| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Subunit of Glycoprotein Hormone-Driven Pituitary Tumor-Transforming Gene Transgenic Mice
Departments of Medicine (R.A.A., I.T., E.M.B., S.-G.R., K.W., S.M.) and S. Mark Taper Imaging Center (D.-Y.C.), Cedars Sinai Research Institute, David Geffen School of Medicine at University of California at Los Angeles, Los Angeles, California 90048
Address all correspondence and requests for reprints to: Shlomo Melmed, M.D., Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Room 2015, Los Angeles, California 90048. E-mail: melmeds{at}cshs.org.
| ABSTRACT |
|---|
|
|
|---|
-subunit of glycoprotein hormone. Males showed plurihormonal focal pituitary transgene expression with LH-, TSH-, and, unexpectedly, also GH-cell focal hyperplasia and adenoma, associated with increased serum LH, GH, testosterone, and/or IGF-I levels. MRI revealed both pituitary and prostate enlargement at 912 months. Urinary obstruction caused by prostatic hyperplasia and seminal vesicle hyperplasia, with renal tract inflammation, resulted in death by 10 months in some animals. Pituitary PTTG expression results in plurihormonal hyperplasia and hormone-secreting microadenomas with profound peripheral growth-stimulatory effects on the prostate and urinary tract. These results provide evidence for early pituitary plasticity, whereby PTTG overexpression results in a phenotype switch in early pituitary stem cells and promotes differentiated polyhormonal cell focal expansion. | INTRODUCTION |
|---|
|
|
|---|
Pituitary tumors develop due to intrinsic adenohypophysial cell alterations or altered growth factor availability (5, 6). Mutations in three genes have been linked to a familial predisposition to development of human pituitary tumors including multiple endocrine neoplasia type I (7), gsp (8), and PRKAR1a (9). Disrupted cell cycle regulatory genes, including Rb, p27, and p18, also result in murine pituitary tumor development, mainly in the intermediate lobe (10, 11, 12).
Pituitary tumor-transforming gene (PTTG), isolated by differential display from GH-secreting pituitary tumor cell lines (13), is expressed in actively proliferating normal tissue especially the testis and lymphopoietic system, and in several tumor types (13, 14, 15, 16, 17, 18, 19, 20). PTTG is required for tissue self-renewal and pttg-null mice have hypoplastic testes, spleen, and pituitary glands (21). Male pttg-null mice also develop diabetes due to decreased pancreatic ß-cell mass and proliferation (22).
PTTG acts as a securin protein essential for mitosis (23). During the cell cycle, a complex series of events ensures timely and equal separation of sister chromatids. During metaphase, sister chromatids are bound by cohesin, which is degraded by separin leading to chromatid separation at anaphase. PTTG binds separin and blocks chromatid separation at metaphase. Separase activation occurs upon PTTG degradation by the anaphase-promoting complex at the metaphase-anaphase transition. Thus, too much or too little PTTG results in chromosomal instability and aneuploidy (21, 24, 25, 26).
Several lines of evidence support the role of PTTG in tumorigenesis. Overexpressed PTTG induces cell aneuploidy (24), transforms NIH3T3 cells in vitro and in vivo (13), stimulates fibroblast growth factor production (6, 14, 20), and induces angiogenesis (5). Of genes associated with malignant cell behavior, PTTG was identified as one of nine genes comprising the "expression signature" for metastatic potential of solid tumors (27). Expression of a dominant-negative PTTG motif blocks experimental rat pituitary adenoma growth (28), whereas PTTG deletion protects Rb+/ mice from developing pituitary and thyroid tumors (29). These observations underscore the requirement of PTTG for pituitary tumorigenesis.
Pituitary cell differentiation and commitment follow a well-orchestrated temporal and spatial cascade arising from multipotential stem cells. Temporal and spatial expression of transcription factors and growth factors determine the specificity of hormone-secreting cell commitment. For example, Prop-1 determines specific GH, prolactin, and TSH expression (1), T-Pit is required for proopiomelanocortin gene expression (1, 30), and steroidogenic factor 1 is required for gonadotroph cell commitment (31). The dimeric glycoprotein hormones, FSH, LH, and TSH, are comprised of a common
-subunit [
-subunit of glycoprotein hormone (
GSU)] and a specific ß-subunit. As
GSU is the earliest expressed pituitary hormone gene product (32), transgenic mice were generated with the
GSU promoter driving PTTG expression, to determine the impact of early pituitary PTTG expression. The results showing development of multihormonal tumors, by allowing hyperproliferation of early
GSU-expressing cells, lend credence to the presence of a multipotential early anterior pituitary stem cell.
| RESULTS |
|---|
|
|
|---|
GSU-directed hPTTG1 cDNA and enhanced green fluorescent protein (EGFP) were generated (Fig. 1A
GSU.PTTG: 637 ± 135 vs. wild type: 250 ± 60 ng/ml; P < 0.05). A greater increase in pituitary size in response to pregnancy and lactation was also observed in transgenic females, as assessed by magnetic resonance imaging (MRI) (data not shown).
|
|
GSU.PTTG phenotypes is shown in Table 2
GSU.PTTG mice, and some male transgenic mice died prematurely at 812 months of age as a result of urinary tract obstruction and inflammation. MRI of male transgenic animals demonstrated larger and irregularly shaped pituitary glands than wild type (Fig. 2
|
|
|
GSU promoter targets transgene expression to both gonadotropes and thyrotropes (32), double-label immunocytochemistry was performed to determine hormonal PTTG coexpression. Control pituitary glands derived from wild-type littermates did not exhibit appreciable PTTG immunofluorescence, but transgenic pituitaries expressed PTTG immunoreactivity in most, but not all,
GSU-expressing cells. Figure 4
GSU staining using fluorescein-labeled antibodies (green) and PTTG staining with Texas Red (red). Double-labeled cells are yellow. PTTG was expressed in some, but not all,
GSU cells as well as other cell types. Because LH and TSH are coexpressed with
GSU, pituitary sections were costained for LH (Fig. 4D
GSU cells that expressed PTTG also costained for GH (Fig. 4C
GSU (Fig. 4F
GSU, LH, and/or GH cells was observed in some animals (Fig. 5
|
|
Shown in Fig. 5
are two representative male transgenic pituitaries; one with a plurihormonal focal adenoma consisting of ribbon-like PTTG-expressing cells that costained for
GSU, LH, TSH, and GH (Fig. 5
, AH), whereas the other exhibited focal expansion of LH cells alone (Fig. 5
, I and J). Thus, evidence for focal LH- or GH- or TSH-cell adenoma formation in transgenic male pituitaries included the ribbon-like pattern of adenoma cells and reticulin loss. Presence of extensive pituitary vacuolization further supported the adenomatous nature of the focal cell expansions (33, 34).
Hormone Levels
Table 2
depicts serum hormone levels observed in wild-type and transgenic mice. FSH, TSH, and T4 levels were not different in male transgenic from wild-type mice (Table 2
). LH and GH levels were elevated in some, but not all, transgenic animals (Table 2
and Fig. 6
, A and B). However, mean serum testosterone and IGF-I levels were higher in transgenic than in wild-type mice (Table 2
and Fig. 6
, C and D), as were testicular testosterone levels (data not shown).
|
GSU.PTTG male transgenic mice was that of urinary tract obstruction secondary to prostate hyperplasia evident at 812 months of age. The urinary bladder was enlarged with wall thickening and filled with urine containing inflammatory cells and white deposits. Seminal vesicles were also enlarged (Fig. 7
|
|
| DISCUSSION |
|---|
|
|
|---|
GSU promoter results in focal PTTG expression in LH- and GH-producing cells ranging from hyperplasia to frank adenoma development. The finding of GH cell hyperplasia was surprising because the
GSU promoter has not been shown to drive expression to mature somatotrope cells. Increased GH and LH result in elevated IGF-I and testosterone levels, respectively, resulting in marked prostate and seminal vesicle neoplasia. Prostate hyperplasia results in bladder obstruction, kidney reflex, and inflammation. Some phenotypic features of
GSU.PTTG male mice are reminiscent of previously reported defects in mice that overexpress human chorionic gonadotropin (35, 36), suggesting a role for LH overexpression in the pathogenesis of prostate hyperplasia. These observations suggest that PTTG overexpression in the developing pituitary targets early pituitary multipotential cells or, alternatively, may influence neighboring non-
GSU-expressing cells by a paracrine mechanism.
How is transgene expression in GH cells explained? The mouse
GSU promoter targets PTTG expression to pituitary stem cells early in development, with the potential to give rise to all pituitary hormone cell types. Nevertheless, mature somatotrope cells rarely express
GSU. However, Camper and co-workers (37) labeled early embryonic cells with ß-galactosidase and showed that all pituitary cells, including GH cells, appear to originate from
GSU progenitor cells. Nevertheless, why PTTG is not suppressed in GH cells remains to be determined. Some GH cells express
GSU modestly (38), as do GH-secreting tumor cells (39, 40), supporting the hypothesis for a common plastic pituitary precursor lineage. Overexpressed thyrotrope PTTG may have resulted in thyrotrope hyperplasia and transdifferentiation of these cells into somatotropes, because these cells share the common Pit-1 lineage. Transdifferentiation of GH-secreting from TSH-secreting cells has been reported in states of hypothyroidism leading to TSH hyperplasia (41). Gonadotrope PTTG overexpression may also result in paracrine regulation of GH cell proliferation. For example, female transgenic mice that hypersecrete LH also exhibit elevated serum GH levels (42, 43).
Recent observations have suggested that a subpopulation of embryonic pituitary cells may coexpress two or more hormone mRNAs.
GSU with GH and/or prolactin expression are the earliest coexpressed hormones occurring at embryonic d 16. Age-related changes in combined single-cell hormone coexpression did not correspond with those observed for single hormone expression, suggesting a unique response of coexpressing adenohypophysial cells to developmental signals (38). The results shown here, whereby
GSU-driven PTTG gives rise to adenomas of both glycoprotein hormones as well as GH-secreting cells, provide further evidence for the coexpression of
GSU in embryonic somatotropes.
Prostate, seminal vesicle, and urinary tract pathology is attributed to increased pituitary secretion of both LH and GH, resulting in elevated testosterone and IGF-I levels, respectively. Although high levels of all four hormones were rarely observed in the same animal, most
GSU.PTTG male mice had abnormally elevated levels of at least one of these hormones. Not surprisingly, these animals developed prostate pathology as both testosterone (44) and IGF-I (45, 46, 47, 48, 49) have been linked to prostate hyperplasia and tumors. As the animals aged, prostate enlargement resulted in urinary tract obstruction leading to urinary bladder enlargement, inflammation, and even pyelonephritis in some animals.
These studies suggest that early overexpressed PTTG results in proliferation of multihormonal pituitary cells, underscoring the role of PTTG in pituitary cell proliferation and adenoma formation, and also point to the presence of a multipotential early pituitary stem cell expressing
GSU. Cell vacuolization is a hallmark of acidophilic stem cell adenoma. The large clear vacuoles observed in acidophilic stem cell adenoma are due to mitochondrial accumulation that can be seen as a giant mitochondrion under electron microscopy, which is indicative of oncocytic change (34). Previous studies have shown that PTTG abundance is increased in several tumor types, and its overexpression results in cell transformation. Our results validate that in vivo overexpression of PTTG itself induces abnormal pituitary cell proliferation and adenomas. Potential mechanisms include induction of aneuploidy as a result of dysregulation of sister chromatid separation (24, 50), regulation of other cell cycle proteins, including p53 (51, 52), or transactivation with other transcription factors involved in pituitary proliferation (19, 53).
| MATERIALS AND METHODS |
|---|
|
|
|---|
GSU promoter region [generously provided by Dr. E. C. Ridgway (32)], and by insertion of a 654-bp (Xho I-MluI) fragment containing the full-length hPTTG1 cDNA into the polylinker region of the pIRES2-EGFP vector (CLONTECH Laboratories, Inc., Palo Alto, CA) with the following restriction sites replaced by linkers: AseI by SacII and AflII by SfiI, respectively (Fig. 1A
Transgenic Mice
hPTTG1-IRES2-EGFP was digested with KpnI and AflII, the transgene was microinjected into B6C3-fertilized mouse pronuclei, and injected eggs were transplanted to pseudopregnant foster mothers at the University of California Los Angeles Transgenic Core Facility. For genotyping, either Southern blots or PCR using EGFP primers (AGAACGGCATCAAGGTGAAC and CAGAAGAACGGCATCAAGGT) were performed. All animal experiments were performed according to the guidelines of the Institutional Animal Care and Use Committee. Briefly, mice were housed in microisolator cages and cubicles in a room with 12-h light, 12-h dark cycle. Animals were euthanized using CO2 chambers, and blood was withdrawn directly from the heart. Pituitary glands were collected and fixed in 2% paraformaldehyde for 2 h whereas remaining organs were fixed in formalin.
Southern Blots
Tail genomic DNA samples were digested with EcoRI and resolved on 1% agarose gel. After DNA transfer to Hybond-n + (Amersham Pharmacia Biotech, Arlington Heights, IL) membrane, it was hybridized with a radiolabeled probe comprising a 1.2-kb XbaI fragment containing the junction of the
GSU promoter and hPTTG1 (Fig. 1B
). Upon exposure of the membrane to film, a 6.8-kb band appears in transgenic samples. Injected plasmid DNA digested with EcoRI was used as control.
Confocal Microscopy
Scanning confocal images were obtained using a confocal microscope TCS-SP confocal scanner (Leica Microsystems, Mannheim, Germany). Images were taken with a x10, 0.3 N.A. Plan Fluotar. The objective provides a scan field of 1 x 1 mm. Because the pituitary is significantly larger, we performed a tiled scan. The complete imaging field was divided into three x four quadrants. Each quadrant was scanned separately as a 200-µm deep stack with 7-µm spaced optical sections along the z-axis. The sample was positioned by a Scan motorized stage (Märzhäuser, Wertzlar, Germany), maximum intensity projection was calculated for each stack, and aligned projections were assembled into the final figure. The spectrophotometer was set to optimal EGFP detection to a wide setting of 500590 nm. Pinhole was set to 1.5 Airy units to provide for depth penetration and efficient light collection.
Histology
Tissue sectioning was performed by the Department of Pathology at Cedars Sinai Medical Center. For the pituitary, 4-µm sections of paraformaldehyde- (2% in PBS for 2 h) fixed and paraffin-embedded tissue were obtained and stained for hematoxylin and eosin or reticulin silver stain. Double-labeled immunocytochemistry was performed using a previously optimized protocol (42, 43) or the EnVision kit (DAKO Cytomation, Inc., Carpinteria, CA). Antibodies used were: rabbit polyclonal anti-PTTG-1 (Zymed Laboratories Inc., South San Francisco, CA, 1:2000), Rabbit antihuman ACTH [National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), 1:200], rabbit antirat GH (NIDDK, 1:200), guinea pig antirat
-subunit (NIDDK, 1:200), guinea pig antirat ß-LH (NIDDK, 1:200), guinea pig antirat prolactin (NIDDK, 1:200), rabbit antirat TSHß (NIDDK, 1:1000). Secondary antibodies included fluorescein thiocyanate-labeled antirabbit, Cy3-labeled antirabbit, Rhodamine-labeled antirabbit, and fluorescein thiocyanate-labeled antiguinea pig. When the Envision kit was used, secondary antibodies and chromagens were used according to manufacturer specification. For PTTG immunostaining, an antigen-retrieval step was performed before incubation with primary antibody. Slides were counterstained with 4',6-diamidino-2-phenylindole or hematoxylin to visualize nuclei.
RIA
Serum IGF-I was measured using the rat IGF-I RIA kit (DSL, Inc., Webster, TX). A solid-phase RIA for measurement of total testosterone (Coat-A-Count, Diagnostic Products Corp., Los Angeles, CA) in diethyl ether extracted serum samples. The DPC Coat-A-Count total T4 assay was also used. For GH measurements, a rat GH RIA was used as previously described (54). LH and FSH levels were assayed by the University of Virginia Center for Cellular and Molecular studies in Reproduction.
MRI
We used a clinical whole-body 1.5 Tesla MRI system (Siemens Visions, Madison, WI) to image the mouse pituitary. Procedures were performed during nonclinical hours between 2100 h and 0700 h, and equipment was disinfected before and after animal imaging. Animals were anesthetized with avertin and imaged using a small solenoidal receiver coil. We obtained T1-weighted spin echo images (repetition time, 400 msec; echo time, 14 msec; number of signal averages, 4; imaging time, 6 min, 53 sec; slice thickness, 1 mm; in-plane resolution, 195 µm) in the coronal and sagittal imaging planes. Pituitary volume was determined by multiplying pixel volume by the number of pixels within the pituitary gland as defined by a region of interest that was manually drawn on magnified sagittal images using the MRI system console.
Statistical Analysis
Because most comparisons were made between wild-type and transgenic littermates, an unpaired Students t test was used to determine statistical significances, which are determined at P < 0.05.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
First Published Online January 27, 2005
Abbreviations: EGFP, Enhanced green fluorescent protein;
GSU,
-subunit of glycoprotein hormone; MRI, magnetic resonance imaging; PTTG, pituitary tumor-transforming gene.
Received for publication October 11, 2004. Accepted for publication January 18, 2005.
| REFERENCES |
|---|
|
|
|---|
-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol Endocrinol 8:14201433
-subunit. Clin Endocrinol (Oxf) 25:173179[Medline]
-subunit hypersecretion in patients with pituitary tumors: clinically nonfunctioning and somatotroph adenomas. J Clin Endocrinol Metab 70:859864
-subunit gene to gonadotropin-releasing hormone and estrogens. Mol Endocrinol 13:14491459This article has been cited by other articles:
![]() |
F. Salehi, K. Kovacs, B. W. Scheithauer, D. Cantelmi, E. Horvath, R. V. Lloyd, and M. Cusimano Immunohistochemical Expression of Pituitary Tumor Transforming Gene (PTTG) in Pituitary Adenomas: A Correlative Study of Tumor Subtypes International Journal of Surgical Pathology, February 1, 2010; 18(1): 5 - 13. [Abstract] [PDF] |
||||
![]() |
C. Zhou, K. Wawrowsky, S. Bannykh, S. Gutman, and S. Melmed E2F1 Induces Pituitary Tumor Transforming Gene (PTTG1) Expression in Human Pituitary Tumors Mol. Endocrinol., December 1, 2009; 23(12): 2000 - 2012. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chesnokova, S. Zonis, K. Kovacs, A. Ben-Shlomo, K. Wawrowsky, S. Bannykh, and S. Melmed p21Cip1 restrains pituitary tumor growth PNAS, November 11, 2008; 105(45): 17498 - 17503. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Salehi, K. Kovacs, B. W Scheithauer, R. V Lloyd, and M. Cusimano Pituitary tumor-transforming gene in endocrine and other neoplasms: a review and update Endocr. Relat. Cancer, September 1, 2008; 15(3): 721 - 743. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chesnokova, S. Zonis, T. Rubinek, R. Yu, A. Ben-Shlomo, K. Kovacs, K. Wawrowsky, and S. Melmed Senescence Mediates Pituitary Hypoplasia and Restrains Pituitary Tumor Growth Cancer Res., November 1, 2007; 67(21): 10564 - 10572. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M El-Naggar, M. T Malik, A. Martin, J. P Moore, M. Proctor, T. Hamid, and S. S Kakar Development of cystic glandular hyperplasia of the endometrium in Mullerian inhibitory substance type II receptor-pituitary tumor transforming gene transgenic mice J. Endocrinol., July 1, 2007; 194(1): 179 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Kim, H. Ying, M. C. Willingham, and S.-y. Cheng The pituitary tumor-transforming gene promotes angiogenesis in a mouse model of follicular thyroid cancer Carcinogenesis, May 1, 2007; 28(5): 932 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vlotides, T. Eigler, and S. Melmed Pituitary Tumor-Transforming Gene: Physiology and Implications for Tumorigenesis Endocr. Rev., April 1, 2007; 28(2): 165 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yu, M. Cruz-Soto, S. L. Calzi, H. Hui, and S. Melmed Murine pituitary tumor-transforming gene functions as a securin protein in insulin-secreting cells. J. Endocrinol., October 1, 2006; 191(1): 45 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Donangelo, S. Gutman, E. Horvath, K. Kovacs, K. Wawrowsky, M. Mount, and S. Melmed Pituitary Tumor Transforming Gene Overexpression Facilitates Pituitary Tumor Development Endocrinology, October 1, 2006; 147(10): 4781 - 4791. [Abstract] [Full Text] [PDF] |
||||
![]() |
W E Farrell Pituitary tumours: findings from whole genome analyses. Endocr. Relat. Cancer, September 1, 2006; 13(3): 707 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Gillam, M. E. Molitch, G. Lombardi, and A. Colao Advances in the Treatment of Prolactinomas Endocr. Rev., August 1, 2006; 27(5): 485 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tfelt-Hansen, D. Kanuparthi, and N. Chattopadhyay The emerging role of pituitary tumor transforming gene in tumorigenesis. Clin. Med. Res., June 1, 2006; 4(2): 130 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Pierantoni, P. Finelli, E. Valtorta, D. Giardino, O. Rodeschini, F. Esposito, M. Losa, A. Fusco, and L. Larizza High-mobility group A2 gene expression is frequently induced in non-functioning pituitary adenomas (NFPAs), even in the absence of chromosome 12 polysomy Endocr. Relat. Cancer, December 1, 2005; 12(4): 867 - 874. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chesnokova, K. Kovacs, A.-V. Castro, S. Zonis, and S. Melmed Pituitary Hypoplasia in Pttg-/- Mice Is Protective for Rb+/- Pituitary Tumorigenesis Mol. Endocrinol., September 1, 2005; 19(9): 2371 - 2379. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |