help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2004-0381
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data Files
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monroe, D. G.
Right arrow Articles by Spelsberg, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monroe, D. G.
Right arrow Articles by Spelsberg, T. C.
Molecular Endocrinology 19 (6): 1555-1568
Copyright © 2005 by The Endocrine Society

Estrogen Receptor {alpha} and ß Heterodimers Exert Unique Effects on Estrogen- and Tamoxifen-Dependent Gene Expression in Human U2OS Osteosarcoma Cells

David G. Monroe, Frank J. Secreto, Malayannan Subramaniam, Barbara J. Getz, Sundeep Khosla and Thomas C. Spelsberg

Department of Biochemistry and Molecular Biology (D.G.M., F.J.S., M.S., B.J.G., T.C.S.), and Endocrine Research Unit (S.K.), Mayo Clinic College of Medicine, Rochester, Minnesota 55905

Address all correspondence and requests for reprints to: David G. Monroe, Ph.D., Department of Biochemistry and Molecular Biology, Mayo Clinic College of Medicine, 1601C Guggenheim, 200 1st Street Southwest, Rochester, Minnesota 55905. E-mail: Monroe.David{at}mayo.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The 17ß-estradiol (E2) receptor isoforms [estrogen receptor (ER) {alpha} and ERß] bind E2 and selective ER modulators (SERMs) as homodimers ({alpha}/{alpha} or ß/ß) or heterodimers ({alpha}/ß) to regulate gene expression. Although recent studies have shown that ER homodimers regulate unique sets of E2-responsive genes, little information exists regarding the transcriptional actions of the ER{alpha}/ß heterodimer. This paper describes the development of a U2OS human osteosarcoma (osteoblast) cell line stably expressing both ER{alpha} and ERß isoforms at a ratio of 1:4, a ratio reported to exist in normal, mature osteoblast cells derived from cancellous bone. The regulation of endogenous genes by E2 and 4-hydroxy-tamoxifen were measured in these cells using gene microarrays and real-time RT-PCR. Both E2 and 4-hydroxy-tamoxifen were shown to regulate unique sets of endogenous genes in the U2OS-ER{alpha}/ß heterodimer cell line (20% and 27% of total, respectively), compared with all the genes regulated in U2OS-ER homodimer cell lines. Furthermore, two novel E2-regulated genes, retinoblastoma binding protein 1 and 7-dehydrocholesterol reductase, were found to contain estrogen response element-like sequences that directly bind the ER{alpha}/ß heterodimer. These results suggest that the expression of both ER isoforms, forming functional ER{alpha} heterodimers, result in unique patterns of gene regulation, many of which are distinct from the genes regulated by the ER homodimers.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE PHYSIOLOGICAL effects of estrogens (e.g. 17ß-estradiol or E2) and SERMS [selective estrogen receptor (ER) modulators] are largely mediated by two different, but related, ER isoforms termed ER{alpha} and ERß (1, 2, 3, 4, 5, 6, 7). Both ER isoforms belong to a diverse group of transcription factors, termed nuclear hormone receptors, which share several functional and structural domains. These domains include a highly variable N-terminal transactivation function (AF-1) (8, 9, 10, 11), a centrally located DNA binding domain comprised of two zinc finger motifs, and a C-terminally located ligand binding domain (LBD) involved in ligand binding, dimerization and transactivation (AF-2). The DNA binding domain is highly conserved at the amino acid level between the ER isoforms (97%), whereas the LBD shows a lesser conservation (55%). Although ER{alpha} and ERß bind E2 with similar affinities (12), differences exist in SERM binding affinities that are important in mediating the tissue- and cell-type specificities of SERMs such as 4-hydroxy-tamoxifen (4HT) and genistein (13, 14, 15, 16).

After ligand binding, either homo- or heterodimerization occurs between ER{alpha} and/or ERß (17, 18). These ER dimers modulate gene expression through binding to estrogen-responsive DNA elements in the control regions of estrogen (or SERM) target genes. Both ER{alpha} and ERß homodimers bind to and induce transcriptional activation through classical estrogen response elements (EREs). However, differences in transactivation potential exist between the ER isoform homodimers at activator protein (AP)-1 (fos/jun) elements when bound to SERMs such as 4HT (19). Although the ER{alpha}/ß heterodimer can bind a classical ERE (17, 18), binding of ER{alpha}/ß to other estrogen-responsive DNA elements in the presence of either E2 or SERMs, as well as the transcriptional consequences of such binding are currently unknown.

Activation of transcription is achieved through the recruitment of specific transcriptional coregulators (coactivators and corepressors), which perform multiple functions including chromatin remodeling and recruitment of the basal transcriptional machinery (20, 21, 22, 23, 24). Previous studies have indicated that one molecule of steroid receptor coactivator 1, the founding member of the steroid receptor coactivator/p160 family of transcriptional coactivators, binds to the ER dimer and aids in the activation of transcription (25, 26, 27). Therefore, differences in the ER{alpha} or ERß/coactivator interfaces could potentially lead to large differences in the patterns of gene expression induced by the ER-isoform homodimers. Indeed, recent data from our laboratory (28), and supported by others (29, 30), have demonstrated that stable expression of either ER{alpha} or ERß, in a U2OS osteosarcoma model system, display unique patterns of gene regulation when treated with E2. Specifically, only approximately 20% of those genes regulated through either ER isoform are similarly regulated through the other ER isoform, demonstrating that large and significant differences exist between the ER isoforms in their regulation of specific genes. However, because one ER isoform is expressed in each of these cell lines, the effects of only the ER homodimers could be assessed.

The novel coactivator interaction surface of the ER{alpha} heterodimer suggests that ER{alpha}/ß may cause even more complex patterns of endogenous gene expression not observed by either ER isoform homodimer alone. However, no published reports exist that address this question. It is known that when ER{alpha} and ERß are coexpressed, ER{alpha}/ß heterodimers are formed (17, 18). Furthermore, the kinetics of ER{alpha} heterodimerization and the recruitment of coactivators by the ER{alpha}/ß heterodimer have been studied in vitro (31, 32). Past studies by Li et al. (33), using a transiently transfected ER{alpha}/ERß fusion construct, have demonstrated that ER{alpha} is the dominant partner of the ER{alpha}/ß heterodimer functioning on a variety of synthetic reporter constructs. Currently, no information exists concerning endogenous ER{alpha}/ß target genes, or whether the ER{alpha}/ß heterodimer can regulate endogenous gene expression in a novel manner. Because cancellous bone osteoblasts contain both ER{alpha} and ERß (34, 35, 36), we felt it worthwhile to examine the actions of the ER{alpha} heterodimer on the pattern of gene expression in a human osteosarcoma cell line.

To properly examine endogenous gene expression elicited through the ER{alpha}/ß heterodimer, we have developed a unique cell model system based on our previous U2OS-ER cell lines (28). This line expresses both ER{alpha} and ERß, forms heterodimers in vivo and is termed U2OS-ER{alpha}/ß. Microarray analysis demonstrates the regulation of specific endogenous gene expression patterns by E2 and 4HT through the ER{alpha}/ß heterodimer, compared with patterns generated by the U2OS-ER{alpha} or -ERß cell lines (28). This report supports the hypothesis that the ER isoform species have unique functions and play significant roles in the genetic and cellular response to E2 or 4HT in target cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Production and Characterization of the U2OS-ER{alpha}/ß Heterodimer Cell Line
This laboratory has previously described the production and gene expression profiles of U2OS osteoblastic cell lines stably expressing FLAG-epitope tagged ER{alpha} and ERß under the control of the T-Rex System (Invitrogen, Carlsbad, CA) (28). These cell lines, termed U2OS-ER{alpha} and U2OS-ERß, respectively, form functional homodimers and affect gene expression in a unique manner. To investigate whether or not the ER{alpha}/ß heterodimer regulates unique endogenous gene expression, a suitable cell model expressing both ER{alpha} and ERß was needed. To produce this cell line, the existing U2OS-ERß cell line was stably transfected with an ER{alpha} expression plasmid and individual cell clones were screened for ER expression (see Materials and Methods for details). As seen in Fig. 1AGo, a single clone termed U2OS-ER{alpha}/ß was identified that expresses ER{alpha} and ERß in approximately a 1:4 ratio, which is reportedly the ratio found in mature osteoblasts (OBs) derived from cancellous bone (34, 35, 36).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Expression of ER{alpha} and ERß and Heterodimer Formation in the U2OS-ER{alpha}/ß Heterodimer Cell Line

A, U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cells were treated with 100 ng/ml Dox for 24 h and harvested. Equal amounts of protein extract were subjected to Western blot analysis using the {alpha}-FLAG-M2 Ab (Sigma) and visualized using enhanced chemiluminescence. The ER{alpha} and ERß proteins are observed at the expected sizes of 66 and 54 kDa. B, The U2OS-ER{alpha}/ß cell line was treated with 100 ng/ml Dox for 24 h and total protein extract was prepared. Five hundred micrograms of nuclear extract were immunoprecipitated overnight using an ER{alpha}-specific polyclonal Ab. After extensive washing, the precipitated protein was subjected to Western blot analysis using the {alpha}-FLAG-M2 Ab. C, The U2OS-ER{alpha}/ß cell line was pretreated in triplicate with 100 ng/ml Dox for 24 h, followed by treatment with either vehicle control (C), E2 (10–8 or 10–9) or the ER{alpha}-specific agonist PPT (10–8 or 10–9) for an additional 24 h. The cells were harvested, total RNA prepared, and real-time RT-PCR performed using oligonucleotide primers specific for ß-actin and vWF. Data are expressed as the mean ± SE. Asterisks denote significance at the P < 0.001 level (ANOVA) compared with control treatment.

 
To assess whether ER{alpha}/ß heterodimers form in the U2OS-ER{alpha} cell line, the ER{alpha} protein was immunoprecipitated using a polyclonal antibody (Ab) followed by Western blot analysis using a FLAG-specific Ab. Because both ER isoforms contain an N-terminal FLAG epitope (37), the stoichiometry of ER{alpha} and ERß proteins can be determined after ER{alpha} immunoprecipitation. As seen in Fig. 1BGo, ERß coimmunoprecipitates with ER{alpha} at a 1:1 ratio, thereby indicating that ER{alpha}/ß heterodimers form in the U2OS-ER{alpha}/ß cell line. To verify that these ER{alpha} heterodimers are transcriptionally active, the U2OS-ER{alpha} cell line was treated with either E2 or the ER{alpha}-specific agonist 4,4',4'-(4-propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT) (38). Using the previously described ER{alpha}-specific gene, von Willebrand factor (vWF) as a model (28), we demonstrate that although E2 treatment results in a significant increase in vWF expression at both E2 concentrations tested, vWF fails to respond to the ER{alpha}-specific agonist, PPT, at either concentration (Fig. 1CGo). In parallel experiments, PPT is fully capable of inducing vWF expression in the U2OS-ER{alpha} cell line (data not shown). These results demonstrate that the ER{alpha}/ß heterodimer can function to induce vWF expression, which is induced by the ER{alpha} homodimer but not the ERß homodimer (28), and that no functional ER{alpha} homodimer exists in the U2OS-ER{alpha} cell line because PPT failed to active vWF expression. However, it is assumed that ERß homodimers exist in the U2OS-ER{alpha} cell line due to the overabundance of ERß over ER{alpha} (Fig. 1AGo).

To more completely characterize the binding of the ER{alpha} heterodimer in our U2OS model system, an EMSA was developed using a consensus ERE as a probe (GGTCA xxx TGACC). Figure 2Go demonstrates specific binding of ERs from U2OS-ER{alpha}, -ERß, and -ER{alpha}/ß extracts to the consensus ERE sequence (see lanes 2, 7, and 12, respectively; single asterisks). Experiments using cold competitor ERE (unlabeled) showed efficient competition with the each ER species (see lanes 3, 8, and 13), demonstrating sequence specificity of binding for the ER isoforms. Ab supershifts using ER{alpha}- and ERß-specific antibodies with U2OS-ER{alpha} and -ERß nuclear extracts, respectively, demonstrated bands consistent with the ER-ERE-Ab complexes (see lanes 4 and 10). To confirm that ER{alpha}/ß heterodimers form and can bind an ERE sequence in our U2OS system, we performed supershift assays with both ER{alpha} and ERß Abs, which demonstrated a positive supershift with each Ab (lanes 14 and 15). Because Fig. 1CGo proved that no ER{alpha} homodimers exist in the U2OS-ER{alpha} cell line, these data support that ER{alpha}/ß heterodimers form in this cell line and are capable of binding to a consensus ERE.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2. EMSA Analysis of the U2OS-ER Cell Lines

U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cells were treated with 100 ng/ml Dox for 24 h and nuclear extracts were prepared. Approximately 1 µg of U2OS-ER{alpha} and U2OS-ERß and 2.5 µg of U2OS-ER{alpha}/ß nuclear extract were subjected to EMSAs as described in Materials and Methods. Unlabeled double-stranded ERE competitor is labeled as NS-C, the single asterisk denotes the ER-ERE shift, and the double asterisk denotes the Ab supershift.

 
Microarray Analysis and Comparison of the U2OS-ER{alpha}/ß Line Treated with Either E2 or 4HT
Using an Affymetrix microarray containing approximately 6800 genes, we previously reported microarray analysis of the U2OS-ER{alpha} and U2OS-ERß homodimer cell lines (28). To properly analyze the gene expression profile of the U2OS-ER{alpha} cell line with a more encompassing microarray, gene expression profile analyses between the U2OS-ER{alpha} and -ERß cell lines needed to be reexamined. Thus, all three U2OS-ER cell lines were treated with either E2 or 4HT for 24 h and gene expression profiles were determined using the Affymetrix Human Genome Focus Array, which contains approximately 8500 genes. Microarray analysis was conducted using the GeneSpring 7 software package (Silicon Genetics, Redwood City, CA) and only those genes containing a present flag (P) in either the control and/or the steroid treatment, and those genes regulated greater than 2-fold (induced or inhibited relative to the control) were included in the analysis.

The E2 treatment of the U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha} cell lines resulted in the identification of 295, 162, and 296 genes that were modulated greater or less than 2-fold when compared with untreated cells (Table 1Go). A majority of these gene regulated genes (60%, 57%, and 56% in the ER{alpha}, ERß and ER{alpha} cell lines respectively) were up-regulated by E2. Treatment of the U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha} cell lines with 4HT resulted in regulation of 69, 62, and 69 genes greater or less than 2-fold compared with control. In contrast to E2 treatment, treatment with 4HT resulted in the down-regulation of the majority of genes (52%, and 74% in the U2OS-ER{alpha} and U2OS-ERß cell lines, respectively). However, 4HT treatment resulted in the down-regulation of only 42% in the U2OS-ER{alpha}/ß heterodimer line, suggesting that the ER heterodimer has unique transcriptional properties when bound to 4HT.


View this table:
[in this window]
[in a new window]
 
Table 1. Total Genes Regulated by E2 or 4HT in the U2OS-ER Lines

 
To identify target genes that display an ER homodimer vs. heterodimer preference, the gene expression profiles among the three U2OS-ER cell lines were compared using Venn diagrams for both E2 and 4HT treatment (Fig. 3Go). A majority of E2-regulated genes are regulated by ER{alpha} only (126 genes, 25% of the genes regulated). Comparison of the U2OS-ER{alpha} and -ERß microarray data alone resulted in an 18% and 33% overlap, respectively, closely resembling our previous data where we showed a 21% and 22% overlap, respectively (28). Interestingly, 102 genes (20% of the total) were regulated solely through the ER{alpha}/ß heterodimer using the 2-fold exclusion parameter, demonstrating that ER{alpha} regulates specific and unique sets of E2-dependent genes apart from those regulated through either ER homodimer (Fig. 3AGo and Table 2GoGo). Forty-two genes (27% of the total) were regulated solely through the ER{alpha}/ß heterodimer when treated with 4HT (Fig. 3BGo and Table 3Go). Fold changes on all the genes represented in Fig. 3Go are published as supplemental data files 1–3 on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. Comparison of Gene Expression Patterns in All U2OS-ER Cell Lines Treated with Either E2 or 4HT

U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cells were pretreated in duplicate with 100 ng/ml Dox for 24 h followed by treatment with either vehicle control (ethanol), 10 nM E2 (A), or 10 nM 4HT (B) for an additional 24 h. RNA was harvested and subjected to oligonucleotide microarray analysis. Venn diagrams comparing the gene expression patterns (≤ ≥ 2-fold of control) for all three U2OS-ER lines were created using the GeneSpring 7 Software package (Silicon Genetics). Each circle is labeled with the ER isoform, number of genes regulated by that particular intersection, and the percent of the total number of genes regulated by all three ER isoforms for that steroid treatment.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Genes Uniquely Regulated in the E2-Treated U2OS-ER{alpha}/ß Cell Line

 

View this table:
[in this window]
[in a new window]
 
Table 2A. Continued

 

View this table:
[in this window]
[in a new window]
 
Table 3. Genes Uniquely Regulated in the 4HT-treated U2OS-ER{alpha}/ß Cell Line

 
Comparisons of E2 and 4HT treatment were also examined from data within each U2OS-ER cell line to understand the relative contribution of each ligand to gene expression. Figure 4Go demonstrates that E2 alone regulates the majority of genes in each cell line (80%, 70%, and 80% in the ER{alpha}, ERß, and ER{alpha} cell lines, respectively). A small percentage of genes were regulated by both E2 and 4HT (7%, 7%, and 5% in the U2OS-ER{alpha}, -ERß, and -ER{alpha}/ß cell lines, respectively).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. Comparison of Gene Expression Patterns within Each U2OS-ER Cell Line Treated with Either E2 or 4HT

The data from Fig. 3Go were reanalyzed comparing the relative contribution of E2 or 4HT to gene expression within each U2OS-ER cell line. Pie graphs were generated for each cell line and are labeled with those genes only regulated by E2, 4HT, or both ligands.

 
To verify the validity of our microarray experimentation and analysis, we randomly selected genes from the U2OS-ER{alpha}/ß-specific gene list, as described in Tables 2GoGo and 3Go, and performed real-time RT-PCR. As seen in Fig. 5Go, all genes were significantly regulated by either E2 or 4HT in the U2OS-ER{alpha}/ß cell line, confirming and validating the results of the microarray analysis. Seventeen total genes were examined for ER{alpha}/ß-specific regulation in both the E2- and 4HT-treated cell lines using RT-PCR, and we observed that 15 genes confirmed our microarray analysis. This demonstrates that our microarray gene expression prediction rate is roughly 88% (15/17), well within accepted limits defined by the microarray literature (39).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Real-Time RT-PCR Confirmation of Select Genes Identified as ER{alpha}/ß-Specific by the Microarray Analysis

U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cells were pretreated in triplicate with 100 ng/ml Dox for 24 h followed by treatment with either vehicle control (open bars). A, 10 nM E2 (closed bars) or B, 10 nM 4HT (closed bars) for an additional 24 h. These samples are an independent experiment from those used for the microarray analysis. RNA was harvested and subjected to real-time RT-PCR analysis using primers specific for the genes listed. Each bar is represented as mRNA content relative to the ß-actin control and the ethanol control arbitrarily set at 1 for each cell line. The data are expressed as the mean ± the SE. Asterisks denote significance at the P < 0.01 level (ANOVA) compared with the ethanol control for each cell line. LOR, Loricrin; NOV, nephroblastoma overexpressed gene; CYP19, cytochrome p450, 19A1; PTX3, pentraxin; ACTC, actin, {alpha}, cardiac muscle; WDR8, WD-repeat protein 8; Bag-1, BCL2-associated athanogene; CACNA1D, calcium channel, voltage-dependent, L type, {alpha} 1D subunit.

 
Effects of E2 and 4HT on Cell Proliferation of the U2OS-ER Cell Lines
We have previously reported that E2 treatment results in a 40% decrease in proliferation in the U2OS-ER{alpha} cell line, whereas no significant effect was observed in the U2OS-ERß cell line (28). To determine the effect of E2 on the proliferation of the U2OS-ER{alpha}/ß cell line, and to determine the effect of 4HT on the proliferation of all three U2OS-ER cell lines, a cell proliferation assay was performed. As seen in Fig. 6Go, proliferation of the U2OS-ER{alpha}/ß cell line was inhibited a modest, but significant, 15% of control by E2 at the highest concentration tested (10–7 M), whereas the proliferation of the U2OS-ER{alpha} cell line was inhibited approximately 40%, as previously reported (28). There was no significant effect of E2 on the cell proliferation of the U2OS-ERß cell line. Treatment of all lines with either concentration of 4HT resulted in a marked and significant increase in proliferation. This suggests that the mechanism(s) for 4HT-dependent increases in cellular proliferation is not dependent on a particular ER-dimer isoform. It should be mentioned that this enhanced cell proliferation is dependent on some form of ER because cotreatment with ICI 182,780, a pure ER antagonist, reverses the increased proliferation.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. Cell Proliferation Analysis of the U2OS-ER Cell Lines Treated with Either E2 or 4HT

The U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cell lines were seeded in 96-well dishes and treated in triplicate with 100 ng/ml Dox and either vehicle control (EtOH), E2 (10–8 or 10–7), 4HT (10–8 or 10–7), or ICI 182,780 (10–7) for 72 h. The cell proliferation assay was performed as described in Materials and Methods. The data are represented as the proliferation relative to the ethanol control (arbitrarily set at 100%) and expressed as the mean ± the SE. Asterisks denote significance at the P < 0.01 level (ANOVA) compared with the ethanol control for each cell line. The experiment was repeated twice, and a representative experiment is shown.

 
Binding of the ER{alpha}/ß Heterodimer to Endogenous Gene Targets
We have previously demonstrated that the ER{alpha}/ß heterodimer binds to a consensus ERE in EMSA experiments (Fig. 2Go). To verify that the ER{alpha}/ß heterodimer binds to endogenously regulated genes in our U2OS model system, a chromatin immunoprecipitation (ChIP) assay was developed. The genomic sequences of selected genes regulated by E2 in the U2OS-ER{alpha}/ß cell line were scanned for potential ERE-like sequences. As depicted in Fig. 7AGo, an ERE-like sequence was found in intron 1 at nucleotide +899 (relative to the transcription start site) of the retinoblastoma binding protein 1 (RBBP1) gene, which is a 9/10 nucleotide match with the consensus ERE (GGTCA xxx TGACC). Similarly, another ERE-like sequence was found upstream of the 7-dehydrocholesterol reductase (DHCR7) gene at nucleotide –676 (relative to the transcription start site), which is a 8/10 match with the consensus ERE (Fig. 7AGo). We next determined whether the ER{alpha} heterodimer binds these ERE-like sequences using ChIP analysis. Using an ER{alpha}-specific Ab, both ERE-like sequences in the RBBP1 and DHCR7 genes are bound by ER{alpha} in an E2-dependent manner (Fig. 7BGo). In similar ChIP analyses, using an ERß-specific Ab, both ERE-like sequences bind ERß in an E2-dependent manner. To verify that the ER dimers bound at these elements are indeed the ER{alpha}/ß heterodimer, Re-ChIP experiments were conducted where the ER{alpha} immunoprecipitate was reimmunoprecipitated with the ERß Ab (or vice versa). The presence of a band in the Re-ChIP lanes (Fig. 7BGo) clearly indicates that ER{alpha} and ERß occupy the RBBP1 and DHCR7 EREs at the same time, demonstrating that the ER{alpha}/ß heterodimer is bound to these sites.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7. ChIP Analysis of the U2OS-ER{alpha}/ß Cell Line

A, Schematic diagrams of the RBBP1 and DHCR7 EREs are shown with arrows and numbers denoting primer locations relative to the transcription start site (+1) based on the published sequences. The sequence of the ERE is indicated with those nucleotides conforming to the consensus ERE is uppercase and those nucleotides not conforming in lower case. The lowercase xxx denotes the three-nucleotide spacer in the ERE. B, ChIP assays were performed in the U2OS-ER{alpha}/ß cell line using antibodies specific for either ER{alpha} or ERß in the presence (+) or absence (–) of 10 nM E2. Re-ChIP assays were performed by diluting the original ChIP (+ E2) 20-fold with ChIP dilution buffer and reperforming the assay with the Ab against the other ER isoform. Non-Spec were used as a control for the ChIP procedure.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The difficulty in exploring the importance of the ER{alpha} heterodimer has been in large part due to the lack of suitable model systems expressing both ER isoforms, resulting in ER{alpha} heterodimer formation. In the present study, we demonstrate not only that ER{alpha}/ß heterodimers form in our new U2OS-ER{alpha} cell line, but also that they can regulate ligand-dependent gene expression of genes not regulated by either ER{alpha} or ERß homodimers. These findings are significant because it suggests that not only the ER homodimers, but also the ER{alpha} heterodimer, have distinct transcriptional roles in cells expressing both ER isoforms.

The U2OS-ER{alpha}/ß model system was developed in an initial effort to understand the contribution of the ER{alpha} heterodimers to endogenous, steroid-dependent gene expression. We demonstrate that no functional ER{alpha} homodimer exists in the U2OS-ER{alpha}/ß cell line because induction of an ER{alpha}-specific gene, vWF, was not observed. However, significant amounts of ERß homodimer form in this cell line. We can specifically identify those genes regulated by the ER{alpha}/ß heterodimer by comparing the gene expression profiles between the U2OS-ERß and U2OS-ER{alpha}/ß cell lines. Those genes regulated in the U2OS-ER{alpha}/ß cell line, but not in the U2OS-ERß cell line, should therefore be assigned to the ER{alpha} heterodimer.

Using this technique, we identified 102 and 42 genes uniquely regulated by the ER{alpha}/ß heterodimer by E2 and 4HT treatment, respectively, which are not regulated by either ER homodimer. This observation was unexpected because earlier reports from our laboratory (37) and others (40) suggested that ERß simply modulates, or is redundant to ER{alpha} function, possibly acting through ER{alpha}/ß heterodimer formation. Our data indeed support these findings because a significant overlap of 116 genes in the gene expression profiles of U2OS-ER{alpha} and the U2OS-ER{alpha} cell line was observed with E2 treatment. Within this gene list exist examples of genes whose E2-dependent activity is enhanced, attenuated, or similar to, the ER{alpha}/ß heterodimer cell line (data not shown). Therefore, the activity of the ER{alpha} heterodimer compared with the ER{alpha} homodimer on these genes does not follow a strict rule (e.g. all genes either attenuated or enhanced) and is probably dependent on the specific promoter elements that exists in each gene. Our data, however, extend these findings to demonstrate that the ER{alpha}/ß heterodimer has a broader role, regulating its own subset of genes in addition to its modulatory role. The mechanisms underlying each of these roles are currently unknown and may involve the type of estrogen-responsive DNA element present in the promoter region(s) of these responsive genes.

A few laboratories have investigated the formation and function of the ER{alpha}/ß heterodimer. Cowley et al. (17) and Pace et al. (18) initially showed that transient coexpression of ER{alpha} and ERß leads to heterodimer formation and binds to a synthetic ERE in vitro. We have shown in OBs (37), and others in human kidney 293 cells (41), that transient coexpression of ER{alpha} and ERß activates transcription of an ERE-reporter construct; however, the reporter gene activity is attenuated when compared with either ER isoform alone. Hall and McDonnell (40) demonstrated that ER{alpha}/ß heterodimers have the potential to form in vivo. However, in these studies the contribution of ER{alpha} homodimers cannot be distinguished from the activity of ER{alpha}/ß heterodimers. To circumvent this problem, Li et al. (33) developed a single chain ER{alpha}/ß heterodimer construct using a genetic fusion strategy. Because ER{alpha} and ERß sequences are present on the same polypeptide chain, this approach was designed to ensure that only ER{alpha}/ß heterodimer formation occurs, with no contaminating homodimer formation. Transient coexpression of this construct with an ERE-reporter gene construct results in a similar pattern of reporter gene activation with E2 treatment as seen with ER{alpha} homodimers. One concern with the single chain ER dimers is the potential lack of native confirmations, which may affect coregulator binding and ultimately gene regulation. The current study takes a further step as it is first to examine endogenous gene expression patterns of the ER{alpha}/ß heterodimer in the presence of E2 or 4HT, and the first to demonstrate ER{alpha}/ß-specific endogenous gene regulation.

The current study also demonstrates fundamental differences between E2 and 4HT in the transcriptional targeting of each ER dimer on endogenous gene expression. Upon ligand binding, a conformational change occurs in the LBD of the receptor dimer, specifically a rearrangement of helix 12 that allows association with steroid receptor coactivators (42). Examination of the structures of E2- and 4HT-bound ERs, demonstrate that these ligands induce differing conformations of helix 12, thereby creating slight alterations in the ER-LBD/coactivator interface (43, 44, 45). This results in differential effects of these ligands on transcriptional activation through alterations in coregulator binding (22, 46, 47, 48, 49). Our data verify this hypothesis because the data demonstrate that little overlap occurs between the E2- and 4HT-regulated gene lists in all three U2OS-ER cell lines (7%, 7%, and 5% for the U2OS-ER{alpha}, -ERß-, and -ER{alpha}/ß cell lines, respectively). Our data further demonstrate that the unique conformations adopted by differential ligand binding have differing global transcriptional effects on E2 and 4HT signaling, acting through each of the ER dimers. Continuing studies are needed to further characterize the exact nature of the coregulator complexes involved in mediating differential ER responses.

It is interesting to note that a component of the AP-1 transcriptional complex, specifically JunB, is induced by 4HT in the U2OS-ER{alpha} cell line. The AP-1 complex is a class of transcription factors that are composed of either homo- or heterodimers between members of the Jun and Fos families (50). It has been shown that 4HT-bound ERß can activate via AP-1 sites to a greater extent than E2 (19). Our data suggest that the ER{alpha}/ß heterodimer induces components of the AP-1 complex, possibly sensitizing the cells to 4HT-dependent transcriptional regulation through ERß, which may be one important physiological function of the ER{alpha}/ß heterodimer. Whether this up-regulation of AP-1 affects downstream ER{alpha}/ß signaling is unknown and will depend on characterization of select ER{alpha}/ß-specific, 4HT-regulated promoters using ChIP. Further studies are needed to examine the role of AP-1 complexes in 4HT-dependent signaling in OBs.

The role of the ER{alpha}/ß heterodimer may be of physiological significance in OBs, where the ratio of ER{alpha} to ERß changes throughout OB differentiation (34, 35, 36). Early in OB differentiation, ER{alpha} expression dominates, whereas ERß dominates later in differentiation. During this process, ER{alpha} heterodimers certainly exist and our data suggest that this may have important and unique consequences for the OB cells because ER{alpha}/ß can modulate specific gene expression patterns. It is therefore not surprising that all three ER dimer combinations (ER{alpha}, ERß homodimers, and ER{alpha} heterodimers) can regulate unique sets of genes in Obs because these differences may be of physiological importance during OB differentiation.

In conclusion, the current study presents novel data supporting the notion that ER{alpha}/ß heterodimers can uniquely regulate endogenous gene expression when bound with either E2 or 4HT in OBs. The identification of the promoters of these ER{alpha}/ß-specific genes will allow further characterization of the coregulatory molecules involved and may uncover a unique transcriptional paradigm specific for the ER{alpha}/ß heterodimer.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Chemicals
The human U2OS-ER{alpha} and U2OS-ERß cell lines, described previously (28), were cultured in phenol red-free DMEM/F12 media containing 10% (vol/vol) fetal bovine serum (FBS), 1x antibiotic/antimycotic (Invitrogen), 5 mg/liter blasticidin S (Roche Diagnostics Corp., Indianapolis, IN) and 500 mg/liter zeocin (Invitrogen). The U2OS-ER{alpha}/ß cell line, described in the text, was cultured in the same media supplemented with 100 mg/liter hygromycin B (Invitrogen). Steroid treatments were performed in charcoal-stripped FBS (CS-FBS)-containing DMEM/F12 media (Hyclone Laboratories, Logan, UT). The pure ER antagonist ICI 182,780 was generously provided by Zeneca Pharmaceuticals (Macclesfield, Cheshire, UK). The E2, 4HT and doxycycline (Dox) were purchased from Sigma (St. Louis, MO). The ER{alpha}-specific agonist, PPT, was purchased from Tocris Cookson Inc. (Ellisville, MO).

Development of the U2OS-ER{alpha}/ß Heterodimer Cell Line
The generation of the U2OS-ER{alpha} and U2OS-ERß cell lines using the T-REx System (Invitrogen) was described previously (28). To generate the U2OS-ER{alpha}/ß cell line, the ER{alpha} coding sequence (plus an N-terminal FLAG-epitope) was subcloned as a BamHI/XhoI fragment from the pcDNA4/TO vector (37) into the pcDNA5/TO vector, which confers hygromycin B resistance. The ER{alpha}-pcDNA5/TO vector was linearized using a PvuI restriction digest and transfected into the U2OS-ERß cells at a density of 50% using lipofectamine PLUS reagent (Invitrogen). Forty-eight hours later, the transfected cells were split into U2OS-ER{alpha}/ß-selective media. Individual cell clones were isolated and Western blot analysis performed to confirm expression of both ER{alpha} and ERß. The resulting cell line is termed U2OS-ER{alpha}/ß.

Western Blot Analysis
The U2OS-ER{alpha}, U2OS-ERß, and U2OS-ER{alpha}/ß cell lines were plated at a density of 75% in 10-cm culture dishes and treated with 100 ng/ml Dox for 24 h. Total protein extracts were prepared in RIPA buffer [1% (vol/vol) Nonidet P-40, 0.5% (vol/vol) sodium deoxycholate, 0.1% (vol/vol), sodium dodecyl sulfate, and 1x protease inhibitor cocktail (Roche Diagnostics Corp.) in 1x PBS] and the protein concentrations determined using a standard Bradford assay. Equal amounts of protein (75 µg) were analyzed by Western blot using a FLAG-M2 Ab (Sigma) and visualized using enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ).

Immunoprecipitation
Nuclear extracts of the U2OS-ER{alpha}/ß cell line were produced using the Dignam method (51). Five hundred micrograms of nuclear extract were immunoprecipitated overnight with 10 µg of an ER{alpha}-specific Ab (clone ER1D5, Immunotech, Marseille, France). The Ab-protein complex was bound using Protein G agarose beads (Upstate Biotechnology, Lake Placid NY) and washed three times in RIPA buffer. The beads were boiled in Laemmli buffer and electrophoresed on a 10% polyacrylamide gel and blotted to a nitrocellulose membrane. Western blot analysis was performed using an {alpha}-FLAG-M2 Ab (Sigma) and visualized using enhanced chemiluminescence (Amersham Pharmacia).

Microarray Analysis
The U2OS-ER{alpha}, U2OS-ER, and U2OS-ER{alpha}/ß cells were plated in 10-cm cell culture dishes at a cell density of 50% and pretreated with 100 ng/ml Dox for 24 h in CS-FBS media. The cells were then treated with 100 ng/ml Dox plus ethanol control, 10 nM E2, or 10 nM 4HT for 24 h in duplicate. The total RNA was isolated using Trizol reagent (Invitrogen) and was used in microarray analysis using the Human Genome Focus Array (Affymetrix, Santa Clara, CA), which contains probes for over 8500 verified human gene sequences. Preparation of the labeled cDNA and microarray hybridization was performed by Microarray Core Facility at the Mayo Clinic (Rochester, MN). The microarray analysis was performed using GeneSpring 7 Software (Silicon Genetics). Briefly, the raw data were normalized using the following scheme: 1) set measurements less than 0.01 to 0.01, 2) normalize to 50th percentile, and 3) normalize to median. The starting gene lists were filtered to only include those genes marked as "Present" (P) in all replicates of any given sample and treatment. Fold change assessments (≤ ≥ 2-fold) were determined by comparison of the treated sample for each cell line relative to the control treatment and the resulting gene lists were compared using a Venn diagram. The number of replicate microarrays for each cell line and steroid treatment are as follows: four replicates for the 4HT treatments in all U2OS-ER cell lines, four replicates for the E2 treatments in the U2OS-ER{alpha} and -ERß cell lines, five replicates for the E2 treatments in the U2OS-ER{alpha}/ß cell line, six replicates for the control treatment in the U2OS-ER{alpha} cell line, and seven replicates for the control treatments in the U2OS-ERß and -ER{alpha}/ß cell lines. The data discussed in this publication have been deposited in the National Center for Biotechnology Information’s Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession no. GSE2292 (52, 53).

Real-Time RT-PCR
The U2OS-ER{alpha}, U2OS-ER, and U2OS-ER{alpha}/ß cells were plated in six-well cell culture dishes at a cell density of 50% and pretreated with 100 ng/ml Dox for 24 h in CS-FBS media. The cells were then treated with 100 ng/ml Dox plus ethanol control, 10 nM E2, or 10 nM 4HT for 24 h in triplicate. The RNA was harvested using Trizol Reagent (Invitrogen). Four micrograms of total RNA were heat denatured at 68 C for 15 min in a reverse transcription reaction buffer [1x First Strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 50 mM dithiothreitol, 1 µM deoxynucleotide triphosphates, 500 ng oligo-deoxythymidine primer]. After heat denaturation, 1 U mouse Moloney leukemia virus-reverse transcriptase (Invitrogen) was added and the mixture incubated at 37 C for 45 min followed by a 68 C incubation for an additional 15 min. The cDNA products were diluted to 50 µl with PCR-grade water and 2 µl was used in a PCR. Real-time PCR kits for the selected genes (see text and Fig. 5Go) were purchased from SuperArray Bioscience Corp. (Frederick, MD). In the experiments for the confirmation of active ER dimers in the U2OS-ER{alpha} line, cells were seeded in six-well plates and pretreated with 100 ng/ml Dox for 24 h in CS-FBS media. The cells were then treated with 100 ng/ml Dox plus varying concentrations of either E2 or the ER{alpha}-specific agonist, PPT, for 24 h. Real-time RT-PCR was performed using primers specific for ß-actin or vWF as described previously (28).

Proliferation Assay
The U2OS-ER{alpha}, U2OS-ERß and U2OS-ER{alpha}/ß cell lines were seeded into 96-well plates at a density of 6400 cells per well. Twenty-four hours later, the cells were treated with 100 ng/ml Dox for an additional 24 h in CS-FBS media. The cells were then treated (in triplicate) with E2, 4HT, and/or ICI 182,780 at the concentrations indicated in the text and allowed to proliferate for 72 h. Dox and steroids were added fresh every 24 h to maintain the effective concentrations over the 72-h period. Twenty microliters of the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) reagent were added to each well and allowed to incubate at 37 C for 30 min. The plate was read at 490 nm on a SpectraMax 340 spectrophotometer (Molecular Devices Corp., Sunnyvale, CA) using the SoftMax Pro software (Molecular Devices Corp.).

ChIP Assay
U2OS-ER{alpha}/ß cells (10 x 107) were seeded into 10-cm plates and treated with Dox for 24 h followed by either ethanol control or 10–8 E2 for 2 h in CS-FBS medium. ChIPs were then performed using modifications of the procedure described by Lambert and Nordeen (54). Cells were scraped into collection buffer [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA]. The cell pellet was then resuspended in 400 µl of lysis buffer [1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris-HCl (pH 8.0)] and incubated on ice for 10 min. The cell suspension was then sonicated four times for 10 sec at power setting 3 using a Heat Systems-Ultrasonics Cell Disruptor Model W-220F (Plainview, NY), placing the sample on ice for at least 10 sec between pulses. After centrifugation, the supernatant was diluted to 5 ml in dilution buffer [0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.0), 167 mM NaCl]. One milliliter of the diluted sample was used for immunoprecipitation with either 1 µg of ER{alpha}-specific HC20 Ab (Santa Cruz Biotechnology Inc., Santa Cruz, CA) or 1 µg of ERß-specific Ab (P2571; Invitrogen) overnight at 4 C. Complexes were recovered by a 2-h incubation with Protein A/G Sepharose beads (Pierce Biotechnology Inc., Rockford, IL). Precipitates were serially washed with 1 ml of low salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.0), 150 mM NaCl], 1 ml high salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.0), 500 mM NaCl], 1 ml LiCl wash buffer [250 mM LiCl, 1% Nonidet P-40, 1% Na deoxycholate, 1 mM EDTA, 10 mM Tris-HCl (pH 8.0)], and twice with 1 ml TE [10 mM Tris-HCl (pH 8.0), 1 mM EDTA]. Precipitated chromatin complexes were recovered with two 250-µl incubations with elution buffer (1% SDS, 100 mM NaHCO3) and combined. Salt concentrations were altered to 200 mM NaCl, treated with 5 µl of 10 mg/ml proteinase K for 1 h at 45 C, phenol/chloroform extracted and ethanol precipitated. Chromatin pellets were resuspended in 50 µl water and 2 µl used in PCRs. Inputs were generated as above excluding the Ab immunoprecipitation and chromatin DNA pellets were resuspended in 200 µl water. Standard end-point PCRs were performed as previously described (28) using primers specific for RBBP1 (30 cycles) and DHCR7 (35 cycles). The 5' to 3' sequences of these primers are: RBBP1 forward +833: AAGCCCGAAGGGAGCTCTGG; RBBP1 reverse +1015: CCAGGACGCAGGAGCTGAGG; RBBP1 nonspecific primers (Non-Spec) forward +2990: CGAGGTGCCTTCTGTGAGGCAAAG; RBBP1 Non-Spec reverse +3454: GGCATGAGACACTACGCCCAGTCAC; DHCR7 forward –697: GGCTCGCACTGTGGCTCAGCTTCTCC; DHCR7 reverse –412: GCGACGCACATTGATGGAGCGTATG; DHCR7 Non-Spec forward –3009: ATGTCTGGGAATTCAGTGTTGAGG and DHCR7 Non-Spec reverse –2627: GACATGTATCTACCATCCTTTGAGTAC. The PCR products were separated on a 1.5% agarose gel. Control ChIPs were performed using a nonspecific goat antirabbit IgG and no detectable bands were observed (data not shown).

EMSA
U2OS-ER nuclear extracts were incubated with 1x binding buffer [4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM Tris-HCl (pH 7.5), 50 µg/ml poly(deoxyinosine-deoxyctyosine) (Promega)], 5 x 10–5 M E2, and 40 ng (10x molar excess) of unlabeled, double-stranded consensus ERE (Santa Cruz Biotechnology Inc.). After a 10-min incubation at room temperature, 4 ng of 32P-labeled ({gamma}32P ATP, 6000 Ci/mmol; PerkinElmer Life and Analytical Sciences, Boston, MA) double-stranded consensus ERE was added and incubated at room temperature for an additional 20 min. For the Ab supershifts, 1–4 µg of specific Ab was added to the appropriate reactions and incubated for an additional 30 min at room temperature. Reactions were separated on a 7.5% nondenaturing polyacrylamide gel (37.5:1 acrylamide/bis-acrylamide in Tris-borate EDTA). The gel was dried, exposed to x-ray film, and developed.


    ACKNOWLEDGMENTS
 
The authors would like to thank Kay Rasmussen for her excellent technical assistance.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant PO1-AG04875-21, a grant from the Breast Cancer Research Foundation (New York, NY), and the Mayo Foundation.

First Published Online March 31, 2005

Abbreviations: Ab, Antibody; AP, activator protein; ChIP, chromatin immunoprecipitation; CS-FBS, charcoal-stripped FBS; DHCR7, 7-dehydrocholesterol reductase; Dox, doxycycline; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen response element; FBS, fetal bovine serum; 4HT, 4-OH tamoxifen; LBD, ligand binding domain; Non-Spec, nonspecific primers; OB, osteoblast; PPT, 4,4',4'-(4-propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol; RBBP1, retinoblastoma binding protein 1; SDS, sodium dodecyl sulfate; SERM, selective ER modulator; vWF, von Willebrand factor.

Received for publication September 27, 2004. Accepted for publication March 23, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Monroe DG, Spelsberg T 2004 General mechanisms of steroid receptors and receptor coregulator action. In: Miller V, Hay M, eds. Advances in molecular and cell biology. 34th ed. Amsterdam: Elsevier B.V.; 39–48
  2. Monroe DG, Spelsberg TC 2004 Gonadal steroids and receptors. In: Favus MJ, ed. Primer on the metabolic bone dieseases and disorders of mineral metabolism. 5th ed. Philadelphia: Lippincott, Williams and Wilkins; 32–38.
  3. Rickard D, Harris SA, Turner R, Khosla S, Spelsberg TC 2000 Estrogen and progestins. In: Bilezikian P, Raisz LG, Rodan GA, eds. Principles of bone biology. 2nd ed. San Diego: Academic Press
  4. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal location and functional analysis of the murine estrogen receptor ß. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  5. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J-A 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  6. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kaster P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  7. Mosselman S, Polman J, Dijkema R 1996 ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  8. Yi P, Bhagat S, Hilf R, Bambara RA, Muyan M 2002 Differences in the abilities of estrogen receptors to integrate activation functions are critical for subtype-specific transcriptional responses. Mol Endocrinol 16:1810–1827[Abstract/Free Full Text]
  9. Merot Y, Metivier R, Penot G, Manu D, Saligaut C, Gannon F, Pakdel F, Kah O, Flouriot G 2004 The relative contribution exerted by AF-1 and AF-2 transactivation functions in estrogen receptor {alpha} transcriptional activity depends upon the differentiation stage of the cell. J Biol Chem 279:26184–26191[Abstract/Free Full Text]
  10. Metzger D, Ali S, Bornert JM, Chambon P 1995 Characterization of the amino-terminal transcriptional activation function of the human estrogen receptor in animal and yeast cells. J Biol Chem 270:9535–9542[Abstract/Free Full Text]
  11. Delaunay F, Pettersson K, Tujague M, Gustafsson JA 2000 Functional differences between the amino-terminal domains of estrogen receptors {alpha} and ß. Mol Pharmacol 58:584–590[Abstract/Free Full Text]
  12. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA 1998 Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor ß. Endocrinology 139:4252–4263[Abstract/Free Full Text]
  13. Katzenellenbogen BS, Katzenellenbogen JA 2002 Biomedicine. Defining the "S" in SERMs. Science 295:2380–2381[Abstract/Free Full Text]
  14. Katzenellenbogen JA, O’Malley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol Endocrinol 10:119–131[Free Full Text]
  15. Castro-Rivera E, Safe S 2003 17ß-Estradiol- and 4-hydroxytamoxifen-induced transactivation in breast, endometrial and liver cancer cells is dependent on ER-subtype, cell and promoter context. J Steroid Biochem Mol Biol 84:23–31[CrossRef][Medline]
  16. Rickard DJ, Monroe DG, Ruesink TJ, Khosla S, Riggs BL, Spelsberg TC 2003 Phytoestrogen genistein acts as an estrogen agonist on human osteoblastic cells through estrogen receptors {alpha} and ß. J Cell Biochem 89:633–646[CrossRef][Medline]
  17. Cowley SM, Hoare S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  18. Pace P, Taylor J, Suntharalingam S, Coombes RC, Ali S 1997 Human estrogen receptor ß binds DNA in a manner similar to and dimerizes with estrogen receptor {alpha}. J Biol Chem 272:25832–25838[Abstract/Free Full Text]
  19. Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson J-A, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  20. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  21. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  22. Smith CL, O’Malley BW 2004 Coregulator function: a key to understanding tissue specificity of selective receptor modulators. Endocr Rev 25:45–71[Abstract/Free Full Text]
  23. Monroe DG, Secreto FJ, Spelsberg T 2003 Overview of estrogen action in osteoblasts: role of the ligand, receptor, and the co-regulators. J Musculoskeletal Neuronal Int 3:357–362
  24. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  25. Margeat E, Poujol N, Boulahtouf A, Chen Y, Muller JD, Gratton E, Cavailles V, Royer CA 2001 The human estrogen receptor {alpha} dimer binds a single SRC-1 coactivator molecule with an affinity dictated by agonist structure. J Mol Biol 306:433–442[CrossRef][Medline]
  26. Gee AC, Carlson KE, Martini PG, Katzenellenbogen BS, Katzenellenbogen JA 1999 Coactivator peptides have a differential stabilizing effect on the binding of estrogens and antiestrogens with the estrogen receptor. Mol Endocrinol 13:1912–1923[Abstract/Free Full Text]
  27. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  28. Monroe DG, Getz BJ, Johnsen SA, Riggs BL, Khosla S, Spelsberg TC 2003 Estrogen receptor isoform-specific regulation of endogenous gene expression in human osteoblastic cell lines expressing either ER{alpha} or ERß. J Cell Biochem 90:315–326[CrossRef][Medline]
  29. Kian Tee M, Rogatsky I, Tzagarakis-Foster C, Cvoro A, An J, Christy RJ, Yamamoto KR, Leitman DC 2004 Estradiol and selective estrogen receptor modulators differentially regulate target genes with estrogen receptors {alpha} and ß. Mol Biol Cell 15:1262–1272[Abstract/Free Full Text]
  30. Stossi F, Barnett DH, Frasor J, Komm B, Lyttle CR, Katzenellenbogen BS 2004 Transcriptional profiling of estrogen-regulated gene expression via estrogen receptor {alpha} or estrogen receptor ß in human osteosarcoma cells: distinct and common target genes for these receptors. Endocrinology 145:3473–3486[CrossRef][Medline]
  31. Tamrazi A, Carlson KE, Rodriguez AL, Katzenellenbogen JA 20 January 2005 Coactivator proteins as determinants of estrogen receptor structure and function: spectroscopic evidence for a novel coactivator-stabilized receptor conformation. Mol Endocrinol 10.1210/me.2004–0458
  32. Jisa E, Jungbauer A 2003 Kinetic analysis of estrogen receptor homo- and heterodimerization in vitro. J Steroid Biochem Mol Biol 84:141–148[CrossRef][Medline]
  33. Li X, Huang J, Yi P, Bambara RA, Hilf R, Muyan M 2004 Single-chain estrogen receptors (ERs) reveal that the ER{alpha}/ß heterodimer emulates functions of the ER{alpha} dimer in genomic estrogen signaling pathways. Mol Cell Biol 24:7681–7694[Abstract/Free Full Text]
  34. Bord S, Horner A, Beavan S, Compston J 2001 Estrogen receptors {alpha} and ß are differentially expressed in developing human bone. J Clin Endocrinol Metab 86:2309–2314[Abstract/Free Full Text]
  35. Arts J, Kuiper GG, Janssen JM, Gustafsson JA, Lowik CW, Pols HA, van Leeuwen JP 1997 Differential expression of estrogen receptors {alpha} and ß mRNA during differentiation of human osteoblast SV-HFO cells. Endocrinology 138:5067–5070[Abstract/Free Full Text]
  36. Onoe Y, Miyaura C, Ohta H, Nozawa S, Suda T 1997 Expression of estrogen receptor ß in rat bone. Endocrinology 138:4509–4512[Abstract/Free Full Text]
  37. Monroe DG, Johnsen SA, Subramaniam M, Getz BJ, Khosla S, Riggs BL, Spelsberg TC 2003 Mutual antagonism of estrogen receptors {alpha} and ß and their preferred interactions with steroid receptor coactivators in human osteoblastic cell lines. J Endocrinol 176:349–357[Abstract]
  38. Kraichely DM, Sun J, Katzenellenbogen JA, Katzenellenbogen BS 2000 Conformational changes and coactivator recruitment by novel ligands for estrogen receptor-{alpha} and estrogen receptor-ß: correlations with biological character and distinct differences among SRC coactivator family members. Endocrinology 141:3534–3545[Abstract/Free Full Text]
  39. Hawse JR, Hejtmancik JF, Horwitz J, Kantorow M 2004 Identification and functional clustering of global gene expression differences between age-related cataract and clear human lenses and aged human lenses. Exp Eye Res 79:935–940[CrossRef][Medline]
  40. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  41. Pettersson K, Delaunay F, Gustafsson JA 2000 Estrogen receptor ß acts as a dominant regulator of estrogen signaling. Oncogene 19:4970–4978[CrossRef][Medline]
  42. McDonnell DP 2004 The molecular determinants of estrogen receptor pharmacology. Maturitas 48(Suppl 1):S7–S12
  43. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  44. Paige LA, Christensen DJ, Gron H, Norris JD, Gottlin EB, Padilla KM, Chang CY, Ballas LM, Hamilton PT, McDonnell DP, Fowlkes DM 1999 Estrogen receptor (ER) modulators each induce distinct conformational changes in ER {alpha} and ER ß. Proc Natl Acad Sci USA 96:3999–4004[Abstract/Free Full Text]
  45. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  46. Norris JD, Fan D, Sherk A, McDonnell DP 2002 A negative coregulator for the human ER. Mol Endocrinol 16:459–468[Abstract/Free Full Text]
  47. Katzenellenbogen BS, Frasor J 2004 Therapeutic targeting in the estrogen receptor hormonal pathway. Semin Oncol 31:28–38
  48. Martini PG, Katzenellenbogen BS 2003 Modulation of estrogen receptor activity by selective coregulators. J Steroid Biochem Mol Biol 85:117–122[CrossRef][Medline]
  49. Fleming FJ, Hill AD, McDermott EW, O’Higgins NJ, Young LS 2004 Differential recruitment of coregulator proteins steroid receptor coactivator-1 and silencing mediator for retinoid and thyroid receptors to the estrogen receptor-estrogen response element by beta-estradiol and 4-hydroxytamoxifen in human breast cancer. J Clin Endocrinol Metab 89:375–383[Abstract/Free Full Text]
  50. Shaulian E, Karin M 2002 AP-1 as a regulator of cell life and death. Nat Cell Biol 4:E131–E136
  51. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  52. Edgar R, Domrachev M, Lash AE 2002 Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 30:207–210[Abstract/Free Full Text]
  53. Barrett T, Suzek TO, Troup DB, Wilhite SE, Ngau WC, Ledoux P, Rudnev D, Lash AE, Fujibuchi W, Edgar R2005 NCBI GEO: mining millions of expression profiles—database and tools. Nucleic Acids Res 33:D562–D566
  54. Lambert JR, Nordeen SK 2001 Analysis of steroid hormone-induced histone acetylation by chromatin immunoprecipitation assay. In: Lieberman BA, ed. Steroid receptor methods: protocols and assays. Totowa, NJ: Humana Press Inc.; 273–281

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα  |  ERβ
Ligands:   17β-Estradiol  |  4-Hydroxytamoxifen



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
Z. Papoutsi, C. Zhao, M. Putnik, J.-A. Gustafsson, and K. Dahlman-Wright
Binding of estrogen receptor {alpha}/{beta} heterodimers to chromatin in MCF-7 cells
J. Mol. Endocrinol., August 1, 2009; 43(2): 65 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
E. D. Hudgens, L. Ji, C. D. Carpenter, and S. L. Petersen
The gad2 Promoter Is a Transcriptional Target of Estrogen Receptor (ER) {alpha} and ER{beta}: A Unifying Hypothesis to Explain Diverse Effects of Estradiol
J. Neurosci., July 8, 2009; 29(27): 8790 - 8797.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Powell and W. Xu
Intermolecular interactions identify ligand-selective activity of estrogen receptor {alpha}/{beta} dimers
PNAS, December 2, 2008; 105(48): 19012 - 19017.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. A. Krum, G. A. Miranda-Carboni, M. Lupien, J. Eeckhoute, J. S. Carroll, and M. Brown
Unique ER{alpha} Cistromes Control Cell Type-Specific Gene Regulation
Mol. Endocrinol., November 1, 2008; 22(11): 2393 - 2406.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
A. M Davis, J. Mao, B. Naz, J. A Kohl, and C. S Rosenfeld
Comparative effects of estradiol, methyl-piperidino-pyrazole, raloxifene, and ICI 182 780 on gene expression in the murine uterus
J. Mol. Endocrinol., October 1, 2008; 41(4): 205 - 217.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. D. Conzen
Minireview: Nuclear Receptors and Breast Cancer
Mol. Endocrinol., October 1, 2008; 22(10): 2215 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. M. Sotoca Covaleda, H. van den Berg, J. Vervoort, P. van der Saag, A. Strom, J.-A. Gustafsson, I. Rietjens, and A. J. Murk
Influence of Cellular ER{alpha}/ER{beta} Ratio on the ER{alpha}-Agonist Induced Proliferation of Human T47D Breast Cancer Cells
Toxicol. Sci., October 1, 2008; 105(2): 303 - 311.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg
Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain
Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
X. Li, S. L Nott, Y. Huang, R. Hilf, R. A Bambara, X. Qiu, A. Yakovlev, S. Welle, and M. Muyan
Gene expression profiling reveals that the regulation of estrogen-responsive element-independent genes by 17{beta}-estradiol-estrogen receptor {beta} is uncoupled from the induction of phenotypic changes in cell models
J. Mol. Endocrinol., May 1, 2008; 40(5): 211 - 229.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen
Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding
Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Levy, D. Tatomer, C. B. Herber, X. Zhao, H. Tang, T. Sargeant, L. J. Ball, J. Summers, T. P. Speed, and D. C. Leitman
Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene
Mol. Endocrinol., February 1, 2008; 22(2): 287 - 303.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Ruegg, E. Swedenborg, D. Wahlstrom, A. Escande, P. Balaguer, K. Pettersson, and I. Pongratz
The Transcription Factor Aryl Hydrocarbon Receptor Nuclear Translocator Functions as an Estrogen Receptor {beta}-Selective Coactivator, and Its Recruitment to Alternative Pathways Mediates Antiestrogenic Effects of Dioxin
Mol. Endocrinol., February 1, 2008; 22(2): 304 - 316.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S. M Johnson, M. Maleki-Dizaji, J. A Styles, and I. N H White
Ishikawa cells exhibit differential gene expression profiles in response to oestradiol or 4-hydroxytamoxifen
Endocr. Relat. Cancer, June 1, 2007; 14(2): 337 - 350.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
W. Zwart, A. Griekspoor, M. Rondaij, D. Verwoerd, J. Neefjes, and R. Michalides
Classification of anti-estrogens according to intramolecular FRET effects on phospho-mutants of estrogen receptor {alpha}
Mol. Cancer Ther., May 1, 2007; 6(5): 1526 - 1533.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Zhao, J. Matthews, M. Tujague, J. Wan, A. Strom, G. Toresson, E. W-F. Lam, G. Cheng, J.-A. Gustafsson, and K. Dahlman-Wright
Estrogen Receptor {beta}2 Negatively Regulates the Transactivation of Estrogen Receptor {alpha} in Human Breast Cancer Cells
Cancer Res., April 15, 2007; 67(8): 3955 - 3962.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. K. Iyer, Y.-H. Zhang, and E. R. B. McCabe
Dosage-Sensitive Sex Reversal Adrenal Hypoplasia Congenita Critical Region on the X Chromosome, Gene 1 (DAX1) (NR0B1) and Small Heterodimer Partner (SHP) (NR0B2) Form Homodimers Individually, as Well as DAX1-SHP Heterodimers
Mol. Endocrinol., October 1, 2006; 20(10): 2326 - 2342.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg
Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS
J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Frasor, E. C. Chang, B. Komm, C.-Y. Lin, V. B. Vega, E. T. Liu, L. D. Miller, J. Smeds, J. Bergh, and B. S. Katzenellenbogen
Gene expression preferentially regulated by tamoxifen in breast cancer cells and correlations with clinical outcome.
Cancer Res., July 15, 2006; 66(14): 7334 - 7340.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L. C Murphy and P. H Watson
Is oestrogen receptor- {beta} a predictor of endocrine therapy responsiveness in human breast cancer?
Endocr. Relat. Cancer, June 1, 2006; 13(2): 327 - 334.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
R. L. Vessella, T. A. Guise, E. S. Susman, L. J. Suva, G. A. Clines, S. L. Kominsky, K. L. Weber, J. M. Chirgwin, L. K. McCauley, and W. Kozlow
Meeting Report from Skeletal Complications of Malignancy IV: A symposium jointly sponsored by The Paget Foundation for Paget's Disease of Bone and Related Disorders, the National Cancer Institute, and the University of Virginia School of Medicine * April 28-30, 2005 in Bethesda, Maryland, USA
IBMS BoneKEy, March 1, 2006; 3(3): 15 - 42.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data Files
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monroe, D. G.
Right arrow Articles by Spelsberg, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monroe, D. G.
Right arrow Articles by Spelsberg, T. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals