| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer
Departments of Veterinary Physiology and Pharmacology (KK., S.S.), and Veterinary Anatomy and Public Health (R.Ba., R.Bu.), Texas A&M University, College Station, Texas 77843; and Institute of Biosciences and Technology (S.S.), Texas A&M University System Health Science Center, Houston, Texas 77030-3303
Address all correspondence and requests for reprints to: Stephen Safe, Department of Veterinary Physiology and Pharmacology, Texas A&M University, 4466 TAMU, Veterinary Research Building 409, College Station, Texas 77843-4466. E-mail: ssafe{at}cvm.tamu.edu.
| ABSTRACT |
|---|
|
|
|---|
/Sp1 with GC-rich promoter elements. This study investigates ligand-dependent interactions of ER
and Sp1 in MCF-7 breast cancer cells using fluorescence resonance energy transfer (FRET). Chimeric ER
and Sp1 proteins fused to cyan fluorescent protein or yellow fluorescent protein were transfected into MCF-7 cells, and a FRET signal was induced after treatment with 17ß-estradiol, 4'-hydroxytamoxifen, or ICI 182,780. Induction of FRET by these ER
agonists/antagonists was paralleled by their activation of gene expression in cells transfected with a construct (pSp13) containing three tandem Sp1 binding sites linked to a luciferase reporter gene. In contrast, interactions between ER
and Sp1
DBD [a DNA binding domain (DBD) deletion mutant of Sp1] are not observed, and this is consistent with the critical role of the C-terminal DBD of Sp1 for interaction with ER
. Results of the FRET assay are consistent with in vitro studies on ER
/Sp1 interactions and transactivation, and confirm that ER
and Sp1 interact in living breast cancer cells. | INTRODUCTION |
|---|
|
|
|---|
and ß are members of the nuclear receptor superfamily of transcription factors that exhibit a modular domain structure (1, 2, 3, 4, 5). Activation function (AF)1 and AF2 are expressed in the N-terminal A/B and C-terminal E/F domains and are critical regions of ER that interact with nuclear coregulatory and coactivator proteins. The hinge domain D has multiple functions, and all nuclear receptors contain a highly characteristic DNA binding domain (DBD) (C) that forms two zinc fingers that interact with their cognate genomic response elements. Ligand-activation of ER
induces formation of a homodimeric complex the binds estrogen-responsive elements (EREs) in target gene promoters, and the subsequent ordered recruitment of other nuclear factors results in activation of gene expression (6, 7, 8, 9).
In addition to the classical mechanism of ER
-dependent activation of ERE promoters, ER
also activates GC-rich and activator protein-1 (AP1) promoter through interactions with DNA-bound Sp and AP1 proteins, respectively (10, 11, 12, 13, 14, 15). ER
/Sp1- and ER
/AP1-mediated transactivation in breast and other cancer cell lines is ligand dependent but does not require the receptor DBD because ER interacts with other transcription factors but not promoter DNA. Research in this laboratory in MCF-7 and ZR-75 breast cancer cells has shown that several hormone-induced genes associated with cell proliferation, cell cycle progression, and nucleotide metabolism are regulated by ER
/Sp1, and these include vascular endothelial growth factor, bcl-2, cyclin D1, adenosine deaminase, DNA polymerase
, thymidylate synthase, retinoic acid receptor
, creatine kinase B, IGF binding protein 4, cathepsin D, c-fos, E2F1, and carbamoylphosphate synthetase/aspartate carbamyl transferase/dihydroorotase (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27). In vitro studies show that ER
interacts with both Sp1 and Sp3, and the C-terminal DBD of Sp1 is the major interaction site for ER
.
Bai and Giguere (28) have studied interactions of ER
and ERß in living cells using fluorescence resonance energy transfer (FRET) and showed that 17ß-estradiol (E2) enhanced receptor dimerization and interactions with coactivators. In this study, we have used FRET to investigate interactions between ER
and Sp1 proteins in living cells. MCF-7 cells were transfected with chimeric ER
and Sp1 proteins fused to cyan fluorescent protein (CFP) or yellow fluorescent protein (YFP), and ligand-dependent interactions were determined. E2, 4-hydroxytamoxifen (4-OHT), and ICI 182,780 induce time-dependent interactions between ER
and Sp1 in MCF-7 cells, and the ligand-induced FRET signal is decreased in cells cotransfected with a dominant negative expression plasmid for Sp1. In contrast, interactions between ER
and Sp1
DBD (a DBD deletion mutant of Sp1) are not observed, and this is consistent with the critical role of the C-terminal DBD of Sp1 for interaction with ER
. Results of the FRET assay are consistent with in vitro studies on ER
/Sp1 interactions and transactivation, and confirm that ER
and Sp1 interact in living breast cancer cells.
| RESULTS |
|---|
|
|
|---|
and Sp1 proteins interact and ER
/Sp1 mediates transcriptional activation of E2-responsive genes through GC-rich promoters (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29). To investigate ER
/Sp1 protein-protein interactions in living cells, we generated various CFP and YFP fusion constructs expressing CFP-YFP chimera, CFP-human (h)ER
, YFP-hER
, CFP-Sp1 and CFP-Sp1
DBD (Fig. 1
or Sp1 did not disrupt transcriptional activities of these transcription factors, the fusion proteins of CFP-hER
or YFP-hER
were first assayed in a transient transfection system. ER-negative MDA-MB-231 cells were transfected with constructs containing three tandem EREs (pERE3) or three tandem GC-rich Sp binding sites (pSp13) along with chimeric CFP-hER
, YFP-hER
, or wild-type hER
expression plasmids. Cells were then treated with 10 nM E2 for 24 h, and results showed that E2-induced transactivation was observed in MDA-MB-231 cells transfected with pERE3 (Fig. 2A
. Thus, both YFP-hER
and CFP-hER
were functional in MDA-MB-231 cells.
|
|
enhanced E2-induced transactivation (Fig. 2D
and CFP-Sp1 enhanced levels of basal and E2-induced activity.
MCF-7 cells were cotransfected with CFP-Sp1 and pSp13 and then treated with 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 for 24 h; increased basal levels of transcription were observed. In contrast, coexpression of YFP-hER
and CFP-Sp1 expression plasmid significantly increased both the basal and estrogen- or antiestrogen-induced luciferase activities in cells transfected only with CFP-Sp1, YFP-hER
, or hER
. However, the overall fold-induction was not significantly changed (Fig. 2E
). These results confirmed that CFP-hER
, YFP-hER
, and CFP-Sp1 fusion proteins designed for the FRET study are effectively transfected into ER-positive and ER-negative breast cancer cells and maintain their ligand-dependent or -independent transcriptional activities that are comparable to those of wild-type hER
or Sp1 (16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29). We also showed that CFP-Sp1
DBD did not affect hormone inducibility in cells transfected with pSp13 (Fig. 2F
).
Detection of Fluorescence Resonance Energy Transfer in Living Cells
We initially investigated ligand-dependent colocalization of CFP-Sp1 with YFP-hER
and CFP-hER
/YFP-hER
in MCF-7 cells. The percentage of CFP-hER
colocalizing with YFP-hER
was significantly increased after treatment with E2 (Fig. 3A
), and colocalization between CFP-hER
and YFP-hER
almost reached 100%, whereas a 10% increase of CFP-Sp1/YFP-hER
colocalization was observed. However, this increase was significant (Fig. 3A
). Interestingly, without ligand, approximately 4050% of CFP-hER
/YFP-hER
or CFP-Sp1/YFP-hER
colocalization was observed, suggesting that dimerization of interactions between ERs or between ER and Sp1 proteins was also ligand independent.
|
To detect ligand-dependent intermolecular protein-protein interactions, we have determined ER receptor dimerization using FRET with different ligands, and these results were compared with those obtained in cells cotransfected with CFP-Sp1 and YFP-hER
. ER dimerization is stabilized by ligand binding, and the liganded ER ligand binding domain is resistant to denaturants (32, 33, 34). Stronger dimerization between ERs has been detected using FRET in living cells after ligand addition (28). MCF-7 cells were transfected with CFP-hER
and YFP-hER
constructs together, and 8 min after ligand treatment, images were acquired under the same conditions for measuring the negative and positive controls (Fig. 3
, C and D). Translocation of both CFP-hER
and YFP-hER
into the nucleus was observed in cells treated with different ligands, and acquired images consistently showed a stronger FRET signal in ligand-treated cells compared with dimethylsulfoxide (DMSO)-treated cells. Representative images from E2-treated cells are illustrated in Fig. 3C
. In addition, a punctated nuclear staining pattern of YFP-hER
over a diffused pattern was observed in cells after E2 treatment (data not shown), and this is consistent with results of previous studies (35, 36).
Direct interactions between ER and Sp proteins have been detected using coimmunoprecipitation and glutathione S-transferase (GST) pull-down assay in vitro, and ER
binds to the zinc finger domain of Sp1 protein (10, 11). However, direct physical interactions between ER
and Sp1 protein have not been investigated in living cells. In contrast to the fractional cytoplasmic localization of unliganded CFP-hER
and YFP-hER
, transfected CFP-Sp1 protein is localized only in the nucleus regardless of different ligand addition (Fig. 3
, E and F). Consistently, in cells transfected with CFP-Sp1 and YFP-hER
constructs, stronger FRET signals were detected after treatment with E2 or antiestrogens (Fig. 3F
).
Based on the FRET conditions established in these experiments (Fig. 3
), ligand-dependent CFP-hER
/YFP-hER
and CFP/Sp1/YFP-hER
interactions were analyzed, and FRET efficiency was calculated for each treatment as described in Materials and Methods. The results indicated that E2, 4-OHT, and ICI 182,780 treatment increased FRET efficiency in cells transfected with CFP-hER
and YFP-hER
(Fig. 3D
), and the order of FRET efficiency was similar to that observed in cells transfected with CFP-Sp1/YFP-hER
(Fig. 3F
).
The time-dependent changes in YFP signal intensity were also investigated in MCF-7 cells transfected with CFP-Sp1 and YFP-ER
and treated with DMSO, 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 (Fig. 4
). The stronger YFP signal was detected as hER
/Sp1 protein-protein interactions were increased over time. To avoid CFP signal bleeding over time, images were acquired in 30-sec intervals for 450 sec. The results showed that DMSO did not change YFP intensity over the time course (Fig. 4
). These results show that ligand binding to YFP-hER
enhanced the efficiency of fluorescence energy transfer from CFP-Sp1 to YFP-hER
due to a ligand-dependent decrease in distance or change in orientation of the two proteins. Interestingly, 4-OHT induced a more rapid increase in YFP intensity, whereas E2 or ICI 182,780 significantly increased YFP intensity only after 240 sec, suggesting that the kinetics of ER
-Sp1 interactions and ER translocation into the nucleus were ligand dependent.
|
and Sp1 was also investigated by using the YFP or CFP portion of the fusion proteins as a tag. MCF-7 cells were transfected with YFP-hER
and Sp1 or CFP-Sp1 and hER
expression plasmids, and whole cell lysates from the transfected cells were immunoprecipitated with anti-green fluorescent protein (GFP) antibody 1520 min after treatment with DMSO or ligands. Western blot analysis of these lysates with Sp1 or ER antibodies showed that E2, 4-OHT, and ICI 182,780 enhanced hER
interactions with Sp1 (Fig. 5
|
/Sp1 interactions in vitro has been previously reported from our laboratory using a GST pull-down assay (11). To further investigate the role of Sp1 DBD, we generated CFP-Sp1
DBD construct containing a deletion of amino acids (aa) 613788 in the DBD of Sp1. This deletion resulted in both nuclear and cytoplasmic localization of CFP-Sp1
DBD proteins, suggesting that a nuclear localization signal may, in part, reside in this region of the Sp1 protein (Fig. 6A
(Fig. 6A
DBD deletion mutant protein was confirmed by Western blot analysis of whole cell lysates from transfected cells (data not shown). There was no significant increase of FRET efficiency in cells transfected with CFP-Sp1
DBD and YFP-hER
, compared with that observed in cells transfected with CFP-Sp1 and YFP-hER
after treatment with E2 (Fig. 6B
(Fig. 6C
-interacting region of Sp1. E2 induced transactivation in a one-hybrid assay only in cells transfected with GAL4-Sp1 chimeras that express full-length Sp1 or the C/D C-terminal domain of Sp1 (pM-Sp1CD) (Fig. 6D
(10, 11). In addition, CFP-Sp1
DBD inhibited basal activity (Fig. 6E
and Sp1DN, which expresses the C-terminal DBD region of Sp1 (Fig. 6F
and Sp1 interact in living cells, and these interactions are enhanced by ligands. These results are consistent with the hormone-dependent regulation of multiple genes in breast cancer cells through the ER/Sp1 pathway where ER
binds Sp1 but not promoter DNA.
|
| DISCUSSION |
|---|
|
|
|---|
Recently, ligand-dependent interactions of ER
with ERß and ER interactions with steroid receptor coactivators of LXXLL peptides (SRC interacting domains) have been detected in living cells using FRET (20, 45, 46). In this study, we have investigated ligand-dependent hER
-Sp1 protein interactions in living cells by using FRET microscopy and image analysis. Previous studies have identified ER
and Sp proteins associated with GC-rich promoters using DNA footprinting electrophoretic mobility shift or chromatin immunoprecipitation assays and ER
interacts with Sp1 and Sp3 in pull-down and coimmunoprecipitation assays (10, 11, 16, 24, 27). The results illustrated in Fig. 2
show that individual transcriptional activities of CFP- and YFP-ER and Sp1 fusion proteins are comparable to those of wild-type proteins in MDA-MB-231, MCF-7, and ZR-75 breast cancer cells transfected with constructs containing ERE or GC-rich promoters. In addition, coexpression of CFP-Sp1 and hER
increased both the basal and inducible levels of luciferase activities. Acquired images using two-photon excitation fluorescence microscopy with a three-filter set indicated that FRET signals from cells transfected with the CFP-YFP chimera were much higher than those observed in the negative control cells (Fig. 3B
). In cells cotransfected with CFP-hER
and YFP-hER
, E2 induced translocation of the fusion proteins from the cytoplasm into the nucleus; the enhanced FRET signal indicated ligand-induced ER homodimerization, and this was consistent with previous reports using FRET to investigate ligand-induced ER interactions (28, 32, 33, 34).
To accurately determine ligand-dependent interactions of hER
/Sp1 using FRET, we first set the range from minimum to maximum levels of either CFP or YFP expression as the selection criterion because individual cells can express different amounts of donor and acceptor proteins by variability in transfection efficiency. Values from cells that did not fit this criterion for correcting variations in fluorophore expression level were eliminated. Secondly, it was assumed that the ratio of positive control FRET signal to negative control FRET signal, which is
2.0, would represent 50% FRET efficiency, and, based on this assumption, additional calculations for measuring FRET efficiency were performed. Enhanced ligand-dependent dimerization between CFP-hER
and YFP-hER
(Fig. 3
, A and C) has been reported previously (28), and this dimerization property was used as another positive control for confirming the method described above for quantifying FRET efficiency. The order of FRET efficiency for ligand-induced CFP-hER
/YFP-hER
or CFP-Sp1/YFP-hER
interactions was similar (4-OHT > E2 > ICI 182,780) (Fig. 3
, D and F), and all ligands induced an increase in protein-protein interactions in living cells. However, the overall FRET efficiencies in CFP-Sp1/YFP-hER
were relatively lower than observed for CFP-hER
/YFP-hER
, indicating that the increased size and molecular weight of CFP-Sp1 may induce an unfavorable orientation between the fusion proteins and decrease overall FRET efficiency. Previous studies have also shown ligand structure-dependent differences in ER dimer formation, stability, and dissociation, and these were not necessarily related to ligand-binding affinities (34, 47). Differences in FRET efficiencies for E2, 4-OHT, and ICI 182,780 observed in this study will therefore be due not only to ER
-Sp1 interactions but also to the stability of both ER and ER/Sp1 complexes and their rate of nuclear translocation.
Variations in YFP intensity over time were measured after addition of each ligand to assess CFP-Sp1 interactions with YFP-ER
. The ratio between CFP fusion and YFP fusion proteins cannot affect the overall YFP signal (FRET signal plus background signal). DMSO did not alter YFP intensity over time (Fig. 4
), whereas all other ligands, including E2, 4-OHT and ICI 182,780, increased YFP intensity with a slight fluctuating pattern. The final order of YFP intensity 7.5 min after ligand addition was the same as the order of FRET efficiency measured in Fig. 3
, and this was consistent with ligand-dependent hER
/Sp1 interactions in living cells. Furthermore, coimmunoprecipitation for YFP-hER
/Sp1 has also been carried out to confirm the ligand-dependent interactions of these proteins in vivo (Fig. 5
). These results demonstrate that ER ligands not only induce ER subtype dimerization as previously shown by FRET analysis (28) but also induce ER
interactions with Sp1.
The critical role of Sp1 DBD for ER binding has been previously demonstrated in vitro by a GST pull-down assay (11) and was further analyzed in this study using FRET and a one-hybrid assay. CFP-Sp1
DBD was detected in both the nucleus and cytoplasm in transfected cells, whereas YFP-ER
is primarily nuclear (Fig. 6A
). The YFP signal (Fig. 6A
top, middle E2 panel) is primarily due to background (or bleed) excitation of CFP to the YFP channel. The results show that FRET efficiency in MCF-7 cells for CFP-Sp1
DBD/YFP-hER
was minimal compared with the CFP-Sp1/YFP-hER
pair (Fig. 6B
). In addition, these data were complemented by mammalian one-hybrid analysis of GAL4-Sp1 (wild-type and mutant) activation by E2 and hER
in which the C-terminal C/D domain was required for induction of luciferase activity (Fig. 6D
) and overexpression of Sp1DN also decreased hormone-enhanced FRET efficiency (Fig. 6C
). These data are consistent with previous reports showing that ER
-Sp1 interactions were dependent on the C-terminal region of Sp1, which also interacts with many other transcription factors including nuclear receptors (12). The nonclassical activation of estrogen-responsive genes through ER/Sp interactions with GC-rich promoters in breast cancer cells has also been observed in other cell lines (48, 49, 50, 51, 52) and for other ligand-activated and orphan nuclear receptors, including the progesterone receptor (53, 54), androgen receptor (55, 56), retinoic acid and retinoic X receptors (57, 58, 59), peroxisome proliferator-activated receptor
(60), chicken ovalbumin upstream-promoter transcription factor (61, 62), steroidogenic factor-1 (63, 64), and the vitamin D receptor (65). Using FRET analysis and ER
/Sp1 as a model, we have now shown that nuclear receptor-mediated transactivation through nuclear receptor-protein-DNA interactions involves direct protein-protein interactions in living cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals and Biochemicals
DMEM nutrient mixture F-12 (DME/F12) without phenol red, PBS, E2, 4-OHT, BSA (Fraction V), and 100x antibiotic/antimycotic solution were purchased from Sigma (St. Louis, MO). Fetal bovine serum (FBS) was obtained from JRH Biosciences (Lenexa, KS). ICI 182,780 was kindly provided by Dr. Alan Wakeling (Astra USA, Inc.Zeneca Pharmaceuticals, Macclesfield, UK). All the restriction enzymes and modifying enzymes (T4 DNA ligase, calf intestinal alkaline phosphatase) used in this study were purchased from Promega Corp. (Madison, WI) or Roche Molecular Biochemicals (Indianapolis, IN). Plasmid preparation kits were purchased from QIAGEN (Valencia, CA), and 40% polyacrylamide was obtained from National Diagnostics (Atlanta, GA). All other chemicals were obtained from commercial sources at the highest quality available.
Cell Maintenance and Transient Transfection Assay
MCF-7, MDA-MB-231, and ZR-75 cells were obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells were grown in DME/F12 supplemented with 2.2 g/liter sodium bicarbonate, 5% FBS, BSA, and 10 ml/liter antibiotic/antimycotic solution; and ZR-75 cells were maintained in RPMI 1640 medium with phenol red and supplemented with 10% FBS, sodium pyruvate, sodium bicarbonate, and glucose. Cells were cultured and maintained in 150 cm2 tissue culture dishes at 37 C in 5% CO2:95% air. For transient transfection assays, cells were seeded in six-well tissue culture plates in DME/F12 without phenol red supplemented with 2.2 g/liter sodium bicarbonate, 5% dextran-coated charcoal-stripped FBS, BSA, and 10 ml/liter antibiotic/antimycotic solution. After 24 h, cells were transfected using calcium phosphate and 500 ng pGAL4-luc (containing five tandem GAL4 response elements linked to luciferase), pSp13, or pERE3 (29); 100 ng pcDNA3/His/lacZ (Invitrogen, Carlsbad, CA) was also cotransfected as a standard reference for transfection efficiency. After 56 h, the media were removed, and cells were shocked with 20% glycerol in PBS (pH 7.4) for 1 min. Cells were rinsed twice with 1 ml PBS and treated with 5% charcoal-stripped DME/F12 containing DMSO, E2 (10 nM), 4-OHT (1 µM), or ICI 182,780 (1 µM) for 3640 h. After harvesting cells by scraping in 1x reporter lysis buffer (Promega), luciferase activity was determined on aliquots of this extract using the luciferase assay system (Promega). ß-Galactosidase activity was performed using Tropic Galacto-Light Plus assay system (Tropix, Bedford, MA). Light emission was detected on a LumiCount microwell plate reader (Packard, Meriden, CT), and luciferase reporter gene activity was corrected by normalizing against ß-galactosidase activity, obtained from the same sample. Results are expressed as means ± SD with at least three determinations for each treatment group.
Coimmunoprecipitation and Western Blot Analysis
Cells were seeded in 35-mm six-well tissue culture plates in phenol red-free DME/F12 medium containing 2.5% charcoal-stripped FBS. When cells were 6080% confluent, YFP-hER
and Sp1 expression plasmids were transfected using Lipofectamine Plus Reagent (Invitrogen). After 24 h, transfected cells were treated with DMSO, 10 nM E2, 1 µM 4-OHT, or 1 µM ICI 182,780 for 30 min; 1 ml of RIPA buffer (1x PBS, 1% Nonidet P-40 or Igepal CA-630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mg/ml phenylmethylsulfonyl fluoride in isopropanol, aprotinin, 100 nM sodium orthovanadate) was added, and cells were disrupted by repeated aspiration through a 21-gauge needle. Cellular debris was removed by centrifugation at 10,000 x g for 10 min at 4 C, and the supernatant was transferred to a fresh microcentrifuge tube on ice. Lysate was precleared by adding 1.0 µg of the appropriate control normal rabbit IgG together with 20 µl of appropriate suspended (25% vol/vol) protein A/G-agarose conjugate and incubated at 4 C for 30 min. After centrifugation for 30 sec, the supernatant (800 µg total cellular proteins) was transferred to a microcentrifuge tube, 5 µl of rabbit polyclonal anti-GFP antibody (1 µg) (Santa Cruz Biotechnology, Santa Cruz, CA) was added and incubated for 23 h at 4 C. The immunoprecipitate was collected by centrifugation, and the pellet was gently washed with 1.0 ml RIPA buffer (2x) and then with PBS. The agarose pellet was then resuspended in 50 µM of 1x Laemmli buffer [50 mM Tris-HCl, 2% sodium dodecyl sulfate, 0.1% bromphenol blue, 175 mM ß-mercaptoethanol], boiled, and centrifuged. The suspended sample was separated by SDS-10% PAGE, electrophoresed to a polyvinylidene difluoride membrane. The membrane was blocked in Blotto [5% milk, Tris-buffered saline (10 nM Tris-HCl, pH 8.0, 150 mM NaCl), and 0.05% Tween 20] and probed with primary antibodies for Sp1 (PEP2) or ER
(H184) for 3 h at room temperature. After incubation with peroxidase-conjugated secondary antibody, Igs were visualized using the enhanced chemiluminescence detection system (NEN, Boston, MA).
FRET Microscopy and Analysis
To perform FRET, cells were washed with DME/F12 medium containing 5% serum and then put on the stage of the Bio-Rad 2000MP system (Bio-Rad Laboratories, Hercules, CA) equipped with a Nikon T#300 inverted microscope with a 60x (NA1.2) water immersion objective lens and a Titanium:Saphire laser tuned to 820-nm wavelength and Argon/Krypton laser tuned to 488-nm excitation (Table 1
). Control images were acquired before treatment of cells with DMSO, E2, 4-OHT, or ICI 182,780. Additional images were acquired between 8 and 18 min after addition of each ligand at a speed of 25 images per sec. FRET data in MCF-7 cells transfected with CFP and YFP fusion constructs alone or in combination were collected using 2 photon-820 nM excitation wavelength. Both CFP and YFP were excited at 820 nm to ultimately generate 410 nm for excitation of the CFP and FRET channels. Emission of CFP (CFP channel; donor signal) was collected using a 500DCLP dichroic and 450/80-nm filter whereas emission of YFP (FRET channel; acceptor signal) was collected using a 528/50-nm filter. Donor bleed through signal to the FRET channel was calculated by measuring the FRET channel signal resulting from MCF-7 cells transfected only with the CFP fusion construct. Acceptor bleed through to the FRET channel was calculated by measuring the FRET channel signal resulting from MCF-7 cells transfected with YFP fusion construct alone. For determination of YFP-hER
localization in YFP channel, YFP-hER
was excited at 488 nm with argon/krypton laser, and emission of YFP-hER
was collected at 525/50 nm. To correct for variations in fluorophore expression resulting from different transfection efficiencies, minimum levels of YFP expression and maximum levels of CFP were selected based on data collected from each experiment. Cells that did not match the selection criteria were eliminated from the FRET analysis. Negative (CFP empty and YFP empty) and positive (CFP-YFP chimera) controls were used to calculate the approximate FRET efficiency in cells treated with different ligands; it was assumed that the signal from cells transfected with the positive CFP-YFP chimera construct will exhibit 50% FRET efficiency when compared with signals from cells transfected with CFP/YFP empty constructs.
|
Plasmid Construction for FRET
CFP-C1 and YFP-C1 mammalian expression vectors were obtained from BD Biosciences CLONTECH Laboratories, Inc. (Palo Alto, CA). The CFP-YFP chimera was generated by PCR using the following primer set: 5' TCCCCGCGGTAGCCGCCATGGTGAGCAAGGGC-GAGGAGCTG 3' (sense) and 5-CGGGATCCCTTGTACAGCTCGTCCATGCCGAG 3' (anti-sense). The PCR product was digested with SacII and BamHI and cloned into the CFP-C1 vector (28, 30, 31). CFP-hER
and YFP-hER
were made by PCR using the following primer set: 5' TTCGAATTCTATGACCATGACCCTCC ACACCAAAGCA 3' (sense) and 5' TAGTCGACTCAGACTGTGGCAGGGA AACCCTC 3' (antisense); the primer set for CFP-Sp1 is 5' TTCGAATTCTACAGGTGAGCTTGACCTCACAGCC 3' (sense) and 5' TAGTCGACTCAGAAGCCATTGCCACTGATATT 3' (antisense). The PCR product was digested with EcoRI and SalI and cloned into either the CFP or YFP con-struct. CFP-Sp1
DBD was generated through deletion of 613788 aa by BamHI treatment of CFP-Sp1 construct, and the remaining portion of the construct was religated. Sp1DN plasmid (Sp1DN containing 592778 aa) was provided by Drs. Yoshihiro Sowa and Toshiyuki Sakai (Kyoto Prefectural University of Medicine, Kyoto, Japan). pMGAL4-Sp1(83778aa) and pMGAL4-Sp1AB(83621 aa) constructs were obtained from Dr. Stephen Smale (University of CaliforniaLos Angeles). pMGAL4-Sp1CD (543778aa) and pMGAL4-Sp1D (622778 aa) were generated using PCR. The primer sets for pMGAL4-Sp1CD are 5' TCCGGATCCGCCTGCCGTTGGCTATAGCA AAT 3' (sense) and 5' GTATGTCGACATCAGAAGCCATTGCCACTGATATT 3' (antisense); and primer sets for pMGAL4-Sp1D (635788aa) are 5' TCCGGATCCGCCTGCCGTTGGCTATA GCAAAT 3' (sense) and the same antisense primer above. The PCR products were di-gested with BamHI and SalI and cloned into pM constructs. pMGAL4-Sp1B (263542 aa) fragment was PCR amplified by using the primer set of 5' TCCGTCGACGCAACAGCGTTTCTGCAGCTACC 3' (sense) and 5' TATCTAGAATCAGCCTTGAATTGGGTGCACCTG 3' (antisense); then it was digested with SalI and XbaI, and finally cloned into the pM construct.
Statistical Analysis
The statistical difference among different groups was determined by ANOVA and Scheffes post hoc test. The data are expressed as the mean ± SD for at least three determinations. Treatments were considered significantly different from controls if P < 0.05.
| FOOTNOTES |
|---|
First Published Online January 6, 2005
Abbreviations: aa, Amino acids; AF, activation function; AP1, activator protein-1; CFP, cyan fluorescent protein; DBD, DNA binding domain; DME/F12, DMEM nutrient mixture F-12; DMSO, dimethylsulfoxide; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen-responsive element; FBS, fetal bovine serum; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; GST, glutathione S-transferase; 4-OHT, 4-hydroxytamoxifen; Sp1DN, Sp1 dominant negative; YFP, yellow fluorescent protein.
Received for publication August 19, 2004. Accepted for publication December 23, 2004.
| REFERENCES |
|---|
|
|
|---|
-dependent transcription with chromatin templates. Mol Cell Biol 23:335348
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751763[CrossRef][Medline]
on responsive promoters is an integral feature of estrogen signaling. Mol Cell 11:695707[CrossRef][Medline]
/ß)-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:53795387
and ERß at AP1 sites. Science 277:15081510
1 gene expression: role of estrogen receptor-Sp1 complex. Mol Endocrinol 12:882890
gene expression in MCF-7 cells by 17ß-estradiol. Endocrinology 142:10001008
and Sp proteins. Oncogene 23:10521063[CrossRef][Medline]
(ER
) required for ER
/Sp1-mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol Endocrinol 17:804817
and steroid receptor coactivator-1. Mol Endocrinol 14:518534
is ligand- and proteasome-dependent. Nat Cell Biol 3:1523[CrossRef][Medline]
in living cells. BMC Cell Biol 2:8[CrossRef][Medline]
through nuclear factor-
B, and by 17ß-estradiol through Sp-1 in human vascular endothelial cells. J Biol Chem 275:2578125790
interaction in 17ß-estradiol-mediated transcriptional activation of the low-density lipoprotein receptor gene expression. Endocrinology 142:15461553
and Sp1 regulate progesterone receptor gene expression. Mol Cell Endocrinol 201:165175[CrossRef][Medline]
via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277:96769683NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
C. E. Mason, F.-J. Shu, C. Wang, R. M. Session, R. G. Kallen, N. Sidell, T. Yu, M. H. Liu, E. Cheung, and C. B. Kallen Location analysis for the estrogen receptor-{alpha} reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements Nucleic Acids Res., January 4, 2010; (2010) gkp1188v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Safe and K. Kim Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wu, R. Xu, K. Kim, J. Martin, and S. Safe In Vivo Profiling of Estrogen Receptor/Specificity Protein-Dependent Transactivation Endocrinology, November 1, 2008; 149(11): 5696 - 5705. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Maneix, G. Beauchef, A. Servent, Y. Wegrowski, F. X. Maquart, N. Boujrad, G. Flouriot, J. P. Pujol, K. Boumediene, P. Galera, et al. 17{beta}-Oestradiol up-regulates the expression of a functional UDP-glucose dehydrogenase in articular chondrocytes: comparison with effects of cytokines and growth factors Rheumatology, March 1, 2008; 47(3): 281 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan, F. Wu, S. Liu, Q. Wu, and S. Safe Role of specificity protein transcription factors in estrogen-induced gene expression in MCF-7 breast cancer cells J. Mol. Endocrinol., October 1, 2007; 39(4): 289 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Levy, X. Zhao, H. Tang, R. B. Jaffe, T. P. Speed, and D. C. Leitman Multiple Transcription Factor Elements Collaborate with Estrogen Receptor {alpha} to Activate an Inducible Estrogen Response Element in the NKG2E Gene Endocrinology, July 1, 2007; 148(7): 3449 - 3458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Padron, L. Li, E. M. Kofoed, and F. Schaufele Ligand-Selective Interdomain Conformations of Estrogen Receptor-{alpha} Mol. Endocrinol., January 1, 2007; 21(1): 49 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hiscox, N. J Jordan, W. Jiang, M. Harper, R. McClelland, C. Smith, and R. I Nicholson Chronic exposure to fulvestrant promotes overexpression of the c-Met receptor in breast cancer cells: implications for tumour-stroma interactions Endocr. Relat. Cancer, December 1, 2006; 13(4): 1085 - 1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maor, D. Mayer, R. I Yarden, A. V Lee, R. Sarfstein, H. Werner, and M. Z Papa Estrogen receptor regulates insulin-like growth factor-I receptor gene expression in breast tumor cells: involvement of transcription factor Sp1 J. Endocrinol., December 1, 2006; 191(3): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eeckhoute, J. S. Carroll, T. R. Geistlinger, M. I. Torres-Arzayus, and M. Brown A cell-type-specific transcriptional network required for estrogen regulation of cyclin D1 and cell cycle progression in breast cancer Genes & Dev., September 15, 2006; 20(18): 2513 - 2526. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan, R. Barhoumi, R. Burghardt, S. Liu, K. Kim, and S. Safe Molecular Mechanism of Inhibitory Aryl Hydrocarbon Receptor--Estrogen Receptor/Sp1 Cross Talk in Breast Cancer Cells Mol. Endocrinol., September 1, 2006; 20(9): 2199 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Monslow, J. D. Williams, D. J. Fraser, D. R. Michael, P. Foka, A. P. Kift-Morgan, D. D. Luo, C. A. Fielding, K. J. Craig, N. Topley, et al. Sp1 and Sp3 Mediate Constitutive Transcription of the Human Hyaluronan Synthase 2 Gene J. Biol. Chem., June 30, 2006; 281(26): 18043 - 18050. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, E. Ariazi, K. Kim, S. Khan, R. Barhoumi, R. Burghardt, S. Liu, D. Hill, R. Finnell, B. Wlodarczyk, et al. 3-Methylcholanthrene and Other Aryl Hydrocarbon Receptor Agonists Directly Activate Estrogen Receptor {alpha} Cancer Res., February 15, 2006; 66(4): 2459 - 2467. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, J.-M. Sun, L. Li, and J. R. Davie Differential Intranuclear Organization of Transcription Factors Sp1 and Sp3 Mol. Biol. Cell, September 1, 2005; 16(9): 4073 - 4083. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |