| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Cellular Biology (W.H., J.Z., M.W., J.L., D.D.M.), Baylor College of Medicine, and Department of Molecular Genetics (J.M.P., G.L.), University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Address all correspondence and requests for reprints to: David D. Moore, Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030. E-mail: moore{at}bcm.tmc.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
CAR is activated by phenobarbital (PB) and a group of structurally diverse agents referred to as "phenobarbital-like" (7). The pesticide contaminant 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) is the most potent PB-like inducer (8) and a specific agonist ligand for murine CAR (mCAR) (9). In contrast, PB and several other inducers do not bind CAR directly, but instead activate a signal transduction pathway that results in translocation of the constitutive transactivator from the hepatocyte cytoplasm to the nucleus (10).
CAR activators can also induce acute hepatomegaly (11, 12). This augments the ability of the liver to clear a xenobiotic stress and could be an adaptive response. However, long-term treatments with these compounds cause liver tumors (11). The xenobiotic inducers differ from other carcinogens in that they do not bind to DNA or cause DNA lesions; instead their effects are thought to be due to their ability to increase cell proliferation and suppress apoptosis (13). In addition to the CAR activators, several other groups of nongenotoxic carcinogens have been identified in rodent assays, but their relevance to human health is controversial due to the lack of a clear molecular mechanism (12, 13, 14).
As recently described in independent studies (15), we have found that CAR is essential for tumorigenesis in response to chronic treatment with PB and TCPOBOP. CAR also mediates a transient hepatomegalic response to xenobiotic treatment, which is associated with both induction of DNA replication and suppression of apoptosis. CAR directly activates Mdm2 expression, and loss of Mdm2 function blunts the replicative response to TCPOBOP. The ability of human (h) CAR to induce similar effects in the mouse suggests that this receptor may mediate the effects of chronic xenobiotic stress on hepatocarcinogenesis in humans.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). Both xenobiotics increased liver size in wild-type, but not CAR–/– mice, as expected, and this response was also significantly decreased 3 d after withdrawal of PB, but not TCPOBOP (Fig. 1B). The recovery of liver size after withdrawal of PB treatment was associated with increased apoptosis in wild-type mice (published as supplemental Fig. 1 on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org).
|
). We conclude that CAR directs a transient replicative response to an acute xenobiotic stress. The increased liver size should promote clearance of the stress, particularly because an increase in hepatocyte ploidy has been associated with higher metabolic activity (19).
CAR Mediates Hepatocarcinogenesis in Response to Chronic Xenobiotic Stress
Although hepatomegaly can thus be considered an adaptive response to acute stress, both PB and TCPOBOP are nongenotoxic hepatocarcinogens. We compared the responses of wild-type and CAR–/– mice to extended PB or TCPOBOP exposure, with or without prior treatment with the alkylating agent N-nitrosodiethylamine (DEN). In accord with previous results (11), treatment of wild-type mice with a single nontumorigenic dose of DEN followed 2 wk later by 30 wk of subsequent xenobiotic treatment resulted in a large number of tumors (Fig. 2A and Table 1). Both adenomas and carcinomas were observed in DEN plus PB and also DEN plus TCPOBOP-treated animals (Fig. 2B and Table 1). Although tumors can be induced by longer-term PB treatments, none were observed with PB or DEN alone in these studies. TCPOBOP induced liver adenomas, as expected (11). In striking contrast, none of the treatment combinations resulted in any tumors in the CAR–/– mice (Fig. 2A and Table 1). This requirement of CAR for xenobiotic-induced tumorigenesis is very consistent with results of a recent independent study of PB effects that used a different CAR–/– line (15).
|
|
) and in the number of PCNA-positive cells in the wild-type TCPOBOP-treated mice (supplemental Fig. 2B). Consistent with reported acute anti-apoptotic effects of PB (20), liver sections from the chronically TCPOBOP-treated wild-type mice showed significantly lower numbers of apoptotic cells than the untreated controls or CAR–/– mice (Fig. 2D). Thus, chronic and acute xenobiotic stresses produce similar responses.
CAR Activation Produces a Tumorigenic Environment via Induction of Mdm2
The replicative increase in ploidy upon acute CAR activation is associated with increased expression of a number of cell cycle regulators (Ref. 21 and data not shown), but none have been identified as primary CAR targets. Gene array screens for potential CAR targets rapidly induced by TCPOBOP identified Mdm2 among a number of other targets. Mdm2 is of particular interest because it suppresses p53-dependent apoptosis and can also stimulate cell proliferation in a p53-independent manner (22). Moreover, recent studies have linked increased Mdm2 expression to the formation of preneoplastic lesions in the liver (23), and overexpression of Mdm2 has been observed in human hepatocellular carcinoma (24). Northern blotting confirmed induction of Mdm2 by TCPOBOP (Fig. 3A), and both quantitative real-time PCR (data not shown) and Western blot analysis (Fig. 3B) showed that TCPOBOP treatment increased hepatic Mdm2 expression at early time points in wild-type but not CAR–/– mice.
|
). In transient transfections, CAR transactivated a reporter construct containing the functional Mdm2 element, but not the mutant (Fig. 3D). Chromatin immunoprecipitation demonstrated specific binding of CAR to this site in the endogenous Mdm2 gene in a stable CAR expressing HepG2 derivative, but not parental HepG2 cells (Fig. 3E). As in other cell lines, CAR is constitutively nuclear in these cells. We conclude that Mdm2 is a primary CAR target gene.
Loss of Mdm2 function results in embryonic lethality that can be suppressed by loss of p53 (26, 27). Because the loss of p53 function does not affect the proliferative response to PB (28), we investigated the potential role of Mdm2 in TCPOBOP-induced hepatomegaly by treating p53–/– and p53–/–/Mdm2–/– double-null mice with a single injection of TCPOBOP. Loss of Mdm2 function in this context blunted the TCPOBOP-induced replicative response as demonstrated by decreases in the proportion of octoploid hepatocytes (Fig. 4) and the number of PCNA-positive nuclei (supplemental Fig. 3). These results indicate that Mdm2 contributes to TCPOBOP-induced endoreduplication but also strongly suggest that other genes are involved.
|
), in agreement with recent results with other PB-like activators (29). This suppression was completely absent in CAR–/– cells. TCPOBOP also suppressed apoptosis and induced Mdm2 mRNA in a CAR expressing HepG2 cell line, but not parental HepG2 cells (supplemental Fig. 4, A and B). CAR expression in the HepG2 derivative resulted in a strong decrease in both basal and UV-induced p53 protein levels (supplemental Fig. 4C).
|
). The response to this chemotherapeutic agent, which induces double-strand breaks, is clearly dependent on p53 because it did not induce apoptosis in p53–/– primary hepatocytes. TCPOBOP also blocked apoptosis induced by a single ip injection of the alkylating agent methyl methanesulfonate in the livers of wild-type but not CAR–/– mice (Fig. 5C). As with the bleomycin-treated primary hepatocytes, the basal response observed in the TCPOBOP-treated wild-type mice was indistinguishable from that observed in p53–/– mice. Thus, both cell culture and in vivo experiments demonstrate a selective suppression of p53-mediated apoptosis upon CAR activation.
Replicative and Antiapoptotic Effects of hCAR
To determine whether hCAR can induce similar replicative and antiapoptotic responses, we used a previously described mouse strain that expresses only hCAR in the liver (31). hCAR is not responsive to TCPOBOP, but treatment with PB for 1 wk induced expression of Cyp2B10 and Mdm2 (Fig. 6A) and significantly increased liver size (Fig. 6B). Both the proportion of octoploid hepatocytes and the number of PCNA-positive cells were also increased (Fig. 5C). PB treatment of primary hepatocytes from the hCAR mice also suppressed UV-induced apoptosis (Fig. 5D). Thus, activation of hCAR in the mouse background generates all of the acute responses observed with mCAR.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Multiple steps must be necessary in the progression from the CAR-dependent proliferative state to hepatocellular carcinoma. Such tumor progression has been extensively studied in the liver (32), and foci of proliferating hepatocytes with increased expression of the placental isoform of glutathione-S-transferase and other markers are thought to represent a very early stage. It is interesting that glutathione-S-transferase-Pi is a CAR target gene (31), that such preneoplastic foci induced by DEN alone or DEN plus PB overexpress Mdm2 (23), and also that withdrawal of PB from chronically treated mice rapidly increases apoptosis in the lesions and decreases their number and size (17, 33). These findings suggest that the proliferative and antiapoptotic environment induced by CAR activators and other nongenotoxic carcinogens may be an important common contributor to early stages of hepatocarcinogenesis. For example, such epigenetic effects could promote the accumulation of cells carrying tumorigenic genetic changes such as the ß-catenin mutations that are common in human hepatocarcinomas (34) and also observed in the majority of mouse liver tumors induced in the presence of PB (35).
The well-known differences in rodent and human xenobiotic responses raise the issue of the relevance of these rodent results to liver carcinogenesis in humans. Preliminary results indicate that chronic xenobiotic stress promotes tumorigenesis in the hCAR mice. Although this is consistent with a limited number of reports linking long-term barbituate treatment to hepatocarcinogenesis (36, 37), long-term barbituate treatment is not associated with increased incidence of liver tumors in humans (38), and similar conclusions have been reached with fibrates and other nongenotoxic agents. This may simply be due to lower doses in humans than in mice. However, humans are relatively resistant to tumorigenesis for a variety of reasons, including shorter telomeres, and the resistance of telomerase-deficient mice to chemically induced hepatocarcinoma (39) is at least consistent with the possibility that such additional mechanisms contribute to the apparent ineffectiveness of the nongenotoxic agents in humans. Overall, as many as 80% of human cancers are thought to be sporadically generated in response to environmental factors (40). Thus, the demonstration of a key role for CAR in tumor promotion provides a novel and potentially important link between environmental stress and tumorigenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cells and Transfections
Hela cells were transfected using calcium phosphate as described (41). Transfections included 100 ng of reporter plasmid, 100 ng ß-gal internal control plasmid, and 100 ng CAR expression plasmid. Cells were assayed for chloramphenicol acetyl transferase (Roche Molecular Biochemicals, Indianapolis, IN) activity 24 h after the addition of the ligands, and reporter expression was normalized to the ß-gal activity, according to manufacturer’ directions. Single nucleotide mutagenesis was performed with QuikChange XL Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). Similar results were obtained from at least three independent experiments. The permanent cell line (HepG2-CAR) was as described (9).
Histology
The left lobe of the livers was removed and fixed in 4% formaldehyde-PBS solution, embedded in paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin. Sections were also prepared and stained using a PCNA staining kit (Zymed Laboratories Inc., South San Francisco, CA) or terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) kit (Roche) according to the manufacturers’ instruction.
DNA Binding
PT7-lac-His vectors expressing full-length cDNAs of hCAR and hRXR
were used to generate [35S]methionine-labeled proteins by in vitro translation as described (9). End-labeled double-stranded oligonucleotides were incubated with 1–2 µl of [35S]methionine-labeled CAR and RXR. Complexes were resolved by electrophoresis on a 4% nondenaturing polyacrylamide gel and visualized by autoradiography.
DNA Fragmentation
Mouse primary hepatocytes were prepared and cultured as described (42). Primary hepatocytes were plated at a density of 60,000 cells/cm2 and treated with UV at indicated doses after 12 h. Cells were collected 24 h after UV treatment and washed with PBS. The cell sediment was resuspended in 2.5 ml cell lysis buffer (50 mM Tris, 1 mM EDTA, 1% sodium dodecyl sulfate) and 10 µl 1 mg/ml proteinase K at 37 C for 1 h and DNA was prepared by phenol/chloroform/isoamyl alcohol (25:24:1) extraction and ethanol precipitation. Ten micrograms of DNA per sample were resolved on a 1.8% agarose gel.
Protein Analysis
Freshly excised liver specimens were homogenized in buffer [2 M sucrose, 10 mM HEPES (pH 7.6), 25 mM KCl, 1 mM EDTA, 10% glycerol, 0.15 mM spermine, 1 mM spermidine, 2 µg/ml aprotinin, 10 µg/ml leupeptin, 5 µg/ml pepstain A, 0.1 mM Pefabloc, and 50 µg/ml N-acetylleucylleucylnorleucinal] and were centrifuged at 24,000 rpm for 1 h at 4 C. The nuclear pellet was resuspended in 0.5–0.7 ml extraction buffer [10 mM HEPES (pH 7.6), 100 mM KCl, 2 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 2 µg/ml aprotinin, 10 µg/ml leupeptin, 5 µg/ml pepstain A, 0.1 mM Pefabloc, 50 µg/ml N-acetylleucylleucylnorleucina]. A 1/10 volume 4M (NH4)2SO4 (pH 7.9) was added, and the mixture was gently agitated at 4 C for 1 h. The lysate was centrifuged at 85,000 rpm for 1 h, and the clean supernatant was the nuclear extract. Liver nuclear extracts (40 µg) were resolved by 10% PAGE and immunoblotted with antibodies specific for Mdm2 (Oncogene) and laminB1 (Zymed Laboratories Inc.). For p53, 300 µg total protein from cell lysates were immunoprecipitated and blotted with a p53 monoclonal antibody (Oncogene, Cambridge, MA). Western blotting was performed using ECL kit (Amersham Biosciences, Piscataway, NJ).
RNA Analysis
Total liver RNA was extracted using TRIzol Reagent (Invitrogen) according to the manufacturer’s instruction. Equivalent amounts of RNA from three to five mice were pooled and 10–15 µg was subjected to Northern blot analysis. All cDNA probes were prepared by RT-PCR with mouse liver RNA using Super-Script One Step RT-PCR system (Invitrogen). PCR primers used were: human Mdm2, atggtgaggagcaggtactg and ccaatcgccactgaacacag.
Flow Cytometry
Primary hepatocytes were prepared and 2 x 106 cells were resuspended in 2 ml 0.9% NaCl. Five milliliters of 90% cold EtOH was added drop wise to fix the cells for at least 30 min at room temperature. Before they were subjected to flow cytometry, cells were incubated with 100 µl 1 mg/ml ribonuclease and stained with 50 µg/ml propidium iodide at 37 C for 30 min. Cell sorting was performed at the core facility at Baylor College of Medicine.
Chromatin Immunoprecipitation
HepG2 or HepG2-mCAR cells were treated with either solvent or 500 nM TCPOBOP for 3 h. Cells were collected and chromatin complexes were prepared and immunocleared with protein A/G agarose and 2 µg/ml sheared salmon sperm DNA for 2 h at 4 C. The cleared chromatin complexes were immunoprecipitated overnight at 4 C with an anti-Flag antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) against the mCAR epitope tag, followed by protein A/G agarose at room temperature for 2 h. PCR analysis was performed using a pair of Mdm2 intron1-specific primers (P1): forward primer, ttcagtgggcaggttgac and reverse primer, acaagtcaggacttaactcc. A pair of primers amplifying a fragment approximately 10 kb upstream of Mdm2 intron1 (P2) were used as a negative control: forward, ttcatgcaattctcctgc and reverse, tcaggagttcgagaccag. Five percent of input chromatin complexes were subjected to a loading control PCR using a pair of glyceraldehyde-3-phosphate dehydrogenase-specific primers.
Statistics
The values were represented as mean ± SEM. Statistical analysis was carried out using two-tailed Student’s t test.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Present address for J.Z.: Clark Center W252, 318 Campus Drive, Stanford University School of Medicine, Stanford, California 94305.
First Published Online April 14, 2005
1 W.H. and J.Z. contributed equally to this work. 
Abbreviations: CAR, Constitutive androstane receptor; DEN, N-nitrosodiethylamine; h, human; mCAR, murine CAR; PB, phenobarbital; TCPOBOP, contaminant 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene; RXR, retinoid X receptor; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling.
Received for publication December 17, 2004. Accepted for publication April 5, 2005.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
NURSA Molecule Pages Link:
This article has been cited by other articles:
 |
|
 |
|
  A. K. Goetz and D. J. Dix Mode of Action for Reproductive and Hepatic Toxicity Inferred from a Genomic Study of Triazole Antifungals Toxicol. Sci., August 1, 2009; 110(2): 449 - 462. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Phillips, L. D. Burgoon, and J. I. Goodman The Constitutive Active/Androstane Receptor Facilitates Unique Phenobarbital-Induced Expression Changes of Genes Involved in Key Pathways in Precancerous Liver and Liver Tumors Toxicol. Sci., August 1, 2009; 110(2): 319 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Phillips, L. D. Burgoon, and J. I. Goodman Phenobarbital Elicits Unique, Early Changes in the Expression of Hepatic Genes that Affect Critical Pathways in Tumor-Prone B6C3F1 Mice Toxicol. Sci., June 1, 2009; 109(2): 193 - 205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. D. Beilke, L. M. Aleksunes, R. D. Holland, D. G. Besselsen, R. D. Beger, C. D. Klaassen, and N. J. Cherrington Constitutive Androstane Receptor-Mediated Changes in Bile Acid Composition Contributes to Hepatoprotection from Lithocholic Acid-Induced Liver Injury in Mice Drug Metab. Dispos., May 1, 2009; 37(5): 1035 - 1045. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Li, T. Chen, J. Cottrell, and H. Wang Nuclear Translocation of Adenoviral-Enhanced Yellow Fluorescent Protein-Tagged-Human Constitutive Androstane Receptor (hCAR): A Novel Tool for Screening hCAR Activators in Human Primary Hepatocytes Drug Metab. Dispos., May 1, 2009; 37(5): 1098 - 1106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Phillips and J. I. Goodman Multiple Genes Exhibit Phenobarbital-Induced Constitutive Active/Androstane Receptor-Mediated DNA Methylation Changes during Liver Tumorigenesis and in Liver Tumors Toxicol. Sci., April 1, 2009; 108(2): 273 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Ross, T. Moore, and S. A. Leavitt In vivo mutagenicity of conazole fungicides correlates with tumorigenicity Mutagenesis, March 1, 2009; 24(2): 149 - 152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gopinathan, D. B. Hannon, J. M. Peters, and J. P. Vanden Heuvel Regulation of Peroxisome Proliferator-Activated Receptor-{alpha} by MDM2 Toxicol. Sci., March 1, 2009; 108(1): 48 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Li, T. Chen, J. D. Stanton, T. Sueyoshi, M. Negishi, and H. Wang The Peripheral Benzodiazepine Receptor Ligand 1-(2-Chlorophenyl-methylpropyl)-3-isoquinoline-carboxamide Is a Novel Antagonist of Human Constitutive Androstane Receptor Mol. Pharmacol., August 1, 2008; 74(2): 443 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yamamoto and M. Negishi The Antiapoptotic Factor Growth Arrest and DNA-Damage-Inducible 45 {beta} Regulates the Nuclear Receptor Constitutive Active/Androstane Receptor-Mediated Transcription Drug Metab. Dispos., July 1, 2008; 36(7): 1189 - 1193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Rosen, B. D. Abbott, D. C. Wolf, J. C. Corton, C. R. Wood, J. E. Schmid, K. P. Das, R. D. Zehr, E. T. Blair, and C. Lau Gene Profiling in the Livers of Wild-type and PPAR{alpha}-Null Mice Exposed to Perfluorooctanoic Acid Toxicol Pathol, June 1, 2008; 36(4): 592 - 607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Rosen, J. S. Lee, H. Ren, B. Vallanat, J. Liu, M. P. Waalkes, B. D. Abbott, C. Lau, and J. C. Corton Toxicogenomic Dissection of the Perfluorooctanoic Acid Transcript Profile in Mouse Liver: Evidence for the Involvement of Nuclear Receptors PPAR{alpha} and CAR Toxicol. Sci., May 1, 2008; 103(1): 46 - 56. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhou, M. Liu, Y. Zhai, and W. Xie The Antiapoptotic Role of Pregnane X Receptor in Human Colon Cancer Cells Mol. Endocrinol., April 1, 2008; 22(4): 868 - 880. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sueyoshi, R. Moore, J. Sugatani, Y. Matsumura, and M. Negishi PPP1R16A, The Membrane Subunit of Protein Phosphatase 1{beta}, Signals Nuclear Translocation of the Nuclear Receptor Constitutive Active/Androstane Receptor Mol. Pharmacol., April 1, 2008; 73(4): 1113 - 1121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kiyosawa, J. C. Kwekel, L. D. Burgoon, K. J. Williams, C. Tashiro, B. Chittim, and T. R. Zacharewski o,p'-DDT Elicits PXR/CAR-, Not ER-, Mediated Responses in the Immature Ovariectomized Rat Liver Toxicol. Sci., February 1, 2008; 101(2): 350 - 363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Guo, J. Sarkar, K. Suino-Powell, Y. Xu, K. Matsumoto, Y. Jia, S. Yu, S. Khare, K. Haldar, M. S. Rao, et al. Induction of Nuclear Translocation of Constitutive Androstane Receptor by Peroxisome Proliferator-activated Receptor {alpha} Synthetic Ligands in Mouse Liver J. Biol. Chem., December 14, 2007; 282(50): 36766 - 36776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Peffer, J. G. Moggs, T. Pastoor, R. A. Currie, J. Wright, G. Milburn, F. Waechter, and I. Rusyn Mouse Liver Effects of Cyproconazole, a Triazole Fungicide: Role of the Constitutive Androstane Receptor Toxicol. Sci., September 1, 2007; 99(1): 315 - 325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Woods, J. P. Vanden Heuvel, and I. Rusyn Genomic Profiling in Nuclear Receptor-Mediated Toxicity Toxicol Pathol, June 1, 2007; 35(4): 474 - 494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Phillips, Y. Yamamoto, M. Negishi, R. R. Maronpot, and J. I. Goodman Orphan Nuclear Receptor Constitutive Active/Androstane Receptor-Mediated Alterations in DNA Methylation during Phenobarbital Promotion of Liver Tumorigenesis Toxicol. Sci., March 1, 2007; 96(1): 72 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. S. Tien, K. Matsui, R. Moore, and M. Negishi The Nuclear Receptor Constitutively Active/Androstane Receptor Regulates Type 1 Deiodinase and Thyroid Hormone Activity in the Regenerating Mouse Liver J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 307 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Nelson, V. Bhaskaran, W. R. Foster, and L. D. Lehman-McKeeman p53-Independent Induction of Rat Hepatic Mdm2 following Administration of Phenobarbital and Pregnenolone 16{alpha}-Carbonitrile Toxicol. Sci., December 1, 2006; 94(2): 272 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sakai, H. Iwata, E.-Y. Kim, O. Tsydenova, N. Miyazaki, E. A. Petrov, V. B. Batoev, and S. Tanabe Constitutive Androstane Receptor (CAR) as a Potential Sensing Biomarker of Persistent Organic Pollutants (POPs) in Aquatic Mammal: Molecular Characterization, Expression Level, and Ligand Profiling in Baikal Seal (Pusa sibirica) Toxicol. Sci., November 1, 2006; 94(1): 57 - 70. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
