help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0343
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Newhall, K. J.
Right arrow Articles by McKnight, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Newhall, K. J.
Right arrow Articles by McKnight, G. S.
Molecular Endocrinology 19 (4): 982-991
Copyright © 2005 by The Endocrine Society

Deletion of the RIIß-Subunit of Protein Kinase A Decreases Body Weight and Increases Energy Expenditure in the Obese, Leptin-Deficient ob/ob Mouse

Kathryn J. Newhall, David E. Cummings, Michael A. Nolan and G. Stanley McKnight

Department of Pharmacology (K.J.N, G.S.M.), University of Washington, and Division of Metabolism (D.E.C.), Endocrinology and Nutrition, University of Washington, Veterans Affairs Puget Sound Health Care System, Seattle, Washington 98195; and Wyeth Research (M.A.N.), Collegeville, Pennsylvania 19426

Address all correspondence and requests for reprints to: Dr. G. Stanley McKnight, Department of Pharmacology, University of Washington, Box 357750, Seattle, Washington 98195. E-mail: mcknight{at}u.washington.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Disruption of the RIIß regulatory subunit of protein kinase A (PKA) results in mice with a lean phenotype, nocturnal hyperactivity, and increased resting metabolic rate. In this report, we have examined whether deletion of RIIß would lead to increased metabolism and rescue the obese phenotype of the leptin-deficient ob/ob (ob) mouse. Body weight gain and food consumption were decreased, whereas basal oxygen consumption and nocturnal locomotor activity were increased in the double mutant animals compared with ob mice. The ob mice are unable to maintain body temperature when placed in a cold environment due to a loss of brown adipose tissue activation, and this cold sensitivity was partially rescued by concomitant disruption of RIIß. These findings indicate that PKA modifies the phenotype of the leptin-deficient mouse, leading to increases in both thermogenesis and energy expenditure.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE cAMP-DEPENDENT KINASE, protein kinase A (PKA), is an important mediator of signal transduction downstream of G protein-coupled receptors and plays a key role in the regulation of metabolism and triglyceride storage. Targeted deletion of the RIIß regulatory subunit of PKA results in mice that are lean, display an increased basal oxygen consumption, and show a dramatic increase in nocturnal locomotor activity (1, 2). RIIß is selectively expressed in tissues involved in body-weight regulation, including the brain, white adipose tissue (WAT), and brown adipose tissue (BAT). RIIß knockout mice (RKO) have decreased WAT stores and increased basal kinase activity in WAT and BAT due to a compensatory increase in the RI{alpha} PKA holoenzyme, which is more cAMP sensitive than the RIIß holoenzyme (3, 4). These changes in BAT lead to an increase in uncoupling protein 1 (UCP1) through a posttranscriptional mechanism (1). UCP1 acts to dissipate the proton gradient across the inner mitochondrial membrane (5) and is a critical mediator of nonshivering (cold-induced) thermogenesis in mice. UCP1 mRNA and protein are both increased upon cold exposure (6, 7).

In contrast to RKO mice, leptin-deficient, obese ob/ob mice (ob) are hyperphagic, hypoactive, hypothermic, and hyperinsulinemic (8). These mice have decreased expression of ß-adrenergic receptors (ß-ARs) and UCP1 in BAT, primarily due to decreased sympathetic nervous system input to this tissue (9, 10). Central or peripheral administration of leptin to ob mice decreases food consumption, increases metabolic rate, and ultimately promotes weight loss (11, 12, 13, 14, 15). Furthermore, leptin administration restores ß-AR and UCP1 expression in adipose tissue of ob mice (16, 17).

RIIß is also highly expressed in specific brain regions, including the striatum, hypothalamus, hippocampus, and neocortex (18). As in WAT and BAT of RKO mice, RI ({alpha} and ß) partially compensates for loss of RIIß in the brain, switching to a type I holoenzyme that is activated at lower cAMP concentrations than a type II holoenzyme (3, 4, 18). PKA is part of the downstream signaling mechanism for many neuropeptides in the hypothalamus that are regulated by leptin, including {alpha}-MSH, agouti-related protein (AgRP), and neuropeptide Y (NPY) (19, 20). In general, the catabolic neuropeptides, such as {alpha}-MSH, signal through pathways that tend to increase PKA activity, whereas the anabolic neuropeptides like NPY and AgRP signal through pathways that tend to decrease PKA activity.

We have crossed RKO mice with ob mice to generate double mutants, designated double knockout (DKO). The deletion of RIIß partially rescues the phenotypes associated with leptin deficiency. Double mutants have decreased body weight and increased energy expenditure compared with ob mice and display increased physical activity. Furthermore, BAT is activated by the deletion of RIIß in ob mice, partially rescuing the cold sensitivity of this animal. These findings indicate that PKA modifies the phenotype of the leptin-deficient mouse leading to increases in both thermogenesis and energy expenditure.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Body Weight Gain, Food Consumption, and Adiposity Are Decreased in ob Mice by the RIIß Mutation
DKO mice were generated from an initial cross between RIIß +/– and ob +/– mice as depicted in Fig. 1AGo. Body weight was monitored from 5–13 wk of age (Fig. 1BGo). As previously observed (2), body weight gain was significantly decreased in RKO mice compared with wild-type (WT) controls. Similarly, DKO mice had decreased body weight gain compared with ob mice. By 10 wk of age, DKO mice weighed 11.9% less than their ob counterparts, and this difference in body weight increased to 14.5% by 13 wk of age (P < 0.001). Both sets of mice with the ob mutation, however, gained more weight than either the WT or RKO mice.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. RIIß Deletion Partially Rescues the Obese Phenotype of the ob Mouse

A, The breeding strategy for generating RKO, DKO, WT, and ob mice is diagrammed. B, Body weight was measured weekly in male mice from 5–13 wk of age in RKO (n = 6), DKO (n = 6), WT (n = 7), or ob (n = 8) mice. Results are presented as mean ± SEM. *, P < 0.05 vs. WT; **, P < 0.001 vs. WT; and #, P < 0.001 DKO vs. ob using a repeated-measures ANOVA with a Newman-Keuls multiple comparison test. C, For food consumption measurements, each animal was housed individually and food was monitored daily for 5 d, then averaged per group for RKO (n = 9), DKO (n = 6), WT (n = 7), or ob (n = 7) mice. **, P < 0.001 vs. WT; #, P < 0.001 DKO vs. ob using a one-way ANOVA with a Newman-Keuls multiple comparison test. D, Adiposity was determined as the sum of the weight of three white adipose tissue pads (bilateral reproductive, inguinal, and retroperitoneal), expressed as a percentage of body weight for RKO (n = 5), DKO (n = 11), WT (n = 8), or ob (n = 6) mice. **, P < 0.001 vs. WT using a one-way ANOVA with a Newman-Keuls multiple comparison test.

 
The deletion of RIIß also significantly reverses the hyperphagic phenotype of ob mice (Fig. 1CGo). Food consumption was monitored daily for 5 d in individually housed mice and then averaged per animal. DKO mice had significantly decreased food consumption per day compared with ob mice (7.4 g/d vs. 8.5 g/d) (P < 0.001). Despite this decrease, both sets of mice on the ob background ate more than either WT or RKO mice (5 g/d).

Consistent with their decreased body weight, RKO mice of age 10–12 wk have significantly diminished white adipose tissue stores (1.3%) compared with WT mice (3%) (P < 0.001) (Fig. 1DGo). Adiposity was determined as the combined weight of three white adipose tissue pads (bilateral reproductive, inguinal, and retroperitoneal) expressed as a percentage of body weight. The DKO mice trended toward decreased adiposity (12.3%) compared with ob mice (13.5%), but the numbers were not statistically significant due to the variability of this measure (P = 0.25). However, this 9% decreased adiposity is consistent with the 12–14% decrease in body weight and the 13% decrease in food consumption, indicating that the RIIß mutation has partially rescued the body weight phenotype of the ob mouse.

The RIIß Mutation Restores Normal Oxygen Consumption to ob Mice
We have previously reported that RKO mice are metabolically inefficient, due to an increase in UCP1 protein in BAT accompanied by increased metabolic rate (2). Because ob mice have decreased metabolic rate compared with WT mice (21), we hypothesized that the RIIß deletion would rescue the diminished oxygen consumption (VO2) in the leptin-deficient mouse. VO2 was assessed in 12-wk-old male mice. Animals were placed individually in an Oxymax chamber (Columbus Instruments, Columbus, OH) for 3 h, with an airflow of 0.5 liters/min. Resting VO2 was averaged for each mouse for the last 60 min the animal was in the chamber (Fig. 2BGo). As previously reported, RKO mice had significantly increased VO2 compared with WT mice, and, as predicted, the DKO mice had increased oxygen consumption compared with ob mice (Fig. 2Go). The RIIß mutation causes nearly a complete return to normal from the low basal oxygen consumption seen with the ob mice.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of Oxygen Consumption in Mutant Mice

A, An Oxymax chamber (Columbus Instruments, Columbus, OH) with an airflow of 0.5 liters/min was used to measure VO2 in 12-wk-old male RKO (n = 9), DKO (n = 9), WT (n = 5), or ob (n =8) mice. Results are presented as mean ± SEM. *, P < 0.05 vs. WT; #, P < 0.05 DKO vs. ob using a repeated-measures ANOVA with a Newman-Keuls multiple comparison test for the resting VO2 period indicated by the bar. B, Resting oxygen consumption was calculated as the average of the last 60 min per mouse. Results are presented as mean ± SEM. *, P < 0.05 vs. WT using a one-way ANOVA with a Newman-Keuls posttest.

 
BAT Histology Is Partially Rescued and UCP1 Protein Is Induced in ob Mice by the RIIß Mutation
The increased metabolic rate in RKO mice is associated with increased UCP1 protein in BAT (2). Conversely, UCP1 expression is reduced in ob BAT (9), and this is associated with a decreased metabolic rate. UCPs give BAT the ability to generate heat instead of ATP and increase thermogenesis in response to cold exposure (5). The activity of UCP1 is regulated by the sympathetic nervous system (SNS) and is mediated through ß-ARs (22), which signal via PKA. Sympathetic input can affect UCP1 protein levels in BAT at room temperature, but housing mice at thermoneutral conditions (30 C) minimizes this adrenergic response. Therefore, changes in the UCP1 content of BAT observed at thermoneutral temperatures are likely due to changes intrinsic to the tissue, rather than from increased sympathetic input. UCP1 protein levels in RKO mice are elevated 1.5-fold above WT levels, as observed previously (2). By introducing the RIIß deletion into the ob mouse, we have increased UCP1 protein levels in DKO mice by about 3-fold at thermoneutral conditions (Fig. 3AGo). UCP1 protein levels in ob mice were approximately 1.6-fold decreased from those in WT BAT.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. RIIß Deletion Rescues ob-Induced Defects in BAT and Cold-Induced Thermogenesis

A, UCP1 protein levels are increased in BAT from RKO (n = 3) and DKO (n = 4) mice housed at thermoneutral conditions (30 C) for 2 wk, compared with WT (n = 3) and ob (n = 3) mice. A Western blot and quantification of UCP1 from mice of each genotype is shown. UCP1 protein levels were normalized to ß-tubulin protein levels and quantitated on the graph in this figure. Results are expressed as mean ± SEM. using a one-way ANOVA with a Newman-Keuls posttest. *, P < 0.05 vs. WT; #, P < 0.05 DKO vs. ob. B, Hematoxylin and eosin stained BAT sections show that DKO BAT is partially restored to a WT phenotype and has smaller lipid droplets than ob BAT. C, DKO mice are able to maintain body temperature in a cold environment (4 C) more efficiently than do ob mice. Male, 12-wk-old RKO (n = 4), DKO (n =8), WT (n = 6), and ob (n = 8) mice were used in this study with food and water provided ad libitum. By 4 h of cold exposure, six of eight ob mice had reached a body temperature below 25 C and had to be removed from the cold, whereas only one of eight DKO mice reached a body temperature below 25 C. Results are expressed as mean ± SEM using a repeated-measures ANOVA with a Newman-Keuls posttest. *, P < 0.05 vs. WT; #, P < 0.05 DKO vs. ob.

 
Interscapular BAT from ob mice is enlarged and pale in color compared with that in WT animals. This is due to large unilocular triglyceride deposits that give ob BAT an appearance more similar to WAT. (Fig. 3BGo) In contrast, BAT from RKO mice has decreased triglyceride stores and increased mitochondria per brown adipocyte compared with BAT from WT mice (1). When the two mutations are combined in the DKO mouse, the BAT is partially restored to a phenotype more similar to WT, with smaller lipid deposits.

The RIIß Mutation Partially Rescues the Cold-Induced Hypothermia of ob Mice
BAT in ob mice is largely unresponsive to cold-induced activation (9, 22, 23, 24). A decrease of both ß-ARs and UCP1 contributes to the hypothermia observed in ob mice exposed to the cold (9). Because UCP1 is necessary for nonshivering thermogenesis (25), and deletion of RIIß rescues UCP1 protein expression in ob mice, we reasoned that DKO mice might show improvements in their ability to induce nonshivering thermogenesis. As indicated in Fig. 3CGo, core body temperature falls dramatically in ob mice within 2 h of cold exposure, whereas WT and RKO animals maintain their body temperature in the cold indefinitely. DKO mice demonstrate a reduced rate of body temperature drop when placed at 4 C, but they do not maintain their body temperature indefinitely and will eventually succumb to the cold if not returned to room temperature. During 4 h of cold exposure, only one of eight DKO mice had a body temperature that dropped below 25 C, whereas six of eight ob mice were unable to maintain core temperature above 25 C. This result suggests that the DKO mice have an increased capacity for thermogenesis compared with ob mice, as reflected by the increase in UCP1 protein in BAT, but that they are still not able to respond fully to SNS stimulation to adjust to the cold.

Mutation of RIIß Does Not Restore ß-AR or UCP1 mRNA Expression in BAT from ob Mice
The inability to maintain body temperature completely in DKO mice, despite high levels of UCP1 protein in BAT, suggests that defects remained in the SNS regulation of BAT. We examined the expression of ßAR mRNAs to determine whether the DKO animals had restored ßAR expression in BAT. ß1-AR and ß3-AR mRNA levels in BAT were very low in ob mice, as previously reported (10) (Fig. 4Go). The RKO mice expressed ß1-AR and ß3-AR at WT levels, but there was no rescue of adrenergic receptor expression in the DKO BAT compared with ob. The expression of ß2-AR mRNA was also reduced in the BAT of both ob and DKO mice compared with WT and RKO.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Gene Expression Changes in WT and Mutant BAT

The expression of ß-AR1, ß-AR2, ß-AR3, and UCP1 mRNA as examined in BAT using real-time PCR. Results are expressed as mean ± SEM (n = 3 animals per genotype and treatment). *, P < 0.05 vs. WT using a one-way ANOVA with a Newman-Keuls multiple comparison test.

 
The induction of UCP1 protein in RKO BAT has recently been shown to be at the posttranscriptional level (1), and we measured UCP1 mRNA in all four genotypes to determine whether this was also true for the DKO mice. As shown in Fig. 4Go, the levels of UCP1 mRNA are much lower in ob BAT and remain at the same low level in DKO BAT, despite the increase in UCP1 protein seen in Fig. 3AGo. We conclude that the loss of RIIß does not rescue the adrenergic responsiveness of BAT. This would help explain why DKO mice continue to lose body temperature even with an elevated level of UCP1 protein.

Locomotor Activity in ob Mice Is Increased by the RIIß Mutation
Total energy expenditure consists of adaptive thermogenesis, physical activity, and obligatory energy expenditure (26). Ob animals have decreased physical activity, compared with WT mice. In contrast, dark-phase hyperactivity has been reported in mouse models of genetic leanness resulting from disruptions of energy balance (27, 28, 29). This phenotype was recently shown to occur in RKO mice (1). We therefore investigated whether the deletion of RIIß could rescue the hypoactivity of the ob mouse. Animals were individually housed for 48 h in cages equipped with four sets of infrared photobeams, and consecutive adjacent photobeam breaks were scored as ambulations.

DKO mice exhibited a significant increase in nocturnal activity compared with ob mice, although daytime activity did not differ among genotypes (Fig. 5Go). A significant increase in nocturnal activity in RKO mice was observed compared with WT mice, as expected. The deletion of RIIß increased the nocturnal locomotor activity of ob animals by about 2-fold, but that nocturnal activity level was still only about 50% of WT.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Nocturnal Locomotor Activity Is Increased in DKO Compared with ob Mice

A, Activity of DKO (n = 11) and ob mice (n = 11), and (B) WT (n = 7) and RKO mice (n = 7) was measured for 48 h. Data are presented as ambulations, or number of consecutive beam breaks, per hour. The bars at the top of the graph represent dark phase. Results are presented as mean ± SEM. C, Average total ambulations from the two dark phase periods are shown for each genotype. Results are presented as mean ± SEM. *, P < 0.05 vs. WT; **, P < 0.01 vs. WT; #, P < 0.05 DKO vs. ob using a one-way ANOVA with a Bonferroni posttest.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PKA is a major intracellular mediator of both ß-adrenergic action in adipose tissue and neuropeptide signaling in brain. Disruption of the RIIß gene removes a significant regulator of C-subunit activity in adipose tissue as well as in neurons of the striatum, hypothalamus, and cortex. More than 50% of neuronal PKA activity in these regions and nearly all of the PKA activity in WAT and BAT can be attributed to the RIIß/C holoenzyme (3, 4, 18). Partial compensation for the loss of RIIß occurs in these tissues with the up-regulation of RI, but the kinase formed with RI is more sensitive to cAMP. This causes an increased basal PKA activity and an increased turnover and down-regulation of the free C subunit. The physiological consequences of RIIß deletion include BAT activation, increased energy expenditure, nocturnal hyperlocomotor activity, and an overall leanness and resistance to diet-induced obesity (1, 2, 4, 30). Because the leptin-deficient, ob mouse is characterized by a decrease in energy expenditure as well as hyperphagia and extreme obesity, we conducted the current study to determine whether the RIIß mutation could partially rescue some or all of the ob phenotypes. Our results demonstrate that the RIIß mutation can partially reverse the hyperphagia, weight gain, cold sensitivity, and decreased locomotor activity associated with the ob mouse.

The RIIß-subunit is selectively expressed in just a few tissues including the brain, BAT, and WAT, and the contribution of each tissue to the RKO phenotype is beginning to be understood. In RKO BAT, UCP1 protein is induced by a posttranscriptional mechanism, with a concomitant increase in mitochondria, and the animals have elevated basal oxygen consumption. However, the induction of UCP1 is not required to maintain the lean phenotype, although it is essential to sustain the increased basal oxygen consumption (1). Recently, we have used tissue specific re-expression of RIIß to demonstrate that the nocturnal hyperactivity and lean phenotype of the RKO mice persist when BAT re-expresses normal levels of RIIß, but these two phenotypes are rescued when RIIß is re-expressed in brain (Sikorski, M. A., and G. S. McKnight, unpublished data). We conclude that both BAT and brain contribute to the phenotypes we have observed in RIIß null mice.

The RIIß mutation leads to BAT activation when crossed into the ob background, and this increases the thermogenic potential of BAT and increases oxygen consumption of ob mice. Nevertheless, the underlying changes in BAT gene expression that result from the ob mutation persist, including the dramatic suppression of ß-AR mRNA expression. This lack of ß-ARs is likely due to a centrally mediated loss of SNS stimulation that accompanies the leptin deficiency (10, 22). The DKO mice display the same degree of ß-AR deficiency seen in ob BAT, indicating that there has not been a restoration of SNS responsiveness in this tissue. Ablation of all ß-ARs in mice causes them to be cold sensitive (31), similar to both ob mice (9, 15, 32, 33) and UCP1 knockout mice (25). The lack of ß-ARs in BAT from DKO mice probably explains why these mice are ultimately unable to maintain body temperature when challenged by cold exposure, although they are initially much more resistant than ob mice.

In the arcuate nucleus (ARC) of the hypothalamus, leptin increases the firing of proopiomelanocortin (POMC) neurons that secrete the catabolic neuropeptide, {alpha}-MSH, and inhibits the firing of neurons in the arcuate nucleus that secrete the anabolic neuropeptides, NPY and AgRP (34). As depicted by the model in Fig. 6Go, both groups of arcuate neurons project to neurons in the paraventricular hypothalamus (PVH) that express the G{alpha}s-coupled {alpha}-MSH receptors, MC3R and MC4R, and the G{alpha}i-coupled NPY receptors, Y1 and Y5. {alpha}-MSH acts through its receptor, MCR, to elevate cAMP, reduce food consumption, and increase energy expenditure; the action of {alpha}-MSH is antagonized at the MCR by AgRP (35). One of the actions mediated by NPY receptors is the inhibition of adenylate cyclase activity and a decrease in cAMP. Because the RIIß mutation is thought to elevate basal PKA activity and increase sensitivity to cAMP in hypothalamic neurons, we would predict that the RIIß mutation would act downstream of MCR to amplify this catabolic pathway initiated by leptin. Therefore {alpha}-MSH effects would be augmented and NPY effects blunted, leading to a decrease in feeding and an increase in energy expenditure, and we see both results when the RIIß mutation is bred onto the ob background. POMC neurons also project to sympathetic preganglionic neurons in the spinal cord (36) and {alpha}-MSH release is thought to lead to increased sympathetic outflow to peripheral tissues, including BAT, as shown in the diagram in Fig. 6Go.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6. Sites of PKA Signaling in the Hypothalamus, Striatum, Spinal Neurons, and BAT that Are Postulated to Affect Energy Balance

Leptin, secreted from adipose tissue, binds to its receptor (LepR) on both NPY/AgRP and POMC neurons in the ARC of the hypothalamus. Neurons in the PVH are innervated by both the POMC neurons and the NPY/AgRP neurons of the ARC. The POMC neurons release {alpha}MSH, which acts on the melanocortin receptors MC3R and MC4R (MCR), activating adenylate cyclase through G{alpha}s to increase cAMP and PKA activity. AgRP released onto the same neurons of the PVH acts as an MCR antagonist. NPY binds to Y1 and Y5 receptors (YR) that are coupled through G{alpha}i to inhibition of adenylate cyclase and a subsequent decrease in PKA activity. The MCR and YR expressing neurons in the PVH are key regulators of feeding. POMC neurons in the ARC also make synaptic connections with preganglionic sympathetic spinal neurons and the release of {alpha}MSH would also lead to adenylate cyclase activation and an increase in cAMP and PKA activity. These spinal neurons control sympathetic outflow and the release of norepinephrine at peripheral sites such as BAT. BAT expresses ß1, 2, and 3 adrenergic receptors (ß-ARs) that are coupled through G{alpha}s to activation of PKA. Sympathetic stimulation leads to induction of UCP1 protein through both transcriptional and posttranscriptional mechanisms and sympathetic stimulation of BAT leads to UCP1-dependent thermogenesis. MCH neurons in the dorsal LHA project widely throughout the CNS and release the anabolic peptide, MCH. The MCH receptor (MCH1R) is widely expressed in brain with particularly high levels on dopamine-responsive neurons of the striatum and nucleus accumbens. MCH receptors signal through G{alpha}i and would therefore lead to inhibition of adenylate cyclase and a decrease in PKA activity. Direct inputs to the MCH neurons are still unclear, but a recent report (39 ) demonstrated that firing of these neurons is stimulated by orexin and inhibited by NPY suggesting that they have NPY receptors (YR) as indicated on the diagram. Orexin expressing neurons are also found in the LHA although not shown on the diagram. It is unclear whether the NPY/AgRP neurons of the ARC synapse directly with the MCH neurons as indicated by the dotted arrow.

 
Genes for many of the neuropeptides and receptors involved in the regulation of energy balance have been mutated in mice and several of these mutants have been crossed to ob mice. Disruption of NPY alone produced very little effect on energy balance but when combined with the ob mutation, NPY ablation reduced feeding, increased energy expenditure, and partially suppressed the weight gain and obesity associated with ob mice (37). Another neuropeptide that is induced in ob mice is melanin-concentrating hormone (MCH), and disruption of the prohormone precursor of MCH (Pmch) produced mice that were lean, hypophagic, and had an increased metabolic rate (38). NPY has recently been shown to inhibit the firing of MCH neurons in the lateral hypothalamic area (LHA) (39), although a direct connection between NPY neurons in the ARC and MCH neurons has not been demonstrated. A similar lean phenotype was seen when the MCH receptor (MCH1R) was ablated and in this case the mice displayed a hyperactive phenotype similar to RIIß mutant mice (27, 40). When the Pmch null mice were crossed with ob mice, the double mutants had a significant increase in locomotor activity, metabolic rate, cold tolerance, and were leaner than ob mice (41). MCH receptors are G{alpha}i-coupled to an inhibition of adenylate cyclase and are highly expressed in the striatum, a region of the brain known to be involved in locomotion (Fig. 6Go). The striatum is also the area of the brain with the highest expression of RIIß. The similar phenotypes of RKO and MCH knockout mice as well as the ability of both to partially rescue the ob phenotype suggests that they may be affecting a common signaling pathway.

In summary, deletion of the RIIß-subunit of PKA in the leptin-deficient mouse partially reverses the metabolic phenotypes of ob mice but does not completely restore them to normal body weight or adiposity. Increased basal kinase activity in the RKO mouse is postulated to act in neuropeptide regulated pathways in the brain that are affected by leptin and involved in energy expenditure and feeding. Basal kinase activity is also increased in the BAT of the DKO mice and this leads to increases in UCP1 protein, basal oxygen consumption, and cold tolerance. The results of this study demonstrate a modifying role for PKA on the leptin-dependent regulation of energy homeostasis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Double Mutant Mice
The generation of RKO mice was described previously (2). Heterozygotic C57BL/6J/ob mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and bred with RIIß +/– mice to obtain double heterozygotes, which were then crossed to obtain the breeders for WT, RKO, ob, and DKO mice as diagrammed in Fig. 1AGo. Experiments were conducted on male mice with the same more than 98% C57BL/6J genetic background, ages 10–12 wk unless otherwise indicated. Mice were housed at the University of Washington in a specific pathogen-free facility on a 12-h light, 12-h dark cycle. All animals had access to standard mouse chow (LabDiet 5053, PMI Nutrition International, Brentwood, MO) and water ad libitum. All procedures were approved by the Institutional Animal Care and Use Committee, in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals.

RKO genotyping was conducted as previously described (18). Primers for ob/ob genotyping were 5': 5'-TGTCCAAGATGGACCAGACTC-3'; 3': 5'-ACTGGTCTGAGGCAGGGAGCA-3'. Ob PCR products were digested with DdeI to give a WT band of 150 bp and mutant bands of 100 and 50 bp.

Physiological Measurements
Body weight gain was measured weekly in mice from 5–13 wk of age. Adiposity was determined as the combined weight of three white adipose tissue pads (bilateral reproductive, inguinal, and retroperitoneal, each weighed individually) expressed as a percentage of body weight. For food consumption measurements, each animal was housed individually and food consumption was monitored daily for a period of 5 d.

VO2 was determined for individual mice in an Oxymax Chamber (Columbus Instruments, Columbus, OH) with airflow of 0.5 liters/min. The chamber was housed at room temperature and was 10.5 x 11.5 x 21 cm, allowing limited locomotion. The entire apparatus was housed in an isolated room away from other animals and stimuli. Mice were placed in the chamber for a total of 3 h (between 0800 and 1300 h), and resting VO2 was defined as the average for the last 60 min the animal spent in the chamber.

Body temperature was measured in a constant 4 C room using a rectal thermister (Yellow Springs Instruments, Yellow Springs, OH). Animals were individually housed in cages, with food and water supplied ad libitum. Mice were removed from 4 C after 4 h or when their body temperature dropped below 25 C. For thermoneutral UCP1 induction experiments, animals were housed in a chamber at 30 C for 2 wk.

Locomotor activity of individual mice was measured using cages (20 x 20 x 40 cm) equipped with four sets of infrared photobeams and analyzed using Photobeam Activity software (PASF, San Diego Instruments, San Diego, CA). Ambulations were scored as interruptions of consecutive beams in 30-min intervals. Animals were individually housed in the cages for 48 h, starting at 1600 h, with food and water supplied ad libitum. Nocturnal activity was taken as the total distance traveled in the dark phases (1900–0700 h).

Histology
After fixation in formaldehyde, tissues were serially dehydrated in ethanol and processed in paraffin. Embedded specimens were sectioned on a microtome at 8 µm and stained with hematoxylin and eosin. Images were taken at x40 magnification on a Zeiss Axioscop2 (Carl Zeiss, Inc., Thornwood, NY). Image processing was conducted with AxioVision 3.1 software (Carl Zeiss, Inc.).

Western Blot Analysis
Intrascapular BAT was homogenized in lysis buffer [250 mM sucrose, 20 mM Tris-Cl (pH 7.6), 0.1 mM EDTA, 0.5 mM EGTA, 10 mM dithiothreitol, 1% Triton X-100, 0.5% deoxycholic acid] supplemented with protease and phosphatase inhibitors (1 µg/ml leupeptin, 3 µg/ml aprotinin, 40 µg/ml soybean trypsin inhibitor, 0.5 µM 4-(2-aminoethyl)benzenesulphonyl fluoride, 0.1 µM microcystin-LR, 0.2 µM NaF, 0.2 µM orthovanadate), sonicated, and cleared by centrifugation (10,000 x g, 15 min). After the protein concentration of the soluble infranatent was determined by the Bradford method (Bio-Rad, Hercules, CA), samples were diluted into 1x sample buffer [62.5 mM Tris-Cl, 2% (wt/vol) sodium dodecyl sulfate, 5% glycerol, 0.05% (wt/vol) bromophenol blue, 5% (vol/vol) ß-mercaptoethanol] and boiled for 5 min. Forty micrograms of protein were separated by 10% SDS-PAGE, transferred to nitrocellulose membranes (Protran, Schleicher & Schuell, Dassel, Germany), and stained with Ponceau S. Membranes were blocked [5% (wt/vol) BSA in PBS (10 mM sodium phosphate, 150 mM NaCl, pH 7.2), 1 h] and probed with polyclonal antisera raised against UCP1 (Calbiochem, Darmstadt, Germany) at a 1:1000 dilution in 5% BSA/PBS for 3 h at room temperature. After three washes in PBST [0.1% (vol/vol) Tween 20 in PBS], membranes were incubated for 1 h with horseradish peroxidase-conjugated secondary antibody [1:10,000 (vol/vol) in PBST containing 5% (wt/vol) nonfat dry milk]. After three more washes in PBST, bound antibodies were detected using ECL (Amersham Biosciences, Piscataway, NJ) and exposed to HyperFilm ECL (Amersham Biosciences). Densitometric quantification was conducted using NIH Image (version 1.63).

Real-Time PCR Analysis
Total RNA was extracted from intrascapular BAT pads using Trizol (Invitrogen Life Technologies, Gaithersburg, MD) after manufacturer’s protocol followed by precipitation in ethanol and resuspension in ribonuclease-free water. RNA was further purified using RNAEasy (QIAGEN, Inc., Valencia, CA) with deoxyribonculease digestion, according to the instructions provided with the kit. RNA was diluted to 10 and 2 µg/ml for use in real-time RT-PCRs.

Primer and TaqMan probe sequences were selected using Primer Express (PerkinElmer Applied Biosystems, Foster City, CA). Primers and probes that were used are as follows: ß1-AR: 5': 5'-AGCAGAAGGCGCTCAAGA-3'; 3': 5'-AGGAAGAAGGGCAGCCAG-3'; Probe: 5'-/56-FAM/TCATCATGGGTGTGTTCACGCTCT/3BHQ_1/-3'. ß2-AR: 5': 5'-ACTTGTCAGCTGGGGCAG-3'; 3': 5'-CACAAAGCCTTCCATGCC-3'; Probe: 5'-/56-FAM/CAGGAACTGCTGTGTGAGGATCCC/3BHQ_1/-3'. ß3-AR: 5': 5'-CCTGAACTGGCTGGGCTA-3'; 3': 5'-CAGAAGACGACGGAAGGC-3'; Probe: 5'-/56-FAM/CCTTCAACCCGGTCATCTACTGCC/3BHQ_1/-3'. UCP1: 5': 5'-CCCAAGCGTACCAAGCTG-3'; 3': 5'-ACCCTTTGAAAAAGGCCG-3'; Probe: 5'-/56-FAM/CCATGTACACCAAGGAAGGACCGA/3BHQ_1/-3'. Acidic ribosomal binding protein: 5': 5'-GGTGTTTGACAACGACAGCATT-3'; 3': 5'-CAGGGCCTGCTCTGTGATGT-3'; Probe: 5'-/56-FAM/TGTCCTGTCCCTGCTCACTGCAGG/3BHQ_1/-3'.

Reverse transcription and quantitative PCRs were conducted in the same 10 µl reaction mix using the Brilliant Single-Step Quantitative RT-PCR Core Reagent Kit (Stratagene, La Jolla, CA).

Quantitative analysis was conducted using a Stratagene Mx3000P Real-Time Detection System. The reverse transcriptase reaction ran for 30 min at 45 C, and the PCR ran for 40 cycles of a two-step PCR amplification (95 C for 15 sec and 56 C for 1 min). All reactions were run in duplicate with an input of 2 ng or 10 ng of RNA with and without reverse transcriptase. A standard curve of total BAT RNA was used for logarithmic regression analysis of unknown samples. Data were normalized to the acidic ribosomal binding protein values.

Statistical Analysis
All data are presented as the mean ± SEM, and comparisons among genotypes or treatment groups were analyzed using a repeated measures or single factor ANOVA with a Newman-Keuls or Bonferroni multiple comparison test. P < 0.05 was considered statistically significant.


    ACKNOWLEDGMENTS
 
The authors thank Thomas Su for technical support and Ama Sikorski and Paul Amieux for critical reading of the manuscript.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant GM32875 (to G.S.M). K.J.N. is a recipient of training grant support from the National Institutes of Health (T32 GM07270).

First Published Online December 23, 2004

Abbreviations: AgRP, Agouti-related protein; ß-Ars, ß-adrenergic receptors; ARC, arcuate nucleus; BAT, brown adipose tissue; BMR, basal metabolic rate; DKO, RIIß/ob double knockout; LHA, lateral hypothalamic area; MCH, melanin-concentrating hormone; MCR, {alpha}-MSH receptor; MC3R and MC4R, MCR 3 and 4; NPY, neuropeptide Y; ob, leptin null mutation; PKA, protein kinase A; POMC, proopiomelanocortin; PVH, paraventricular hypothalamus; RKO, RIIß knockout; SNS, sympathetic nervous system; UCP, uncoupling protein; VO2, oxygen consumption; WAT, white adipose tissue; WT, wild-type; YR, Y1 and Y5 receptors.

Received for publication September 1, 2004. Accepted for publication December 13, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Nolan MA, Sikorski MA, McKnight GS 2004 The role of uncoupling protein 1 in the metabolism and adiposity of RIIß-protein kinase A-deficient mice. Mol Endocrinol 18:2302–2311[Abstract/Free Full Text]
  2. Cummings DE, Brandon EP, Planas JV, Motamed K, Idzerda RL, McKnight GS 1996 Genetically lean mice result from targeted disruption of the RII ß subunit of protein kinase A. Nature 382:622–626[CrossRef][Medline]
  3. Amieux PS, Cummings DE, Motamed K, Brandon EP, Wailes LA, Le K, Idzerda RL, McKnight GS 1997 Compensatory regulation of RI{alpha} protein levels in protein kinase A mutant mice. J Biol Chem 272:3993–3998[Abstract/Free Full Text]
  4. Planas JV, Cummings DE, Idzerda RL, McKnight GS 1999 Mutation of the RIIß subunit of protein kinase A differentially affects lipolysis but not gene induction in white adipose tissue. J Biol Chem 274:36281–36287[Abstract/Free Full Text]
  5. Lowell BB 1998 Adaptive thermogenesis: turning on the heat. Curr Biol 8:R517–R520
  6. Jacobsson A, Cannon B, Nedergaard J 1987 Physiological activation of brown adipose tissue destabilizes thermogenin mRNA. FEBS Lett 224:353–356[CrossRef][Medline]
  7. Jacobsson A, Muhleisen M, Cannon B, Nedergaard J 1994 The uncoupling protein thermogenin during acclimation: indications for pretranslational control. Am J Physiol 267:R999–R1007
  8. Bray GA, York DA 1979 Hypothalamic and genetic obesity in experimental animals: an autonomic and endocrine hypothesis. Physiol Rev 59:719–809[Free Full Text]
  9. Reichling S, Patel HV, Freeman KB, Kates AL, Himms-Hagen J 1988 Attenuated cold-induced increase in mRNA for uncoupling protein in brown adipose tissue of obese (ob/ob) mice. Biochem Cell Biol 66:193–198[Medline]
  10. Collins S, Daniel KW, Rohlfs EM, Ramkumar V, Taylor IL, Gettys TW 1994 Impaired expression and functional activity of the ß 3- and ß 1-adrenergic receptors in adipose tissue of congenitally obese (C57BL/6J ob/ob) mice. Mol Endocrinol 8:518–527[Abstract/Free Full Text]
  11. Weigle DS, Bukowski TR, Foster DC, Holderman S, Kramer JM, Lasser G, Lofton-Day CE, Prunkard DE, Raymond C, Kuijper JL 1995 Recombinant ob protein reduces feeding and body weight in the ob/ob mouse. J Clin Invest 96:2065–2070
  12. Mistry AM, Swick AG, Romsos DR 1997 Leptin rapidly lowers food intake and elevates metabolic rates in lean and ob/ob mice. J Nutr 127:2065–2072[Abstract/Free Full Text]
  13. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269:540–543[Abstract/Free Full Text]
  14. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  15. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269:546–549[Abstract/Free Full Text]
  16. Breslow MJ, An Y, Berkowitz DE 1997 ß-3 Adrenoceptor (ß-3AR) expression in leptin treated OB/OB mice. Life Sci 61:59–64[CrossRef][Medline]
  17. Commins SP, Watson PM, Padgett MA, Dudley A, Argyropoulos G, Gettys TW 1999 Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140:292–300[Abstract/Free Full Text]
  18. Brandon EP, Logue SF, Adams MR, Qi M, Sullivan SP, Matsumoto AM, Dorsa DM, Wehner JM, McKnight GS, Idzerda, RL 1998 Defective motor behavior and neural gene expression in RIIß-protein kinase A mutant mice. J Neurosci 18:3639–3649[Abstract/Free Full Text]
  19. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661–671[Medline]
  20. Flier JS 2004 Obesity wars: molecular progress confronts an expanding epidemic. Cell 116:337–350[CrossRef][Medline]
  21. Breslow MJ, Min-Lee K, Brown DR, Chacko VP, Palmer D, Berkowitz DE 1999 Effect of leptin deficiency on metabolic rate in ob/ob mice. Am J Physiol 276:E443–E449
  22. Collins S, Surwit RS 2001 The ß-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Prog Horm Res 56:309–328[Abstract]
  23. Trayhurn P, Duncan JS, Rayner DV 1995 Acute cold-induced suppression of ob (obese) gene expression in white adipose tissue of mice: mediation by the sympathetic system. Biochem J 311(Pt 3):729–733
  24. Ricquier D, Bouillaud F, Toumelin P, Mory G, Bazin R, Arch J, Penicaud L 1986 Expression of uncoupling protein mRNA in thermogenic or weakly thermogenic brown adipose tissue. Evidence for a rapid ß-adrenoreceptor-mediated and transcriptionally regulated step during activation of thermogenesis. J Biol Chem 261:13905–13910[Abstract/Free Full Text]
  25. Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387:90–94[CrossRef][Medline]
  26. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  27. Marsh DJ, Weingarth DT, Novi DE, Chen HY, Trumbauer ME, Chen AS, Guan XM, Jiang MM, Feng Y, Camacho RE, Shen Z, Frazier EG, Yu H, Metzger JM, Kuca SJ, Shearman LP, Gopal-Truter S, MacNeil DJ, Strack AM, MacIntyre DE, Van der Ploeg LH, Qian S 2002 Melanin-concentrating hormone 1 receptor-deficient mice are lean, hyperactive, and hyperphagic and have altered metabolism. Proc Natl Acad Sci USA 99:3240–3245[Abstract/Free Full Text]
  28. Smith SJ, Cases S, Jensen DR, Chen HC, Sande E, Tow B, Sanan DA, Raber J, Eckel RH, Farese Jr RV 2000 Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking Dgat. Nat Genet 25:87–90[CrossRef][Medline]
  29. Zhou Z, Yon Toh S, Chen Z, Guo K, Ng CP, Ponniah S, Lin SC, Hong W, Li P 2003 Cidea-deficient mice have lean phenotype and are resistant to obesity. Nat Genet 35:49–56
  30. Schreyer SA, Cummings DE, McKnight GS, LeBoeuf RC 2001 Mutation of the RIIß subunit of protein kinase A prevents diet-induced insulin resistance and dyslipidemia in mice. Diabetes 50:2555–2562[Abstract/Free Full Text]
  31. Bachman ES, Dhillon H, Zhang CY, Cinti S, Bianco AC, Kobilka BK, Lowell BB 2002 ßAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297:843–845[Abstract/Free Full Text]
  32. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  33. Ueno N, Oh-ishi S, Segawa M, Nishida M, Fukuwatari Y, Kizaki T, Ookawara T, Ohno H 1998 Effect of age on brown adipose tissue activity in the obese (ob/ob) mouse. Mech Ageing Dev 100:67–76[CrossRef][Medline]
  34. Pinto S, Roseberry AG, Liu H, Diano S, Shanabrough M, Cai X, Friedman JM, Horvath TL 2004 Rapid rewiring of arcuate nucleus feeding circuits by leptin. Science 304:110–115[Abstract/Free Full Text]
  35. Ollmann MM, Wilson BD, Yang YK, Kerns JA, Chen Y, Gantz I, and Barsh GS 1997 Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278:135–138[Abstract/Free Full Text]
  36. Elias CF, Lee C, Kelly J, Aschkenasi C, Ahima RS, Couceyro PR, Kuhar MJ, Saper CB, Elmquist JK 1998 Leptin activates hypothalamic CART neurons projecting to the spinal cord. Neuron 21:1375–1385[CrossRef][Medline]
  37. Erickson JC, Hollopeter G, Palmiter RD 1996 Attenuation of the obesity syndrome of ob/ob mice by the loss of neuropeptide Y. Science 274:1704–1707[Abstract/Free Full Text]
  38. Shimada M, Tritos NA, Lowell BB, Flier JS, Maratos-Flier E 1998 Mice lacking melanin-concentrating hormone are hypophagic and lean. Nature 396:670–674[CrossRef][Medline]
  39. van den Pol AN, Acuna-Goycolea C, Clark KR, Ghosh PK 2004 Physiological properties of hypothalamic MCH neurons identified with selective expression of reporter gene after recombinant virus infection. Neuron 42:635–652[CrossRef][Medline]
  40. Chen Y, Hu C, Hsu CK, Zhang Q, Bi C, Asnicar M, Hsiung HM, Fox N, Slieker LJ, Yang DD, Heiman ML, Shi Y 2002 Targeted disruption of the melanin-concentrating hormone receptor-1 results in hyperphagia and resistance to diet-induced obesity. Endocrinology 143:2469–2477[Abstract/Free Full Text]
  41. Segal-Lieberman G, Bradley RL, Kokkotou E, Carlson M, Trombly DJ, Wang X, Bates S, Myers Jr MG, Flier JS, Maratos-Flier E 2003 Melanin-concentrating hormone is a critical mediator of the leptin-deficient phenotype. Proc Natl Acad Sci USA 100:10085–10090[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Gerontol A Biol Sci Med SciHome page
L. C. Enns, J. F. Morton, R. S. Mangalindan, G. S. McKnight, M. W. Schwartz, M. R. Kaeberlein, B. K. Kennedy, P. S. Rabinovitch, and W. C. Ladiges
Attenuation of Age-Related Metabolic Dysfunction in Mice With a Targeted Disruption of the C{beta} Subunit of Protein Kinase A
J Gerontol A Biol Sci Med Sci, December 1, 2009; 64A(12): 1221 - 1231.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L. S Kirschner, Z. Yin, G. N Jones, and E. Mahoney
Mouse models of altered protein kinase A signaling
Endocr. Relat. Cancer, September 1, 2009; 16(3): 773 - 793.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
G. Mantovani, S. Bondioni, L. Alberti, L. Gilardini, C. Invitti, S. Corbetta, M. A. Zappa, S. Ferrero, A. G. Lania, S. Bosari, et al.
Protein Kinase A Regulatory Subunits in Human Adipose Tissue: Decreased R2B Expression and Activity in Adipocytes From Obese Subjects
Diabetes, March 1, 2009; 58(3): 620 - 626.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Z. de Pina, H. Vazquez-Meza, J. P. Pardo, J. L. Rendon, R. Villalobos-Molina, H. Riveros-Rosas, and E. Pina
Signaling the Signal, Cyclic AMP-dependent Protein Kinase Inhibition by Insulin-formed H2O2 and Reactivation by Thioredoxin
J. Biol. Chem., May 2, 2008; 283(18): 12373 - 12386.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. A. Czyzyk, M. A. Sikorski, L. Yang, and G. S. McKnight
Disruption of the RII subunit of PKA reverses the obesity syndrome of agouti lethal yellow mice
PNAS, January 8, 2008; 105(1): 276 - 281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Newhall, K. J.
Right arrow Articles by McKnight, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Newhall, K. J.
Right arrow Articles by McKnight, G. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals