help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0403
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbud, R. A.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbud, R. A.
Right arrow Articles by Melmed, S.
Molecular Endocrinology 19 (5): 1383-1391
Copyright © 2005 by The Endocrine Society

Early Multipotential Pituitary Focal Hyperplasia in the {alpha}-Subunit of Glycoprotein Hormone-Driven Pituitary Tumor-Transforming Gene Transgenic Mice

Rula A. Abbud, Ichiro Takumi, Erin M Barker, Song-Guang Ren, Dar-Yong Chen, Kolja Wawrowsky and Shlomo Melmed

Departments of Medicine (R.A.A., I.T., E.M.B., S.-G.R., K.W., S.M.) and S. Mark Taper Imaging Center (D.-Y.C.), Cedars Sinai Research Institute, David Geffen School of Medicine at University of California at Los Angeles, Los Angeles, California 90048

Address all correspondence and requests for reprints to: Shlomo Melmed, M.D., Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Room 2015, Los Angeles, California 90048. E-mail: melmeds{at}cshs.org.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pituitary tumor-transforming gene (PTTG), a securin protein isolated from pituitary tumor cell lines, is highly expressed in invasive tumors and exhibits characteristics of a transforming gene. To determine the role of PTTG in pituitary tumorigenesis, transgenic human PTTG1 was targeted to the mouse pituitary using the {alpha}-subunit of glycoprotein hormone. Males showed plurihormonal focal pituitary transgene expression with LH-, TSH-, and, unexpectedly, also GH-cell focal hyperplasia and adenoma, associated with increased serum LH, GH, testosterone, and/or IGF-I levels. MRI revealed both pituitary and prostate enlargement at 9–12 months. Urinary obstruction caused by prostatic hyperplasia and seminal vesicle hyperplasia, with renal tract inflammation, resulted in death by 10 months in some animals. Pituitary PTTG expression results in plurihormonal hyperplasia and hormone-secreting microadenomas with profound peripheral growth-stimulatory effects on the prostate and urinary tract. These results provide evidence for early pituitary plasticity, whereby PTTG overexpression results in a phenotype switch in early pituitary stem cells and promotes differentiated polyhormonal cell focal expansion.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PITUITARY CELL COMMITMENT and terminal differentiation follows a well-orchestrated temporal and spatial developmental cascade arising from multipotential cells (1, 2, 3, 4). The mature gland comprises at least five highly differentiated hormone-secreting cell types.

Pituitary tumors develop due to intrinsic adenohypophysial cell alterations or altered growth factor availability (5, 6). Mutations in three genes have been linked to a familial predisposition to development of human pituitary tumors including multiple endocrine neoplasia type I (7), gsp (8), and PRKAR1a (9). Disrupted cell cycle regulatory genes, including Rb, p27, and p18, also result in murine pituitary tumor development, mainly in the intermediate lobe (10, 11, 12).

Pituitary tumor-transforming gene (PTTG), isolated by differential display from GH-secreting pituitary tumor cell lines (13), is expressed in actively proliferating normal tissue especially the testis and lymphopoietic system, and in several tumor types (13, 14, 15, 16, 17, 18, 19, 20). PTTG is required for tissue self-renewal and pttg-null mice have hypoplastic testes, spleen, and pituitary glands (21). Male pttg-null mice also develop diabetes due to decreased pancreatic ß-cell mass and proliferation (22).

PTTG acts as a securin protein essential for mitosis (23). During the cell cycle, a complex series of events ensures timely and equal separation of sister chromatids. During metaphase, sister chromatids are bound by cohesin, which is degraded by separin leading to chromatid separation at anaphase. PTTG binds separin and blocks chromatid separation at metaphase. Separase activation occurs upon PTTG degradation by the anaphase-promoting complex at the metaphase-anaphase transition. Thus, too much or too little PTTG results in chromosomal instability and aneuploidy (21, 24, 25, 26).

Several lines of evidence support the role of PTTG in tumorigenesis. Overexpressed PTTG induces cell aneuploidy (24), transforms NIH3T3 cells in vitro and in vivo (13), stimulates fibroblast growth factor production (6, 14, 20), and induces angiogenesis (5). Of genes associated with malignant cell behavior, PTTG was identified as one of nine genes comprising the "expression signature" for metastatic potential of solid tumors (27). Expression of a dominant-negative PTTG motif blocks experimental rat pituitary adenoma growth (28), whereas PTTG deletion protects Rb+/– mice from developing pituitary and thyroid tumors (29). These observations underscore the requirement of PTTG for pituitary tumorigenesis.

Pituitary cell differentiation and commitment follow a well-orchestrated temporal and spatial cascade arising from multipotential stem cells. Temporal and spatial expression of transcription factors and growth factors determine the specificity of hormone-secreting cell commitment. For example, Prop-1 determines specific GH, prolactin, and TSH expression (1), T-Pit is required for proopiomelanocortin gene expression (1, 30), and steroidogenic factor 1 is required for gonadotroph cell commitment (31). The dimeric glycoprotein hormones, FSH, LH, and TSH, are comprised of a common {alpha}-subunit [{alpha}-subunit of glycoprotein hormone ({alpha}GSU)] and a specific ß-subunit. As {alpha}GSU is the earliest expressed pituitary hormone gene product (32), transgenic mice were generated with the {alpha}GSU promoter driving PTTG expression, to determine the impact of early pituitary PTTG expression. The results showing development of multihormonal tumors, by allowing hyperproliferation of early {alpha}GSU-expressing cells, lend credence to the presence of a multipotential early anterior pituitary stem cell.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Targeted Pituitary Human (h) PTTG1 Expression in Transgenic Mice
To gain further insight into the in vivo requirement of PTTG for pituitary cell proliferation, transgenic mice expressing {alpha}GSU-directed hPTTG1 cDNA and enhanced green fluorescent protein (EGFP) were generated (Fig. 1AGo). Of four founder lines (three males and one female), one male founder failed to reproduce and developed intermediate lobe hyperplasia at 4 months of age, one was subfertile and gave rise to transgenic animals that failed to reproduce due to reproductive tract pathologies, and one sired transgenic offspring with a variety of phenotypes. Female transgenic mice were fertile and appeared healthy, and many offspring were obtained from the one female founder (Table 1Go). Female mice had enlarged pituitaries with elevated levels of serum IGF-I ({alpha}GSU.PTTG: 637 ± 135 vs. wild type: 250 ± 60 ng/ml; P < 0.05). A greater increase in pituitary size in response to pregnancy and lactation was also observed in transgenic females, as assessed by magnetic resonance imaging (MRI) (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Generation of {alpha}GSU.PTTG Transgenic Mice

A, {alpha}GSU.PTTG transgene construct consisting of the {alpha}GSU promoter driving expression of hPTTG1 and EGFP. IRES sequences allow for expression of both hPTTG1 and EGFP proteins. B, Mouse genotyping using Southern blot analysis. Tail DNA was digested with EcoRI and resolved on a 1.0% agarose gel. After transfer, the membrane was hybridized with a random-radiolabeled probe comprising the 1.2-kb XbaI fragment containing part of the bridging {alpha}GSU promoter and PTTG junction. Expected size of the transgenic fragment is 6.8 kb (arrow). P, Injected plasmid with vector digested with EcoRI as control; WT, wild type; TG, transgenic; IRES, internal ribosome entry site.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Breeding of Four {alpha}GSU.PTTG Transgenic Founders

 
A summary of {alpha}GSU.PTTG phenotypes is shown in Table 2Go. There was a nonsignificant increase in body weight in {alpha}GSU.PTTG mice, and some male transgenic mice died prematurely at 8–12 months of age as a result of urinary tract obstruction and inflammation. MRI of male transgenic animals demonstrated larger and irregularly shaped pituitary glands than wild type (Fig. 2Go). Pituitary transgene expression was confirmed by demonstrating EGFP expression using scanning confocal microscopy. The EGFP signal was visualized on both the pituitary surface and up to 100 µm deep. Transgenic, but not wild-type, pituitary glands expressed EGFP in cell clusters assembled in two bilateral streaks in some animals (Fig. 3AGo). Rows of EGFP-positive cells juxtaposed to blood vessels were evident, and PTTG immunostaining showed focal PTTG expression (Fig. 3BGo). Focal PTTG expression was accompanied by loss of the reticulin network in some animals (Fig. 3EGo), indicating microadenoma rather than hyperplasia. Figure 3Go, C–F, depicts an example of a microadenoma coexpressing LH and PTTG, with vacuolizations.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of Observed {alpha}GSU.PTTG Phenotypes

 


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2. Evidence of Transgenic Pituitary Enlargement and Irregular Shape on MRI

Sagittal (A) and coronal (B) MRI images of one wild-type and two transgenic ({alpha}GSU.PTTG) mice. C, Scattergram depicting pituitary size in total pixels obtained by adding the pituitary area obtained from consecutive sagittal images. WT, Wild type.

 


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 3. Pituitary PTTG Expression in {alpha}GSU.PTTG Mice Results in Focal Hyperplasia and Adenoma

A, Scanning confocal images showing EGFP signal (green) appearing as two bilateral streaks in {alpha}GSU.PTTG pituitary. B, Focal PTTG expression in a representative {alpha}GSU.PTTG mouse pituitary sections (5 µm) immunostained for PTTG (brown) and counterstained with hematoxylin (blue). Magnification: x100. C–F, Representative pituitary sections from {alpha}GSU.PTTG animal that developed a highly vacuolized (arrows) PTTG (panel D, red) and LH-immunostained (panel F, red) tumor, as evidenced by the disrupted reticulin network (panel E, black fibers). Magnification: C, x40; D, x400; E, x100; F: x200.

 
Because the mouse {alpha}GSU promoter targets transgene expression to both gonadotropes and thyrotropes (32), double-label immunocytochemistry was performed to determine hormonal PTTG coexpression. Control pituitary glands derived from wild-type littermates did not exhibit appreciable PTTG immunofluorescence, but transgenic pituitaries expressed PTTG immunoreactivity in most, but not all, {alpha}GSU-expressing cells. Figure 4Go, A and B show {alpha}GSU staining using fluorescein-labeled antibodies (green) and PTTG staining with Texas Red (red). Double-labeled cells are yellow. PTTG was expressed in some, but not all, {alpha}GSU cells as well as other cell types. Because LH and TSH are coexpressed with {alpha}GSU, pituitary sections were costained for LH (Fig. 4DGo), TSH (Fig. 4EGo), and PTTG. PTTG was expressed in both LH and TSH. Surprisingly, non-{alpha}GSU cells that expressed PTTG also costained for GH (Fig. 4CGo), and some GH cells expressed {alpha}GSU (Fig. 4FGo). Focal expansion of {alpha}GSU, LH, and/or GH cells was observed in some animals (Fig. 5Go), whereas expression of pituitary ACTH and prolactin was normal (data not shown).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4. Polyhormonal PTTG Coexpression in {alpha}GSU.PTTG Mouse Pituitary

A and B, Double-label immunostaining of a transgenic mouse pituitary for PTTG (red) and {alpha}GSU (green). Overlay of PTTG and {alpha}GSU images with Adobe Photoshop (Adobe Systems, Inc., San Jose, CA) reveals double-labeled cells in yellow. Magnification: x1000. C, Double-label immunostaining for PTTG (brown) and GH (pink) of transgenic mouse pituitary, showing costaining of some GH and PTTG cells (arrows) with ribbon-like appearance of adenomatous tumor cells. Magnification: x1000. D, Double-label immunocytochemistry for LH (green) and PTTG (red) with costained cells appearing in yellow. Magnification: x200. E, Coexpression of some, but not all, TSH- (pink) and PTTG-expressing (brown) cells. Arrow indicates double-labeled cells and arrowhead points to a TSH cell not expressing PTTG. Note the ribbon-like pattern of PTTG expression. Magnification: x200. F, Representative pituitary section from an animal with elevated IGF-I levels costained for {alpha}GSU (green) and GH (red). Focal hyperplasia of GH-expressing cells was observed with coexpression of {alpha}GSU with GH in some cells (arrows). Asterisk depicts {alpha}GSU cell that did not express GH. Magnification: x400.

 


View larger version (75K):
[in this window]
[in a new window]
 
Fig. 5. Development of Plurihormonal Focal Adenomas in {alpha}GSU.PTTG Mice

A–H, Pituitary sections from a representative animal with PTTG-expressing cells organized in a ribbon-like or bead-on-a-string-like pattern. Sections were costained with PTTG (brown, panels E–H) and one of the following: TSH (red, panel A), LH (red, panel B), {alpha}GSU (red, panel C), and GH (red, panel D), respectively. Magnification: x1000. I–J, Representative sections from an animal with LH-producing (red) adenoma that did not immunostain for GH (green). Magnification: I, x200; J, x400.

 
Pathological findings in transgenic pituitaries consisted of microscopic focal expansion of hormone-specific cells with ribbon-like pattern of tumor cells and vacuolizations. Exclusion of other immunoreactive hormones from these areas was indicative of cell specificity. Loss of reticulin network was also a hallmark of adenomatous change. Large macroscopic adenomas were not observed, likely because animals died early from renal tract obstruction.

Shown in Fig. 5Go are two representative male transgenic pituitaries; one with a plurihormonal focal adenoma consisting of ribbon-like PTTG-expressing cells that costained for {alpha}GSU, LH, TSH, and GH (Fig. 5Go, A–H), whereas the other exhibited focal expansion of LH cells alone (Fig. 5Go, I and J). Thus, evidence for focal LH- or GH- or TSH-cell adenoma formation in transgenic male pituitaries included the ribbon-like pattern of adenoma cells and reticulin loss. Presence of extensive pituitary vacuolization further supported the adenomatous nature of the focal cell expansions (33, 34).

Hormone Levels
Table 2Go depicts serum hormone levels observed in wild-type and transgenic mice. FSH, TSH, and T4 levels were not different in male transgenic from wild-type mice (Table 2Go). LH and GH levels were elevated in some, but not all, transgenic animals (Table 2Go and Fig. 6Go, A and B). However, mean serum testosterone and IGF-I levels were higher in transgenic than in wild-type mice (Table 2Go and Fig. 6Go, C and D), as were testicular testosterone levels (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. Hypersecretion of LH, GH, Testosterone, and/or IGF-I in {alpha}GSU.PTTG Mice

Serum hormone levels were measured by RIA and values were normalized to those obtained from wild-type littermates. Individual data points are plotted for both wild-type and transgenic ({alpha}GSU.PTTG) mice. WT, Wild type.

 
Male Genitourinary Tract Pathology
The most striking phenotype observed in {alpha}GSU.PTTG male transgenic mice was that of urinary tract obstruction secondary to prostate hyperplasia evident at 8–12 months of age. The urinary bladder was enlarged with wall thickening and filled with urine containing inflammatory cells and white deposits. Seminal vesicles were also enlarged (Fig. 7Go), but testicular weight was unchanged. Seminal vesicle histology showed fibromuscular stromal thickening with signs of inflammation or adenoma in some animals (Fig. 7Go). Histological examination of the prostate revealed focal micropapillary hyperplasia with dilated ducts, cell atypia, and prostate intraepithelial neoplasia. It is characterized by multifocal proliferative regions of atypical epithelial cells in multiple ductules with cribriform and/or tufting growth patterns with progressive nuclear atypia. These patterns appear as bridges of epithelial cells within each ductule. In some animals that died prematurely, stromal hyperplasia, and inflammatory prostatitis were observed (Fig. 8Go).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 7. Seminal Vesicle Pathology in {alpha}GSU.PTTG Mice

Shown are representative seminal vesicles (outlined in white) derived from wild-type (A) and {alpha}GSU.PTTG transgenic (B) animals. Transgenic animals had enlarged seminal vesicles with increased lumen size. C, Representative seminal vesicle section (5 µm) stained with hematoxylin and eosin showing thickening of the fibromuscular stroma (*), signs of inflammation (black arrowhead), and adenoma (white arrow).

 


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 8. Prostate Pathology in {alpha}GSU.PTTG Mice

A and B, MRI of wild-type and transgenic ({alpha}GSU.PTTG) mice showing enlargement of the ventral prostate (arrows) in transgenic as compared with wild type. Prostate enlargement leads to narrowing of the urethral opening (*). C–E, Hematoxylin and eosin-stained sections from wild-type and transgenic ({alpha}GSU.PTTG) prostate glands, with transgenic prostate showing intraepithelial neoplasia with multifocal proliferative regions of atypical epithelial cells forming bridges (arrow) with cribriform and tufting growth patterns. E, Evidence for inflammatory prostatitis (arrows) in {alpha}GSU.PTTG mouse prostate section stained with hematoxylin and eosin. WT, Wild type.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Targeted expression of PTTG using the mouse {alpha}GSU promoter results in focal PTTG expression in LH- and GH-producing cells ranging from hyperplasia to frank adenoma development. The finding of GH cell hyperplasia was surprising because the {alpha}GSU promoter has not been shown to drive expression to mature somatotrope cells. Increased GH and LH result in elevated IGF-I and testosterone levels, respectively, resulting in marked prostate and seminal vesicle neoplasia. Prostate hyperplasia results in bladder obstruction, kidney reflex, and inflammation. Some phenotypic features of {alpha}GSU.PTTG male mice are reminiscent of previously reported defects in mice that overexpress human chorionic gonadotropin (35, 36), suggesting a role for LH overexpression in the pathogenesis of prostate hyperplasia. These observations suggest that PTTG overexpression in the developing pituitary targets early pituitary multipotential cells or, alternatively, may influence neighboring non-{alpha}GSU-expressing cells by a paracrine mechanism.

How is transgene expression in GH cells explained? The mouse {alpha}GSU promoter targets PTTG expression to pituitary stem cells early in development, with the potential to give rise to all pituitary hormone cell types. Nevertheless, mature somatotrope cells rarely express {alpha}GSU. However, Camper and co-workers (37) labeled early embryonic cells with ß-galactosidase and showed that all pituitary cells, including GH cells, appear to originate from {alpha}GSU progenitor cells. Nevertheless, why PTTG is not suppressed in GH cells remains to be determined. Some GH cells express {alpha}GSU modestly (38), as do GH-secreting tumor cells (39, 40), supporting the hypothesis for a common plastic pituitary precursor lineage. Overexpressed thyrotrope PTTG may have resulted in thyrotrope hyperplasia and transdifferentiation of these cells into somatotropes, because these cells share the common Pit-1 lineage. Transdifferentiation of GH-secreting from TSH-secreting cells has been reported in states of hypothyroidism leading to TSH hyperplasia (41). Gonadotrope PTTG overexpression may also result in paracrine regulation of GH cell proliferation. For example, female transgenic mice that hypersecrete LH also exhibit elevated serum GH levels (42, 43).

Recent observations have suggested that a subpopulation of embryonic pituitary cells may coexpress two or more hormone mRNAs. {alpha}GSU with GH and/or prolactin expression are the earliest coexpressed hormones occurring at embryonic d 16. Age-related changes in combined single-cell hormone coexpression did not correspond with those observed for single hormone expression, suggesting a unique response of coexpressing adenohypophysial cells to developmental signals (38). The results shown here, whereby {alpha}GSU-driven PTTG gives rise to adenomas of both glycoprotein hormones as well as GH-secreting cells, provide further evidence for the coexpression of {alpha}GSU in embryonic somatotropes.

Prostate, seminal vesicle, and urinary tract pathology is attributed to increased pituitary secretion of both LH and GH, resulting in elevated testosterone and IGF-I levels, respectively. Although high levels of all four hormones were rarely observed in the same animal, most {alpha}GSU.PTTG male mice had abnormally elevated levels of at least one of these hormones. Not surprisingly, these animals developed prostate pathology as both testosterone (44) and IGF-I (45, 46, 47, 48, 49) have been linked to prostate hyperplasia and tumors. As the animals aged, prostate enlargement resulted in urinary tract obstruction leading to urinary bladder enlargement, inflammation, and even pyelonephritis in some animals.

These studies suggest that early overexpressed PTTG results in proliferation of multihormonal pituitary cells, underscoring the role of PTTG in pituitary cell proliferation and adenoma formation, and also point to the presence of a multipotential early pituitary stem cell expressing {alpha}GSU. Cell vacuolization is a hallmark of acidophilic stem cell adenoma. The large clear vacuoles observed in acidophilic stem cell adenoma are due to mitochondrial accumulation that can be seen as a giant mitochondrion under electron microscopy, which is indicative of oncocytic change (34). Previous studies have shown that PTTG abundance is increased in several tumor types, and its overexpression results in cell transformation. Our results validate that in vivo overexpression of PTTG itself induces abnormal pituitary cell proliferation and adenomas. Potential mechanisms include induction of aneuploidy as a result of dysregulation of sister chromatid separation (24, 50), regulation of other cell cycle proteins, including p53 (51, 52), or transactivation with other transcription factors involved in pituitary proliferation (19, 53).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA Constructs
The hPTTG1-IRES2-EGFP plasmid was constructed by replacement of PCMV by the 4.6 kb (KpnI-HindIII) fragment of the rat {alpha}GSU promoter region [generously provided by Dr. E. C. Ridgway (32)], and by insertion of a 654-bp (Xho I-MluI) fragment containing the full-length hPTTG1 cDNA into the polylinker region of the pIRES2-EGFP vector (CLONTECH Laboratories, Inc., Palo Alto, CA) with the following restriction sites replaced by linkers: AseI by SacII and AflII by SfiI, respectively (Fig. 1AGo).

Transgenic Mice
hPTTG1-IRES2-EGFP was digested with KpnI and AflII, the transgene was microinjected into B6C3-fertilized mouse pronuclei, and injected eggs were transplanted to pseudopregnant foster mothers at the University of California Los Angeles Transgenic Core Facility. For genotyping, either Southern blots or PCR using EGFP primers (AGAACGGCATCAAGGTGAAC and CAGAAGAACGGCATCAAGGT) were performed. All animal experiments were performed according to the guidelines of the Institutional Animal Care and Use Committee. Briefly, mice were housed in microisolator cages and cubicles in a room with 12-h light, 12-h dark cycle. Animals were euthanized using CO2 chambers, and blood was withdrawn directly from the heart. Pituitary glands were collected and fixed in 2% paraformaldehyde for 2 h whereas remaining organs were fixed in formalin.

Southern Blots
Tail genomic DNA samples were digested with EcoRI and resolved on 1% agarose gel. After DNA transfer to Hybond-n + (Amersham Pharmacia Biotech, Arlington Heights, IL) membrane, it was hybridized with a radiolabeled probe comprising a 1.2-kb XbaI fragment containing the junction of the {alpha}GSU promoter and hPTTG1 (Fig. 1BGo). Upon exposure of the membrane to film, a 6.8-kb band appears in transgenic samples. Injected plasmid DNA digested with EcoRI was used as control.

Confocal Microscopy
Scanning confocal images were obtained using a confocal microscope TCS-SP confocal scanner (Leica Microsystems, Mannheim, Germany). Images were taken with a x10, 0.3 N.A. Plan Fluotar. The objective provides a scan field of 1 x 1 mm. Because the pituitary is significantly larger, we performed a tiled scan. The complete imaging field was divided into three x four quadrants. Each quadrant was scanned separately as a 200-µm deep stack with 7-µm spaced optical sections along the z-axis. The sample was positioned by a Scan motorized stage (Märzhäuser, Wertzlar, Germany), maximum intensity projection was calculated for each stack, and aligned projections were assembled into the final figure. The spectrophotometer was set to optimal EGFP detection to a wide setting of 500–590 nm. Pinhole was set to 1.5 Airy units to provide for depth penetration and efficient light collection.

Histology
Tissue sectioning was performed by the Department of Pathology at Cedars Sinai Medical Center. For the pituitary, 4-µm sections of paraformaldehyde- (2% in PBS for 2 h) fixed and paraffin-embedded tissue were obtained and stained for hematoxylin and eosin or reticulin silver stain. Double-labeled immunocytochemistry was performed using a previously optimized protocol (42, 43) or the EnVision kit (DAKO Cytomation, Inc., Carpinteria, CA). Antibodies used were: rabbit polyclonal anti-PTTG-1 (Zymed Laboratories Inc., South San Francisco, CA, 1:2000), Rabbit antihuman ACTH [National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), 1:200], rabbit antirat GH (NIDDK, 1:200), guinea pig antirat {alpha}-subunit (NIDDK, 1:200), guinea pig antirat ß-LH (NIDDK, 1:200), guinea pig antirat prolactin (NIDDK, 1:200), rabbit antirat TSHß (NIDDK, 1:1000). Secondary antibodies included fluorescein thiocyanate-labeled antirabbit, Cy3-labeled antirabbit, Rhodamine-labeled antirabbit, and fluorescein thiocyanate-labeled antiguinea pig. When the Envision kit was used, secondary antibodies and chromagens were used according to manufacturer specification. For PTTG immunostaining, an antigen-retrieval step was performed before incubation with primary antibody. Slides were counterstained with 4',6-diamidino-2-phenylindole or hematoxylin to visualize nuclei.

RIA
Serum IGF-I was measured using the rat IGF-I RIA kit (DSL, Inc., Webster, TX). A solid-phase RIA for measurement of total testosterone (Coat-A-Count, Diagnostic Products Corp., Los Angeles, CA) in diethyl ether extracted serum samples. The DPC Coat-A-Count total T4 assay was also used. For GH measurements, a rat GH RIA was used as previously described (54). LH and FSH levels were assayed by the University of Virginia Center for Cellular and Molecular studies in Reproduction.

MRI
We used a clinical whole-body 1.5 Tesla MRI system (Siemens Visions, Madison, WI) to image the mouse pituitary. Procedures were performed during nonclinical hours between 2100 h and 0700 h, and equipment was disinfected before and after animal imaging. Animals were anesthetized with avertin and imaged using a small solenoidal receiver coil. We obtained T1-weighted spin echo images (repetition time, 400 msec; echo time, 14 msec; number of signal averages, 4; imaging time, 6 min, 53 sec; slice thickness, 1 mm; in-plane resolution, 195 µm) in the coronal and sagittal imaging planes. Pituitary volume was determined by multiplying pixel volume by the number of pixels within the pituitary gland as defined by a region of interest that was manually drawn on magnified sagittal images using the MRI system console.

Statistical Analysis
Because most comparisons were made between wild-type and transgenic littermates, an unpaired Student’s t test was used to determine statistical significances, which are determined at P < 0.05.


    ACKNOWLEDGMENTS
 
The authors thank Dr. Dan Haisenleder and Ms. Aleisha Schoenfelder for their assistance with RIAs through the Center for Cellular and Molecular Studies in Reproduction at the University of Virginia. We also thank Dr. Toni Prezant, Dr. Jonathan Said, and Ms. Liz Lantsey for their helpful expertise.


    FOOTNOTES
 
This work was supported by National Institutes of Health (NIH) Grant CA 075979 (to S.M.), the Yoshida Foundation, and the Janameg (to I.T.). The Center for Cellular and Molecular Studies in Reproduction at the University of Virginia was supported by NIH Grant U54-HD28–934.

First Published Online January 27, 2005

Abbreviations: EGFP, Enhanced green fluorescent protein; {alpha}GSU, {alpha}-subunit of glycoprotein hormone; MRI, magnetic resonance imaging; PTTG, pituitary tumor-transforming gene.

Received for publication October 11, 2004. Accepted for publication January 18, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Burgess R, Lunyak V, Rosenfeld M 2002 Signaling and transcriptional control of pituitary development. Curr Opin Genet Dev 12:534–539[CrossRef][Medline]
  2. Watkins-Chow DE, Camper SA 1998 How many homeobox genes does it take to make a pituitary gland? Trends Genet 14:284–290[CrossRef][Medline]
  3. Drouin J, Lamolet B, Lamonerie T, Lanctot C, Tremblay JJ 1998 The PTX family of homeodomain transcription factors during pituitary developments. Mol Cell Endocrinol 140:31–36[CrossRef][Medline]
  4. Alarid ET, Holley S, Hayakawa M, Mellon PL 1998 Discrete stages of anterior pituitary differentiation recapitulated in immortalized cell lines. Mol Cell Endocrinol 140:25–30[CrossRef][Medline]
  5. Melmed S 2003 Mechanisms for pituitary tumorigenesis: the plastic pituitary. J Clin Invest 112:1603–1618[CrossRef][Medline]
  6. Heaney AP, Melmed S 2004 Molecular targets in pituitary tumours. Nat Rev Cancer 4:285–295[CrossRef][Medline]
  7. Marx SJ, Agarwal SK, Kester MB, Heppner C, Kim YS, Skarulis MC, James LA, Goldsmith PK, Saggar SK, Park SY, Spiegel AM, Burns AL, Debelenko LV, Zhuang Z, Lubensky IA, Liotta LA, Emmert-Buck MR, Guru SC, Manickam P, Crabtree J, Erdos MR, Collins FS, Chandrasekharappa SC 1999 Multiple endocrine neoplasia type 1: clinical and genetic features of the hereditary endocrine neoplasias. Recent Prog Horm Res 54:397–438
  8. Spada A, Vallar L, Faglia G 1993 G-proteins and hormonal signalling in human pituitary tumors: genetic mutations and functional alterations. Front Neuroendocrinol 14:214–232[CrossRef][Medline]
  9. Stratakis CA, Matyakhina L, Courkoutsakis N, Patronas N, Voutetakis A, Stergiopoulos S, Bossis I, Carney JA 2004 Pathology and molecular genetics of the pituitary gland in patients with the ‘complex of spotty skin pigmentation, myxomas, endocrine overactivity and schwannomas’ (Carney complex). Front Horm Res 32:253–264[Medline]
  10. Franklin DS, Godfrey VL, Lee H, Kovalev GI, Schoonhoven R, Chen-Kiang S, Su L, Xiong Y 1998 CDK inhibitors p18(INK4c) and p27(Kip1) mediate two separate pathways to collaboratively suppress pituitary tumorigenesis. Genes Dev 12:2899–2911[Abstract/Free Full Text]
  11. Park MS, Rosai J, Nguyen HT, Capodieci P, Cordon-Cardo C, Koff A 1999 p27 and Rb are on overlapping pathways suppressing tumorigenesis in mice. Proc Natl Acad Sci USA 96:6382–6387[Abstract/Free Full Text]
  12. Yamasaki L, Bronson R, Williams BO, Dyson NJ, Harlow E, Jacks T 1998 Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/–)mice. Nat Genet 18:360–364[CrossRef][Medline]
  13. Pei L, Melmed S 1997 Isolation and characterization of a pituitary tumor-transforming gene (PTTG). Mol Endocrinol 11:433–441[Abstract/Free Full Text]
  14. McCabe CJ, Khaira JS, Boelaert K, Heaney AP, Tannahill LA, Hussain S, Mitchell R, Olliff J, Sheppard MC, Franklyn JA, Gittoes NJ 2003 Expression of pituitary tumour transforming gene (PTTG) and fibroblast growth factor-2 (FGF-2) in human pituitary adenomas: relationships to clinical tumour behaviour. Clin Endocrinol (Oxf) 58:141–150[CrossRef][Medline]
  15. Saez C, Pereda T, Borrero JJ, Espina A, Romero F, Tortolero M, Pintor-Toro JA, Segura DI, Japon MA 2002 Expression of hpttg proto-oncogene in lymphoid neoplasias. Oncogene 21:8173–8177[CrossRef][Medline]
  16. Shibata Y, Haruki N, Kuwabara Y, Nishiwaki T, Kato J, Shinoda N, Sato A, Kimura M, Koyama H, Toyama T, Ishiguro H, Kudo J, Terashita Y, Konishi S, Fujii Y 2002 Expression of PTTG (pituitary tumor transforming gene) in esophageal cancer. Jpn J Clin Oncol 32:233–237[Abstract/Free Full Text]
  17. Saez C, Japon MA, Ramos-Morales F, Romero F, Segura DI, Tortolero M, Pintor-Toro JA 1999 hpttg Is over-expressed in pituitary adenomas and other primary epithelial neoplasias. Oncogene 18:5473–5476[CrossRef][Medline]
  18. Dominguez A, Ramos-Morales F, Romero F, Rios RM, Dreyfus F, Tortolero M, Pintor-Toro JA 1998 hpttg, A human homologue of rat pttg, is overexpressed in hematopoietic neoplasms. Evidence for a transcriptional activation function of hPTTG. Oncogene 17:2187–2193[CrossRef][Medline]
  19. Yu R, Melmed S 2004 Pituitary tumor transforming gene: an update. Front Horm Res 32:175–185[Medline]
  20. Heaney AP, Horwitz GA, Wang Z, Singson R, Melmed S 1999 Early involvement of estrogen-induced pituitary tumor transforming gene and fibroblast growth factor expression in prolactinoma pathogenesis. Nat Med 5:1317–1321[CrossRef][Medline]
  21. Wang Z, Yu R, Melmed S 2001 Mice lacking pituitary tumor transforming gene show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, and premature centromere division. Mol Endocrinol 15:1870–1879[Abstract/Free Full Text]
  22. Wang Z, Moro E, Kovacs K, Yu R, Melmed S 2003 Pituitary tumor transforming gene-null male mice exhibit impaired pancreatic ß cell proliferation and diabetes. Proc Natl Acad Sci USA 100:3428–3432[Abstract/Free Full Text]
  23. Orr-Weaver TL 1999 Perspectives: cell cycle. The difficulty in separating sisters. Science 285:344–345
  24. Yu R, Lu W, Chen J, McCabe CJ, Melmed S 2003 Overexpressed pituitary tumor-transforming gene causes aneuploidy in live human cells. Endocrinology 144:4991–4998[Abstract/Free Full Text]
  25. Zou H, McGarry TJ, Bernal T, Kirschner MW 1999 Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science 285:418–422[Abstract/Free Full Text]
  26. Waizenegger I, Gimenez-Abian JF, Wernic D, Peters JM 2002 Regulation of human separase by securin binding and autocleavage. Curr Biol 12:1368–1378[CrossRef][Medline]
  27. Ramaswamy S, Ross KN, Lander ES, Golub TR 2003 A molecular signature of metastasis in primary solid tumors. Nat Genet 33:49–54[CrossRef][Medline]
  28. Horwitz GA, Miklovsky I, Heaney AP, Ren SG, Melmed S 2003 Human pituitary tumor-transforming gene (PTTG1) motif suppresses prolactin expression. Mol Endocrinol 17:600–609[Abstract/Free Full Text]
  29. Chesnokova V, Castro A-V, Kovacs K, Melmed S, Pttg is required for pituitary tumor development in Rb-deficient mice. Program of the 86th Annual Meeting of The Endocrine Society, New Orleans, LA, 2004, p 127 (Abstract OR37-2)
  30. Pulichino AM, Vallette-Kasic S, Couture C, Gauthier Y, Brue T, David M, Malpuech G, Deal C, Van Vliet G, De Vroede M, Riepe FG, Partsch CJ, Sippell WG, Berberoglu M, Atasay B, Drouin J 2003 Human and mouse TPIT gene mutations cause early onset pituitary ACTH deficiency. Genes Dev 17:711–716[Abstract/Free Full Text]
  31. Bakke M, Zhao L, Parker KL 2001 Approaches to define the role of SF-1 at different levels of the hypothalamic-pituitary-steroidogenic organ axis. Mol Cell Endocrinol 179:33–37[CrossRef][Medline]
  32. Kendall SK, Gordon DF, Birkmeier TS, Petrey D, Sarapura VD, O’Shea KS, Wood WM, Lloyd RV, Ridgway EC, Camper SA 1994 Enhancer-mediated high level expression of mouse pituitary glycoprotein hormone {alpha}-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol Endocrinol 8:1420–1433[Abstract/Free Full Text]
  33. Wenig B, Heffess C, Adair C 1997 Atlas of endocrine pathology. 1st ed. Philadelphia: W.B. Saunders Co.
  34. Asa SL 1998 Atlas of tumor pathology: tumors of the pituitary. 3rd series ed. Washington, DC: Armed Forces Institute of Pathology
  35. Matzuk MM, DeMayo FJ, Hadsell LA, Kumar TR 2003 Overexpression of human chorionic gonadotropin causes multiple reproductive defects in transgenic mice. Biol Reprod 69:338–346[Abstract/Free Full Text]
  36. Rulli SB, Ahtiainen P, Makela S, Toppari J, Poutanen M, Huhtaniemi I 2003 Elevated steroidogenesis, defective reproductive organs, and infertility in transgenic male mice overexpressing human chorionic gonadotropin. Endocrinology 144:4980–4990[Abstract/Free Full Text]
  37. Cushman LJ, Burrows HL, Seasholtz AF, Lewandoski M, Muzyczka N, Camper SA 2000 Cre-mediated recombination in the pituitary gland. Genesis 28:167–174[CrossRef][Medline]
  38. Seuntjens E, Hauspie A, Vankelecom H, Denef C 2002 Ontogeny of plurihormonal cells in the anterior pituitary of the mouse, as studied by means of hormone mRNA detection in single cells. J Neuroendocrinol 14:611–619[CrossRef][Medline]
  39. White MC, Newland P, Daniels M, Turner SJ, Mathias D, Teasdale G, Kendall-Taylor P 1986 Growth hormone secreting pituitary adenomas are heterogeneous in cell culture and commonly secrete glycoprotein hormone {alpha}-subunit. Clin Endocrinol (Oxf) 25:173–179[Medline]
  40. Oppenheim DS, Kana AR, Sangha JS, Klibanski A 1990 Prevalence of {alpha}-subunit hypersecretion in patients with pituitary tumors: clinically nonfunctioning and somatotroph adenomas. J Clin Endocrinol Metab 70:859–864[Abstract/Free Full Text]
  41. Shimon I, Nass D, Gross DJ 2001 Pituitary macroadenoma secreting thyrotropin and growth hormone: remission of bihormonal hypersecretion in response to lanreotide therapy. Pituitary 4:265–269[CrossRef][Medline]
  42. Mohammad HP, Abbud RA, Parlow AF, Lewin JS, Nilson JH 2003 Targeted overexpression of luteinizing hormone causes ovary-dependent functional adenomas restricted to cells of the Pit-1 lineage. Endocrinology 144:4626–4636[Abstract/Free Full Text]
  43. Abbud RA, Ameduri RK, Rao JS, Nett TM, Nilson JH 1999 Chronic hypersecretion of luteinizing hormone in transgenic mice selectively alters responsiveness of the {alpha}-subunit gene to gonadotropin-releasing hormone and estrogens. Mol Endocrinol 13:1449–1459[Abstract/Free Full Text]
  44. Santos AF, Huang H, Tindall DJ 2004 The androgen receptor: a potential target for therapy of prostate cancer. Steroids 69:79–85[CrossRef][Medline]
  45. Oliver SE, Barrass B, Gunnell DJ, Donovan JL, Peters TJ, Persad RA, Gillatt D, Neal DE, Hamdy FC, Holly JM 2004 Serum insulin-like growth factor-I is positively associated with serum prostate-specific antigen in middle-aged men without evidence of prostate cancer. Cancer Epidemiol Biomarkers Prev 13:163–165[Abstract/Free Full Text]
  46. Konno-Takahashi N, Takeuchi T, Shimizu T, Nishimatsu H, Fukuhara H, Kamijo T, Moriyama N, Tejima S, Kitamura T 2003 Engineered IGF-I expression induces glandular enlargement in the murine prostate. J Endocrinol 177:389–398[Abstract]
  47. Cohen P, Clemmons DR, Rosenfeld RG 2000 Does the GH-IGF axis play a role in cancer pathogenesis? Growth Horm IGF Res 10:297–305[CrossRef][Medline]
  48. DiGiovanni J, Kiguchi K, Frijhoff A, Wilker E, Bol DK, Beltran L, Moats S, Ramirez A, Jorcano J, Conti C 2000 Deregulated expression of insulin-like growth factor 1 in prostate epithelium leads to neoplasia in transgenic mice. Proc Natl Acad Sci USA 97:3455–3460[Abstract/Free Full Text]
  49. Ruan W, Powell-Braxton L, Kopchick JJ, Kleinberg DL 1999 Evidence that insulin-like growth factor I and growth hormone are required for prostate gland development. Endocrinology 140:1984–1989[Abstract/Free Full Text]
  50. Romero F, Gil-Bernabe AM, Saez C, Japon MA, Pintor-Toro JA, Tortolero M 2004 Securin is a target of the UV response pathway in mammalian cells. Mol Cell Biol 24:2720–2733[Abstract/Free Full Text]
  51. Hamid T, Kakar SS 2004 PTTG/securin activates expression of p53 and modulates its function. Mol Cancer 3:18[CrossRef][Medline]
  52. Bernal JA, Luna R, Espina A, Lazaro I, Ramos-Morales F, Romero F, Arias C, Silva A, Tortolero M, Pintor-Toro JA 2002 Human securin interacts with p53 and modulates p53-mediated transcriptional activity and apoptosis. Nat Genet 32:306–311[CrossRef][Medline]
  53. Wang Z, Melmed S 2000 Pituitary tumor transforming gene (PTTG) transforming and transactivation activity. J Biol Chem 275:7459–7461[Abstract/Free Full Text]
  54. Ren SG, Kim S, Taylor J, Dong J, Moreau JP, Culler MD, Melmed S 2003 Suppression of rat and human growth hormone and prolactin secretion by a novel somatostatin/dopaminergic chimeric ligand. J Clin Endocrinol Metab 88:5414–5421[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Chesnokova, S. Zonis, K. Kovacs, A. Ben-Shlomo, K. Wawrowsky, S. Bannykh, and S. Melmed
p21Cip1 restrains pituitary tumor growth
PNAS, November 11, 2008; 105(45): 17498 - 17503.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
F. Salehi, K. Kovacs, B. W Scheithauer, R. V Lloyd, and M. Cusimano
Pituitary tumor-transforming gene in endocrine and other neoplasms: a review and update
Endocr. Relat. Cancer, September 1, 2008; 15(3): 721 - 743.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Chesnokova, S. Zonis, T. Rubinek, R. Yu, A. Ben-Shlomo, K. Kovacs, K. Wawrowsky, and S. Melmed
Senescence Mediates Pituitary Hypoplasia and Restrains Pituitary Tumor Growth
Cancer Res., November 1, 2007; 67(21): 10564 - 10572.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. M El-Naggar, M. T Malik, A. Martin, J. P Moore, M. Proctor, T. Hamid, and S. S Kakar
Development of cystic glandular hyperplasia of the endometrium in Mullerian inhibitory substance type II receptor-pituitary tumor transforming gene transgenic mice
J. Endocrinol., July 1, 2007; 194(1): 179 - 191.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C. S. Kim, H. Ying, M. C. Willingham, and S.-y. Cheng
The pituitary tumor-transforming gene promotes angiogenesis in a mouse model of follicular thyroid cancer
Carcinogenesis, May 1, 2007; 28(5): 932 - 939.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
G. Vlotides, T. Eigler, and S. Melmed
Pituitary Tumor-Transforming Gene: Physiology and Implications for Tumorigenesis
Endocr. Rev., April 1, 2007; 28(2): 165 - 186.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. Yu, M. Cruz-Soto, S. L. Calzi, H. Hui, and S. Melmed
Murine pituitary tumor-transforming gene functions as a securin protein in insulin-secreting cells.
J. Endocrinol., October 1, 2006; 191(1): 45 - 53.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. Donangelo, S. Gutman, E. Horvath, K. Kovacs, K. Wawrowsky, M. Mount, and S. Melmed
Pituitary Tumor Transforming Gene Overexpression Facilitates Pituitary Tumor Development
Endocrinology, October 1, 2006; 147(10): 4781 - 4791.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
W E Farrell
Pituitary tumours: findings from whole genome analyses.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 707 - 716.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. P. Gillam, M. E. Molitch, G. Lombardi, and A. Colao
Advances in the Treatment of Prolactinomas
Endocr. Rev., August 1, 2006; 27(5): 485 - 534.
[Abstract] [Full Text] [PDF]


Home page
Clin Med ResHome page
J. Tfelt-Hansen, D. Kanuparthi, and N. Chattopadhyay
The emerging role of pituitary tumor transforming gene in tumorigenesis.
Clin. Med. Res., June 1, 2006; 4(2): 130 - 137.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
G. M. Pierantoni, P. Finelli, E. Valtorta, D. Giardino, O. Rodeschini, F. Esposito, M. Losa, A. Fusco, and L. Larizza
High-mobility group A2 gene expression is frequently induced in non-functioning pituitary adenomas (NFPAs), even in the absence of chromosome 12 polysomy
Endocr. Relat. Cancer, December 1, 2005; 12(4): 867 - 874.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Chesnokova, K. Kovacs, A.-V. Castro, S. Zonis, and S. Melmed
Pituitary Hypoplasia in Pttg-/- Mice Is Protective for Rb+/- Pituitary Tumorigenesis
Mol. Endocrinol., September 1, 2005; 19(9): 2371 - 2379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbud, R. A.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbud, R. A.
Right arrow Articles by Melmed, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals