Molecular Endocrinology, doi:10.1210/me.2004-0425
Molecular Endocrinology 19 (5): 1329-1342
Copyright © 2005 by The Endocrine Society
Bone Morphogenic Protein (Smad)-Mediated Repression of Proopiomelanocortin Transcription by Interference with Pitx/Tpit Activity
Maria Nudi,
Jean-François Ouimette and
Jacques Drouin
Laboratoire de Génétique Moléculaire, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada H2W 1R7
Address all correspondence and requests for reprints to: Dr. Jacques Drouin, Laboratoire de Génétique Moléculaire, Institut de Recherches Cliniques de Montréal, 110 avenue des Pins Ouest, Montréal, Québec, Canada H2W 1R7. E-mail: jacques.drouin{at}ircm.qc.ca.
 |
ABSTRACT
|
|---|
The signaling molecules bone morphogenic protein (BMP) 4 and 2 have been implicated in early organogenesis and cell differentiation of the pituitary. However, the use of different experimental paradigms has led to conflicting interpretations with regard to the action of these factors on differentiation of corticotroph cells and on expression of the proopiomelanocortin (POMC) gene. We have now directly assessed the action of BMP signaling on POMC expression and found that BMP4 represses POMC mRNA levels and promoter activity. This repression appears to be dependent on the classical BMP signaling pathway that involves the activin-like kinase 3/6 receptors and the Smad1/4 transcription factors. The repression is reversed by overexpression of the inhibitory Smads, Smad6 or Smad7. Collectively, the evidence suggests that autocrine BMP signaling may be acting upon AtT-20 cells to set the level of POMC expression. Upon BMP4 stimulation, activated phospho-Smad1 is recruited to the POMC promoter, where it apparently acts through interactions with the Pitx and Tpit transcription factors. It is postulated that these interactions interfere with the transcriptional activity of Pitx and/or Tpit, thus resulting in transcriptional repression.
 |
INTRODUCTION
|
|---|
BONE MORPHOGENIC PROTEIN (BMP) factors belong to the TGFß superfamily of multifunctional secretory peptides that regulate such diverse cellular responses as cell migration, adhesion, proliferation, differentiation, and death. Recently, transgenic and gene-deleted mice experiments have implicated BMP4 in the initial inductive phase of pituitary morphogenesis. The pituitary develops from a layer of competent oral ectoderm, Rathkes pouch (RP), that remains in contact with inducing neuroectoderm or ventral diencephalon throughout development. BMP4 is detected in the ventral diencephalon directly overlying the pituitary primordium; abrogation of this activity in BMP4 null (1) or Pitx1-Noggin transgenic mice (2) compromised initiation of RP formation. Neuroectodermal BMP4 signals are gradually lost as cellular proliferation and differentiation events are initiated in the glandular pituitary derived from RP. In parallel, BMP2 signals appear ventrally in the oral ectoderm as well as in surrounding mesenchyme, and together with dorsal fibroblast growth factor-8 signals, they have been proposed to establish pituitary cell fate-defining patterns of gene expression (2, 3).
Six distinct hormone-producing cell types arise in the developing pituitary: corticotrophs, gonadotrophs, lactotrophs, somatotrophs and thyrotrophs within the anterior lobe, and melanotrophs within the intermediate lobe (4). The emergence of these distinct cell fates from a common primordium is coordinated by sets of transcription factors expressed in a precise spatiotemporal manner during pituitary organogenesis. The expression and activities of these transcription factors are thought to be specified early by extracellular signaling molecules such as BMP factors. In the case of gonadotroph differentiation, BMP2 has been shown to directly induce the expression of the GATA-2 zinc finger transcriptional activator of gonadotroph-specific LH and FSH gene expression (5). The role that BMP signaling might be playing in the establishment of corticotroph cell identity is presently unclear. Corticotroph cells distinguish themselves from other anterior pituitary cells by their expression of proopiomelanocortin (POMC) and ACTH starting at d 12.5 of development [embryonic day (e) 12.5], ACTH arising from the proteolytic maturation of POMC (6). ACTH expression in RP explants cultured in the presence of BMP2-expressing COS cells was significantly down-regulated (3); however, unaffected ACTH protein levels in the pituitaries of
-glycoprotein hormone subunit-BMP4 transgenic mice (2) have argued against a negative role for BMP signals in the differentiation of corticotrophs.
As an initial approach toward elucidation of the role of BMP signaling in corticotroph differentiation, we studied regulation of POMC expression by BMP signaling pathways in the corticotroph AtT-20 cell line model. Previous analyses of the POMC (480/+63 bp) gene promoter known to confer corticotroph-specific activity (7, 8) had implicated distal and central regulatory elements in the maintenance of promoter activity (9). In particular, cell specificity of POMC promoter activity has been attributed to an interaction between basic helix-loop-helix (bHLH) transcription factors bound to the distal domain, and Pitx homeodomain and Tpit T-box transcription factors bound to the central domain (10, 11, 12). bHLH heterodimers containing NeuroD1/BETA2 bind to the distal Eboxneuro. NeuroD1 is expressed in the developing pituitary primarily in corticotrophs at the time (e12e15) when POMC begins to be expressed. Its role in the onset of corticotroph differentiation has been recognized in NeuroD1-null mice wherein the emergence of ACTH-positive cells is delayed (13). The dimerization partners of NeuroD1, either the Pan1 (E12), Pan2 (E47), or ITF2 ubiquitous bHLH factors, have been shown to participate in synergistic protein:protein interactions with Pitx factors (11). The pan-pituitary Pitx1 and Pitx2 factors have indeed been assigned a central role in the combinatorial program that coordinates POMC expression, collaborating not only with bHLH factors but also with Tpit (11, 12). Obligate partners of one another, both Tpit and Pitx1 are required for significant transcriptional activation of POMC promoter activity. Unlike Pitx factors, which are important for early pituitary organogenesis (14), Tpit stands out in its contribution to corticotroph cell fate decisions because it is expressed solely in the pituitary POMC-expressing lineages (12) and because it is essential for terminal differentiation of corticotrophs and melanotrophs (15, 16). Tpit is also a negative regulator of the gonadotroph cell fate.
Cellular responses to TGFß/BMP/activin signals are mediated for the most part by the Smad family of transcription factors. Specific ligand-induced TGFß/BMP serine/threonine receptor complexes, the activin-like kinase (Alk) receptors, recruit and phosphorylate receptor-regulated Smads (R-Smads): Smad-1/5/8 in response to BMP and Smad2/3 in response to TGFß/activin stimulation (17, 18, 19). Activated R-Smads subsequently associate with the common-mediator Smad4 (Co-Smad4) and translocate to the nucleus where they enable target gene selection and either positive or negative gene regulation through close interactions with cell type-specific transcriptional partners. The list of Smad DNA-binding partners lengthens with every new target gene characterized; some of the first characterized include the Xenopus FAST-1 (Fox H1) protein for the activation of nodal-responsive Xenopus Mix.2 (20), the mouse FAST-2 protein mediating activin-induced activation of the goosecoid gene (21) and the Olf-1/EBF-associated zinc finger (OAZ) protein in BMP-mediated positive control of Xenopus Xvent-2 activity (22). Whereas OAZ is required to direct the BMP-activated Smad complex to the Xenopus Vent-2 promoter (22), Smad1 and Smad4 together are able to confer BMP2 responsiveness to the human Id gene promoter independently of other transcription factors (23). TGFß induction of transcription has been reported to occur either through recruitment by Smads and/or associated proteins of coactivators like p300, or through a derepression mechanism that involves Smad-directed removal of negative regulators from their binding sites (24). TGFß-induced repression of transcription is less understood. Smad3 was shown to inhibit myogenic processes by directly interfering with the transcriptional activity of MyoD (25). Histone deacetylase-recruiting repressors such as tumor growth inhibitory factor (26), c-ski (27, 28, 29) and SnoN (30, 31, 32) have been implicated in the attenuation of Smad activity. So far, most identified BMP-responsive genes are activated by Smads. However, Smad6 and Smad7 are negative regulators of Smad signaling that interfere with phosphorylation and/or nuclear translocation of R-Smads (33).
We show in the present report that BMP4 signaling negatively regulates endogenous POMC expression as well as POMC promoter activity in AtT-20 cells. The negative regulation of POMC promoter activity by BMP4 is mediated by classical Smad signaling because BMP effects are mimicked and/or increased by the overexpression of specific Alk-3/6 receptors and Smad1 mediator signaling components (34) and counteracted by the overexpression of the specific BMP-inhibitor Smad6, and the general TGFß inhibitor Smad7. Our studies moreover identify the Pitx1 and Tpit transcription factors as targets of negative BMP/Smad activity. Direct in vitro bindings of Smad1 with Tpit and/or Pitx1 suggest that protein interactions would be the basis of Smad-directed interferences with Pitx- and Tpit-induced transcription of POMC.
 |
RESULTS
|
|---|
BMP4 Inhibits POMC Expression in AtT-20 Cells
To investigate the role of BMP signaling in regulation of POMC expression, we assessed the effect of BMP4 on POMC mRNA levels in POMC-expressing AtT-20 cells. BMP4 and the related BMP2 are expressed around the developing pituitary; the exact expression patterns, timing and effects of BMP signals on the developing pituitary remain however controversial (2, 3). AtT-20 cells were incubated in presence of recombinant (r)BMP4 for 24 and 48 h and POMC expression was assessed by Northern blot hybridization. As shown in Fig. 1A
, rBMP4 reduced POMC mRNA levels by about 60% after 48 h. These results are consistent with previous observations that described down-regulation of ACTH expression in e9.5 RP explants cultured in the presence of BMP2-coated beads (3). We have also observed down-regulation of AtT-20 cells POMC mRNA in presence of BMP2 (data not shown) in agreement with the idea that BMP2 and BMP4 have very similar biological activity (25, 33, 34). We cannot exclude that together or in association with other BMPs, such as BMP7, these BMPs may have enhanced activity as shown previously for BMP2/7 and BMP4/7 heterodimers (35, 36).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1. BMP4 Represses POMC Expression and Promoter Activity
A, Northern blot analysis of POMC mRNA in AtT-20 cells treated with 1 nM BMP4 for 24 and 48 h, compared with nontreated cells. Bands corresponding to POMC mRNA were quantified by densitometry and compared with ß-actin mRNA used as internal control. B and C, Effect of rBMP4 on AtT-20 cells transfected with a luc reporter gene driven by the POMC promoter (480/+63). B, rBMP4 (1 nM) represses POMC-luc activity in a time-dependent manner. C, Dose response of POMC promoter repression by rBMP4 measured after 24 h treatment. Results in panels B and C were standardized relative to CMV-ß gal reporter activity used as internal control. Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test.
|
|
To determine whether BMP signaling negatively regulates POMC expression at the transcriptional level, a POMC (480/+63) promoter-luciferase (luc) reporter construct was transiently transfected into AtT-20 cells and the response to rBMP4 was assessed. rBMP4 treatments inhibited POMC promoter activity in a time-dependent (Fig. 1B
) and in a concentration-dependent manner (Fig. 1C
). Repression of POMC-luc activity was significant (
50%) after 12 h with 1 nM rBMP4, and an almost maximal after 24 h treatment. When tested at 24 h of treatment, repression was maximal (
80%) with 1 nM BMP4.
BMP4 Repression Is Mediated through BMP-Specific Receptors and Smad1/4 Transcription Factors
BMP signals are mediated from the cell membrane to the nucleus through BMP-specific receptors that activate R-Smads (Smad1,5,8). BMP receptor type-I ligand activation can be mimicked by mutations within the GS domain of Alk-3 and Alk-6 (37), so that Alk-3(Q223D) and Alk-6(Q203D) are constitutively activated mutants that signal in the absence of ligand. To test whether BMP repression of POMC activity in AtT-20 cells can be mediated by the activation of BMP-specific receptors, expression vectors encoding Alk-3(Q223D) and Alk-6(Q203D) were used in transfection assays. Overexpressed Alk-3 and Alk-6 decreased POMC-luc activity to levels similar to those produced by rBMP4 (Fig. 2A
). In subsequent assays, 250 ng of Alk-3(Q223D) was used as an alternative for 1 nM rBMP4 treatments.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2. BMP4 Repression Is Mediated through BMP-Specific Receptors and Smad1/4 Transcription Factors
A, Overexpression of increasing amounts of constitutively active Alk-3 (Q223D) and Alk-6 (Q203D) receptors down-regulates POMC-luc reporter activity in AtT-20 cells to similar or greater levels than those observed in cells stimulated with rBMP4. pcDNA 1 was used as control vector. B, Flag-Smad1 (S1) overexpressed alone, or together with Smad4-HA (S4), represses POMC-luc activity when transfected in AtT-20 and P19 cells, and furthermore enhances BMP inhibitory effects in AtT-20 cells. Results are the average (±SEM) from at least three sets of experiments performed in duplicate. In each cell line, the basal activity of POMC-luc was similar (about 50,000 relative light units/mg protein). Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test. C, After 4, 24, and 48 h of 1 nM BMP4 treatment of AtT-20 cells, nuclear extracts (25 µg) were assayed for content of phosphorylated Smad1 protein using an antibody against Smad1 phosphorylated on Serine 463 and 465 of the C-term SSXS motif. The 65-kb band corresponds to phosphorylated Smad1 (arrow), whereas the slower migrating band may be another BMP-specific Smad, such as Smad5 or Smad8. The same blots were assayed by Western blotting for levels of Tpit and Pitx1.
|
|
If Smad1 participates in BMP-mediated repression of POMC, its overexpression would be expected to increase the sensitivity of AtT-20 cells to BMPs and hence enhance BMP4 inhibitory effects on POMC. When Flag-Smad1 and/or Smad4-HA were transiently overexpressed in AtT-20 cells, BMP4-mediated repression of POMC-luc activity was significantly enhanced (Fig. 2B
). The 4-fold inhibition of POMC promoter activity encountered upon overexpression of Smad1/4 in the absence of BMP treatment suggests that BMP signals might already be present in cultured AtT-20 cells to activate Smad proteins. In unstimulated P19 cells, overexpression of Smad1 and Smad4 only slightly repressed POMC promoter activity, and this activity was not additive to the slight inhibitory effect of BMP4 (Fig. 2B
). Because P19 cells are BMP4 responsive, these data suggest that repression of POMC promoter activity may largely depend on the cellular context of AtT-20 cells.
Smad1 is the best-characterized intracellular transducer of BMP signals. Activation of cytoplasmic Smad1 by BMP receptors is characterized by phosphorylation of the carboxy-terminal serines 462, 463, and 465, and subsequent translocation into the nucleus. To determine whether endogenous Smad1 is indeed activated in AtT-20 cells after rBMP4 treatments, nuclear protein extracts of rBMP4-stimulated and nonstimulated cells were immunoblotted for the presence of phosphorylated Smad1 using an antibody specific for phosphorylated serines 463/465 Smad1. As shown in Fig. 2C
, small amounts of phosphorylated Smad1 are present in unstimulated AtT-20 cells, consistent with constitutive BMP signaling in these cells. Upon rBMP4 stimulation, nuclear phosphorylated Smad1 was increased, peaking 24 h after rBMP4 addition. When cultured AtT-20 cells were assayed for BMP ligands and/or receptors expression using RT-PCR, they were found to have transcripts for BMP7, as well as for Alk-2 and Alk-6 BMP-specific type-I receptors (data not shown). Alk-2 and Alk-6 type I receptors have been reported to function in the activation of BMP-specific R-Smads after ligand stimulation (38). Thus, it appears that AtT-20 cells express BMP receptors and at least one ligand, BMP7, and these may account for constitutive BMP signaling in agreement with the low levels of phospho-Smad1 in unstimulated conditions.
BMP/Smad1 Signaling Specifically Represses POMC Promoter Activity
BMP/Smad1 signaling is known to activate transcription from the mouse Tlx-2 promoter in P19 cells (39). We first asked whether the same BMP-signaling pathway may repress POMC and activate Tlx2 promoter activity. In AtT-20 cells, we show that, whereas Alk-3 and Smad1/4 overexpression represses POMC-luc activity by at least 2-fold, it does not repress Tlx2-lux activity but induces it very weakly (Fig. 3A
). POMC-luc and Tlx2-lux promoter activities responded in the same direction in P19 cells, but Tlx2-lux was much more responsive (Fig. 3B
). These data indicate that the inhibitory effects of the BMP pathway on the POMC promoter are promoter specific and do not reflect a general cellular response.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3. BMP/Smad1 Signaling Specifically Represses POMC
In both AtT-20 and P19 cells, overexpression of Alk-3 and Smad1 (A and B) as well as rBMP4 treatments (C and D) repress POMC-luc but not Tlx2-luc or 3TP-lux reporter activities. Noteworthy is the greater sensitivity of POMC promoter activity to BMP/Smad-mediated repression in AtT-20 cells compared with P19 cells. POMC-luc activity is also repressed by rActivin-A, but not rTGFß treatments (C and D). Tlx2-lux activity is induced by Smad1/4, Alk-3, and BMP4 in P19 cells (B and D), but only by Smad1/4 and Alk-3 overexpression in AtT-20 cells (A). The TGFß-specific 3TP-lux reporter is activated in both P19 and AtT-20 cells by rActivin and rTGFß but not by rBMP4. E, Increasing concentrations of Flag-Smad1, but not Flag-Smad2 or Flag-Smad3 repress the activity of POMC-luc transfected in AtT-20 cells. Results are the average (±SEM) from at least three sets of experiments in duplicate. Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test.
|
|
Different members of the TGFß superfamily of growth factors were tested for the specificity of their effects on POMC promoter activity in both AtT-20 and P19 cells. The Tlx2-lux and 3TP-lux reporters were used, as controls of BMP- and TGFß-dependent signals, respectively (39, 40). The stimulation of 3TP-lux activity by rActivin or rTGFß, showed that AtT-20 cells are responsive to different members of the TGFß family of growth factors (Fig. 3C
). POMC promoter activity was repressed in AtT-20 and P19 cells treated with rBMP4 (1 nM) or rActivin-A (500 pM) but was not affected in either cell type challenged with TGFß (100 pM) (Fig. 3
, C and D). The activin-mediated repression of POMC promoter activity observed in AtT-20 cells is in support of previous work showing reduced accumulation of secreted ACTH upon activin-A treatment (41). Also highlighting their difference in signaling, rActivin, but not rBMP4 treatment, repressed Tlx2 promoter activity in AtT-20 cells (Fig. 3C
).
Although the intracellular activity of Smad1 is specific to BMP responses, Smad2 and Smad3 activities have been assigned to activin and TGFß signaling pathways (42). To assess the specific TGF-ß signaling pathway involved in repression of POMC promoter in AtT-20 cells, increasing concentrations of Flag-Smad1, Flag-Smad2, or Flag-Smad3 were overexpressed in these cells and the activity of POMC-luc assayed. Only Smad1 repressed the POMC promoter (Fig. 3E
), suggesting that an endogenous autocrine BMP signaling pathway is acting to repress POMC in AtT-20 cells.
Smad6 and Smad7 Counteract BMP-Mediated Repression of POMC
Smad6 and Smad7 are known inhibitors of BMP/TGFß-induced cellular responses. The down-regulation of POMC promoter activity after BMP4 treatment or Smad1/4 overexpression was completely blocked by overexpression of the BMP-specific inhibitor Smad6 (Fig. 4A
) and the general TGFß inhibitor Smad7 (Fig. 4B
). Notably, basal POMC promoter activity was augmented by overexpression of Smad6 and Smad7, indicating once more that autocrine BMP signaling may be repressing constitutive POMC expression in these cells.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4. Inhibitory Smad6 and Smad7 Reverse BMP/Smad-Dependent POMC Repression
Increasing concentrations of the BMP-specific inhibitor Smad6 (A) and the general TGFß inhibitor Smad7 (B) counteract the repressive effects of Smad1/4 overexpression and rBMP4 treatment on POMC-luc activity in AtT-20 cells. Results are the average (±SEM) from at least three sets of experiments in duplicate. Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test.
|
|
Negative BMP/Smad Signals Target Pitx/Tpit Activities on the POMC Promoter
The POMC promoter has been divided into three regions; namely, distal (480/(324 bp), central (323/(166 bp), and proximal (165/34 bp) regions (9). In an attempt to identify POMC promoter sequences that are responsive to BMP/Smad signaling, we tested the BMP4 response of constructs containing these promoter regions, alone or in combination. Previous studies had shown that central and distal domains act in synergy and that this synergism is cell specific (9, 43). Only the reporter construct containing both distal and central POMC promoter regions responded to rBMP4 stimulations to the same extent as did the full-length promoter (Fig. 5A
). These results suggest that BMP signaling negatively targets synergistic activities acting on the distal and central domains of the POMC promoter.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5. BMP Signals Target Pitx1 and Tpit Regulatory Elements on POMC
A, Activities of distal, central, and proximal regions of the 480/34 POMC promoter, alone or in combination, inserted upstream of the minimal (34/+63) POMC promoter were tested in BMP4-treated AtT-20 cells and are shown relative to their respective basal activities in nontreated cells. Only the combined activity of distal and central promoter regions (D + C), in a similar fashion to the (480/+63) full-length promoter (D + C + P), is repressed by BMP signaling. B, Relative activities (in BMP4-treated vs. nontreated AtT-20 cells) of point and replacement mutants of either NurRE, Eboxneuro, Tpit, Pitx1, or Eboxubi regulatory elements within the distal and central domains of the (480/+63) rPOMC promoter. The loss of Tpit or Pitx regulatory elements abolishes BMP4 inhibitory effects. All promoter mutants maintain at least 10 times more promoter activity than the minimal promoter (Min) construct. Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test.
|
|
The distal and central domains of the POMC promoter contain most of the critical regulatory elements for cell-specific recognition, for synergism between the two domains, as well as for hormone response (10, 12, 44). We used element-specific mutants to determine which is/are required for BMP inhibitory signaling. Mutagenesis of either Nur factor response element (NurRE) that confers CRH and glucocorticoid responsiveness (44) or of the Eboxneuro that confers cell-specific recognition by neurogenic bHLH factors and synergism with the central promoter domain (11) did not affect BMP4 responsiveness (Fig. 5B
). However, BMP4 sensitivity was lost upon mutagenesis of either Pitx1 or Tpit binding sites.
Tpit is a T-box transcription factor (12) that binds DNA cooperatively and that synergizes transcriptionally with Pitx1; their binding sites are only 5 bp away from each other. The restricted action of BMP4 on Tpit/Pitx1 indicates that it is primarily their activity rather than their synergism with NeuroD1 dimers acting as Eboxneuro that is targeted by Smad action. To verify this, a reporter construct driven by three oligomers containing the Pitx/Tpit response element (12) was transfected in CV-1 cells and found to be repressed by Alk-3 (Q223D) (Fig. 6
). Repression was most evident in the presence of both Pitx1 and Tpit, but a similar tendency was also observed on Tpit-dependent activity. Because BMP4-expressing epithelia have been documented to repress Pitx1 expression in mandibular mesenchyme (45), we analyzed whether activation of the BMP4 signaling pathway in AtT-20 cells affected the expression of Pitx1 and/or Tpit. Nuclear protein extracts from AtT-20 cells treated or not with rBMP4 were assayed by Western blot for Pitx1 and Tpit protein levels. No change in Pitx1 or Tpit protein expression was detected (Fig. 2C
), in agreement with the interpretation that BMP signaling interferes with Pitx/Tpit activity (Fig. 6
).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6. The Tpit/Pitx Regulatory Element Is Sufficient for BMP Repression without Changes in Tpit or Pitx Levels
Overexpression of constitutively active Alk-3 (Q223D) receptor in POMC nonexpressing CV-1 cells abolishes reconstituted Tpit activity, as well as transcriptional synergy between Pitx1 and Tpit on a luc reporter driven by a trimerized 40-bp POMC oligonucleotide that contains both Pitx and Tpit binding sites. Results are the average (±SEM) from at least three sets of experiments in duplicate. Asterisk, Statistical difference (P 0.05) compared with control sample using the Students t test.
|
|
Smad1, Pitx1, and Tpit Proteins Interact in Vitro
One manner in which BMP-activated Smad1 (Fig. 2C
) could interfere with the transcriptional activities of Pitx and Tpit would be through protein:protein interactions. Indeed, the mutagenesis results that showed dependence on the Pitx and Tpit binding sites (Fig. 5B
) and that also showed great sensitivity of the synergistic activity between distal and central promoter elements (Fig. 5A
) could be explained by recruitment of activated Smad proteins to promoter-bound Pitx1 and/or Tpit. Such interactions may lead to promoter dissociation of the factors or alternatively, may prevent the actions of Pitx1/Tpit (including both trans-activation and synergism with bHLH dimers) through protein interference. As a first step toward testing this hypothesis, we used a glutathione-S-transferase (GST) pull-down assay to show interactions of in vitro-translated Pitx1 and Tpit with Smad1 but not with GST or GST-luc (Fig. 7A
). To test whether BMP signaling does result in Smad1 recruitment to the POMC promoter and whether this recruitment may affect promoter occupancy by Pitx and/or Tpit, we used the chromatin immunoprecipitation (ChIP) technique to assess POMC promoter occupation before and after treatment with BMP4 (Fig. 7B
). These experiments indicated that POMC promoter occupancy by both Pitx1 and Tpit is unchanged after BMP4 treatment. On the other hand, BMP4 treatment leads to promoter recruitment of phospho-Smad1 in agreement with activation of this regulatory Smad after BMP4 treatment (Fig. 2C
). Taken together, these data are consistent with a model in which activated phospho-Smad1 is recruited to the POMC promoter through protein-protein interactions with Pitx1 and/or Tpit and in which the resulting complex hampers the transcriptional activity of Pitx1 and Tpit.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7. Smad1 Interacts with Pitx1 and Tpit and Is Recruited to the POMC Promoter
A, In pull-down assays, GST resin-bound Smad1 (GST-S1) but not resin-bound control (GST) pulled down 35S-labeled Pitx1 and Tpit proteins synthesized separately or cosynthesized in vitro. In vitro-translated 35S-labeled luc did not bind to either GST or GST-S1. B, ChIP analysis of POMC promoter recruitment of Pitx1, Tpit, and phospho-Smad1 with and without BMP4 treatment. Promoter recruitment for each protein is expressed relative to an IgG control. ß-Actin was used as an internal standard to normalize POMC promoter recruitment.
|
|
 |
DISCUSSION
|
|---|
Transcription factors Pitx1 and Tpit are critical for terminal differentiation and identity of corticotroph cells. These factors participate in synergistic interactions that are the basis of cell-specific POMC transcription. We have shown that BMP4 and Smad1-specific signaling pathways repress POMC expression in AtT-20 cells, and we propose that interactions of Smad1 with Pitx and Tpit constitute the basis of this repression.
Mechanisms of BMP Repression of POMC Transcription
Few examples of TGFß/BMP/Smad repression of transcription have been reported (46, 47). We show that BMP4 signaling represses endogenous POMC expression in AtT-20 cells (Fig. 1A
) as well as POMC promoter activity (Fig. 1
, B and C). We further show that the classical cognate receptor/Smad signaling pathway conveys BMP signals to the nucleus in AtT-20 cells. Indeed, BMP4 inhibitory effects on POMC promoter activity were mimicked by expression of the BMP-specific intracellular mediator Smad1 (Fig. 2B
) but not by Smad 2 or 3 (Fig. 3E
) and constitutively activated forms of either Alk-3 or Alk-6 receptors (Fig. 2A
). Recently, other signaling pathways such as the cascades that implicate ERK, protein kinase C, cAMP-dependent protein kinase A, and TGF-activated kinase-1 activities have been implicated in BMP responses (48, 49, 50, 51). In light of this, the possibility that Smad-independent pathways are involved in BMP-induced effects on POMC expression is not excluded. However, Smad6 and Smad7 overexpression studies (Fig. 4
) suggest that BMP-induced inhibitory POMC responses are principally mediated by the Smad signaling pathway.
Smad translocation into the nucleus is known to require ligand stimulation, suggesting that the mere presence of supplementary Smad mediator proteins would not suffice to affect gene responses in cells. However, some groups have demonstrated that transiently overexpressed Smad proteins are able to transactivate target genes in a ligand-independent manner (52, 53). We found that overexpression of Smad1 alone or in combination with Smad4 could repress POMC expression up to 4-fold in AtT-20 cells (Fig. 2B
) even in the absence of exogenous BMP stimulation. Overexpressed Smad1 could be acting in a ligand-independent manner if supplementary amounts of Smad1 were to overcome some mechanism of negative signaling present in AtT-20 cells, such as that produced by inhibitory Smad6 or Smad7 or simply by microtubule sequestration of Smads (33). Still, evidence that BMP7 signaling may operate in an autocrine way in AtT-20 cells is in favor of a ligand-dependent activity of overexpressed Smad1 in these cells. Our findings that overexpression of Smad6 or Smad7 could reverse POMC repression by BMP signals, whether they are endogenous or exogenous, furthermore suggests that these or other BMP antagonists might be working against BMP/Smad-mediated repression of POMC in some circumstances during development.
Specificity of BMP Repression of POMC
It appears that different members of the TGFß superfamily of signaling molecules repress POMC expression. We observed that rActivin-A, but not rTGFß, repressed POMC to a similar extent as did rBMP4 (Fig. 4C
). Others had implicated Activin-A in inhibition of POMC mRNA accumulation and ACTH secretion from AtT-20 cells (41) and shown negative regulation of POMC mRNA by TGFß in hypothalamic neurons (54). Our failure to observe TGFß down-regulation of POMC expression in AtT-20 cells may be due to the use of the POMC (480/+63) promoter region in our work: this promoter fragment does not contain regulatory sequences for hypothalamic expression of POMC (55). Although we did detect in AtT-20 cells transcripts coding for the Alk-2 type I TGFß receptor, which is known to mediate common responses to activin and BMP7 (38), we could not detect activation of Smad1 in rActivin-treated AtT-20 cells. We were moreover unable to detect any effects on POMC promoter activity after the overexpression of activin-specific Smad2 and Smad3 at concentrations for which Smad1-inhibited POMC expression (Fig. 3E
). These data may suggest a Smad-independent effect of activin on POMC expression in AtT-20 cells, although they may also reflect an absence of autocrine activin signaling in AtT-20 cells. In muscle cells for example, TGFß-mediated repression of IGF binding protein-5 has been described to occur through c-Jun N-terminal kinase signaling pathways (56).
Smad1 and Alk-3/-6 signaling components were shown to repress POMC transcription and to induce transcription from the Tlx2 promoter in the same cells (Fig. 3
, A and B), as described previously in P19 cells (39). Smad interactions with POMC and Tlx2 promoter-specific transcription factors are likely responsible for these opposite BMP responses. Indeed, Smad binding to DNA is not selective (57), and gene recognition by the Smad complex is thought to occur by way of interactions with specific transcription cofactors. Smad1-mediated induction of Xvent-2 expression for example requires cooperation with the OAZ transcription factor (22). Differential Smad interactions with POMC and Tlx2 promoter-specific transcription factors are the likely explanation for the difference in BMP responses: a Smad DNA-binding partner responsible for activation of Tlx2 has not yet been identified. Our studies support an essential role for interdependent Pitx and Tpit transcription factors in the mechanisms of Smad-mediated repression of POMC (Fig. 5
). Not only are Pitx and Tpit regulatory elements important for activation of POMC transcription (12), but we show that absence of either activity prevents repression by the BMP pathway (Fig. 6
). These observations together with demonstration of in vitro interactions of Smad1 with Pitx1 and Tpit suggest that Pitx and Tpit transcription factors are the principal targets of negative Smad action on the POMC promoter. Smad2 was previously shown to interact with paired-like homeodomain proteins of the Mix family, Mixer and Milk, through a Smad-interacting motif that is also found in members of the FAST family of winged-helix transcription factors (58). However, we could not locate a similar domain in bicoid-related Pitx homeodomain proteins. There are no precedents for interactions between members of the T-box and Smad families.
Promoter mutations (Fig. 5B
) and simple reporter experiments (Fig. 6
) clearly indicate that the primary target of BMP/Smad repression is the Pitx/Tpit pair of transcription factors. Because this repression could be reconstituted in heterologous cells (CV1) using a simple multimeric reporter gene (Fig. 6
), the simplest model that can be proposed to explain transcriptional repression by Smad1 would have to rely on protein interactions between Smad1 and Tpit and/or Pitx1 (Fig. 7A
). Direct protein interactions between these different transcription factors may repress transcription in different ways. For example, after BMP binding to Alk receptors, and the resulting phosphorylation and nuclear translocation of Smad1 (Fig. 2C
), Smad1 could form a complex with Pitx1 and Tpit that no longer has the ability to bind DNA, thus resulting in repression of POMC transcription. Such model does not appear to take place because POMC promoter occupancy of Pitx1 and Tpit is not altered after BMP4 stimulation and recruitment of Smad1 to the same promoter (Fig. 7B
). On the other hand, these ChIP data would be entirely consistent with a model in which promoter-bound Pitx1 and Tpit interact and recruit phospho-Smad1 (Fig. 8
). This recruitment may prevent the interaction of Pitx1 and Tpit with coactivators such as steroid receptor coactivator 2 (59) and may further hamper synergistic interactions with bHLH dimers (11) in agreement with the data of Fig. 5B
showing the sensitivity of the distal/central synergistic activity of the POMC promoter to BMP repression. Promoter-recruited Smad1 could also remodel the chromatin template into a closed conformation through the recruitment of histone deacetylases. Smad2 has been shown to act as a repressor of transcription by associating with tumor growth inhibitory factor in the repression of the Cdc25A promoter for example (60).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 8. Model for BMP-Induced Transcriptional Repression of POMC
A Smad1/4 complex translocates to the nucleus upon BMP stimulation, is recruited to the POMC promoter by interactions with Pitx and Tpit and subsequently disrupts transcriptional activity.
|
|
Possible Role of BMPs in Pituitary
Repression of gene activity plays an important role in the restriction of many regulatory genes during embryonic development. For example, repressor bHLH factors of the Hairy and enhancer of split homolog family play essential developmental roles by delaying the differentiation of neurons in the developing brain such that they undergo terminal differentiation only once they have completed migration to final destination (61). Also, TGFß was implicated in the inhibition of myogenic differentiation through Smad3-mediated repression of MyoD transcriptional activity (62). In a similar fashion, BMP/Smad repression of Pitx1 and/or Tpit, and of POMC transcription could serve to delay terminal differentiation of corticotrophs until the appropriate time during pituitary organogenesis. In this respect, it is interesting to note that BMP signals are particularly strong around developing pituitary before the onset of cell differentiation around e12.5. Many molecules implicated in BMP signaling could modulate the simple pathway illustrated in Fig. 8
. Indeed, regulation of the repressor Smads, Smad6 and Smad7, could play significant roles in the ultimate activity of this pathway. In addition, secreted molecules such as Noggin and Chordin can interfere and modulate the action of BMPs on their receptors (63). Manipulation of some of these constitutive constituents has already been shown to have dramatic effects on pituitary development and cell differentiation (2).
It is also possible that BMP signals may serve functions in the adult pituitary. Although the AtT-20 cells are of tumor origin and may not be entirely representative of normal corticotrophs, their apparent autocrine regulation by BMP signaling (Fig. 4
) may be an indication of similar regulation in fully differentiated corticotrophs. Alternatively, BMP signals may also serve a paracrine function to maintain balance between the various lineages in the adult pituitary.
 |
MATERIALS AND METHODS
|
|---|
Materials
Recombinant (r) human TGFß1, activin-A, and BMP4 were purchased from R&D Systems (Minneapolis, MN). Anti-Smad1/5/8 (N-18) and anti-phospho-Smad1 (Ser 463 and 465) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and Upstate Biotechnology (Lake Placid, NY), respectively. Anti-Pitx1 and anti-Tpit antibodies were prepared in rabbits as described in Refs.64 and 12 , respectively.
Plasmids and Oligonucleotides
The different POMC reporter plasmids were constructed in the vector pXP1 luc as described previously (65). Deleted versions of the 480/+63 bp POMC promoter construct were generated as described previously (9). Point mutations and replacement of NurRE, Eboxneuro, Pitx, Tpit, and Eboxubi POMC regulatory elements were described in (9). The luc reporter plasmid containing three copies of the 40-bp POMC promoter Pitx and Tpit regulatory element was described (66). For Pitx1 and Tpit expression vectors, Pitx1 and Tpit coding sequences were inserted in a Rous sarcoma virus-driven vector as described in Refs.12 and 67 , and further modified with the HindIII/KpnI insertion of a double-stranded oligonucleotide corresponding to the T3 promoter to allow the in vitro synthesis of Pitx1 and Tpit. Reporters 3TP-lux and Tlx2-lux and expression vectors for constitutively active BMP type I receptors and Smad mediators were a gift from J. Wrana and L. Attisano (Hospital for Sick Children, Toronto, Ontario, Canada) and have been described before: Tlx2-lux (39); 3TP-lux (68); pCMV5B/Alk3-HA (Q233D) and Alk6-HA (Q203D) (37, 39); pCMV5B/Flag-Smad1, Flag-Smad2, Flag-Smad3, Smad4-HA, and pGEX14T-1/Smad1 (39, 69, 70, 71).
Cell Culture and Transfection Assays
AtT-20 (9) and CV-1 (72) cells were cultured in DMEM with 10% fetal bovine serum and penicillin/streptavidin antibiotics, and maintained at 37 C and 5% CO2. CV-1 cells were transfected by the calcium phosphate coprecipitation method. Cells (40,000) were plated in 12-well-plates. A total of 6 µg of DNA (3 µg of reporter plasmid, 01.5 µg of effector plasmid, 50 ng of CMV-ß-galactosidase as internal control), was used for each transfection, performed in duplicate. Control experiments contained equivalent amounts of empty expression vector and carrier DNA psp64. Sixteen hours after transfection, medium was changed, and cells were harvested 24 h later. AtT-20 cells were transfected using Lipofectamine (Invitrogen, Carlsbad, CA) as described previously (11). Briefly, 250,000 cells/well were plated into 12-well plates; 1.5 µg total DNA was used for each transfection, performed in duplicate (0.5 µg reporter, 01 µg effector plasmid, 20 ng of CMV-ß-galactosidase as internal control and psp64) together with 5 µl of Lipofectamine in a final volume of 400 µl without serum. After a 20-min incubation at room temperature, the volume was made up to 1 ml with DMEM without serum and left for 4 h on the cells previously rinsed with DMEM without serum. DMEM (500 µl) with 20% FBS was then added to each well, and the cells were recovered 20 h later, using transfection lysis buffer [0.1 M Tris (pH 8.0), 0.5% Nonidet P-40 (NP-40), 1 mM dithiothreitol (DTT)]. Luc activity was assayed as described previously. ß-Gal activity was determined using the ß-gal reporter gene Galacto-Star (Applied Biosystems, Foster City, CA) assay system.
RNA Isolation and Northern Blot Analysis
Total cellular RNA was isolated by the guanidium thiocyanate-phenol-chloroform extraction method (73). Ten micrograms of RNA were analyzed by electrophoresis on a 1.2% agarose gel by the RNA-glyoxal method (74). Transfer was performed on a Hybond-N (Amersham) membrane. The RNA was cross-linked on the membrane, which was incubated overnight in a prehybridization solution [80 mM Tris (pH 7.8), 600 mM NaCl, 4 mM EDTA, 0.1% Na-pyrophosphate, 0.2% sodium dodecyl sulfate (SDS), and 100 µg/ml of heparin] at 65 C. A 923-bp mouse POMC cDNA fragment was 32P-labeled as described in Ref.72 and used to reveal endogenous mouse POMC mRNA in AtT-20 cells. Hybridization and washes were performed as described in Ref.72 . ß-Actin mRNA was revealed on the same Northern blot using a 32P-labeled ß-actin cDNA fragment that is described in Ref.75 .
RT-PCR
AtT-20 cell RNA (2 µg) was used for cDNA synthesis with AMV reverse transcriptase (Promega) according to manufacturers instructions. RNA extracted from e13.5 embryo forelimbs was similarly processed to obtain cDNA that was used as a positive control for Alk receptor and BMP ligand expression. Each PCR was performed for the detection of BMP2, BMP4, BMP7, or Alk-2 transcripts as described in (12), whereas an annealing temperature of 47 C was used for Alk-6. The primers used are the following: BMP2 sense, AGACGTCCTCAGCGAATTTG BMP2; antisense, GTTTGTGTTTGGCTTGACGC; BMP4 sense, CGCCGTCATTCCGGATTACAT; BMP4 antisense, GGCCCAATCTCCACTCCCTT; BMP7 sense, GACATGGTCATGAGCTTCGT; BMP7 antisense, GTCGAAGTAGAGGACAGAGA; Alk-2 sense, GAGTGATGATTCTTCCTGTGC; Alk-2 antisense, TTGGTGGTGATGAGCCCTTCG; Alk-6 sense, TGGAGCAGTGATGAGTGTCT; Alk-6 antisense, TCTGGGTTCCTCTGTGTCTG.
Nuclear Extracts and Western Blot Analysis
AtT-20 nuclear extracts were prepared by resuspending the cellular pellet in 400 µl cold buffer A [10 mM KCl, 10 mM Tris (pH 7.9), 0.1 mM EDTA, 0.1 mM EGTA, 10 mM phenylmethylsulfonyl fluoride, 1 mM DTT, and protease inhibitors] and the suspension of cells left to swell on ice for 15 min. NP-40 (0.01%) was added and the suspension was vortexed vigorously for 30 sec. The suspension was gently spun down, the supernatant discarded, and the nuclear pellet resuspended in 50 µl of cold Buffer C also containing protease inhibitors [20 mM Tris (pH 7.9), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 20 mM phenylmethylsulfonyl fluoride, and 1 mM DTT]. The nuclear suspension was shaken vigorously at 4 C for 1 h, then spun and the supernatant assayed for protein content using the Bradford assay.
Western blot analysis was performed as follows: 25 µg of AtT-20 nuclear extracts/sample was resolved on 10% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride membrane and immunoblotted with either 1:2000 dilution of anti-Pitx1 antibody, 1:1000 dilution of anti-Tpit, or 1:1000 dilution of anti-phopho-Smad1 antibody. Immunodetection was possible with the use of horseradish peroxidase-conjugated antirabbit antibody (1:20,000), followed by incubation with ECL Plus detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ).
GST Protein Purification and Pull-Down Assay
GST and GST-Smad1 proteins were purified from BL21 bacterial cell cultures after GST Gene Fusion System (Amersham Pharmacia Biotech) instructions. The yield of GST proteins was assayed by Bradford and SDS-PAGE analysis. 35S-Methionine-labeled Pitx1 and Tpit proteins were synthesized using the TNT-coupled transcription and translation system (Promega) to according to the manufacturers instructions, and assayed by SDS-polyacrylamide gel. Purified GST (500 ng) and GST-Smad1 fusion protein coupled to glutathione Sepharose 4B beads was incubated with 5 µl of radiolabeled Pitx1 and/or Tpit proteins in 500 µl final volume of a buffer solution made up of 50 mM NaCl, 50 mM Tris (pH 7.9), 1 mM EDTA and 0.1 mM of NP-40, at 4 C for 2 h. The Sepharose beads were then washed twice in 125 nM NaCl, 50 mM Tris (pH 7.9), 1 mM EDTA, and 0.1 mM of NP-40 buffer; and twice in 200 mM NaCl 50 mM Tris (pH 7.9), 1 mM EDTA and 0.1 mM of NP-40 buffer. Bound protein complexes were eluted before being loaded on a 10% SDS-polyacrylamide gel.
ChIP
AtT-20 cells treated with 1 nM Bmp-4 were prepared for ChIP as described (76). Sonicated chromatin corresponding to 107 cells was subjected to immunoprecipitation at 4 C with 5 µg of antibodies against Tpit, Pitx1, matched nonimmune IgG (Sigma) as negative control, or with 3 µg Phospho-Smad1 (Upstate Biotechnology). Immunoprecipitates were collected with protein A/G agarose beads saturated with tRNA. Beads were washed as described by Upstate Biotechnology. Quantitative real-time PCR (MX-4000; Stratagene, La Jolla, CA) was performed with the SYBR Green kit (QIAGEN, Valencia, CA). Quantitation of ß-actin promoter was used as internal control to normalize POMC promoter enrichment. Fold recruitment was calculated relative to IgG control sample.
 |
ACKNOWLEDGMENTS
|
|---|
We are deeply indebted to Jeffrey Wrana and Liliana Attisano for their gift of the plasmids encoding regulatory proteins of the BMP/Smad signaling pathways. We thank Eric Batsché for help in setting up the ChIP assays and Lise Laroche for her expert secretarial assistance.
 |
FOOTNOTES
|
|---|
This work was supported by grants from the National Cancer Institute of Canada with funds provided by the Canadian Cancer Society.
First Published Online February 3, 2005
Abbreviations: Alk, Activin-like kinase; bHLH, basic helix-loop-helix; BMP, bone morphogenic protein; ChIP, chromatin immunoprecipitation; DTT, dithiothretol; e, embryonic day; GST, glutathione-S-transferase; luc, luciferase; NP-40, Nonidet P-40; NurRE, Nur factor response element; POMC, proopiomelanocortin; rBMP4, recombinant BMP4; OAZ, Olf-1/EBF-associated zinc finger; RP, Rathkes pouch; SDS, sodium dodecyl sulfate.
Received for publication October 19, 2004.
Accepted for publication January 24, 2005.
 |
REFERENCES
|
|---|
- Takuma N, Sheng HZ, Furuta Y, Ward JM, Sharma K, Hogan BL, Pfaff SL, Westphal H, Kimura S, Mahon KA 1998 Formation of Rathkes pouch requires dual induction from the diencephalon. Development 125:48354840[Abstract]
- Treier M, Gleiberman AS, OConnell SM, Szeto DP, McMahon JA, McMahon AP, Rosenfeld MG 1998 Multistep signaling requirements for pituitary organogenesis in vivo. Genes Dev 12:16911704[Abstract/Free Full Text]
- Ericson J, Norlin S, Jessell TM, Edlund T 1998 Integrated FGF and BMP signaling controls the progression of progenitor cell differentiation and the emergence of pattern in the embryonic anterior pituitary. Development 125:10051015[Abstract]
- Japon MA, Rubinstein M, Low MJ 1994 In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J Histochem Cytochem 42:11171125[Abstract]
- Dasen JS, OConnell SM, Flynn SE, Treier M, Gleiberman, AS, Szeto DP, Hooshmand F, Aggarwal AK, Rosenfeld MG 1999 Reciprocal interactions of Pit1 and GATA2 mediate signaling gradient-induced determination of pituitary cell types. Cell 97:587598[CrossRef][Medline]
- Benjannet S, Rondeau N, Day R, Chrétien M, Seidah NG 1991 PC1 and PC2 are proprotein convertases capable of cleaving proopiomelanocortin at distinct pairs of basic residues. Proc Natl Acad Sci USA 88:35643568[Abstract/Free Full Text]
- Tremblay Y, Tretjakoff I, Peterson A, Antakly T, Zhang CX, Drouin J 1988 Pituitary-specific expression and glucocorticoid regulation of proopiomelanocortin fusion gene in transgenic mice. Proc Natl Acad Sci USA 85:88908894[Abstract/Free Full Text]
- Liu B, Hammer GD, Rubinstein M, Mortrud M, Low MJ 1992 Identification of DNA elements cooperatively activating proopiomelanocortin gene expression in the pituitary gland of transgenic mice. Mol Cell Biol 12:39783990[Abstract/Free Full Text]
- Therrien M, Drouin J 1991 Pituitary pro-opiomelanocortin gene expression requires synergistic interactions of several regulatory elements. Mol Cell Biol 11:34923503[Abstract/Free Full Text]
- Poulin G, Turgeon B, Drouin J 1997 NeuroD1/BETA2 contributes to cell-specific transcription of the POMC gene. Mol Cell Biol 17:66736682[Abstract]
- Poulin G, Lebel M, Chamberland M, Paradis FW, Drouin J 2000 Specific protein:protein interaction between basic Helix-Loop-Helix transcription factors and homeoproteins of the Pitx family. Mol Cell Biol 20:48264837[Abstract/Free Full Text]
- Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T-box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849859[CrossRef][Medline]
- Lamolet B, Poulin G, Chu K, Guillemot F, Tsai MJ, Drouin J 2004 Tpit-independent function of NeuroD1(BETA2) in pituitary corticotroph differentiation. Mol Endocrinol 18:9951003[Abstract/Free Full Text]
- Suh H, Gage PJ, Drouin J, Camper SA 2002 Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification. Development 129:329337
- Pulichino AM, Vallette-Kasic S, Tsai JPY, Couture C, Gauthier Y, Drouin J 2003 Tpit determines alternate fates during pituitary cell differentiation. Genes Dev 17:738747[Abstract/Free Full Text]
- Pulichino AM, Vallette-Kasic S, Couture C, Gauthier Y, Brue T, David M, Malpuech G, Deal C, Van Vliet G, De Vroede M, Riepe FG, Partsch CJ, Sippell WG, Berberoglu M, Atasay B, Drouin J 2003 Human and mouse Tpit gene mutations cause early onset pituitary ACTH deficiency. Genes Dev 17:711716[Abstract/Free Full Text]
- Gagner J-P, Drouin J 1985 Opposite regulation of pro-opiomelanocortin gene transcription by glucocorticoids and CRH. Mol Cell Endocrinol 40:2532[CrossRef][Medline]
- Gagner J-P, Drouin J 1987 Tissue-specific regulation of pituitary proopiomelanocortin gene transcription by corticotropin-releasing hormone, 3', 5'-cyclic adenosine monophosphate, and glucocorticoids. Mol Endocrinol 1:677682[Abstract]
- Drouin J, Trifiro MA, Plante RK, Nemer M, Eriksson P, Wrange Ö 1989 Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9:53055314[Abstract/Free Full Text]
- Chen X, Weisberg E, Fridmacher V, Watanabe M, Naco G, Whitman M 1997 Smad4 and FAST-1 in the assembly of activin-responsive factor. Nature 389:8589[CrossRef][Medline]
- Labbe E, Silvestri C, Hoodless PA, Wrana JL, Attisano L 1998 Smad2 and Smad3 positively and negatively regulate TGF ß-dependent transcription through the forkhead DNA-binding protein FAST2. Mol Cell 2:109120[CrossRef][Medline]
- Hata A, Seoane J, Lagna G, Montalvo E, Hemmati-Brivanlou A, Massague J 2000 OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100:229240[CrossRef][Medline]
- Korchynskyi O, ten Dijke P 2002 Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. J Biol Chem 277:48834891[Abstract/Free Full Text]
- Shi X, Yang X, Chen D, Chang Z, Cao X 1999 Smad1 interacts with homeobox DNA-binding proteins in bone morphogenetic protein signaling. J Biol Chem 274:1371113717[Abstract/Free Full Text]
- Derynck R, Zhang Y, Feng XH 1998 Smads: transcriptional activators of TGF-ß responses. Cell 95:737740[CrossRef][Medline]
- Wotton D, Lo RS, Lee S, Massague J 1999 A Smad transcriptional corepressor. Cell 97:2939[CrossRef][Medline]
- Wang W, Mariani FV, Harland RM, Luo K 2000 Ski represses bone morphogenic protein signaling in Xenopus and mammalian cells. Proc Natl Acad Sci USA 97:1439414399[Abstract/Free Full Text]
- Akiyoshi S, Inoue H, Hanai J, Kusanagi K, Nemoto N, Miyazono K, Kawabata M 1999 c-Ski acts as a transcriptional co-repressor in transforming growth factor-ß signaling through interaction with smads. J Biol Chem 274:3526935277[Abstract/Free Full Text]
- Sun Y, Liu X, Eaton EN, Lane WS, Lodish HF, Weinberg RA 1999 Interaction of the Ski oncoprotein with Smad3 regulates TGF-ß signaling. Mol Cell 4:499509[CrossRef][Medline]
- Stroschein SL, Wang W, Zhou S, Zhou Q, Luo K 1999 Negative feedback regulation of TGF-ß signaling by the SnoN oncoprotein. Science 286:771774[Abstract/Free Full Text]
- Sun Y, Liu X, Ng-Eaton E, Lodish HF, Weinberg RA 1999 SnoN and Ski protooncoproteins are rapidly degraded in response to transforming growth factor beta signaling. Proc Natl Acad Sci USA 96:1244212447[Abstract/Free Full Text]
- He J, Tegen SB, Krawitz AR, Martin GS, Luo K 2003 The transforming activity of Ski and SnoN is dependent on their ability to repress the activity of Smad proteins. J Biol Chem 278:3054030547.[Abstract/Free Full Text]
- Wrana JL 2000 Regulation of Smad activity. Cell 100:189192[CrossRef][Medline]
- Hogan BL 1996 Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10:15801594[Free Full Text]
- Israel DI, Nove J, Kerns KM, Kaufman RJ, Rosen V, Cox KA, Wozney JM 1996 Heterodimeric bone morphogenetic proteins show enhanced activity in vitro and in vivo. Growth Factors 13:291300[Medline]
- Nishimatsu S, Thomsen GH 1998 Ventral mesoderm induction and patterning by bone morphogenetic protein heterodimers in Xenopus embryos. Mech Dev 74:7588[CrossRef][Medline]
- Akiyama H, Shigeno C, Hiraki Y, Shukunami C, Kohno H, Akagi M, Konishi J, Nakamura T 1997 Cloning of a mouse smoothened cDNA and expression patterns of hedgehog signalling molecules during chondrogenesis and cartilage differentiation in clonal mouse EC cells, ATDC5. Biochem Biophys Res Commun 235:142147[CrossRef][Medline]
- ten Dijke P, Yamashita H, Sampath TK, Reddi AH, Estevez M, Riddle DL, Ichijo H, Heldin CH, Miyazono K 1994 Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J Biol Chem 269:1698516988[Abstract/Free Full Text]
- Tang SJ, Hoodless PA, Lu Z, Breitman ML, McInnes RR, Wrana JL, Buchwald M 1998 The Tlx-2 homeobox gene is a downstream target of BMP signalling and is required for mouse mesoderm development. Development 125:18771887[Abstract]
- Yingling JM, Datto MB, Wong C, Frederick JP, Liberati NT, Wang XF 1997 Tumor suppressor Smad4 is a transforming growth factor ß-inducible DNA binding protein. Mol Cell Biol 17:70197028[Abstract]
- Bilezikjian LM, Blount AL, Campen CA, Gonzalez-Manchon C, Vale W 1991 Activin-A inhibits proopiomelanocortin messenger RNA accumulation and adrenocorticotropin secretion of AtT20 cells. Mol Endocrinol 5:13891395[Abstract]
- Massague J 1998 TGF-ß signal transduction. Annu Rev Biochem 67:753791[CrossRef][Medline]
- Therrien M, Drouin J 1993 Cell-specific helix-loop-helix factor required for pituitary expression of the pro-opiomelanocortin gene. Mol Cell Biol 13:23422353[Abstract/Free Full Text]
- Philips A, Lesage S, Gingras R, Maira MH, Gauthier Y, Hugo P, Drouin J 1997 Novel dimeric Nur77 signaling mechanisms in endocrine and lymphoid cells. Mol Cell Biol 17:59465951[Abstract]
- St Amand TR, Zhang YD, Semina EV, Zhao X, Hu YP, Nguyen L, Murray JC, Chen YP 2000 Antagonistic signals between BMP4 and FGF8 define the expression of Pitx1 and Pitx2 in mouse tooth-forming anlage. Dev Biol 217:323332[CrossRef][Medline]
- Kang Y, Chen CR, Massague J 2003 A self-enabling TGFß response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol Cell 11:915926[CrossRef][Medline]
- Kowanetz M, Valcourt U, Bergstrom R, Heldin CH, Moustakas A 2004 Id2 and Id3 define the potency of cell proliferation and differentiation responses to transforming growth factor ß and bone morphogenetic protein. Mol Cell Biol 24:42414254[Abstract/Free Full Text]
- Lai CF, Cheng SL 2002 Signal transductions induced by bone morphogenetic protein-2 and transforming growth factor-ß in normal human osteoblastic cells. J Biol Chem 227:1551415522
- Hay E, Lemonnier J, Fromigue O, Marie PJ 2001 Bone morphogenetic protein-2 promotes osteoblast apoptosis through a Smad-independent, protein kinase C-dependent signaling pathway. J Biol Chem 276:2902829036[Abstract/Free Full Text]
- Kretzschmar M, Doody J, Massague J 1997 Opposing BMP and EGF signalling pathways converge on the TGF-ß family mediator Smad1. Nature 389:618622[CrossRef][Medline]
- Yamaguchi K, Shirakabe K, Shibuya H, Irie K, Oishi I, Ueno N, Taniguchi T, Nishida E, Matsumoto K 1995 Identification of a member of the MAPKKK family as a potential mediator of TGF-ß signal transduction. Science 270:20082011[Abstract/Free Full Text]
- Zhang Y, Feng X, We R, Derynck R 1996 Receptor-associated Mad homologues synergize as effectors of the TGF-ß response. Nature 383:168172[CrossRef][Medline]
- Nakao A, Imamura T, Souchelnytskyi S, Kawabata M, Ishisaki A, Oeda E, Tamaki K, Hanai J, Heldin CH, Miyazono K, ten Dijke P 1997 TGF-ß receptor-mediated signalling through Smad2, Smad3 and Smad4. EMBO J 16:53535362[CrossRef][Medline]
- Bouret S, Chuoi-Mariot MT, Prevot V, Croix D, Takumi T, Jegou S, Vaudry H, Beauvillain JC, Mitchell V 2001 Evidence that TGF ß may directly modulate POMC mRNA expression in the female rat arcuate nucleus. Endocrinology 142:40554065[Abstract/Free Full Text]
- Young JI, Otero V, Cerdan MG, Falzone TL, Chan EC, Low MJ, Rubinstein M 1998 Authentic cell-specific and developmentally regulated expression of pro-opiomelanocortin genomic fragments in hypothalamic and hindbrain neurons of transgenic mice. J Neurosci 18:66316640[Abstract/Free Full Text]
- Rousse S, Lallemand F, Montarras D, Pinset C, Mazars A, Prunier C, Atfi A, Dubois C 2001 Transforming growth factor-ß inhibition of insulin-like growth factor-binding protein-5 synthesis in skeletal muscle cells involves a c-Jun N-terminal kinase-dependent pathway. J Biol Chem 276:4696146967[Abstract/Free Full Text]
- Shi Y, Wang YF, Jayaraman L, Yang H, Massague J, Pavletich NP 1998 Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-ß signaling. Cell 94:585594[CrossRef][Medline]
- Germain S, Howell M, Esslemont GM, Hill CS 2000 Homeodomain and winged-helix transcription factors recruit activated Smads to distinct promoter elements via a common Smad interaction motif. Genes Dev 14:435451[Abstract/Free Full Text]
- Maira MH, Couture C, Le Martelot G, Pulichino AM, Bilodeau S, Drouin J 2003 The T-box factor Tpit recruits SRC/p160 coactivators and mediates hormone action. J Biol Chem 278:4652346532[Abstract/Free Full Text]
- Iavarone A, Massague J 1997 Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-ß in cells lacking the CDK inhibitor p15. Nature 387:417422[CrossRef][Medline]
- Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F 1995 Targeted disruption of mammalian hairy and enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev 9:31363148[Abstract/Free Full Text]
- Liu D, Black BL, Derynck R 2001 TGF-ß inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev 15:29502966[Abstract/Free Full Text]
- Balemans W, Van Hul W 2002 Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators. Dev Biol 250:231250[CrossRef][Medline]
- Lanctôt C, Gauthier Y, Drouin J 1999 Pituitary homeobox 1 (Ptx1) is differentially expressed during pituitary development. Endocrinology 140:14161422[Abstract/Free Full Text]
- Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454456[Medline]
- Lamonerie T, Tremblay JJ, Lanctôt C, Therrien M, Gauthier Y, Drouin J 1996 PTX1, a bicoid-related homeobox transcription factor involved in transcription of pro-opiomelanocortin (POMC) gene. Genes Dev 10:12841295[Abstract/Free Full Text]
- Tremblay JJ, Marcil A, Gauthier Y, Drouin J 1999 Ptx1 regulates SF-1 activity by an interaction that mimics the role of the ligand-binding domain. EMBO J 18:34313441[CrossRef][Medline]
- Willis SA, Zimmerman CM, Li LI, Mathews LS 1996 Formation and activation by phosphorylation of activin receptor complexes. Mol Endocrinol 10:367379[Abstract]
- Attisano L, Wrana JL, Montalvo E, Massague J 1996 Activation of signalling by the activin receptor complex. Mol Cell Biol 16:10661073[Abstract]