help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0144
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Youn, H.
Right arrow Articles by Ji, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Youn, H.
Right arrow Articles by Ji, T. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Molecular Endocrinology 19 (5): 1318-1328
Copyright © 2005 by The Endocrine Society

An Upstream Initiator-Like Element Suppresses Transcription of the Rat Luteinizing Hormone Receptor Gene

HyeSook Youn, YongBum Koo, Inhae Ji and Tae H. Ji

School of Biotechnology and Biomedical Science (H.Y., Y.K.), Inje University, Gimhae 621-749, Korea; and Department of Chemistry (H.Y., I.J., T.H.J.), University of Kentucky, Lexington, Kentucky 40506-0055

Address all correspondence and requests for reprints to: YongBum Koo, Department of Biotechnology and Biomedical Science, Inje University, Gimhae 61-749, Korea. E-mail: mbkooyb{at}ijnc.inje.ac.kr.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of the rat LH receptor (rLHR) is characterized by a dynamic response to a variety of hormonal stimuli. In addition to activation, the pattern of rLHR expression is also modulated by repression. In this report, an upstream initiator-like element (UInr-lE), CTCACTCTAA, of which the CTC direct repeat motif (CTCACTC) is conserved in the rat, mouse, and human, was identified as a suppressor element. Disruption of the element resulted in a 2-fold enhancement of promoter activity in the LHR-expressing murine Leydig tumor cells. The sequences of the two major initiators (Inr), Inr3 and Inr4, of the rLHR core promoter are similar to UInr-lE and competed efficiently with UInr-lE in the formation of specific protein complexes, suggesting that the same proteins interact with both UInr-lE and the Inrs in vivo. The Inrs are necessary for full promoter activity because a mutant promoter lacking Inrs showed a 70% reduction in activity. UInr-lE also further suppressed the activity of a mutant promoter lacking Inrs. UInr-lE interacted with transcription factor II-I (TFII-I) and an unidentified nuclear protein. However, dominant-negative inhibition experiments using p70 indicated that TFII-I positively regulates LHR promoter activity through UInr-lE and Inrs, suggesting that TFII-I can compromise the suppression of promoter activity mediated by UInr-lE. UInr-lE also showed binding properties distinct from that of the upstream initiator-like suppressor element (upstream regulatory element: CACTCTCC) of rat and human dynorphin promoters. Transfection assays using mutated promoters indicate that the suppression of rLHR promoter activity could be regulated via specific interactions between UInr-lE and trans-acting factors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE LH RECEPTOR (LHR), a member of the G protein-coupled receptor family, is expressed mainly in the Leydig cells of the testis and in the theca, granulosa and luteal cells of the ovary. It binds the ligands, LH/chorionic gonadotropin (CG), and transduces hormonal signals into cells through cAMP-dependent protein kinase A- and protein kinase C-dependent pathways to induce cell differentiation and steroidogenesis (1). In the ovary, its expression is regulated spatially and temporally, at specific stages of the ovarian cycle. This pattern of expression requires multiple regulatory sites and their binding proteins whose expression is likely to be regulated by hormones and growth factors such as FSH (2), LH/CG (3), progesterone (4, 5), epidermal growth factor 1 (6), IGF-I (7, 8, 9), and TGF (10, 11).

The promoter of the rat LHR (rLHR) gene is GC rich, TATA-less, and has five transcriptional start sites (12, 13), four of which are located in their respective initiators (Inrs) and which have the consensus sequence PyPyA+1NT/APyPy (Fig. 1BGo). More than 93% of the transcriptional initiation of the LHR gene in the rat ovary is mediated by the Inrs (14). Two adjacent Inrs, Inr3 and Inr4, are responsible for 74% of the transcription. The regulatory functions of elements in the promoters and the upstream regions of rat and human LHR (hLHR) genes have been previously described. Most of these elements, such as Sp1 binding elements (15), a steroidogenic factor 1 binding site (16), an Sp1c adjacent site-like element (17), an early growth response 1 site (18) and an M1 region (19) were found in the minimal promoter (–180/–1) and were shown to be involved in the positive regulation of transcription. On the other hand, negative regulatory elements have also been found in the minimal promoter. A nuclear orphan receptor binding element that interacts with ErbA-related protein 2 (EAR2), EAR3/chicken ovalbumin upstream promoter transcription factor 1, and testicular orphan receptor 4 was identified as a repression site (20). An Sp1 binding element was shown to recruit the histone deacetylase-mSin3A complex to suppress promoter activity (21). In addition to regulatory elements in the core promoter, regulatory sequences further upstream or down stream of the rLHR gene have been sought by analysis of serial deletions of the promoter region. Negative regulatory regions were mapped at –6500 (approximate)/–2074, –2074/–1376, –1537/–1373, –1376/–482, –482/–186, +30/+156 (22) and at –2056/–1237 and –990/–174 for the rLHR promoter (23), and at –1051/–835, –480/–276, and –276/–184 for the hLHR promoter (24). However, specific elements within these upstream negative regions have not yet been characterized in detail.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Nucleotide Sequence of the Upstream Region and the Core Promoter of the LHR Gene

Comparison of the nucleotide sequences of the upstream initiator-like elements (UInr-lEs) and their vicinity (A) and the core promoters (B) of the rat, mouse, and human LHR genes. UInr-lEs are boxed. Initiators are underlined. The transcriptional start sites of the rat gene are indicated by arrows. The rat initiators are indicated (Inr1 through Inr4). Nucleotides are numbered relative to the translation initiation codon (ATG).

 
In this study, we analyzed the upstream negative regulatory region that is the most proximal to the rLHR minimal promoter (–482/–186). This region has been shown to be responsible for the 2-fold suppression of gene expression in transfection assays with murine Leydig tumor cells (mLTC-1) (22). An upstream initiator-like element (UInr-lE), conserved in the rat, mouse, and human LHR genes, was identified as a suppressor in this region. Analysis by EMSA showed that UInr-lE forms two complexes with mLTC-1 nuclear proteins, one of which was identified as transcription factor II-I (TFII-I). UInr-lE and the Inrs of the LHR core promoter interact with same proteins, as shown by EMSA. UInr-lE functioned as a suppressor in mLTC-1 cells regardless of the presence of Inrs in the core promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Analysis of the Proximal Upstream Negative Regulatory Region (–482/–186)
The 297 nucleotides of the upstream region (–482/–186) of the LHR promoter have been reported to act as a negative regulator in mLTC-1 cells (22). To further dissect this region, 5'-deletion derivatives of the LHR promoter-luciferase reporter plasmid, pGLKp (containing the –482/–1 region) were constructed and transfected into mLTC-1 cells: pLHR8 (–430/–1), pLHR7 (–387/–1), pLHR6 (–330/–1), pLHR5 (–280/–1), pLHR4 (–220/–1), and pSMc (–186/–1) (Fig. 2AGo). The transcriptional activities of these LHR promoter constructs were determined by measuring the luciferase activity of extracts prepared from transfected cells. Reduced luciferase activity was observed for pLHR8 relative to pLHR7 and for pLHR6 relative to pLHR5, whereas enhanced luciferase activity was observed for pLHR7 relative to pLHR6 and for pLHR4 relative to pSMc (Fig. 2BGo). These results suggest that the region has a composite structure with two negative regulatory sites and two positive regulatory sites. Removal of the two negative regulatory sites at –430/–388 and –330/–280 resulted in an enhancement of promoter activity by 1.9-fold, respectively. Removal of the two positive regulatory sites at –387/–330 and –220/–186 reduced luciferase activity by 2.1- and 1.5-fold, respectively (Fig. 2BGo, pLHR7 vs. pLHR6, pLHR4 vs. pSMc). This alternating structure of two opposing regulatory regions has also been found upstream of the promoters for the genes encoding the mouse FSH receptor (25), human GnRH (26), human insulin (27), the cardiac sodium channel (28), human translation termination factor 1 (29), and human p16 (30).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Functional Analysis of 5' Deletion Mutant Promoters of the rLHR

A, 5' Deletion promoters were generated by digestion with Kpn1/Nco1 (pGLKp) and Msc1/Nco1 (pSMc) and by PCR (pLHR8–pLHR4). The promoters were cloned upstream of the firefly luciferase reporter of pGL3-basic. B, Relative luciferase activity of 5' deletion promoters after transfection into mLTC-1 cells. The results were normalized against the luciferase activity of the cotransfected pRL-TK (FL/RL) and expressed as the means ± SE of three independent experiments. *, **, ***, ****, P < 0.01.

 
The Initiator-Like Element Suppresses rLHR Promoter Activity
The two negative regulatory regions were analyzed with the program TF Search (31) to identify consensus elements for transcriptional regulation. One element, –426TCAAGTA–420, which conforms to the motif TYAAGTG recognized by the cardiac transcription factor Nkx2.5, a member of the homeobox gene family (32), was found in the –430/–388 region. Functional analysis of this negative region was not performed. On the other hand, an initiator-like element (consensus for the cap signal for transcriptional initiation), –290TCACTCT–282, was found in the –320/–280 negative regulatory region. This element was termed UInr-lE. Interestingly, this sequence overlaps the CTC direct repeats –291CTCACTC–283, which are conserved at corresponding positions of promoters of the rat, human, and mouse LHR genes (Fig. 1AGo). The combined sequence, CTCACTCT, is identical or highly homologous to the core promoter initiators of the adenovirus major late (AdML) promoter (33, 34), the terminal deoxynucleotide transferase (TdT) promoter (33), and the T-cell receptor variable ß chain (Vß) promoter (35, 36), which were shown to bind the activating factor TFII-I; interestingly, it is also similar to the initiators of the rLHR core promoter. It also shows high homology to the upstream regulatory elements (UREs) of the rat dynorphin (rDyn) and human macrophage inflammatory protein 1 ß (hMIP1ß) promoters, which resemble initiators and which reportedly bind the repressor UREB1 (37, 38). The positioning of these apparently identical elements in two different sites, core promoter and upstream region, is not commonly observed. To study the function of the initiator-like element, we converted the conserved sequence CTCACTC of the luciferase reporter plasmid pGLKp to AGAAAGA, to make pGLKp-m1. This alteration enhanced promoter activity by 1.9-fold relative to that of the wild-type pGLKp in transfected mLTC-1 cells, suggesting that the conserved sequence is required for suppression by the element (Fig. 3Go). To further delineate the nucleotide sequences responsible for suppression, we carried out site-directed mutagenesis to generate a series of mutant derivatives of pGLKp. The construct pGLKp-m3 and pGLKp-m4, in which the first and second repeats are substituted with AGA, respectively, showed moderately elevated luciferase activities (1.6- and 1.4-fold, respectively), whereas pGLKp-m5, in which TAA in the 3' flanking sequence is substituted with GCC showed a more elevated promoter activity (1.9-fold) similar to that of pGLKpm1. The construct pGLKp-m2, which has three nucleotide substitutions further upstream of the conserved sequence, exhibited wild-type promoter activity (Fig. 3Go). These results show that the UInr-lE motif CTCACTCTAA, which contains the conserved sequence CTCACTC and its 3' flanking sequence, TAA, is required for suppression.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Functional Analysis of UInr-lE of the rLHR Promoter by Site-Directed Mutagenesis and Transfection into mLTC-1 Cells

A, The nucleotide sequences of the UInr-lE region of mutant promoters were generated by site-directed mutagenesis. Mutant nucleotides are shown in lower case. The sequence conserved among the rat, mouse, and human LHR is underlined. B, Relative luciferase activity of UInr-lE triplet mutants in transfected mLTC-1 cells. The results were normalized against the Renilla luciferase activity of the cotransfected pRL-TK (FL/RL) and expressed as the means ± the SE of three independent experiments. *, P < 0.01, compared with the relative luciferase activity of pGLKp and pGLKp-m2.

 
The Initiator-Like Element Forms Two DNA-Protein Complexes, C1 and C2
EMSA was performed to characterize interactions between mLTC-1 nuclear proteins and UInr-lE. Two protein-DNA complexes, C1 and C2, were detected by EMSA using the radiolabeled oligonucleotide lhr23wt (Fig. 4Go, A–C). Unlabeled lhr23wt competitor interfered with the formation of both complexes in a concentration-dependent manner (Fig. 4AGo). A nonspecific oligonucleotide competitor, lhr22, was used to further confirm sequence-specific interaction for the two complexes. The lhr22 sequence originates from an upstream region (–390/–376) of rLHR promoter. Complex C1 was unaffected by the lhr22 competitor. However, contrary to expectations, the extent of C2 complex formation was reduced by the lhr22 competitor (Fig. 4AGo). Because lhr22 interfered with C2 complex formation but not C1 complex formation, we compared the sequence of lhr22 with other known elements and found that it contains two repeats (GGCCT and GGCGT) also found in the TFII-I binding core sequence of the endoplasmic reticulum stress response element (ERSE) (39). TFII-I was originally identified as an Inr binding protein. However, it is also known that TFII-I can bind to other sites such as the E-box (33) and ERSE. These results suggest that TFII-I may be a protein component of the C2 complex.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 4. Analysis of Sequence-Specific Protein Binding by UInr-lE

A, Sequence-specific binding of mLTC-1 nuclear extract proteins to wild-type oligonucleotide lhr23wt. Radiolabeled lhr23wt was incubated with mLTC-1 nuclear extract in the presence or absence of competitor oligonucleotides. The two shifted protein-DNA complexes are designated as C1 and C2. Molar excesses (50- to 200-fold) of the unlabeled specific competitor lhr23wt or of the unlabeled nonspecific competitor lhr22 (200-fold) were added. lhr23wt interfered with the formation of both complexes. C2 complex formation was also abrogated by the nonspecific lhr22 competitor (see text for details). B, 200-Fold molar excesses of mutant oligonucleotides (lhr23m2–lhr23m5) with triplet mutations and nonspecific lhr22 were used as competitors. C, 100-Fold molar excesses of the UInr-lE single nucleotide mutant oligonucleotides were used as competitors. See Materials and Methods for mutated sequences.

 
The Sequence CTCACTCTAA Is Required for Interaction with Binding Proteins in the C1 Complex as Well as in the C2 Complex
A series of mutant oligonucleotides derived from lhr23wt was used to determine the nucleotides required for protein binding by UInr-lE. In competition analysis, the mutant oligonucleotide, lhr23m2, which has a triplet substitution (AAG -> CCT) in the 5' flanking sequence of the conserved sequence, competed for both of the two complexes in a manner comparable with the wild-type competitor lhr23wt (Fig. 4BGo). However, the mutant oligonucleotides lhr23m3 and lhr23m4, which have triplet substitutions within the conserved sequence, were not able to compete efficiently. The mutant oligonucleotide lhr23m5, which has a triplet substitution (TAA -> GCC) in the 3' flanking sequence of the conserved nucleotides, was even less efficient (Fig. 4BGo). These results demonstrate that the sequence CTCACTCTAA is required for the formation of the two complexes and that the 3' flanking sequence TAA is more involved in the formation of both complexes than is either of the CTC direct repeats. EMSA of single nucleotide mutants also supports these observations. In addition to the triplet mutation, single nucleotide substitution mutants were generated and used as competitors to further analyze the recognition sequence of UInr-lE. The oligonucleotides, hr23s2, lhr23s6, and lhr23s9, which have mutations in the second T, the sixth T, the ninth A, respectively, were the poorest competitors among the single nucleotide mutant oligonucleotides (Fig. 4CGo). Although the oligonucleotide lhr23s10, which has a mutation in the tenth A, was not an effective competitor than lhr23s2, lhrs6, and lhrs9, it was still a poorer competitor than other single nucleotide mutants, lhr23s3, lhr23s4, lhr23s5, lhr23s8, and lhr23s11 (Fig. 4CGo). These results support the results obtained with the triplet mutants.

The Binding Proteins of the UInr-lE and their Recognition Sequences
Several binding factors including TFII-I (33), UREB1 (37), YY1 (40), and Miz (41) have been found to interact with initiators or initiator-like elements to activate or repress transcription. We found that the upstream initiator-like element of the rLHR promoter is homologous to two groups of elements reported so far. One includes initiators of the TdT, AdML, and Vß promoters, which have been shown to bind TFII-I (33, 34, 35, 36), a general activating transcriptional factor. The other includes the upstream initiator-like elements of the rDyn and hMIP1ß promoters, which bind UREB1, a tyrosine-phosphorylated, presumed repressor protein. We performed EMSA using the lhr23wt, TdT initiator, YY1 and USF1 oligonucleotides. Only the TdT initiator oligonucleotide showed the same binding pattern as lhr23wt, and lhr23wt interfered with binding (Fig. 5AGo). The YY1 oligonucleotide and the USF1 oligonucleotide formed complexes different from the C1 or C2 complexes formed with lhr23wt and were not affected by lhr23wt competitor. These results demonstrate that proteins that interact with the TdT initiator also interact with lhr23wt and suggested that one of these proteins might be TFII-I. To determine whether TFII-I is a component of C1 or C2 complex, supershift analysis was performed using an anti-TFII-I antibody, which is known to abrogate the complex rather than supershift it (42). The C2 complex was disrupted by the anti-TFII-I antibody, whereas the C1 complex was unaffected (Fig. 5BGo). Taken together, these results demonstrate that TFII-I binds to lhr23wt to form the C2 complex. This finding is also supported by EMSA results using a TFII-I binding element, the ERSE-containing lhr22 oligonucleotide (Fig. 4Go, A and B).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 5. UInr-lE Binds TFII-I and Displays Binding Characteristics Distinct from Other Initiator-Like Binding Elements

A, EMSA was performed using oligonucleotides for other initiator-like elements (YY1, YY1 binding element; TdT, TdT initiator) and the E-box (USF1 binding element). Only the TdT initiator promotes formation of the apparently same shift complexes as lhr23wt. B, Supershift analysis performed with the anti-TFII-I antibody, which disrupted only the C2 complex. C, EMSA was performed using lhr23wtL (a longer version of lhr23wt), and competition was assayed using the initiator-like rDynURE and hMIP1ßURE oligonucleotides. The lhr23wtL promoted formation of two complexes, which were unaffected by the rDynURE and hMIP1ßURE oligonucleotides.

 
A candidate for the other binding protein is UREB1. To assess the possibility of UREB1 interaction with the upstream initiator-like element, EMSA using competitor oligonucleotides containing the initiator-like elements of the rDyn and the hMIP1ß genes was performed. In this experiment, we used the lhr23wtL probe, a longer version of lhr23wt. The lhr23wtL oligonucleotide has an additional 9 bp 3' of lhr23wt and matches the rDynURE and hMIP1ß competitors in length. Neither the rDynURE oligonucleotide nor the hMIP1ßURE oligonucleotide competed with lhr23wtL for complex formation, whereas lhr23wt did (Fig. 5CGo). These results demonstrate that despite its sequence similarity to URE, UInr-lE has protein binding properties distinct from that of UREs. This difference must originate from the two-nucleotide difference in their sequences (see Discussion).

UInr-lE Also Suppresses the Inr-Negative Mutant rLHR Promoter
Transcription initiation by RNA polymerase II requires the formation of a preinitiation complex mediated by the TATA-box and/or initiator(s). The rLHR promoter has no TATA box but does contain multiple canonical initiators. Each of the four initiators of the rLHR core promoter has its respective transcriptional start site at the nucleotide A of the initiator consensus YYA+1NYYY (14). Of the four initiators in the rLHR core promoter, Inr2 completely matches the consensus, whereas the others deviate by one nucleotide. Initiation by Inr3 and Inr4 constitute 57% and 17% of the transcriptional activity, respectively, whereas Inr1 and Inr2 initiate 6% of the rLHR transcripts, respectively (14). Interestingly, profound similarities were noticed between UInr-lE and the initiators despite degeneracy or the loose consensus of the initiator elements. EMSA using Inr oligonucleotides (INR1–INR4) as competitors was performed to determine whether any of these could interfere with complex formation by UInr-lE. The oligonucleotides INR3 and INR4, which contain the major initiators Inr3 and Inr4, respectively, effectively interfered with the formation of both complexes, as compared with lhr23wt, whereas INR1 and INR2 were weak competitors (Fig. 6BGo). INR2, which exactly matches the initiator consensus but is a poor initiator, was the worst of the four INR competitors. These results demonstrate that UInr-lE and the four initiators bind the same proteins in vitro and that the affinity of the binding proteins for each of the initiators apparently reflects the transcriptional initiation strength of each corresponding Inr. Although the same factors interact with UInr-lE and the Inrs in vitro, the in vivo functional architecture of the protein-DNA complexes may not be same. It has been postulated that TBP-associated factors or initiator binding proteins such as YY1 and TFII-I initially bind to TATA-less core promoter Inrs and then interact with TFIID or its components to nucleate the assembly of general transcription factors at the core promoters (43, 44, 45). However, according to our in vitro results, it is possible that UInr-lE and the Inrs share a set of binding proteins in vivo, suggesting that there may be functional relations such as direct and/or indirect competition among them.



View larger version (95K):
[in this window]
[in a new window]
 
Fig. 6. Inrs of the rLHR Promoter Compete for Protein-UInr-lE Complexes

The oligonucleotides carrying the Inrs of the rLHR promoter were used as competitors for the complexes formed by the wild type UInr-lE oligonucleotide lhr23wt. INR3 and INR4 interfered with complex formation to an extent comparable with that of lhr23wt. See Materials and Methods for oligonucleotide sequences.

 
The Inrs and/or UInr-lE of the rLHR promoter were disrupted to investigate these possible functional relations. The initiator-negative mutant promoter pLHR6-inr exhibited 30% of the wild type promoter activity, suggesting the active involvement of these elements in transcriptional activation (Fig. 7Go).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. Functional Analysis of the Contribution of UInr-lE and Inrs Elements and Their Associated Binding Factor TFII-I to rLHR Promoter Activity

A, Schematic presentation of the different combinations of mutant sites on the rLHR promoter (–330/–1). UInr-lE or Inrs or both were disrupted by site-directed mutagenesis. Wild-type elements are denoted by filled circles. Disrupted elements are denoted by crosses. B, Relative luciferase activity of the mutants after transfection into mLTC-1 cells. mLTC-1 cells were cotransfected with a LHR promoter-luciferase reporter plasmid (pLHR6 or its mutant) and pcDNA3 (control vehicle), pcTFII-I or pcp70(dominant-negative TFII-I). Transfected cells were cultured for 24 h in the presence or absence of 0.1 nM hCG. The results were normalized against the Renilla luciferase activity of cotransfected pRL-TK (FL/RL) and expressed as means ± SE of three independent experiments. P < 0.01.

 
Disruption of the UInr-lE enhanced the promoter activity of pLHR6-inr up to 50% of the wild-type level (compare pLHR6-inr and pLHR6-m1-inr in Fig. 7Go). These results suggest that UInr-lE suppresses rLHR promoter activity and that its function is independent of the core promoter initiators. The suppression of transcription by the –330/–280 region was also demonstrated when the serially deleted upstream regions covering –490/–183, which were used in rLHR promoter assay, were placed upstream of the noninitiator-dependent core promoter of the sepiapterine receptor gene (data not shown). This result also supports initiator-independent suppression by the UInr-lE.

TFII-I Interacts with UInrl-E and Inrs and Positively Regulates the rLHR Promoter in a hCG-Independent Manner
The function of TFII-I in rLHR promoter activity was investigated by overexpressing wild-type human TFII-I or p70, which is the dominant-negative form of TFII-I (36) in mLTC-1 cells. The expression plasmids, pcTFII-I and pcp70, which express human TFII-I and a dominant-negative form of TFII-I, p70, respectively, were cotransfected with the mutant promoter-luciferase constructs, pLHR6-inr, pLHR6-m1, and pLHR6-m1-inr derived from pLHR6. TFII-I activated the promoters of pLHR6-m1(UIne-lE-negative mutant) and pLHR6(wild type), whereas p70 suppressed promoter activity, indicating that TFII-I up-regulates promoter activity through Inrs (Fig. 7Go). However, the activity of the initiator-negative promoter construct, pLHR6-inr, was also increased by overexpressed TFII-I and suppressed by p70, whereas the double mutant pLHR6-m1-inr responded to neither TFII-I nor p70. This indicates that UInr-lE interacts with TFII-I to activate the promoter.

We also tested whether hCG stimulation of the mLTC-1 would modulate p70-mediated suppression or TFII-I-mediated up-regulation of promoter activity. Treatment with hCG up-regulated by 1.5- to 1.6-fold the activity of all three mutant promoters as well as that of the wild-type promoter. These results suggest that neither suppression of promoter activity by UInr-lE nor TFII-I-mediated up-regulation through UInr-lE and Inrs is dependent on hCG signaling in mLTC-1 cells.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Both positive and negative regulation has been suggested to be involved in controlling the characteristic spatial-temporal expression of LHR genes (4, 21, 46, 47) The negative regulatory sites play roles in repression at the chromatin-level in nonexpressing cells as well as in the dynamic response to hormones in expressing cells in the derepressed state. Recently, negative regulatory sites within the rLHR and hLHR minimal promoters have been analyzed in depth, and detailed mechanisms for repression have been proposed (21, 46, 47).

In the meantime, additional negative regulatory regions were found further upstream by our and other groups but have not been analyzed in detail (22, 23). In this study, we focused on the functional analysis of an upstream negative regulatory region and identified the upstream initiator-like element UInr-lE as a suppressor. The structure of UInr-lE in the LHR promoter is particular in that it has 3' nucleotides (AA) in addition to the TFII-I consensus recognition motif, which are mainly responsible for interaction with TFII-I as well as with the unknown protein in the C1 complex. This was also demonstrated by the results that the mutant pLHR-m5, which has substitutions for these two nucleotides exhibited an elevated promoter activity (Fig. 3Go). From these results, we concluded that the sequence, CTCACTCTAA, which covers the conserved CTCACTC and the 3' TAA, are needed for the full activity of the element. This feature may allow the two factors to compete for the same site. Competition between the two factors may depend on the relative concentrations of each in the nucleus of specific cell types.

Comparison of the sequences of the UREB1 binding elements of the rDyn or hMIP1ß promoters, CACTCTCC, and that of the rLHR upstream initiator-like element, CTCACTCTAA, shows that they differ in the 5' CT and in the 3' AA of the rLHR initiator-like element. However, the 5'CT likely does not explain the difference in competition between the UREs and lhr23wtL because it is also present at the 5' end of hMIP1ßURE, a sequence that could not compete with lhr23wtL(Fig. 5CGo). On the other hand, the 3'AA of the rLHR initiator-like element were shown to be important nucleotides for the specific binding of the C1 complex protein because replacement of either nucleotide with C reduced the binding specificity of the element for the C1 complex protein (Fig. 4CGo). On the other hand, substitution of the corresponding CC nucleotides of hMIP1ßURE or rDynURE with AA was shown to have no effect on the binding specificity of these UREs for UREB1 (37). This means that UREB1 may bind both URE and the initiator-like element of the rLHR promoter with similar affinity. However, it seems that the C1 complex protein in this study is not UREB1 because it interacted with UInr-lE with much higher affinity than with URE, as demonstrated by our EMSA results and by previous reports on URE (37). The 3' AA appears to confer upon UInr-lE the ability to discriminate against UREB1, which reportedly interacts with URE and represses the transcription of the rDyn and hMIP1ß genes.

The identity of the C1 complex protein is not known at this point. It is neither TFII-I nor UREB1, based on the results of supershift analysis with anti-TFII-I, as well as competition analysis with rDynURE and hMIP1ßURE, respectively. However, it might be another TFII-I family protein (48, 49) or a HECT E3 ubiquitin-protein ligase (E3) family protein (50), to which UREB1 belongs. A TFII-I family protein, muscle TFII-I repeat domain-containing protein (MusTRD), general transcription factor 3, binding factor early enhancer, reportedly interacts with an initiator-like element of the human troponin 1 slow enhancer to repress enhancer-mediated activation (51). It has also been shown that MusTRD/general transcription factor 3/binding factor for early enhancer both positively and negatively regulates the transcription of the Ig heavy chain gene in a cell line-dependent manner by interacting with an initiator-like element, DICE (downstream Ig control element), in its promoter (52). Similarly, we cannot exclude a HECT E3 family protein as a candidate C1 complex protein because UREB1 in this family has been shown to interact with an upstream initiator-like element URE. Some proteins in this family have been shown to be involved in the regulation of transcription by degrading or stabilizing other transcription factors or cofactors (53, 54). UREB1 functions as a repressor by counteracting p53-mediated promoter activation (38). It is the only protein of this family that is known to interact with specific DNA elements so far. Both TFII-I and UREB1 are functionally regulated by phosphorylation, so they may respond to extracellular signals (38, 55, 56).

Many different factors can interact with initiator-like elements due to their degenerate nature. As a consequence, there are many different repression mechanisms. Some factors that interact with upstream initiator-like elements have been shown to interact with core promoter initiators (40, 57, 58). These factors usually up-regulate initiator-mediated basal transcription through interaction with initiators and components of the basal transcriptional machinery. The TFII-I family proteins, TFII-I and MusTRD, belong to this category of proteins and are the most probable factors that interact with UInr-lE of the rLHR promoter. The mechanisms of repression by these factors mediated through upstream initiator-like elements are not clearly understood, and identification of their interacting partner proteins is a necessary step. The TFII-I family proteins TFII-I and MusTRD were shown to interact with histone deacetylase 3 to repress transcription, probably at the chromosomal level (59, 60). Repression can be relieved by the cofactor Miz/PIASxb/Siz2 (59), an E3. However, chromatin level repression is not likely to be the only mechanism applicable to initiators or initiator-like elements, because MusTRD represses the troponin 1 gene by interacting with the activator protein MEF2 (51).

Recently, TFII-I was found to interact with c-Myc through an upstream binding element to repress transcription (48). In addition to chromatin level regulation, the modulation of activator proteins may provide further dynamics or fine tuning of rLHR gene expression to meet cellular requirements, such as steroidogenesis upon hormone stimulation.

An interesting feature of the rLHR promoter structure is the similarity of the core promoter initiators and UInr-lE. Interestingly, the two distantly located elements bind the same nuclear proteins, at least as demonstrated by EMSA. This result prompted us to investigate their relationships in the regulation of gene expression. Contrary to our expectations, we did not find an apparent relationship between the two elements in transfection assays using the Inr-negative rLHR promoter and UInr-lE-negative/Inr-negative mutant rLHR promoter (Fig. 7Go).

Several reports have shown that expression of LHR is regulated by its ligands, LH and CG (61, 62, 63). A surge in ovulatory LH levels down-regulates the number of LHR messages as well as the number of LHR receptors. cAMP mimics this ligand-induced down-regulation in both cultured granulose cells and established Leydig cell lines (64). However, other reports demonstrated that cAMP up-regulates LHR promoter activity transcriptionally in in vitro systems using cloned promoter-luciferase constructs and cultured granulose or Leydig cells (65, 66). In agreement with the above the results, we show here that hCG up-regulates rLHR promoter activity in transfection assays in mLTC-1 cells and that this induction is independent of UInr-lE and Inrs (Fig. 7Go). TFII-I is a phosphoprotein that is phosphorylated on serine/threonine and tyrosine residues (56). It is activated by Bruton’s tyrosine kinase (67) and ERK (68, 69). It will be interesting to see whether factors such as IGF-I, epidermal growth factor, basic fibroblast growth factor and TGF-ß (6, 70), which are known to affect LHR expression, or any of their associated signaling pathways, are involved in the activation of TFII-I in gonadal cells.

Ligand-induced dynamic regulation of LHR expression is more closely involved in growth and differentiation in granulose cells than in Leydig cells, in which a relatively constant level of steroidogenesis is maintained by hormonal stimulation. It has been demonstrated that ligand (hCG) regulates the expression of nuclear orphan receptors, EAR2, EAR3/chicken ovalbumin upstream promoter transcription factor 1, and testicular orphan receptor 4, whose expression contributes to gonadotropin-induced derepression of the rLHR promoter in granulose cells (71). Although the same factors are found in human testis, the functions of these factors in Leydig cells have not yet been studied. Investigating how these factors, including nuclear orphan receptors, TFII-I and the unidentified protein in this study, differentially regulate rLHR promoter activity in different cell type may help to elucidate the regulatory signals and regulation mechanisms they elicit in each cell type.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
The LHR promoter and upstream region (–482/–1) was excised from a 5-kb EcoR1 genomic fragment (12) and subcloned into the Kpn1/Nco1 site of the luciferase reporter plasmid pGL3-basic (Promega, Madison, WI) to make pGLKp. A series of 5'-deletion derivatives of pGLKp was generated by PCR with the following 5' PCR primers (with Mlu1 sites underlined) and the 3' primer (with Nco1 site underlined): LHR8, TCGACGCGTGTCAAGTATGGAGGAGCA; LHR7, TCGACGCGTGCGTGGCGTTCCCTCTTC; LHR6, TCGACGCGTACAGGTTTCATGGGGACC, LHR5, TCGACGCGTGCGCTAACCACACATGAC, LHR4, TCGACGCGTATGGGTCGTGGGGAAACA; LHR1 (3' primer), CCCCATGGCCCGCCAGC. PCR fragments were subcloned into the Mlu1/Nco1 site of pGL3-basic to make pLHR8 (–430/–1), pLHR7 (–387/–1), pLHR6 (–330/–1), pLHR5 (–280/–1), pLHR4 (–220/–1). An Msc1/Nco1 restriction fragment (–183/–1) was subcloned into the Sma1/Nco1 site of pGL3-basic to make pSMc. The p70 cDNA (a dominant-negative form lacking the C-terminal transactivating domain of TFII-I) and TFII-I cDNA were amplified from HEK293 mRNA by RT-PCR using a 5' PCR primer with a BamH1 site and a Kozak sequence (underlined), GAGGATCCGCCACCATGGCCCAAGTTGCAATGTCC and 3' primers with Xba1 site (underlined), CATCTAGATTACTGTTTTAGGTCCGTGATTTTGG (for p70) or CATCTAGACTACCACGTGGGGTCTGG (for TFII-I) and cloned into BamH1/Xba1 site of pcDNA3. All constructs were verified by DNA sequencing.

Site-Directed Mutagenesis
UInr-lE mutants were generated by site-directed mutagenesis using oligonucleotides containing substitutions (underlined): lhr23m1, CATAGTTCAAAGCAGAAAGATAAGCGCTAACC; lhr23m2, CATAGTTCAACTACTCACTCTAAGCGCTAACC; lhr23m3, CATAGTTCAAAGCAGAACTCTAAGCGCTAACC; lhr23m4, CATAGTTCAAAGCCTCAAGATAAGCGCTAACC; lhr23m5, CATAGTTCAAAGCCTCACTCGCCGCGCTAACC. The Inr-negative promoter was also generated using oligonucleotides containing substitutions (underlined): inr-m12, CCCCAGGCGGGAACTACGCGGGAGCTC; inr-m34, CAACCTCGGGAGAGACACAGAGGCTGGCGGGCCA. Briefly, the Sma1/Pst1 fragment (–1340/+78) of the rLHR gene was cloned into the vector pALTER-1 (Promega). Mutant oligonucleotides and the ampicillin repair oligonucleotide were annealed. Polymerization and ligation of the new strand and selection of mutants were performed as directed in the manufacturer’s manual. The Kpn1/Nco1 fragments (–482/–1) or PCR-amplified fragments (–330/–1) were subcloned into pGL-3 basic.

Transient Expression Analysis
mLTC-1 cells (ATCC CRL-2065) were grown in six-well culture plates to 60% confluence in DMEM without phenol red (11054-020; Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (dextran/charcoal treated) (72). The monolayer was transfected using Superfect (QIAGEN, Valencia, CA) as directed in the supplier’s manual. Briefly, 1.0 µg of a promoter-luciferase reporter plasmid construct and 0.1 µg pRL-TK (Promega), a Renilla luciferase expression vector, were mixed with 100 µl serum-free medium containing 5 µl Superfect reagent and incubated for 5 min at room temperature. The mixture was diluted with 1 ml DMEM supplemented with 10% fetal bovine serum and added to the monolayer. After 3 h incubation, the medium was replaced with fresh medium. Cells were incubated for an additional 22 h. To investigate the effects of TFII-I or p70 on LHR promoter, 0.5 µg of pcTFII-I or pcp70 plasmid expressing dominant-negative p70 was included in the transfection mixture together with 0.5 µg of a promoter-luciferase reporter plasmid and 0.1 µg of pRL-TK. Luciferase activities were measured in a Luminometer 20e (Turner Designs, Sunnyvale, CA) using a Dual-luciferase assay system (Promega) as directed in the supplier’s manual.

EMSA
Nuclear extracts were prepared from mLTC-1 cells as described (73). Double-stranded oligonucleotides were end-labeled with [{alpha}-32P]ATP (specific activity, 3000 Ci/mmol) in a kination reaction. The oligonucleotide probes used for UInr-lE analysis are as follows (substitutions are underlined): lhr23wt, AAGCCTCACTCTAAG; lhr23m1, ACTACTCACTCTAAG; lhr23m2, AAGCATTAGCGTAAG, lhr23m3, AAGCAGAACTCTAAG; lhr23m4, AAGCCTCAAGATAAG; lhr23m5, AAGCCTCACTCGCCG; lhr23s1, AAGCATCACTCTAAG; lhr23s2, AAGCGCACTCTAAG; lhr23s3, AAGCCTAACTCTAAG; lhr23s4, AAGCCTCCCTCTAAG; lhr23s5, AAGCCTCAATCTAAG; lhr23s6, AAGCCTCACGCTAAG; lhr23s7, AAGCCTCACTATAAG; lhr23s8, AAGCCTCACTCGAAG; lhr23s9, AAGCCTCACTCTCAG; lhr23s10, AAGCCTCACTCTACG; lhrs11, AAGCCTCACTCTAAT; lhr23wth, ACAACTCACTCAATT; lhr23wtL, AAGCCTCACTCTAAGCGCTAACCA; lhr22; GCAGGCGTGGCGTTC; rDynURE, CGAGAGCACTCTCCTCCACATCAC; hMIP1ßURE, CCACTCACTCTCCTGTGCCC; INR1, GCGGTCCAGCATACT; INR2, CTGGCTCAACCTCGG; INR3, GGAGCTCACACTCAG; INR4, CACACTCAGGCTGGC; TSP5, GGCTGGCGGGCCATGG; YY1, CGCTCGGCGGCCATCTTGGCGGCTGGT; USF1, CACCCGGTCACGTGGCCTACACC; TdT, AGCCCTCATTCTGGA. Nuclear extract (5–10 µg protein) was incubated with end-labeled oligonucleotide probe (3.52 pmol, 10,000 cpm) at 4 C for 30 min in 10 µl binding buffer [25 mM Tris-HCl (pH 7.5), 110 mM potassium chloride, 1 mM dithiothreitol, 1 mM magnesium chloride, 0.2 mM ethylenediamine tetraacetic acid, 1 µg/ml polyadenylic-polyinosinic acid, 5% glycerol]. For competition assays, a 50- to 200-fold excess of unlabeled oligonucleotides was added to binding mixtures. Supershift analysis was performed by incubating the reaction mixture with 2 µl 1:2500 diluted purified anti-TFII-I antibody (kindly provided by Dr. Ananda L. Roy, Tufts University, Boston, MA) for 15 min before adding labeled oligonucleotide probe. DNA-protein complexes were separated on a 4% polyacrylamide gel prepared in 0.5x Tris-borate-EDTA buffer supplemented with 3 mM MgCl2 and 0.25% glycerol. The gel was run in 0.5x (Tris-borate-EDTA) buffer supplemented with 3 mM MgCl2 with buffer circulation for 90 min at 4 C. The gels were dried on 3MM paper (Whatman International Ltd., Maidstone, UK) and then exposed to x-ray film for 12–24 h at –80 C.


    FOOTNOTES
 
This work was supported by the Inje Research and Scholarship Foundation in 2002 (to Y.K.), and by National Institutes of Health Grant HD 18702 (to T.H.J.).

First Published Online January 27, 2005

Abbreviations: AdML, Adenovirus major late; CG, chorionic gonadotropin; E3, E3 ubiquitin-protein ligase; EAR, ErbA-related protein; ERSE, endoplasmic reticulum stress response element; hLHR, human LHR; hMIP1ß, human macrophage inflammatory protein 1; Inr, initiator; LHR, LH receptor; mLTC-1, murine Leydig tumor cells; MusTRD, muscle TFII-I repeat domain-containing protein; rDyn, rat dynorphin; rLHR, rat LHR; TdT, terminal deoxynucleotide transferase; TFII-I, transcription factor II-I; UInr-lE, upstream initiator-like element; URE, upstream regulatory element; UREB1, URE binding protein 1; Vß, T-cell receptor variable ß chain.

Received for publication April 7, 2004. Accepted for publication January 19, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Lakkakorpi JT, Rajaniemi HJ 1994 Regulation of intracellular free Ca2+ by the LH/CG receptor in an established cell line 293 expressing transfected rat receptor. Mol Cell Endocrinol 99:39–47[CrossRef][Medline]
  2. LaBarbera AR, Ryan RJ 1981 Porcine granulosa cells in suspension culture. I. Follicle-stimulating hormone induction of human chorionic gonadotropin-binding sites on cells from small follicles. Endocrinology 108:1561–1570[Abstract/Free Full Text]
  3. LaPolt PS, Jia XC, Sincich C, Hsueh AJ 1991 Ligand-induced down-regulation of testicular and ovarian luteinizing hormone (LH) receptors is preceded by tissue-specific inhibition of alternatively processed LH receptor transcripts. Mol Endocrinol 5:397–403[Abstract/Free Full Text]
  4. El-Hefnawy T, Huhtaniemi I 1998 Progesterone can participate in down-regulation of the luteinizing hormone receptor gene expression and function in cultured murine Leydig cells. Mol Cell Endocrinol 137:127–138[CrossRef][Medline]
  5. El-Hefnawy T, Manna PR, Luconi M, Baldi E, Slotte JP, Huhtaniemi I 2000 Progesterone action in a murine Leydig tumor cell line (mLTC-1), possibly through a nonclassical receptor type. Endocrinology 141:247–255[Abstract/Free Full Text]
  6. Nelson S, Ascoli M 1992 Epidermal growth factor, a phorbol ester, and 3',5'-cyclic adenosine monophosphate decrease the transcription of the luteinizing hormone/chorionic gonadotropin receptor gene in MA-10 Leydig tumor cells. Endocrinology 131:615–620[Abstract/Free Full Text]
  7. Magoffin DA, Weitsman SR 1994 Insulin-like growth factor-I regulation of luteinizing hormone (LH) receptor messenger ribonucleic acid expression and LH-stimulated signal transduction in rat ovarian theca-interstitial cells. Biol Reprod 51:766–775[Abstract]
  8. Burks DJ, de Mora JF, Schubert M, Withers DJ, Myers MG, Towery HH, Altamuro SL, Flint CL, White MF 2000 IRS-2 pathways integrate female reproduction and energy homeostasis. Nature 407:377–382[CrossRef][Medline]
  9. Keene DE, Suescun MO, Bostwick MG, Chandrashekar V, Bartke A, Kopchick JJ 2002 Puberty is delayed in male growth hormone receptor gene-disrupted mice. J Androl 23:661–668[Abstract/Free Full Text]
  10. Knecht M, Feng P, Catt KJ 1986 Transforming growth factor-ß regulates the expression of luteinizing hormone receptors in ovarian granulosa cells. Biochem Biophys Res Commun 139:800–807[CrossRef][Medline]
  11. Richards JS, Russell DL, Ochsner S, Hsieh M, Doyle KH, Falender AE, Lo YK, Sharma SC 2002 Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 57:195–220[Abstract/Free Full Text]
  12. Koo YB, Ji I, Slaughter RG, Ji TH 1991 Structure of the luteinizing hormone receptor gene and multiple exons of the coding sequence. Endocrinology 128:2297–2308[Abstract/Free Full Text]
  13. Tsai-Morris CH, Buczko E, Wang W, Xie XZ, Dufau ML 1991 Structural organization of the rat luteinizing hormone (LH) receptor gene. J Biol Chem 266:11355–11359[Abstract/Free Full Text]
  14. Koo YB, Ji I, Ji TH 1994 Characterization of different sizes of rat luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic acids. Endocrinology 134:19–26[Abstract/Free Full Text]
  15. Tsai-Morris CH, Geng Y, Buczko E, Dufau ML 1995 Characterization of diverse functional elements in the upstream Sp1 domain of the rat luteinizing hormone receptor gene promoter. J Biol Chem 270:7487–7494[Abstract/Free Full Text]
  16. Nikula H, Koskimies P, El-Hefnawy T, Huhtaniemi I 2001 Functional characterization of the basal promoter of the murine LH receptor gene in immortalized mouse Leydig tumor cells. J Mol Endocrinol 26:21–29[Abstract]
  17. Chen S, Liu X, Segaloff DL 2001 Identification of an SAS (Sp1c adjacent site)-like element in the distal 5'-flanking region of the rat lutropin receptor gene essential for cyclic adenosine 3',5'-monophosphate responsiveness. Endocrinology 142:2013–2021[Abstract/Free Full Text]
  18. Yoshino M, Mizutani T, Yamada K, Tsuchiya M, Minegishi T, Yazawa T, Kawata H, Sekiguchi T, Kajitani T, Miyamoto K 2002 Early growth response gene-1 regulates the expression of the rat luteinizing hormone receptor gene. Biol Reprod 66:1813–1819[Abstract/Free Full Text]
  19. Tsai-Morris CH, Geng Y, Xie XZ, Buczko E, Dufau ML 1994 Transcriptional protein binding domains governing basal expression of the rat luteinizing hormone receptor gene. J Biol Chem 269:15868–15875[Abstract/Free Full Text]
  20. Zhang Y, Dufau ML 2000 Nuclear orphan receptors regulate transcription of the gene for the human luteinizing hormone receptor. J Biol Chem 275:2763–2770[Abstract/Free Full Text]
  21. Zhang Y, Dufau ML 2002 Silencing of transcription of the human luteinizing hormone receptor gene by histone deacetylase-mSin3A complex. J Biol Chem 277:33431–33438[Abstract/Free Full Text]
  22. Ji I, Koo YB, Ji TH 1994 Characterization of the rat LH/CG receptor gene: dominant suppressers, proximal regulators and transcription start sites. Endocr J 2:279–287
  23. Tsai-Morris CH, Xie X, Wang W, Buczko E, Dufau ML 1993 Promoter and regulatory regions of the rat luteinizing hormone receptor gene. J Biol Chem 268:4447–4452[Abstract/Free Full Text]
  24. Hu YL, Lei ZM, Rao CV 1996 cis-Acting elements and trans-acting proteins in the transcription of chorionic gonadotropin/luteinizing hormone receptor gene in human choriocarcinoma cells and placenta. Endocrinology 137:3897–3905[Abstract]
  25. Levallet J, Koskimies P, Rahman N, Huhtaniemi I 2001 The promoter of murine follicle-stimulating hormone receptor: functional characterization and regulation by transcription factor steroidogenic factor 1. Mol Endocrinol 15:80–92[Abstract/Free Full Text]
  26. Chen Z, Zheng H, Dong KW 2001 Identification of negative and positive estrogen response elements in human GnRH upstream promoter in the placental JEG-3 cells. Mol Cell Endocrinol 184:125–134[CrossRef][Medline]
  27. Boam DS, Clark AR, Docherty K 1990 Positive and negative regulation of the human insulin gene by multiple trans-acting factors. J Biol Chem 265:8285–8296[Abstract/Free Full Text]
  28. Yang P, Kupershmidt S, Roden DM 2004 Cloning and initial characterization of the human cardiac sodium channel (SCN5A) promoter. Cardiovasc Res 61:56–65[Abstract/Free Full Text]
  29. Dubourg C, Toutain B, Le Gall JY, Le Treut A, Guenet L 2003 Promoter analysis of the human translation termination factor 1 gene. Gene 316:91–101[CrossRef][Medline]
  30. Wang W, Wu J, Zhang Z, Tong T 2001 Characterization of regulatory elements on the promoter region of p16(INK4a) that contribute to overexpression of p16 in senescent fibroblasts. J Biol Chem 276:48655–48661[Abstract/Free Full Text]
  31. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, Kolchanov NA 1998 Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26:362–367[Abstract/Free Full Text]
  32. Ueyama T, Kasahara H, Ishiwata T, Nie Q, Izumo S 2003 Myocardin expression is regulated by Nkx2.5, and its function is required for cardiomyogenesis. Mol Cell Biol 23:9222–9232[Abstract/Free Full Text]
  33. Roy AL, Meisterernst M, Pognonec P, Roeder RG 1991 Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature 354:245–248[CrossRef][Medline]
  34. Roy AL, Du H, Gregor PD, Novina CD, Martinez E, Roeder RG 1997 Cloning of an inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO J 16:7091–7104[CrossRef][Medline]
  35. Manzano-Winkler B, Novina CD, Roy AL 1996 TFII is required for transcription of the naturally TATA-less but initiator-containing Vß promoter. J Biol Chem 271:12076–12081[Abstract/Free Full Text]
  36. Cheriyath V, Novina CD, Roy AL 1998 TFII-I regulates Vß promoter activity through an initiator element. Mol Cell Biol 18:4444–4454[Abstract/Free Full Text]
  37. Gu J, Irving SG, Iadarola MJ 1997 URE, an initiator (Inr)-like site, suppresses the promoter of the rat dynorphin gene. Biochem Biophys Res Commun 231:172–177[CrossRef][Medline]
  38. Gu J, Dubner R, Fornace Jr AJ, Iadarola MJ 1995 UREB1, a tyrosine phosphorylated nuclear protein, inhibits p53 transactivation. Oncogene 11:2175–2178[Medline]
  39. Parker R, Phan T, Baumeister P, Roy B, Cheriyath V, Roy AL, Lee AS 2001 Identification of TFII-I as the endoplasmic reticulum stress response element binding factor ERSF: its autoregulation by stress and interaction with ATF6. Mol Cell Biol 21:3220–3233[Abstract/Free Full Text]
  40. Shi Y, Seto E, Chang LS, Shenk T 1991 Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67:377–388[CrossRef][Medline]
  41. Kime L, Wright SC 2003 Mad4 is regulated by a transcriptional repressor complex that contains Miz-1 and c-Myc. Biochem J 370:291–298[CrossRef][Medline]
  42. Novina CD, Cheriyath V, Denis MC, Roy AL 1997 Methods for studying the biochemical properties of an Inr element binding protein: TFII-I. Methods 12:254–263[CrossRef][Medline]
  43. Roy AL, Malik S, Meisterernst M, Roeder RG 1993 An alternative pathway for transcription initiation involving TFII-I. Nature 365:355–359[CrossRef][Medline]
  44. Chalkley GE, Verrijzer CP 1999 DNA binding site selection by RNA polymerase II TAFs: a TAF(II)250-TAF(II)150 complex recognizes the initiator. EMBO J 18:4835–4845[CrossRef][Medline]
  45. Usheva A, Shenk T 1994 TATA-binding protein-independent initiation: YY1, TFIIB, and RNA polymerase II direct basal transcription on supercoiled template DNA. Cell 76:1115–1121[CrossRef][Medline]
  46. Zhang Y, Dufau ML 2003 Repression of the luteinizing hormone receptor gene promoter by cross talk among EAR3/COUP-TFI, Sp1/Sp3, and TFIIB. Mol Cell Biol 23:6958–6972[Abstract/Free Full Text]
  47. Zhang Y, Dufau ML 2003 Dual mechanisms of regulation of transcription of luteinizing hormone receptor gene by nuclear orphan receptors and histone deacetylase complexes. J Steroid Biochem Mol Biol 85:401–414[CrossRef][Medline]
  48. Roy AL, Carruthers C, Gutjahr T, Roeder RG 1993 Direct role for Myc in transcription initiation mediated by interactions with TFII-I. Nature 365:359–361[CrossRef][Medline]
  49. Bayarsaihan D, Ruddle FH 2000 Isolation and characterization of BEN, a member of the TFII-I family of DNA-binding proteins containing distinct helix-loop-helix domains. Proc Natl Acad Sci USA 97:7342–7347[Abstract/Free Full Text]
  50. Huibregtse JM, Scheffner M, Beaudenon S, Howley PM 1995 A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc Natl Acad Sci USA 92:2563–2567[Abstract/Free Full Text]
  51. Polly P, Haddadi LM, Issa LL, Subramaniam N, Palmer SJ, Tay ES, Hardeman EC 2003 hMusTRD1{alpha}1 represses MEF2 activation of the troponin I slow enhancer. J Biol Chem 278:36603–36610[Abstract/Free Full Text]
  52. Tantin D, Tussie-Luna MI, Roy AL, Sharp PA 2004 Regulation of immunoglobulin promoter activity by TFII-I class transcription factors. J Biol Chem 279:5460–5469[Abstract/Free Full Text]
  53. Zhang Y, Chang C, Gehling DJ, Hemmati-Brivanlou A, Derynck R 2001 Regulation of Smad degradation and activity by Smurf2, an E3 ubiquitin ligase. Proc Natl Acad Sci USA 98:974–979[Abstract/Free Full Text]
  54. Miyazaki K, Ozaki T, Kato C, Hanamoto T, Fujita T, Irino S, Watanabe K, Nakagawa T, Nakagawara A 2003 A novel HECT-type E3 ubiquitin ligase, NEDL2, stabilizes p73 and enhances its transcriptional activity. Biochem Biophys Res Commun 308:106–113[CrossRef][Medline]
  55. Gu J, Ren K, Dubner R, Iadarola MJ 1994 Cloning of a DNA binding protein that is a tyrosine kinase substrate and recognizes an upstream initiator-like sequence in the promoter of the preprodynorphin gene. Brain Res Mol Brain Res 24:77–88[Medline]
  56. Novina CD, Cheriyath V, Roy AL 1998 Regulation of TFII-I activity by phosphorylation. J Biol Chem 273:33443–33448[Abstract/Free Full Text]
  57. Kato H, Horikoshi M, Roeder RG 1991 Repression of HIV-1 transcription by a cellular protein. Science 251:1476–1479[Abstract/Free Full Text]
  58. Roy AL 2001 Biochemistry and biology of the inducible multifunctional transcription factor TFII-I. Gene 274:1–13[CrossRef][Medline]
  59. Tussie-Luna MI, Michel B, Hakre S, Roy AL 2002 The SUMO ubiquitin-protein isopeptide ligase family member Miz1/PIASxß/Siz2 is a transcriptional cofactor for TFII-I. J Biol Chem 277:43185–43193[Abstract/Free Full Text]
  60. Tussie-Luna MI, Bayarsaihan D, Seto E, Ruddle FH, Roy AL 2002 Physical and functional interactions of histone deacetylase 3 with TFII-I family proteins and PIASxß. Proc Natl Acad Sci USA 99:12807–12812[Abstract/Free Full Text]
  61. Kishi H, Minegishi T, Tano M, Abe Y, Ibuki Y, Miyamoto K 1997 Down-regulation of LH/hCG receptor in rat cultured granulosa cells. FEBS Lett 402:198–202[CrossRef][Medline]
  62. Lakkakorpi JT, Pietila EM, Aatsinki JT, Rajaniemi HJ 1993 Human chorionic gonadotrophin (CG)-induced down-regulation of the rat luteal LH/CG receptor results in part from the down-regulation of its synthesis, involving increased alternative processing of the primary transcript. J Mol Endocrinol 10:153–162[Abstract/Free Full Text]
  63. Nakamura K, Minegishi T, Takakura Y, Miyamoto K, Hasegawa Y, Ibuki Y, Igarashi M 1990 Regulation of LH/hCG receptor by gonadotropins in rat ovary. Biochem Biophys Res Commun 172:786–792[CrossRef][Medline]
  64. Chuzel F, Schteingart H, Vigier M, Avallet O, Saez JM 1995 Transcription and post-transcriptional regulation of luteotropin/chorionic gonadotropin receptor by the agonist in Leydig cells. Eur J Biochem 229:316–325[Medline]
  65. Tsuchiya M, Minegishi T, Kishi H, Tano M, Kameda T, Hirakawa T, Ibuki Y, Mizutani T, Miyamoto K 1999 Control of the expression of luteinizing hormone receptor by local factors in rat granulosa cells. Arch Biochem Biophys 367:185–192[CrossRef][Medline]
  66. Chen S, Shi H, Liu X, Segaloff DL 1999 Multiple elements and protein factors coordinate the basal and cyclic adenosine 3',5'-monophosphate-induced transcription of the lutropin receptor gene in rat granulosa cells. Endocrinology 140:2100–2109[Abstract/Free Full Text]
  67. Novina CD, Kumar S, Bajpai U, Cheriyath V, Zhang K, Pillai S, Wortis HH, Roy AL 1999 Regulation of nuclear localization and transcriptional activity of TFII-I by Bruton’s tyrosine kinase. Mol Cell Biol 19:5014–5024[Abstract/Free Full Text]
  68. Kim DW, Cochran BH 2000 Extracellular signal-regulated kinase binds to TFII-I and regulates its activation of the c-fos promoter. Mol Cell Biol 20:1140–1148[Abstract/Free Full Text]
  69. Kim DW, Cochran BH 2001 JAK2 activates TFII-I and regulates its interaction with extracellular signal-regulated kinase. Mol Cell Biol 21:3387–3397[Abstract/Free Full Text]
  70. Chuzel F, Clark AM, Avallet O, Saez JM 1996 Transcriptional regulation of the lutropin/human choriogonadotropin receptor and three enzymes of steroidogenesis by growth factors in cultured pig Leydig cells. Eur J Biochem 239:8–16[Medline]
  71. Zhang Y, Dufau ML 2001 EAR2 and EAR3/COUP-TFI regulate transcription of the rat LH receptor. Mol Endocrinol 15:1891–1905[Abstract/Free Full Text]
  72. Han D, Denison MS, Tachibana H, Yamada K 2002 Effects of estrogenic compounds on immunoglobulin production by mouse splenocytes. Biol Pharm Bull 25:1263–1267[CrossRef][Medline]
  73. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
H Cardenas, E Jimenez, and W F Pope
Dihydrotestosterone influenced numbers of healthy follicles and follicular amounts of LH receptor mRNA during the follicular phase of the estrous cycle in gilts
Reproduction, March 1, 2008; 135(3): 343 - 350.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Youn, H.
Right arrow Articles by Ji, T. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Youn, H.
Right arrow Articles by Ji, T. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals