help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0326
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, K.
Right arrow Articles by Safe, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, K.
Right arrow Articles by Safe, S.
Molecular Endocrinology 19 (4): 843-854
Copyright © 2005 by The Endocrine Society

Analysis of Estrogen Receptor {alpha}-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer

Kyounghyun Kim, Rola Barhoumi, Robert Burghardt and Stephen Safe

Departments of Veterinary Physiology and Pharmacology (KK., S.S.), and Veterinary Anatomy and Public Health (R.Ba., R.Bu.), Texas A&M University, College Station, Texas 77843; and Institute of Biosciences and Technology (S.S.), Texas A&M University System Health Science Center, Houston, Texas 77030-3303

Address all correspondence and requests for reprints to: Stephen Safe, Department of Veterinary Physiology and Pharmacology, Texas A&M University, 4466 TAMU, Veterinary Research Building 409, College Station, Texas 77843-4466. E-mail: ssafe{at}cvm.tamu.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogen-dependent regulation of several genes associated with cell cycle progression, proliferation, and nucleotide metabolism in breast cancer cells is associated with interactions of estrogen receptor (ER){alpha}/Sp1 with GC-rich promoter elements. This study investigates ligand-dependent interactions of ER{alpha} and Sp1 in MCF-7 breast cancer cells using fluorescence resonance energy transfer (FRET). Chimeric ER{alpha} and Sp1 proteins fused to cyan fluorescent protein or yellow fluorescent protein were transfected into MCF-7 cells, and a FRET signal was induced after treatment with 17ß-estradiol, 4'-hydroxytamoxifen, or ICI 182,780. Induction of FRET by these ER{alpha} agonists/antagonists was paralleled by their activation of gene expression in cells transfected with a construct (pSp13) containing three tandem Sp1 binding sites linked to a luciferase reporter gene. In contrast, interactions between ER{alpha} and Sp1{Delta}DBD [a DNA binding domain (DBD) deletion mutant of Sp1] are not observed, and this is consistent with the critical role of the C-terminal DBD of Sp1 for interaction with ER{alpha}. Results of the FRET assay are consistent with in vitro studies on ER{alpha}/Sp1 interactions and transactivation, and confirm that ER{alpha} and Sp1 interact in living breast cancer cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ESTROGEN RECEPTORS (ERs) {alpha} and ß are members of the nuclear receptor superfamily of transcription factors that exhibit a modular domain structure (1, 2, 3, 4, 5). Activation function (AF)1 and AF2 are expressed in the N-terminal A/B and C-terminal E/F domains and are critical regions of ER that interact with nuclear coregulatory and coactivator proteins. The hinge domain D has multiple functions, and all nuclear receptors contain a highly characteristic DNA binding domain (DBD) (C) that forms two zinc fingers that interact with their cognate genomic response elements. Ligand-activation of ER{alpha} induces formation of a homodimeric complex the binds estrogen-responsive elements (EREs) in target gene promoters, and the subsequent ordered recruitment of other nuclear factors results in activation of gene expression (6, 7, 8, 9).

In addition to the classical mechanism of ER{alpha}-dependent activation of ERE promoters, ER{alpha} also activates GC-rich and activator protein-1 (AP1) promoter through interactions with DNA-bound Sp and AP1 proteins, respectively (10, 11, 12, 13, 14, 15). ER{alpha}/Sp1- and ER{alpha}/AP1-mediated transactivation in breast and other cancer cell lines is ligand dependent but does not require the receptor DBD because ER interacts with other transcription factors but not promoter DNA. Research in this laboratory in MCF-7 and ZR-75 breast cancer cells has shown that several hormone-induced genes associated with cell proliferation, cell cycle progression, and nucleotide metabolism are regulated by ER{alpha}/Sp1, and these include vascular endothelial growth factor, bcl-2, cyclin D1, adenosine deaminase, DNA polymerase {alpha}, thymidylate synthase, retinoic acid receptor {alpha}, creatine kinase B, IGF binding protein 4, cathepsin D, c-fos, E2F1, and carbamoylphosphate synthetase/aspartate carbamyl transferase/dihydroorotase (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27). In vitro studies show that ER{alpha} interacts with both Sp1 and Sp3, and the C-terminal DBD of Sp1 is the major interaction site for ER{alpha}.

Bai and Giguere (28) have studied interactions of ER{alpha} and ERß in living cells using fluorescence resonance energy transfer (FRET) and showed that 17ß-estradiol (E2) enhanced receptor dimerization and interactions with coactivators. In this study, we have used FRET to investigate interactions between ER{alpha} and Sp1 proteins in living cells. MCF-7 cells were transfected with chimeric ER{alpha} and Sp1 proteins fused to cyan fluorescent protein (CFP) or yellow fluorescent protein (YFP), and ligand-dependent interactions were determined. E2, 4-hydroxytamoxifen (4-OHT), and ICI 182,780 induce time-dependent interactions between ER{alpha} and Sp1 in MCF-7 cells, and the ligand-induced FRET signal is decreased in cells cotransfected with a dominant negative expression plasmid for Sp1. In contrast, interactions between ER{alpha} and Sp1{Delta}DBD (a DBD deletion mutant of Sp1) are not observed, and this is consistent with the critical role of the C-terminal DBD of Sp1 for interaction with ER{alpha}. Results of the FRET assay are consistent with in vitro studies on ER{alpha}/Sp1 interactions and transactivation, and confirm that ER{alpha} and Sp1 interact in living breast cancer cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Characterization of CFP or YFP Fusion Proteins
Previous studies in this laboratory have shown that ER{alpha} and Sp1 proteins interact and ER{alpha}/Sp1 mediates transcriptional activation of E2-responsive genes through GC-rich promoters (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29). To investigate ER{alpha}/Sp1 protein-protein interactions in living cells, we generated various CFP and YFP fusion constructs expressing CFP-YFP chimera, CFP-human (h)ER{alpha}, YFP-hER{alpha}, CFP-Sp1 and CFP-Sp1{Delta}DBD (Fig. 1Go). To ensure that the fusion of CFP or YFP to the N-terminal of hER{alpha} or Sp1 did not disrupt transcriptional activities of these transcription factors, the fusion proteins of CFP-hER{alpha} or YFP-hER{alpha} were first assayed in a transient transfection system. ER-negative MDA-MB-231 cells were transfected with constructs containing three tandem EREs (pERE3) or three tandem GC-rich Sp binding sites (pSp13) along with chimeric CFP-hER{alpha}, YFP-hER{alpha}, or wild-type hER{alpha} expression plasmids. Cells were then treated with 10 nM E2 for 24 h, and results showed that E2-induced transactivation was observed in MDA-MB-231 cells transfected with pERE3 (Fig. 2AGo) or pSp13 (Fig. 2BGo) and wild-type or chimeric ER{alpha}. Thus, both YFP-hER{alpha} and CFP-hER{alpha} were functional in MDA-MB-231 cells.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. CFP and YFP Fusion Proteins Used for FRET Studies

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Effect of CFP or YFP Fusion Constructs on Activation of pSp13 and pERE3

A and B, Activation of pERE3 (A) and pSp13 (B) in MDA-MB-231 cells. MDA-MB-231 cells were cotransfected with pSp13 or pERE3 and CFP or YFP fusion construct and treated with DMSO or 10 nM E2; luciferase activity was determined as described in Materials and Methods. C, Effects of Sp1DN. ZR-75 cells were transfected with unfused Sp1 construct and Sp1DN or CFP-Sp1 and Sp1DN; luciferase activity was determined as described in A. D and E, Effect of CFP-Sp1 and YFP-hER{alpha} on estrogen- or antiestrogen-induced activation of pSp13 in ZR-75 cells (D) or in MCF-7 cells (E). Cells were transfected with hER{alpha}, CFP-Sp1, YFP-hER{alpha}, or both fusion constructs along with pSp13 and then treated with 10 nM E2, 1 µM 4-OHT, and 1 µM ICI 182,780 (ICI). F, Effects of CFP-Sp1{Delta}DBD on hormone responsiveness. Cells were treated with DMSO and E2 and transfected with CFP-Sp1{Delta}DBD, pSp13, and CFP (empty vector). Luciferase activities in all of these experiments were determined as described in Materials and Methods. Significant (P < 0.05) induction (*) or inhibition (**) of this activity is indicated.

 
In ZR-75 cells transfected with pSp13, cotransfection with wild-type Sp1 or chimeric CFP-Sp1 enhanced transactivation, and cotransfection with Sp1 dominant negative (Sp1DN) decreased basal and induced transcription confirming that chimeric CFP-Sp1 was functional (Fig. 2CGo). Moreover, in ZR-75 cells transfected with pSp13, cotransfection with CFP-Sp1 enhanced basal activity, and YFP-ER{alpha} enhanced E2-induced transactivation (Fig. 2DGo). A combination of YFP-ER{alpha} and CFP-Sp1 enhanced levels of basal and E2-induced activity.

MCF-7 cells were cotransfected with CFP-Sp1 and pSp13 and then treated with 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 for 24 h; increased basal levels of transcription were observed. In contrast, coexpression of YFP-hER{alpha} and CFP-Sp1 expression plasmid significantly increased both the basal and estrogen- or antiestrogen-induced luciferase activities in cells transfected only with CFP-Sp1, YFP-hER{alpha}, or hER{alpha}. However, the overall fold-induction was not significantly changed (Fig. 2EGo). These results confirmed that CFP-hER{alpha}, YFP-hER{alpha}, and CFP-Sp1 fusion proteins designed for the FRET study are effectively transfected into ER-positive and ER-negative breast cancer cells and maintain their ligand-dependent or -independent transcriptional activities that are comparable to those of wild-type hER{alpha} or Sp1 (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29). We also showed that CFP-Sp1{Delta}DBD did not affect hormone inducibility in cells transfected with pSp13 (Fig. 2FGo).

Detection of Fluorescence Resonance Energy Transfer in Living Cells
We initially investigated ligand-dependent colocalization of CFP-Sp1 with YFP-hER{alpha} and CFP-hER{alpha}/YFP-hER{alpha} in MCF-7 cells. The percentage of CFP-hER{alpha} colocalizing with YFP-hER{alpha} was significantly increased after treatment with E2 (Fig. 3AGo), and colocalization between CFP-hER{alpha} and YFP-hER{alpha} almost reached 100%, whereas a 10% increase of CFP-Sp1/YFP-hER{alpha} colocalization was observed. However, this increase was significant (Fig. 3AGo). Interestingly, without ligand, approximately 40–50% of CFP-hER{alpha}/YFP-hER{alpha} or CFP-Sp1/YFP-hER{alpha} colocalization was observed, suggesting that dimerization of interactions between ERs or between ER and Sp1 proteins was also ligand independent.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. Visualization and Analysis of FRET in MCF-7 Cells

A and B, Colocalization of CFP-hER{alpha} and YFP-hER{alpha} or CFP-Sp1 and YFP-hER{alpha}. MCF-7 cells were cotransfected with CFP-Sp1 and YFP-hER{alpha}, and then the percentage of colocalization signal was measured 15 min after the addition of 10 nM E2. Cells were transfected with CFP and YFP empty constructs as a negative control or CFP-YFP chimera fusion construct as a positive control. The higher FRET signal was observed from cells transfected with CFP-YFP chimera construct (B). Representative FRET images from cells transfected with CFP-hER{alpha} and YFP-hER{alpha} (C and D) or CFP-Sp1 and YFP-hER{alpha} (E and F). Images were acquired 8 min after treatment with DMSO or E2 (10 nM). The colocalization of CFP-hER{alpha} and YFP-hER{alpha} and translocation of fusion proteins to the nucleus after treatment with E2 were observed. The higher FRET signal was detected from cells treated with E2. The conditions for acquiring images were determined as described in Materials and Methods. FRET efficiency of CFP-hER{alpha}/YFP-hER{alpha} and CFP-Sp1/YFP-hER{alpha} (D and F). MCF-7 cells were transfected with each CFP/YFP fusion construct set. Images were acquired between 8 and 18 min after each ligand treatment. Ten to 15 images were acquired per treatment, and each image contains one to five cells to be analyzed. The subtraction of background signal from the images was carried out as described in Materials and Methods. Significant (P < 0.05) induction compared with DMSO is indicated (*) in A, D, and F.

 
To validate FRET in our system, the CFP-YFP chimera construct was generated and used as a positive control, whereas cotransfection of CFP-empty and YFP-empty constructs was used as a negative control (Fig. 3BGo). It was previously reported that the CFP-YFP chimera was useful as a positive FRET signal in living cells (28, 30, 31). However, the subcellular colocalization of both CFP and YFP proteins in living cells was not sufficient to generate detectable FRET signal (28, 30). Colocalization of CFP and YFP proteins exhibited the light blue color from the overlay image of cyan (CFP) and green (YFP). In contrast, the CFP-YFP chimeric protein expression displayed the more greenish color because of the fluorescence energy transfer. A strong FRET signal was observed from cells transfected with CFP-YFP chimera construct, whereas a minimal FRET signal was detected from cells transfected with CFP empty and YFP empty constructs (Fig. 3BGo). FRET efficiency was calculated by comparing the constructs under investigation to the CFP-YFP chimera (positive control).

To detect ligand-dependent intermolecular protein-protein interactions, we have determined ER receptor dimerization using FRET with different ligands, and these results were compared with those obtained in cells cotransfected with CFP-Sp1 and YFP-hER{alpha}. ER dimerization is stabilized by ligand binding, and the liganded ER ligand binding domain is resistant to denaturants (32, 33, 34). Stronger dimerization between ERs has been detected using FRET in living cells after ligand addition (28). MCF-7 cells were transfected with CFP-hER{alpha} and YFP-hER{alpha} constructs together, and 8 min after ligand treatment, images were acquired under the same conditions for measuring the negative and positive controls (Fig. 3Go, C and D). Translocation of both CFP-hER{alpha} and YFP-hER{alpha} into the nucleus was observed in cells treated with different ligands, and acquired images consistently showed a stronger FRET signal in ligand-treated cells compared with dimethylsulfoxide (DMSO)-treated cells. Representative images from E2-treated cells are illustrated in Fig. 3CGo. In addition, a punctated nuclear staining pattern of YFP-hER{alpha} over a diffused pattern was observed in cells after E2 treatment (data not shown), and this is consistent with results of previous studies (35, 36).

Direct interactions between ER and Sp proteins have been detected using coimmunoprecipitation and glutathione S-transferase (GST) pull-down assay in vitro, and ER{alpha} binds to the zinc finger domain of Sp1 protein (10, 11). However, direct physical interactions between ER{alpha} and Sp1 protein have not been investigated in living cells. In contrast to the fractional cytoplasmic localization of unliganded CFP-hER{alpha} and YFP-hER{alpha}, transfected CFP-Sp1 protein is localized only in the nucleus regardless of different ligand addition (Fig. 3Go, E and F). Consistently, in cells transfected with CFP-Sp1 and YFP-hER{alpha} constructs, stronger FRET signals were detected after treatment with E2 or antiestrogens (Fig. 3FGo).

Based on the FRET conditions established in these experiments (Fig. 3Go), ligand-dependent CFP-hER{alpha}/YFP-hER{alpha} and CFP/Sp1/YFP-hER{alpha} interactions were analyzed, and FRET efficiency was calculated for each treatment as described in Materials and Methods. The results indicated that E2, 4-OHT, and ICI 182,780 treatment increased FRET efficiency in cells transfected with CFP-hER{alpha} and YFP-hER{alpha} (Fig. 3DGo), and the order of FRET efficiency was similar to that observed in cells transfected with CFP-Sp1/YFP-hER{alpha} (Fig. 3FGo).

The time-dependent changes in YFP signal intensity were also investigated in MCF-7 cells transfected with CFP-Sp1 and YFP-ER{alpha} and treated with DMSO, 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 (Fig. 4Go). The stronger YFP signal was detected as hER{alpha}/Sp1 protein-protein interactions were increased over time. To avoid CFP signal bleeding over time, images were acquired in 30-sec intervals for 450 sec. The results showed that DMSO did not change YFP intensity over the time course (Fig. 4Go). These results show that ligand binding to YFP-hER{alpha} enhanced the efficiency of fluorescence energy transfer from CFP-Sp1 to YFP-hER{alpha} due to a ligand-dependent decrease in distance or change in orientation of the two proteins. Interestingly, 4-OHT induced a more rapid increase in YFP intensity, whereas E2 or ICI 182,780 significantly increased YFP intensity only after 240 sec, suggesting that the kinetics of ER{alpha}-Sp1 interactions and ER translocation into the nucleus were ligand dependent.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. YFP Intensity [YFP(T)/YFP(0)] Changes over Time after Ligand Treatment

Images were acquired every 30 sec after each ligand was added. Data represent values from at least 13 cells per treatment.

 
Coimmunoprecipitation of hER{alpha} and Sp1 was also investigated by using the YFP or CFP portion of the fusion proteins as a tag. MCF-7 cells were transfected with YFP-hER{alpha} and Sp1 or CFP-Sp1 and hER{alpha} expression plasmids, and whole cell lysates from the transfected cells were immunoprecipitated with anti-green fluorescent protein (GFP) antibody 15–20 min after treatment with DMSO or ligands. Western blot analysis of these lysates with Sp1 or ER antibodies showed that E2, 4-OHT, and ICI 182,780 enhanced hER{alpha} interactions with Sp1 (Fig. 5Go, A and B), and these results are consistent with the FRET data showing interactions of these proteins (Fig. 3Go).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 5. Detection of ER{alpha}/Sp1 Interactions by Coimmunoprecipitation

A and B, Coimmunoprecipitation of ligand-dependent hER{alpha}/Sp1 protein complex. Whole cell extracts from cells transfected with YFP-hER{alpha} and Sp1 (A) or CFP-SP1 and hER{alpha} (B) were isolated and immunoprecipitated with anti-GFP antibody or anti-ER antibody. The cell extracts were analyzed for immunoreactive Sp1 protein or ER protein by Western blot (WB) analysis with Sp1 or ER{alpha} antibodies as described in Materials and Methods.

 
The critical role of Sp1 DBD in ER{alpha}/Sp1 interactions in vitro has been previously reported from our laboratory using a GST pull-down assay (11). To further investigate the role of Sp1 DBD, we generated CFP-Sp1{Delta}DBD construct containing a deletion of amino acids (aa) 613–788 in the DBD of Sp1. This deletion resulted in both nuclear and cytoplasmic localization of CFP-Sp1{Delta}DBD proteins, suggesting that a nuclear localization signal may, in part, reside in this region of the Sp1 protein (Fig. 6AGo). Treatment of cells for 8 min with E2 showed almost complete nuclear staining of YFP-hER{alpha} (Fig. 6AGo, two bottom panels), and speckle formation was also observed. The expression and expected size of this CFP-Sp1{Delta}DBD deletion mutant protein was confirmed by Western blot analysis of whole cell lysates from transfected cells (data not shown). There was no significant increase of FRET efficiency in cells transfected with CFP-Sp1{Delta}DBD and YFP-hER{alpha}, compared with that observed in cells transfected with CFP-Sp1 and YFP-hER{alpha} after treatment with E2 (Fig. 6BGo). The role of the DBD of Sp1 was further examined in MCF-7 cells by using both FRET and GAL4-Sp1 chimeras, which express different regions of Sp1 protein. Sp1DN, which expresses the DBD of Sp1 (592–778 aa), decreased FRET efficiency in cells transfected with CFP-Sp1/YFP-ER{alpha} (Fig. 6CGo), confirming the importance of Sp1-DBD as the hER{alpha}-interacting region of Sp1. E2 induced transactivation in a one-hybrid assay only in cells transfected with GAL4-Sp1 chimeras that express full-length Sp1 or the C/D C-terminal domain of Sp1 (pM-Sp1CD) (Fig. 6DGo). Hormone-induced transactivation was not observed in cells transfected with constructs (pMSp1A, pMSp1B and pMSp1D) that do not express the C/D domain of Sp1, which is also required for interaction with ER{alpha} (10, 11). In addition, CFP-Sp1{Delta}DBD inhibited basal activity (Fig. 6EGo) but not hormone-induced transactivation (Fig. 2FGo). Similar inhibitory effects were observed in cells transfected with pM-Sp1/hER{alpha} and Sp1DN, which expresses the C-terminal DBD region of Sp1 (Fig. 6FGo). The results of FRET analysis now confirm that ER{alpha} and Sp1 interact in living cells, and these interactions are enhanced by ligands. These results are consistent with the hormone-dependent regulation of multiple genes in breast cancer cells through the ER/Sp1 pathway where ER{alpha} binds Sp1 but not promoter DNA.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of CFP-Sp1{Delta}DBD/YFP-hER{alpha} Interactions by FRET and Mammalian One-Hybrid Assay in MCF-7 Cells

A and B, Representative FRET images from cells transfected with CFP-Sp1{Delta}DBD and YFP-hER{alpha} (A, top three panels). Images were also acquired 8 min after treatment with DMSO or E2 (10 nM) (A, bottom two panels). The cytoplasmic and nuclear localization of CFP-Sp1{Delta}DBD was observed. B, No significant FRET signal from cells transfected with CFP-Sp1{Delta}DBD/YFP-hER{alpha} construct set was detected from cells treated with E2. In addition, excitation at 480 nm showed that YFP-ER{alpha} is localized in the nucleus (A, bottom two panels). The conditions for acquiring images are described in the Materials and Methods. Images were acquired between 8 and 18 min after treatment with each ligand. Eight to 12 images were acquired per treatment, and each image contains one to five cells to be analyzed. C, Effects of Sp1DN on FRET. MCF-7 cells were transfected with CFP-Sp1/YFP-hER{alpha} and Sp1DN, and the effects of SP1DN on the FRET signal were determined as described in Materials and Methods. Significantly (P < 0.05) decreased FRET efficiency is indicated (**). D, ER{alpha} interactions with wild-type and variant Sp1. MCF-7 cells were cotransfected with hER{alpha} expression plasmid and GAL4 empty vector (pM), GAL4-Sp1 (pMSp1), or GAL4-Sp1 deletion mutants (pMSp1A, pMSp1B, pMSp1C/D, and pMSp1D). (Legend continues on next page.)

E2-induced luciferase activity was only observed in cells transfected with constructs containing an intact DBD of Sp1. E, Effects of CFP-Sp1{Delta}DBD on transactivation. CFP-Sp1{Delta}DBD expression plasmid and pSp13 were transfected into ZR-75 cells, and basal luciferase activity was determined as described in Materials and Methods. The total amount of transfected CFP per well was balanced out by CFP-Sp1{Delta}DBD and empty vector, and significantly (P < 0.05) decreased activity is indicated (**). Fold induction by E2 was unchanged (data not shown). F, Effects of Sp1DN on hormone-induced transactivation in MCF-7 cells. Cells were treated with DMSO or 10 nM E2, transfected with pM-Sp1, hER{alpha}, and different amounts of Sp1DN, and luciferase activities were determined as described above. Significant (P < 0.05) inhibition of induced activity is indicated (**). Significant (P < 0.05) induction by E2 in C and D is indicated (*).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Advances in fluorescence microscopy coupled with development of multiple color variants of GFPs, derived from the jellyfish, Aequoria victoria, have greatly facilitated visualization of protein-protein interactions in living cells by FRET and image analysis. FRET is a quantum mechanical process in which energy from an excited donor fluorophore is transferred to a low-energy acceptor fluorophore via a long-range dipole-dipole interaction in a nonradiative manner (37, 38, 39, 40, 41, 42). The efficiency of energy transfer (FRET efficiency) depends on the distance between the donor and acceptor fluorophores (1–10 nm), the extent of spectral overlap between the donor and acceptor, the quantum yield of the donor, and the relative orientation of the donor and acceptor (32). It is critical to selectively extract the background signals from sensitized emission of the FRET pair, and this requires extensive corrections to accurately determine FRET. A CFP and a YFP have been successfully used as FRET pairs for detection of intermolecular protein-protein interactions. Heteromerization of G proteins, dimerization of receptor tyrosine phosphatase, and interaction between nuclear transporter factors have all been visualized in living cells through generation of CFP and YFP fusion proteins (30, 43, 44).

Recently, ligand-dependent interactions of ER{alpha} with ERß and ER interactions with steroid receptor coactivators of LXXLL peptides (SRC interacting domains) have been detected in living cells using FRET (20, 45, 46). In this study, we have investigated ligand-dependent hER{alpha}-Sp1 protein interactions in living cells by using FRET microscopy and image analysis. Previous studies have identified ER{alpha} and Sp proteins associated with GC-rich promoters using DNA footprinting electrophoretic mobility shift or chromatin immunoprecipitation assays and ER{alpha} interacts with Sp1 and Sp3 in pull-down and coimmunoprecipitation assays (10, 11, 16, 24, 27). The results illustrated in Fig. 2Go show that individual transcriptional activities of CFP- and YFP-ER and Sp1 fusion proteins are comparable to those of wild-type proteins in MDA-MB-231, MCF-7, and ZR-75 breast cancer cells transfected with constructs containing ERE or GC-rich promoters. In addition, coexpression of CFP-Sp1 and hER{alpha} increased both the basal and inducible levels of luciferase activities. Acquired images using two-photon excitation fluorescence microscopy with a three-filter set indicated that FRET signals from cells transfected with the CFP-YFP chimera were much higher than those observed in the negative control cells (Fig. 3BGo). In cells cotransfected with CFP-hER{alpha} and YFP-hER{alpha}, E2 induced translocation of the fusion proteins from the cytoplasm into the nucleus; the enhanced FRET signal indicated ligand-induced ER homodimerization, and this was consistent with previous reports using FRET to investigate ligand-induced ER interactions (28, 32, 33, 34).

To accurately determine ligand-dependent interactions of hER{alpha}/Sp1 using FRET, we first set the range from minimum to maximum levels of either CFP or YFP expression as the selection criterion because individual cells can express different amounts of donor and acceptor proteins by variability in transfection efficiency. Values from cells that did not fit this criterion for correcting variations in fluorophore expression level were eliminated. Secondly, it was assumed that the ratio of positive control FRET signal to negative control FRET signal, which is {cong}2.0, would represent 50% FRET efficiency, and, based on this assumption, additional calculations for measuring FRET efficiency were performed. Enhanced ligand-dependent dimerization between CFP-hER{alpha} and YFP-hER{alpha} (Fig. 3Go, A and C) has been reported previously (28), and this dimerization property was used as another positive control for confirming the method described above for quantifying FRET efficiency. The order of FRET efficiency for ligand-induced CFP-hER{alpha}/YFP-hER{alpha} or CFP-Sp1/YFP-hER{alpha} interactions was similar (4-OHT > E2 > ICI 182,780) (Fig. 3Go, D and F), and all ligands induced an increase in protein-protein interactions in living cells. However, the overall FRET efficiencies in CFP-Sp1/YFP-hER{alpha} were relatively lower than observed for CFP-hER{alpha}/YFP-hER{alpha}, indicating that the increased size and molecular weight of CFP-Sp1 may induce an unfavorable orientation between the fusion proteins and decrease overall FRET efficiency. Previous studies have also shown ligand structure-dependent differences in ER dimer formation, stability, and dissociation, and these were not necessarily related to ligand-binding affinities (34, 47). Differences in FRET efficiencies for E2, 4-OHT, and ICI 182,780 observed in this study will therefore be due not only to ER{alpha}-Sp1 interactions but also to the stability of both ER and ER/Sp1 complexes and their rate of nuclear translocation.

Variations in YFP intensity over time were measured after addition of each ligand to assess CFP-Sp1 interactions with YFP-ER{alpha}. The ratio between CFP fusion and YFP fusion proteins cannot affect the overall YFP signal (FRET signal plus background signal). DMSO did not alter YFP intensity over time (Fig. 4Go), whereas all other ligands, including E2, 4-OHT and ICI 182,780, increased YFP intensity with a slight fluctuating pattern. The final order of YFP intensity 7.5 min after ligand addition was the same as the order of FRET efficiency measured in Fig. 3Go, and this was consistent with ligand-dependent hER{alpha}/Sp1 interactions in living cells. Furthermore, coimmunoprecipitation for YFP-hER{alpha}/Sp1 has also been carried out to confirm the ligand-dependent interactions of these proteins in vivo (Fig. 5Go). These results demonstrate that ER ligands not only induce ER subtype dimerization as previously shown by FRET analysis (28) but also induce ER{alpha} interactions with Sp1.

The critical role of Sp1 DBD for ER binding has been previously demonstrated in vitro by a GST pull-down assay (11) and was further analyzed in this study using FRET and a one-hybrid assay. CFP-Sp1{Delta}DBD was detected in both the nucleus and cytoplasm in transfected cells, whereas YFP-ER{alpha} is primarily nuclear (Fig. 6AGo). The YFP signal (Fig. 6AGo top, middle E2 panel) is primarily due to background (or bleed) excitation of CFP to the YFP channel. The results show that FRET efficiency in MCF-7 cells for CFP-Sp1{Delta}DBD/YFP-hER{alpha} was minimal compared with the CFP-Sp1/YFP-hER{alpha} pair (Fig. 6BGo). In addition, these data were complemented by mammalian one-hybrid analysis of GAL4-Sp1 (wild-type and mutant) activation by E2 and hER{alpha} in which the C-terminal C/D domain was required for induction of luciferase activity (Fig. 6DGo) and overexpression of Sp1DN also decreased hormone-enhanced FRET efficiency (Fig. 6CGo). These data are consistent with previous reports showing that ER{alpha}-Sp1 interactions were dependent on the C-terminal region of Sp1, which also interacts with many other transcription factors including nuclear receptors (12). The nonclassical activation of estrogen-responsive genes through ER/Sp interactions with GC-rich promoters in breast cancer cells has also been observed in other cell lines (48, 49, 50, 51, 52) and for other ligand-activated and orphan nuclear receptors, including the progesterone receptor (53, 54), androgen receptor (55, 56), retinoic acid and retinoic X receptors (57, 58, 59), peroxisome proliferator-activated receptor {gamma} (60), chicken ovalbumin upstream-promoter transcription factor (61, 62), steroidogenic factor-1 (63, 64), and the vitamin D receptor (65). Using FRET analysis and ER{alpha}/Sp1 as a model, we have now shown that nuclear receptor-mediated transactivation through nuclear receptor-protein-DNA interactions involves direct protein-protein interactions in living cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
No experimental animals were used in this study.

Chemicals and Biochemicals
DMEM nutrient mixture F-12 (DME/F12) without phenol red, PBS, E2, 4-OHT, BSA (Fraction V), and 100x antibiotic/antimycotic solution were purchased from Sigma (St. Louis, MO). Fetal bovine serum (FBS) was obtained from JRH Biosciences (Lenexa, KS). ICI 182,780 was kindly provided by Dr. Alan Wakeling (Astra USA, Inc.–Zeneca Pharmaceuticals, Macclesfield, UK). All the restriction enzymes and modifying enzymes (T4 DNA ligase, calf intestinal alkaline phosphatase) used in this study were purchased from Promega Corp. (Madison, WI) or Roche Molecular Biochemicals (Indianapolis, IN). Plasmid preparation kits were purchased from QIAGEN (Valencia, CA), and 40% polyacrylamide was obtained from National Diagnostics (Atlanta, GA). All other chemicals were obtained from commercial sources at the highest quality available.

Cell Maintenance and Transient Transfection Assay
MCF-7, MDA-MB-231, and ZR-75 cells were obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells were grown in DME/F12 supplemented with 2.2 g/liter sodium bicarbonate, 5% FBS, BSA, and 10 ml/liter antibiotic/antimycotic solution; and ZR-75 cells were maintained in RPMI 1640 medium with phenol red and supplemented with 10% FBS, sodium pyruvate, sodium bicarbonate, and glucose. Cells were cultured and maintained in 150 cm2 tissue culture dishes at 37 C in 5% CO2:95% air. For transient transfection assays, cells were seeded in six-well tissue culture plates in DME/F12 without phenol red supplemented with 2.2 g/liter sodium bicarbonate, 5% dextran-coated charcoal-stripped FBS, BSA, and 10 ml/liter antibiotic/antimycotic solution. After 24 h, cells were transfected using calcium phosphate and 500 ng pGAL4-luc (containing five tandem GAL4 response elements linked to luciferase), pSp13, or pERE3 (29); 100 ng pcDNA3/His/lacZ (Invitrogen, Carlsbad, CA) was also cotransfected as a standard reference for transfection efficiency. After 5–6 h, the media were removed, and cells were shocked with 20% glycerol in PBS (pH 7.4) for 1 min. Cells were rinsed twice with 1 ml PBS and treated with 5% charcoal-stripped DME/F12 containing DMSO, E2 (10 nM), 4-OHT (1 µM), or ICI 182,780 (1 µM) for 36–40 h. After harvesting cells by scraping in 1x reporter lysis buffer (Promega), luciferase activity was determined on aliquots of this extract using the luciferase assay system (Promega). ß-Galactosidase activity was performed using Tropic Galacto-Light Plus assay system (Tropix, Bedford, MA). Light emission was detected on a LumiCount microwell plate reader (Packard, Meriden, CT), and luciferase reporter gene activity was corrected by normalizing against ß-galactosidase activity, obtained from the same sample. Results are expressed as means ± SD with at least three determinations for each treatment group.

Coimmunoprecipitation and Western Blot Analysis
Cells were seeded in 35-mm six-well tissue culture plates in phenol red-free DME/F12 medium containing 2.5% charcoal-stripped FBS. When cells were 60–80% confluent, YFP-hER{alpha} and Sp1 expression plasmids were transfected using Lipofectamine Plus Reagent (Invitrogen). After 24 h, transfected cells were treated with DMSO, 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 for 30 min; 1 ml of RIPA buffer (1x PBS, 1% Nonidet P-40 or Igepal CA-630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mg/ml phenylmethylsulfonyl fluoride in isopropanol, aprotinin, 100 nM sodium orthovanadate) was added, and cells were disrupted by repeated aspiration through a 21-gauge needle. Cellular debris was removed by centrifugation at 10,000 x g for 10 min at 4 C, and the supernatant was transferred to a fresh microcentrifuge tube on ice. Lysate was precleared by adding 1.0 µg of the appropriate control normal rabbit IgG together with 20 µl of appropriate suspended (25% vol/vol) protein A/G-agarose conjugate and incubated at 4 C for 30 min. After centrifugation for 30 sec, the supernatant (800 µg total cellular proteins) was transferred to a microcentrifuge tube, 5 µl of rabbit polyclonal anti-GFP antibody (1 µg) (Santa Cruz Biotechnology, Santa Cruz, CA) was added and incubated for 2–3 h at 4 C. The immunoprecipitate was collected by centrifugation, and the pellet was gently washed with 1.0 ml RIPA buffer (2x) and then with PBS. The agarose pellet was then resuspended in 50 µM of 1x Laemmli buffer [50 mM Tris-HCl, 2% sodium dodecyl sulfate, 0.1% bromphenol blue, 175 mM ß-mercaptoethanol], boiled, and centrifuged. The suspended sample was separated by SDS-10% PAGE, electrophoresed to a polyvinylidene difluoride membrane. The membrane was blocked in Blotto [5% milk, Tris-buffered saline (10 nM Tris-HCl, pH 8.0, 150 mM NaCl), and 0.05% Tween 20] and probed with primary antibodies for Sp1 (PEP2) or ER{alpha} (H184) for 3 h at room temperature. After incubation with peroxidase-conjugated secondary antibody, Igs were visualized using the enhanced chemiluminescence detection system (NEN, Boston, MA).

FRET Microscopy and Analysis
To perform FRET, cells were washed with DME/F12 medium containing 5% serum and then put on the stage of the Bio-Rad 2000MP system (Bio-Rad Laboratories, Hercules, CA) equipped with a Nikon T#300 inverted microscope with a 60x (NA1.2) water immersion objective lens and a Titanium:Saphire laser tuned to 820-nm wavelength and Argon/Krypton laser tuned to 488-nm excitation (Table 1Go). Control images were acquired before treatment of cells with DMSO, E2, 4-OHT, or ICI 182,780. Additional images were acquired between 8 and 18 min after addition of each ligand at a speed of 25 images per sec. FRET data in MCF-7 cells transfected with CFP and YFP fusion constructs alone or in combination were collected using 2 photon-820 nM excitation wavelength. Both CFP and YFP were excited at 820 nm to ultimately generate 410 nm for excitation of the CFP and FRET channels. Emission of CFP (CFP channel; donor signal) was collected using a 500DCLP dichroic and 450/80-nm filter whereas emission of YFP (FRET channel; acceptor signal) was collected using a 528/50-nm filter. Donor bleed through signal to the FRET channel was calculated by measuring the FRET channel signal resulting from MCF-7 cells transfected only with the CFP fusion construct. Acceptor bleed through to the FRET channel was calculated by measuring the FRET channel signal resulting from MCF-7 cells transfected with YFP fusion construct alone. For determination of YFP-hER{alpha} localization in YFP channel, YFP-hER{alpha} was excited at 488 nm with argon/krypton laser, and emission of YFP-hER{alpha} was collected at 525/50 nm. To correct for variations in fluorophore expression resulting from different transfection efficiencies, minimum levels of YFP expression and maximum levels of CFP were selected based on data collected from each experiment. Cells that did not match the selection criteria were eliminated from the FRET analysis. Negative (CFP empty and YFP empty) and positive (CFP-YFP chimera) controls were used to calculate the approximate FRET efficiency in cells treated with different ligands; it was assumed that the signal from cells transfected with the positive CFP-YFP chimera construct will exhibit 50% FRET efficiency when compared with signals from cells transfected with CFP/YFP empty constructs.


View this table:
[in this window]
[in a new window]
 
Table 1. Excitation and Emission of Fluorescent Proteins

 
For identification of region of interest and FRET analysis, MetaMorph software version 6.0 (Universal Imaging Corp., Downingtown, PA) was used. Acceptor signal acquired with the FRET channel was corrected by subtracting the background signal as well as the donor bleed through signal. Ten to 15 images were collected from each sample, and one to five cells per image captured were analyzed. Three to five experiments for each combination of transfected fusion constructs were conducted on different days. Student’s t test was used to analyze the statistical significance between control and ligand-treated cells at P < 0.05, and this analysis was performed using Prism software version 4.0 (GraphPad Software, Inc., San Diego, CA).

Plasmid Construction for FRET
CFP-C1 and YFP-C1 mammalian expression vectors were obtained from BD Biosciences CLONTECH Laboratories, Inc. (Palo Alto, CA). The CFP-YFP chimera was generated by PCR using the following primer set: 5' TCCCCGCGGTAGCCGCCATGGTGAGCAAGGGC-GAGGAGCTG 3' (sense) and 5-CGGGATCCCTTGTACAGCTCGTCCATGCCGAG 3' (anti-sense). The PCR product was digested with SacII and BamHI and cloned into the CFP-C1 vector (28, 30, 31). CFP-hER{alpha} and YFP-hER{alpha} were made by PCR using the following primer set: 5' TTCGAATTCTATGACCATGACCCTCC ACACCAAAGCA 3' (sense) and 5' TAGTCGACTCAGACTGTGGCAGGGA AACCCTC 3' (antisense); the primer set for CFP-Sp1 is 5' TTCGAATTCTACAGGTGAGCTTGACCTCACAGCC 3' (sense) and 5' TAGTCGACTCAGAAGCCATTGCCACTGATATT 3' (antisense). The PCR product was digested with EcoRI and SalI and cloned into either the CFP or YFP con-struct. CFP-Sp1{Delta}DBD was generated through deletion of 613–788 aa by BamHI treatment of CFP-Sp1 construct, and the remaining portion of the construct was religated. Sp1DN plasmid (Sp1DN containing 592–778 aa) was provided by Drs. Yoshihiro Sowa and Toshiyuki Sakai (Kyoto Prefectural University of Medicine, Kyoto, Japan). pMGAL4-Sp1(83–778aa) and pMGAL4-Sp1AB(83–621 aa) constructs were obtained from Dr. Stephen Smale (University of California–Los Angeles). pMGAL4-Sp1CD (543–778aa) and pMGAL4-Sp1D (622–778 aa) were generated using PCR. The primer sets for pMGAL4-Sp1CD are 5' TCCGGATCCGCCTGCCGTTGGCTATAGCA AAT 3' (sense) and 5' GTATGTCGACATCAGAAGCCATTGCCACTGATATT 3' (antisense); and primer sets for pMGAL4-Sp1D (635–788aa) are 5' TCCGGATCCGCCTGCCGTTGGCTATA GCAAAT 3' (sense) and the same antisense primer above. The PCR products were di-gested with BamHI and SalI and cloned into pM constructs. pMGAL4-Sp1B (263–542 aa) fragment was PCR amplified by using the primer set of 5' TCCGTCGACGCAACAGCGTTTCTGCAGCTACC 3' (sense) and 5' TATCTAGAATCAGCCTTGAATTGGGTGCACCTG 3' (antisense); then it was digested with SalI and XbaI, and finally cloned into the pM construct.

Statistical Analysis
The statistical difference among different groups was determined by ANOVA and Scheffe’s post hoc test. The data are expressed as the mean ± SD for at least three determinations. Treatments were considered significantly different from controls if P < 0.05.


    FOOTNOTES
 
This work was financially supported by the National Institutes of Health (ES09106 and CA104116) and the Texas Agricultural Experiment Station.

First Published Online January 6, 2005

Abbreviations: aa, Amino acids; AF, activation function; AP1, activator protein-1; CFP, cyan fluorescent protein; DBD, DNA binding domain; DME/F12, DMEM nutrient mixture F-12; DMSO, dimethylsulfoxide; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen-responsive element; FBS, fetal bovine serum; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; GST, glutathione S-transferase; 4-OHT, 4-hydroxytamoxifen; Sp1DN, Sp1 dominant negative; YFP, yellow fluorescent protein.

Received for publication August 19, 2004. Accepted for publication December 23, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  2. Altucci L, Gronemeyer H 2001 Nuclear receptors in cell life and death. Trends Endocrinol Metab 12:460–468[CrossRef][Medline]
  3. Nilsson S, Gustafsson JA 2002 Biological role of estrogen and estrogen receptors. Crit Rev Biochem Mol Biol 37:1–28[CrossRef][Medline]
  4. Olefsky JM 2001 Nuclear receptor minireview series. J Biol Chem 276:36863–36864[Free Full Text]
  5. Hall JM, Couse JF, Korach KS 2001 The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 276:36869–36872[Free Full Text]
  6. Acevedo ML, Kraus WL 2003 Mediator and p300/CBP-steroid receptor coactivator complexes have distinct roles, but function synergistically, during estrogen receptor {alpha}-dependent transcription with chromatin templates. Mol Cell Biol 23:335–348[Abstract/Free Full Text]
  7. Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  8. Reid G, Hubner MR, Metivier R, Brand H, Denger S, Manu D, Beaudouin J, Ellenberg J, Gannon F 2003 Cyclic, proteasome-mediated turnover of unliganded and liganded ER{alpha} on responsive promoters is an integral feature of estrogen signaling. Mol Cell 11:695–707[CrossRef][Medline]
  9. Acevedo ML, Lee KC, Stender JD, Katzenellenbogen BS, Kraus WL 2004 Selective recognition of distinct classes of coactivators by a ligand-inducible activation domain. Mol Cell 13:725–738[CrossRef][Medline]
  10. Porter W, Saville B, Hoivik D, Safe S 1997 Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol 11:1569–1580[Abstract/Free Full Text]
  11. Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson J-A, Safe S 2000 Ligand-, cell- and estrogen receptor subtype ({alpha}/ß)-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:5379–5387[Abstract/Free Full Text]
  12. Safe S, Kim K 2004 Nuclear receptor-mediated transactivation through interaction with Sp proteins. Prog Nucleic Acid Res Mol Biol 77:1–36[Medline]
  13. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  14. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson J-Å, Nilsson S, Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  15. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  16. Khan S, Abdelrahim M, Samudio I, Safe S 2003 Estrogen receptor/Sp1 complexes are required for induction of cad gene expression by 17ß-estradiol in breast cancer cells. Endocrinology 144:2325–2335[Abstract/Free Full Text]
  17. Wang W, Dong L, Saville B, Safe S 1999 Transcriptional activation of E2F1 gene expression by 17ß-estradiol in MCF-7 cells is regulated by NF-Y-Sp1/estrogen receptor interactions. Mol Endocrinol 13:1373–1387[Abstract/Free Full Text]
  18. Ngwenya S, Safe S 2003 Cell context-dependent differences in the induction of E2F-1 gene expression by 17ß-estradiol in MCF-7 and ZR-75 cells. Endocrinology 144:1675–1685[Abstract/Free Full Text]
  19. Xie W, Duan R, Safe S 1999 Estrogen induces adenosine deaminase gene expression in MCF-7 human breast cancer cells: role of estrogen receptor-Sp1 interactions. Endocrinology 140:219–227[Abstract/Free Full Text]
  20. Sun G, Porter W, Safe S 1998 Estrogen-induced retinoic acid receptor {alpha}1 gene expression: role of estrogen receptor-Sp1 complex. Mol Endocrinol 12:882–890[Abstract/Free Full Text]
  21. Qin C, Singh P, Safe S 1999 Transcriptional activation of insulin-like growth factor binding protein 4 by 17ß-estradiol in MCF-7 cells: role of estrogen receptor-Sp1 complexes. Endocrinology 140:2501–2508[Abstract/Free Full Text]
  22. Dong L, Wang W, Wang F, Stoner M, Reed JC, Harigai M, Kladde M, Vyhlidal C, Safe S 1999 Mechanisms of transcriptional activation of bcl-2 gene expression by 17ß-estradiol in breast cancer cells. J Biol Chem 174:32099–32107
  23. Xie W, Duan R, Chen I, Samudio I, Safe S 2000 Transcriptional activation of thymidylate synthase by 17ß-estradiol in MCF-7 human breast cancer cells. Endocrinology 141:2439–2449[Abstract/Free Full Text]
  24. Samudio I, Vyhlidal C, Wang F, Stoner M, Chen I, Kladde M, Barhoumi R, Burghardt R, Safe S 2001 Transcriptional activation of DNA polymerase {alpha} gene expression in MCF-7 cells by 17ß-estradiol. Endocrinology 142:1000–1008[Abstract/Free Full Text]
  25. Castro-Rivera E, Samudio I, Safe S 2001 Estrogen regulation of cyclin D1 gene expression in ZR-75 breast cancer cells involves multiple enhancer elements. J Biol Chem 276:30853–30861[Abstract/Free Full Text]
  26. Wang F, Samudio I, Safe S 2002 Transcriptional activation of rat creatine kinase B by 17ß-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites. J Cell Biochem 84:156–172
  27. Stoner M, Wormke M, Saville B, Samudio I, Qin C, Abdelrahim M, Safe S 2004 Estrogen regulation of vascular endothelial growth factor gene expression in ZR-75 breast cancer cells through interaction of estrogen receptor {alpha} and Sp proteins. Oncogene 23:1052–1063[CrossRef][Medline]
  28. Bai Y, Giguere V 2003 Isoform-selective interactions between estrogen receptors and steroid receptor coactivators promoted by estradiol and ErbB-2 signaling in living cells. Mol Endocrinol 17:589–599[Abstract/Free Full Text]
  29. Kim K, Nguyen T, Saville B, Safe S 2003 Domains of estrogen receptor {alpha} (ER{alpha}) required for ER{alpha}/Sp1-mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol Endocrinol 17:804–817[Abstract/Free Full Text]
  30. Damelin M, Silver PA 2000 Mapping interactions between nuclear transport factors in living cells reveals pathways through the nuclear pore complex. Mol Cell 5:133–140[CrossRef][Medline]
  31. Zimmermann T, Rietdorf J, Girod A, Georget V, Pepperkok R 2002 Spectral imaging and linear un-mixing enables improved FRET efficiency with a novel GFP2-YFP FRET pair. FEBS Lett 531:245–249[CrossRef][Medline]
  32. Salomonsson M, Carlsson B, Haggblad J 1994 Equilibrium hormone binding to human estrogen receptors in highly diluted cell extracts is non-cooperative and has a Kd of approximately 10 pM. J Ster Biochem Mol Biol 50:313–318[CrossRef][Medline]
  33. Kumar V, Chambon P 1988 The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 55:145–156[CrossRef][Medline]
  34. Tamrazi A, Carlson KE, Daniels JR, Hurth KM, Katzenellenbogen JA 2002 Estrogen receptor dimerization: ligand binding regulates dimer affinity and dimer dissociation rate. Mol Endocrinol 16:2706–2719[Abstract/Free Full Text]
  35. Stenoien DL, Mancini MG, Patel K, Allegretto EA, Smith CL, Mancini MA 2000 Subnuclear trafficking of estrogen receptor-{alpha} and steroid receptor coactivator-1. Mol Endocrinol 14:518–534[Abstract/Free Full Text]
  36. Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL, O’Malley BW, Mancini MA 2001 FRAP reveals that mobility of oestrogen receptor-{alpha} is ligand- and proteasome-dependent. Nat Cell Biol 3:15–23[CrossRef][Medline]
  37. Day RN, Periasamy A, Schaufele F 2001 Fluorescence resonance energy transfer microscopy of localized protein interactions in the living cell nucleus. Methods 25:4–18[CrossRef][Medline]
  38. Gordon GW, Berry G, Liang XH, Levine B, Herman B 1998 Quantitative fluorescence resonance energy transfer measurements using fluorescence microscopy. Biophys J 74:2702–2713[Medline]
  39. Elangovan M, Wallrabe H, Chen Y, Day RN, Barroso M, Periasamy A 2003 Characterization of one- and two-photon excitation fluorescence resonance energy transfer microscopy. Methods 29:58–73[CrossRef][Medline]
  40. Wallrabe H, Elangovan M, Burchard A, Periasamy A, Barroso M 2003 Confocal FRET microscopy to measure clustering of ligand-receptor complexes in endocytic membranes. Biophys J 85:559–571[Medline]
  41. Miyawaki A, Llopis J, Heim R, McCaffery JM, Adams JA, Ikura M, Tsien RY 1997 Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin. Nature 388:882–887[CrossRef][Medline]
  42. Periasamy A 2001 Fluorescence resonance energy transfer microscopy: a mini review. J Biomed Opt 6:287–291[CrossRef][Medline]
  43. Janetopoulos C, Jin T, Devreotes P 2001 Receptor-mediated activation of heterotrimeric G-proteins in living cells. Science 291:2408–2411[Abstract/Free Full Text]
  44. Tertoolen LG, Blanchetot C, Jiang G, Overvoorde J, Gadella TWJ, Hunter T, den Hertog J 2001 Dimerization of receptor protein-tyrosine phosphatase {alpha} in living cells. BMC Cell Biol 2:8[CrossRef][Medline]
  45. Llopis J, Westin S, Ricote M, Wang Z, Cho CY, Kurokawa R, Mullen TM, Rose DW, Rosenfeld MG, Tsien RY, Glass CK, Wang J 2000 Ligand-dependent interactions of coactivators steroid receptor coactivator-1 and peroxisome proliferator-activated receptor binding protein with nuclear hormone receptors can be imaged in live cells and are required for transcription. Proc Natl Acad Sci USA 97:4363–4368[Abstract/Free Full Text]
  46. Weatherman RV, Chang CY, Clegg NJ, Carroll DC, Day RN, Baxter JD, McDonnell DP, Scanlan TS, Schaufele F 2002 Ligand-selective interactions of ER detected in living cells by fluorescence resonance energy transfer. Mol Endocrinol 16:487–496[Abstract/Free Full Text]
  47. Wang H, Peters GA, Zeng X, Tang M, Ip W, Khan SA 1995 Yeast two-hybrid system demonstrates that estrogen receptor dimerization is ligand-dependent in vivo. J Biol Chem 270:23322–23329[Abstract/Free Full Text]
  48. Bischoff ED, Heyman RA, Lamph WW 1999 Effect of the retinoid X receptor-selective ligand LGD1069 on mammary carcinoma after tamoxifen failure. J Natl Cancer Inst 91:2118–2123[Abstract/Free Full Text]
  49. Tanaka N, Yonekura H, Yamagishi S, Fujimori H, Yamamoto Y, Yamamoto H 2000 The receptor for advanced glycation end products is induced by the glycation products themselves and tumor necrosis factor-{alpha} through nuclear factor-{kappa}B, and by 17ß-estradiol through Sp-1 in human vascular endothelial cells. J Biol Chem 275:25781–25790[Abstract/Free Full Text]
  50. Li C, Briggs MR, Ahlborn TE, Kraemer FB, Liu J 2001 Requirement of Sp1 and estrogen receptor {alpha} interaction in 17ß-estradiol-mediated transcriptional activation of the low-density lipoprotein receptor gene expression. Endocrinology 142:1546–1553[Abstract/Free Full Text]
  51. Jacobson D, Pribnow D, Herson PS, Maylie J, Adelman JP 2003 Determinants contributing to estrogen-regulated expression of SK3. Biochem Biophys Res Commun 303:660–668[CrossRef][Medline]
  52. Schultz JR, Petz LN, Nardulli AM 2003 Estrogen receptor {alpha} and Sp1 regulate progesterone receptor gene expression. Mol Cell Endocrinol 201:165–175[CrossRef][Medline]
  53. Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB 1998 Progesterone regulates transcription of the p21WAF1 cyclin-dependent kinase inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273:10696–10701[Abstract/Free Full Text]
  54. Simmen RCM, Chung TE, Imataka H, Michel FJ, Badinga L, Simmen FA 1999 Trans-activation functions of the Sp-related nuclear factor, basic transcription element-binding protein, and progesterone receptor in endometrial epithelial cells. Endocrinology 140:2517–2525[Abstract/Free Full Text]
  55. Lu S, Jenster G, Epner DE 2000 Androgen induction of cyclin-dependent kinase inhibitor p21 gene: role of androgen receptor and transcription factor Sp1 complex. Mol Endocrinol 14:753–760[Abstract/Free Full Text]
  56. Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, Rissman E, Wilson EM, Shupnik MA 2001 Androgen suppression of GnRH-stimulated rat LHß gene transcription occurs through Sp1 sites in the distal GnRH-responsive promoter region. Mol Endocrinol 15:1906–1917[Abstract/Free Full Text]
  57. Husmann M, Dragneva Y, Romahn E, Jehnichen P 2000 Nuclear receptors modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation. Biochem J 352:763–772
  58. Suzuki Y, Shimada J, Shudo K, Matsumura M, Crippa MP, Kojima S 1999 Physical interactions between retinoic acid receptor and Sp1: mechanism for induction of urokinase by retinoic acid. Blood 93:4264–4276[Abstract/Free Full Text]
  59. Shimada J, Suzuki Y, Kim SJ, Wang PC, Matsumura M, Kojima S 2001 Transactivation via RAR/RXR-Sp1 interaction: characterization of binding between Sp1 and GC box motif. Mol Endocrinol 15:1677–1692[Abstract/Free Full Text]
  60. Sugawara A, Uruno A, Kudo M, Ikeda Y, Sato K, Taniyama Y, Ito S, Takeuchi K 2002 Transcription suppression of thromboxane receptor gene by peroxisome proliferator-activated receptor-{gamma} via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277:9676–9683[Abstract/Free Full Text]
  61. Rohr O, Aunis D, Schaeffer E 1997 COUP-TF and Sp1 interact and cooperate in the transcriptional activation of the human immunodeficiency virus type 1 long terminal repeat in human microglial cells. J Biol Chem 272:31149–31155[Abstract/Free Full Text]
  62. Pipaón C, Tsai SY, Tsai MJ 1999 COUP-TF upregulates NGFI-A gene expression through an Sp1 binding site. Mol Cell Biol 19:2734–2745[Abstract/Free Full Text]
  63. Liu Z, Simpson ER 1999 Molecular mechanism for cooperation between Sp1 and steroidogenic factor-1 (SF-1) to regulate bovine CYP11A gene expression. Mol Cell Endocrinol 153:183–196[CrossRef][Medline]
  64. Sugawara T, Saito M, Fujimoto S 2000 Sp1 and SF-1 interact and cooperate in the regulation of human steroidogenic acute regulatory protein gene expression. Endocrinology 141:2895–2903[Abstract/Free Full Text]
  65. Huang YC, Chen JY, Hung WC 2004 Vitamin D3 receptor/Sp1 complex is required for the induction of p27Kip1 expression by vitamin D3. Oncogene 23:4856–4861[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα
Ligands:   17β-Estradiol  |  4-Hydroxytamoxifen



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
C. E. Mason, F.-J. Shu, C. Wang, R. M. Session, R. G. Kallen, N. Sidell, T. Yu, M. H. Liu, E. Cheung, and C. B. Kallen
Location analysis for the estrogen receptor-{alpha} reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements
Nucleic Acids Res., January 4, 2010; (2010) gkp1188v1.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S. Safe and K. Kim
Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways
J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Wu, R. Xu, K. Kim, J. Martin, and S. Safe
In Vivo Profiling of Estrogen Receptor/Specificity Protein-Dependent Transactivation
Endocrinology, November 1, 2008; 149(11): 5696 - 5705.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg
Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain
Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
L. Maneix, G. Beauchef, A. Servent, Y. Wegrowski, F. X. Maquart, N. Boujrad, G. Flouriot, J. P. Pujol, K. Boumediene, P. Galera, et al.
17{beta}-Oestradiol up-regulates the expression of a functional UDP-glucose dehydrogenase in articular chondrocytes: comparison with effects of cytokines and growth factors
Rheumatology, March 1, 2008; 47(3): 281 - 288.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
S. Khan, F. Wu, S. Liu, Q. Wu, and S. Safe
Role of specificity protein transcription factors in estrogen-induced gene expression in MCF-7 breast cancer cells
J. Mol. Endocrinol., October 1, 2007; 39(4): 289 - 304.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Levy, X. Zhao, H. Tang, R. B. Jaffe, T. P. Speed, and D. C. Leitman
Multiple Transcription Factor Elements Collaborate with Estrogen Receptor {alpha} to Activate an Inducible Estrogen Response Element in the NKG2E Gene
Endocrinology, July 1, 2007; 148(7): 3449 - 3458.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Padron, L. Li, E. M. Kofoed, and F. Schaufele
Ligand-Selective Interdomain Conformations of Estrogen Receptor-{alpha}
Mol. Endocrinol., January 1, 2007; 21(1): 49 - 61.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S. Hiscox, N. J Jordan, W. Jiang, M. Harper, R. McClelland, C. Smith, and R. I Nicholson
Chronic exposure to fulvestrant promotes overexpression of the c-Met receptor in breast cancer cells: implications for tumour-stroma interactions
Endocr. Relat. Cancer, December 1, 2006; 13(4): 1085 - 1099.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. Maor, D. Mayer, R. I Yarden, A. V Lee, R. Sarfstein, H. Werner, and M. Z Papa
Estrogen receptor regulates insulin-like growth factor-I receptor gene expression in breast tumor cells: involvement of transcription factor Sp1
J. Endocrinol., December 1, 2006; 191(3): 605 - 612.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg
Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS
J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Eeckhoute, J. S. Carroll, T. R. Geistlinger, M. I. Torres-Arzayus, and M. Brown
A cell-type-specific transcriptional network required for estrogen regulation of cyclin D1 and cell cycle progression in breast cancer
Genes & Dev., September 15, 2006; 20(18): 2513 - 2526.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Khan, R. Barhoumi, R. Burghardt, S. Liu, K. Kim, and S. Safe
Molecular Mechanism of Inhibitory Aryl Hydrocarbon Receptor--Estrogen Receptor/Sp1 Cross Talk in Breast Cancer Cells
Mol. Endocrinol., September 1, 2006; 20(9): 2199 - 2214.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Monslow, J. D. Williams, D. J. Fraser, D. R. Michael, P. Foka, A. P. Kift-Morgan, D. D. Luo, C. A. Fielding, K. J. Craig, N. Topley, et al.
Sp1 and Sp3 Mediate Constitutive Transcription of the Human Hyaluronan Synthase 2 Gene
J. Biol. Chem., June 30, 2006; 281(26): 18043 - 18050.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Abdelrahim, E. Ariazi, K. Kim, S. Khan, R. Barhoumi, R. Burghardt, S. Liu, D. Hill, R. Finnell, B. Wlodarczyk, et al.
3-Methylcholanthrene and Other Aryl Hydrocarbon Receptor Agonists Directly Activate Estrogen Receptor {alpha}
Cancer Res., February 15, 2006; 66(4): 2459 - 2467.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. He, J.-M. Sun, L. Li, and J. R. Davie
Differential Intranuclear Organization of Transcription Factors Sp1 and Sp3
Mol. Biol. Cell, September 1, 2005; 16(9): 4073 - 4083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, K.
Right arrow Articles by Safe, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, K.
Right arrow Articles by Safe, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals