forskolin. Both B16 and HBL cells still responded to forskolin with strong increases in cAMP, which excludes interferences at the level of adenylyl cyclase. Moreover, receptor desensitization could be demonstrated in studies using a more standard desensitization protocol (Fig. 1E
). In this case, HBL cells were pretreated with NDP-MSH in the absence of PDE inhibitors, the agonist was washed, and the cells were rechallenged with the melanocortin. The cAMP response was strongly attenuated in agonist-pretreated cells as compared with untreated controls. Taken together, these results demonstrate that Mc1r and MC1R undergo homologous desensitization in response to natural ligands such as ACTH139 or the synthetic melanocortin NDP-MSH.
Mc1r signaling in B16 cells continuously exposed to agonists dropped to about 10% of the maximal activity, and a similar inhibition was observed for MC1R in human melanoma cells. This is consistent with reports for other receptors, whose signaling activity is reduced by 7080% upon homologous desensitization (reviewed in Ref.28), and with the behavior of the related Mc4r, with residual levels around 10% in mouse hypothalamic GT1-7 cells (40), and Mc2r, whose response to ACTH decreases to 2030% of maximal values in mouse adrenocortical Y1 cells (39). This low residual signaling suggests that, at least within the time frame considered, desensitization is primarily due to uncoupling from the Gs protein, rather than to down-regulation of plasma membrane receptors. Indeed, careful binding studies performed with HBL cells (25) have shown that long exposures to melanocortins only decrease the number of
-MSH binding sites by about 25%. This modest drop in receptor density does not seem sufficient to account for the much higher inhibition of signaling.
Several lines of evidence point to the involvement of GRK2 and GRK6 in melanocortin 1 receptor desensitization. These include: 1) the lack of effect of inhibitors or activators of the classical second messenger-activated protein kinases; 2) the expression of GRK2 and GRK6 in human and mouse melanoma cells and normal melanocytes; 3) the results of cotransfection experiments in heterologous HEK 293T cells; and 4) the behavior of melanoma cells expressing a GRK2 dominant negative mutant, or enriched in GRK6 after transfection of the corresponding genes. However, some results point to subtle differences between desensitization of Mc1r and MC1R. Notably, Mc1r desensitization displayed a lower dependency on hormone concentration, and hence on receptor occupancy (Fig. 4
). For the human receptor, at NDP-MSH concentrations up to approximately 0.5 nM, the levels of cAMP in HBL cells were higher after 3 h than after a 30-min challenge, indicative of little or no desensitization. This trend was reversed at agonist concentrations higher than 109 M. In this concentration range, cAMP levels were higher at the shorter time (Fig. 4A
). Conversely, for B16 mouse melanoma cells desensitization was already evident at the lower concentrations tested, under conditions of low receptor occupancy and cAMP production. This may indicate that the activated mouse receptor is a better substrate for the desensitizing kinases than its human ortholog.
For several constitutively active mutants of GPCRs, the agonist-independent recognition by a GRK has been described (41). However, desensitization by GRKs of natural, wild-type GPCRs independently of agonist binding has been reported only for a few receptors, like certain isoforms of the 5-hydroxytryptamine 2 c receptor (42). Here, we have shown that the melanocortin 1 receptors and particularly MC1R provide another example of this behavior, because both basal and agonist-induced signaling of the receptors transiently expressed in HEK 293T cells are inhibited upon cotransfection with GRK6.
It has been demonstrated that altered desensitization is a potential etiology for a variety of human diseases, like chronic heart failure (43), hypertension (44), and familial nephrogenic diabetes insipidus (45). Concerning the MCR family, it has recently been postulated that excessive GRK-mediated desensitization and internalization of the MC4R may be responsible for certain cases of human obesity (40). In the light of our results, it is possible that GRK-dependent processes may also be related to skin pigmentation abnormalities in man. In any case, given the relevance of MC1R as a determinant of skin type and pigmentation, it can be hypothesized that human skin pigmentation will be determined not only by the MC1R genotype but also by the interaction of the receptor with GRKs and, likely, other components of the desensitization/internalization/recycling machinery.
 |
MATERIALS AND METHODS
|
|---|
Materials
A cAMP RIA kit and all restriction endonucleases were from Amersham Pharmacia Biotech (Little Chalfont, UK). Igepal CA-630, BSA, EDTA, phenylmethylsulfonylfluoride, 3-isobutyl-1-methylxanthine, TPA, H-89, verapamil, PD 98,059, and bicinchoninic acid were from Sigma (St. Louis, MO). G418 sulfate, ACTH139, the synthetic
-MSH analog [Nle4, D-Phe7]
-MSH (NDP-MSH), staurosporine, and Ro-318425 were from Calbiochem (Darmstadt, Germany). Other reagents were from Merck (Darmstadt, Germany) or Prolabo (Barcelona, Spain), unless stated otherwise. cDNAs encoding bovine GRK2 and its dominant negative mutant GRK2-K220R, cloned into pcDNA3 (32), were a gift from Prof. F. Mayor, Jr. (Madrid, Spain). A cDNA encoding the wild-type MC1R labeled with a FLAG epitope in its N terminus and cloned into pCR3.1 (46) was a gift from Prof. E. Healy (Southampton, UK).
Cell Lines and Cell Culture
Reagents for cell culture were from Nunc (Roskilde, Denmark) or Life Technologies (Gaithersburg, MD). Human embryonic HEK 293T cells were grown in RPMI 1640, supplemented with 10% fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. The origin, culture conditions, and MC1R genotype of the human melanoma cell lines used have been described (47). Frozen cell pellets from normal melanocyte cultures were a gift of Prof. G. Ghanem (Brussels, Belgium).
Preparation of Expression Constructs and Transfection
The preparation of wild-type MC1R and Mc1r constructs in pcDNA3 has been described (23, 48). Human GRK6 cDNA was obtained by RT-PCR, using RNA purified from HBL melanoma cells by cesium bromide gradient centrifugation and primers CGAAGCTTACCATGGAGCTCGAGAACATCG (forward) and GGTCTAGAGGCTAGAGGCGGGTGGGGAG CT (reverse). The primers contain HindIII and XbaI restriction sites (underlined), used for cloning into pcDNA3. The identity of the clones was verified by sequencing of both strands. Transfection was performed with the Superfect reagent (QIAGEN, Paisley, UK) or Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Clones of melanoma cells stably expressing a dominant negative GRK2 mutant (GRK-K220R) or overexpressing GRK6 were obtained as described (33) and cultured in the presence of 800 µg/ml G418 sulfate. Transient transfection of HEK 293T cells has been described previously (47).
cAMP Assays
Cells were grown in six-well plates, transfected if necessary, and serum-deprived for 24 h. They were then incubated with agonists (107 M final concentration unless specified otherwise) from 20 min to 24 h. The medium was aspirated, and the cells were washed quickly with 800 µl ice-cold PBS. Stimulated cells were lysed with 350 µl preheated 0.1 N HCl (70 C) per well and carefully scrapped. The mix was freeze-dried, washed with 100 µl H2O, and freeze-dried again. cAMP was measured with a commercial RIA, as per instructions. Parallel dishes for protein determination were always included.
RT-PCR Analysis of GRKs Expression
Total RNA was extracted with guanidinium thiocyanate and purified by cesium chloride gradient centrifugation. cDNA was synthesized with the Superscript kit (Invitrogen), as per instructions. Then, expression of the different GRKs was analyzed using the primer sets specified in Table 1
. Suitable aliquots of the PCR were electrophoresed in 2.0% agarose gels and ethidium bromide-stained.
Flow Cytometric Analysis
Indirect immunofluorescence analysis for FLAG epitope-labeled MC1R was carried out by flow cytometry in a Becton Dickinson FACScan system (Becton Dickinson and Co., Franklin Lakes, NJ), as described by Robinson and Healy (46). Approximately 250,000 HEK 293T cells transiently expressing the construct were incubated for 30 min in a final volume of 100 µl with the anti-FLAG M2 monoclonal antibody (Sigma) at a 1:25 dilution. Cells were washed twice with 2% fetal calf serum, 0.01% NaN3 in PBS, and incubated with a fluorescein-labeled antimouse IgG, at a 1:250 dilution, for 30 min at 4 C. Cells were washed, resuspended in 500 µl 0.4% paraformaldehyde in PBS, and analyzed.
Western Blot
Cells were solubilized in 10 mM phosphate buffer (pH 7), 1% Igepal CA-640, 0.1 mM EDTA, and 0.1 mM phenylmethylsulfonylfluoride. Reducing SDS-PAGE was performed in 10% acrylamide gels. A volume containing 15 µg of protein was mixed in a 2:1 ratio with sample buffer [0.18 M Tris-HCl (pH 6.8), 15% glycerol, 0.075% bromophenol blue, 9% sodium dodecyl sulfate, 3 M 2-mercaptoethanol) and heated 5 min at 95 C. Gels were transferred to polyvinylidene difluoride membranes, blocked with 5% nonfat dry milk, and incubated overnight at 4 C with anti-GRK2 or anti-GRK6 antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) diluted 1:200 in 10 mM Tris HCl (pH 7.5), 140 mM NaCl, 0.2% Tween 20, and 5% nonfat dry milk. Immunoreactive bands were detected with a peroxidase-labeled secondary antibody and a chemiluminescent substrate (Amersham Pharmacia Biotech, Little Chalfont, UK). Comparable loading was ascertained by cutting the lower portion of the membrane and staining for protein with Amido Black before blocking.
Other Procedures
For protein determination, cells were trypsin-harvested and solubilized as above. Protein concentration in cell lysates was determined by the bicinchoninic acid method.
Statistics
Results are given as mean ± SEM for experiments performed at least twice, with independent duplicates or triplicates (n
4). Statistical significance was assessed with an unpaired Students t test performed with the GraphPad Prism package (GraphPad Software, San Diego, CA).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Prof. G. Ghanem (Free University of Brussels, Brussels, Belgium) for the gift of human melanoma cells and frozen pellets of normal human melanocyte primary cultures. We are also indebted to Prof. F. Mayor, Jr. (Universidad Autónoma de Madrid, Madrid, Spain) for the gift of the bovine GRK2 and the dominant negative mutant GRK2-K220R expression constructs, and to Prof. E. Healy (University of Southampton, Southhampton, UK) for providing the FLAG epitope-tagged MC1R cDNA. We are also grateful to Ineke Gerritsen for excellent assistance.
 |
FOOTNOTES
|
|---|
This work was supported by Grant SAF2003-03411 (to J.C.G.-B.) from the Comisión Interministerial de Ciencia y Tecnología (Madrid, Spain), and FEDER funds (European Community). J.S.-M. is recipient of a fellowship from the Fundación Séneca, Comunidad Autónoma de la Región de Murcia (Madrid, Spain).
First Published Online January 13, 2005
Abbreviations: GPCR, G protein-coupled receptor; GRK, GPCR kinase; MCR, melanocortin receptor; MC1R, human melanocortin 1 receptor; Mc1r, mouse melanocortin 1 receptor; NDP-MSH, norleucine4 D-phenylalanine7-MSH; PDE, phosphodiesterase; PKA, protein kinase A; PKC, protein kinase C; TPA, 12-O-tetradecanoylphorbol-13-acetate.
Received for publication June 3, 2004.
Accepted for publication January 3, 2005.
 |
REFERENCES
|
|---|
- Butler AA, Cone RD 2002 The melanocortin receptors: lessons from knockout models. Neuropeptides 36:7784[CrossRef][Medline]
- Abdel-Malek ZA 2001 Melanocortin receptors: their functions and regulation by physiological agonists and antagonists. Cell Mol Life Sci 58:434441[CrossRef][Medline]
- Gantz I, Fong TM 2003 The melanocortin system. Am J Physiol Endocrinol Metab 284:E468E474
- Kadekaro AL, Kanto H, Kavanagh R, Abdel-Malek ZA 2003 Significance of the melanocortin 1 receptor in regulating human melanocyte pigmentation, proliferation, and survival. Ann NY Acad Sci 994:359365[Abstract/Free Full Text]
- Abdel-Malek ZA, Scott MC, Suzuki I, Tada A, Im S, Lamoreux L, Ito S, Barsh G, Hearing VJ 2000 The melanocortin-1 receptor is a key regulator of human cutaneous pigmentation. Pigment Cell Res 13(Suppl 8):156162
- Barsh GS, Gunn T, He L, Schlossman S, Duke-Cohan J 2000 Biochemical and genetic studies of pigment-type switching. Pigment Cell Res 13(Suppl 8):4853
- Barsh GS 1996 The genetics of pigmentation: from fancy genes to complex traits. Trends Genet 12:299305[CrossRef][Medline]
- Busca R, Ballotti R 2000 Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res 13:6069[CrossRef][Medline]
- Tsatmali M, Ancans J, Yukitake J, Thody AJ 2000 Skin POMC peptides: their actions at the human MC-1 receptor and roles in the tanning response. Pigment Cell Res 13(Suppl 8):125129
- Busca R, Abbe P, Mantoux F, Aberdam E, Peyssonnaux C, Eychene A, Ortonne JP, Ballotti R 2000 Ras mediates the cAMP-dependent activation of extracellular signal-regulated kinases (ERKs) in melanocytes. EMBO J 19:29002910[CrossRef][Medline]
- Mountjoy KG, Robbins LS, Mortrud MT, Cone RD 1992 The cloning of a family of genes that encode the melanocortin receptors. Science 257:12481251[Abstract/Free Full Text]
- Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L, Baack E, Mountjoy KG, Cone RD 1993 Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72:827834[CrossRef][Medline]
- Box NF, Wyeth JR, OGorman LE, Martin NG, Sturm RA 1997 Characterization of melanocyte stimulating hormone receptor variant alleles in twins with red hair. Hum Mol Genet 6:18911897[Abstract/Free Full Text]
- Smith R, Healy E, Siddiqui S, Flanagan N, Steijlen PM, Rosdahl I, Jacques JP, Rogers S, Turner R, Jackson IJ, Birch-Machin MA, Rees JL 1998 Melanocortin 1 receptor variants in an Irish population. J Invest Dermatol 111:119122[CrossRef][Medline]
- Schioth HB, Phillips SR, Rudzish R, Birch-Machin MA, Wikberg JE, Rees JL 1999 Loss of function mutations of the human melanocortin 1 receptor are common and are associated with red hair. Biochem Biophys Res Commun 260:488491[CrossRef][Medline]
- Sturm RA 2002 Skin colour and skin cancerMC1R, the genetic link. Melanoma Res 12:405416[CrossRef][Medline]
- Bastiaens M, ter Huurne J, Gruis N, Bergman W, Westendorp R, Vermeer BJ, Bouwes Bavinck JN 2001 The melanocortin-1-receptor gene is the major freckle gene. Hum Mol Genet 10:17011708[Abstract/Free Full Text]
- Sturm RA, Duffy DL, Box NF, Chen W, Smit DJ, Brown DL, Stow JL, Leonard JH, Martin NG 2003 The role of melanocortin-1 receptor polymorphism in skin cancer risk phenotypes. Pigment Cell Res 16:266272[CrossRef][Medline]
- Valverde P, Healy E, Sikkink S, Haldane F, Thody AJ, Carothers A, Jackson IJ, Rees JL 1996 The Asp84Glu variant of the melanocortin 1 receptor (MC1R) is associated with melanoma. Hum Mol Genet 5:16631666[Abstract/Free Full Text]
- Palmer JS, Duffy DL, Box NF, Aitken JF, OGorman LE, Green AC, Hayward NK, Martin NG, Sturm RA 2000 Melanocortin-1 receptor polymorphisms and risk of melanoma: is the association explained solely by pigmentation phenotype? Am J Hum Genet 66:176186[CrossRef][Medline]
- Bastiaens MT, ter Huurne JA, Kielich C, Gruis NA, Westendorp RG, Vermeer BJ, Bavinck JN 2001 Melanocortin-1 receptor gene variants determine the risk of nonmelanoma skin cancer independently of fair skin and red hair. Am J Hum Genet 68:884894[CrossRef][Medline]
- Abdel-Malek Z, Suzuki I, Tada A, Im S, Akcali C 1999 The melanocortin-1 receptor and human pigmentation. Ann NY Acad Sci 885:117133[Abstract/Free Full Text]
- Sánchez Más J, Hahmann C, Gerritsen I, García-Borrón JC, Jiménez-Cervantes C 2004 Agonist-independent high constitutive activity of the human melanocortin 1 receptor. Pigment Cell Res 17:386395[CrossRef][Medline]
- Scott MC, Suzuki I, Abdel-Malek ZA 2002 Regulation of the human melanocortin 1 receptor expression in epidermal melanocytes by paracrine and endocrine factors and by ultraviolet radiation. Pigment Cell Res 15:433439[CrossRef][Medline]
- Siegrist W, Stutz S, Eberle AN 1994 Homologous and heterologous regulation of
-melanocyte-stimulating hormone receptors in human and mouse melanoma cell lines. Cancer Res 54:26042610[Abstract/Free Full Text]
- Rouzaud F, Annereau JP, Valencia JC, Costin GE, Hearing VJ 2003 Regulation of melanocortin 1 receptor expression at the mRNA and protein levels by its natural agonist and antagonist. FASEB J 17:21542156[Abstract/Free Full Text]
- Chakraborty A, Slominski A, Ermak G, Hwang J, Pawelek J 1995 Ultraviolet B and melanocyte-stimulating hormone (MSH) stimulate mRNA production for
MSH receptors and proopiomelanocortin-derived peptides in mouse melanoma cells and transformed keratinocytes. J Invest Dermatol 105:655659[CrossRef][Medline]
- Pitcher JA, Freedman NJ, Lefkowitz RJ 1998 G protein-coupled receptor kinases. Annu Rev Biochem 67:653692[CrossRef][Medline]
- Luttrell LM, Lefkowitz RJ 2002 The role of ß-arrestins in the termination and transduction of G-protein-coupled receptor signals. J Cell Sci 115:455465[Abstract/Free Full Text]
- Gutkind JS 2000 Regulation of mitogen-activated protein kinase signaling networks by G protein-coupled receptors. Sciences STKE 2000:re1
- Shenoy SK, Lefkowitz RJ 2003 Multifaceted roles of ß-arrestins in the regulation of seven-membrane-spanning receptor trafficking and signaling. Biochem J 375:503515[CrossRef][Medline]
- Aragay AM, Mellado M, Frade JM, Martin AM, Jimenez-Sainz MC, Martinez A, Mayor Jr F 1998 Monocyte chemoattractant protein-1-induced CCR2B receptor desensitization mediated by the G protein-coupled receptor kinase 2. Proc Natl Acad Sci USA 95:29852990[Abstract/Free Full Text]
- Sanchez Mas J, Gerritsen I, Hahmann C, Jimenez-Cervantes C, Garcia-Borron JC 2003 Rate limiting factors in melanocortin 1 receptor signaling through the cAMP pathway. Pigment Cell Res 16:540547[CrossRef][Medline]
- Solca F, Siegrist W, Drozdz R, Girard J, Eberle AN 1989 The receptor for
-melanotropin of mouse and human melanoma cells. Application of a potent
-melanotropin photoaffinity label. J Biol Chem 264:1427714281[Abstract/Free Full Text]
- Houslay MD, Adams DR 2003 PDE4 cAMP phospho-diesterases: modular enzymes that orchestrate signalling cross-talk, desensitization and compartmentalization. Biochem J 370:118[CrossRef][Medline]
- Park HY, Gilchrest BA 1999 Signaling pathways mediating melanogenesis. Cell Mol Biol (Noisy-le-grand) 45:919930
- Lazari MFM, Liu X, Nakamura K, Benovic JL, Ascoli M 1999 Role of G protein-coupled receptor kinases on the agonist-induced phosphorylation and internalization of the follitropin receptor. Mol Endocrinol 13:866878[Abstract/Free Full Text]
- Kong G, Penn R, Benovic JL 1994 A ß-adrenergic receptor kinase dominant negative mutant attenuates desensitization of the ß2-adrenergic receptor. J Biol Chem 269:1308413087[Abstract/Free Full Text]
- Baig AH, Swords FM, Noon LA, King PJ, Hunyady L, Clark AJL 2001 Desensitization of the Y1 cell adrenocorticotropin receptor. Evidence for a restricted heterologous mechanism implying a role for receptor-effector complexes. J Biol Chem 276:4479244797[Abstract/Free Full Text]
- Shinyama H, Masuzaki H, Fang H, Flier JS 2003 Regulation of melanocortin-4 receptor signaling: agonist-mediated desensitization and internalization. Endocrinology 144:13011314[Abstract/Free Full Text]
- Parnot C, Miserey-Lenkei S, Bardin S, Corvol P, Clauser E 2002 Lessons from constitutively active mutants of G protein-coupled receptors. Trends Endocrinol Metab 13:336343[CrossRef][Medline]
- Marion S, Weiner DM, Caron MG 2004 RNA editing induces variation in desensitization and trafficking of 5-hydroxytryptamine 2c receptor isoforms. J Biol Chem 279:29452954[Abstract/Free Full Text]
- Ungerer M, Parruti G, Bohm M, Puzicha M, DeBlasi A, Erdmann E, Lohse MJ 1994 Expression of ß-arrestins and ß-adrenergic receptor kinases in the failing human heart. Circ Res 74:206213[Abstract/Free Full Text]
- Gros R, Tan CM, Chorazyczewski J, Kelvin DJ, Benovic JL, Feldman RD 1999 G-protein-coupled receptor kinase expression in hypertension. Clin Pharmacol Ther 65:545551[CrossRef][Medline]
- Barak LS, Oakley RH, Laporte SA, Caron MG 2001 Constitutive arrestin-mediated desensitization of a human vasopressin receptor mutant associated with nephrogenic diabetes insipidus. Proc Natl Acad Sci USA 98:9398[Abstract/Free Full Text]
- Robinson SJ, Healy E 2002 Human melanocortin 1 receptor (MC1R) gene variants alter melanoma cell growth and adhesion to extracellular matrix. Oncogene 21:80378046[CrossRef][Medline]
- Sanchez Mas J, Olivares Sanchez C, Ghanem G, Haycock J, Lozano Teruel JA, Garcia-Borron JC, Jimenez-Cervantes C 2002 Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function. Eur J Biochem 269:61336141[Medline]
- Jimenez-Cervantes C, Olivares C, Gonzalez P, Morandini R, Ghanem G, Garcia-Borron JC 2001 The Pro162 variant is a loss-of-function mutation of the human melanocortin 1 receptor gene. J Invest Dermatol 117:156158[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
B. L. Sanchez-Laorden, C. Jimenez-Cervantes, and J. C. Garcia-Borron
Regulation of Human Melanocortin 1 Receptor Signaling and Trafficking by Thr-308 and Ser-316 and Its Alteration in Variant Alleles Associated with Red Hair and Skin Cancer
J. Biol. Chem.,
February 2, 2007;
282(5):
3241 - 3251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. M. WACHIRA, B. GURUSWAMY, L. URADU, C. A. HUGHES-DARDEN, and F. J. DENARO
Activation and Endocytic Internalization of Melanocortin 3 Receptor in Neuronal Cells
Ann. N.Y. Acad. Sci.,
January 1, 2007;
1096(1):
271 - 286.
[Abstract]
[Full Text]
[PDF]
|
 |
|