Molecular Endocrinology, doi:10.1210/me.2004-0531
Molecular Endocrinology 19 (8): 2035-2046
Copyright © 2005 by The Endocrine Society
The Modulator of Nongenomic Actions of the Estrogen Receptor (MNAR) Regulates Transcription-Independent Androgen Receptor-Mediated Signaling: Evidence that MNAR Participates in G Protein-Regulated Meiosis in Xenopus laevis Oocytes
Derek Haas,
Stacy N. White,
Lindsey B. Lutz,
Melissa Rasar and
Stephen R. Hammes
Department of Obstetrics and Gynecology (D.H.), Division of Reproductive Endocrinology, Department of Internal Medicine (S.N.W., L.B.L., M.R., S.R.H.), Division of Endocrinology and Metabolism; and Department of Pharmacology (S.R.H.), University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75390-8857
Address all correspondence and requests for reprints to: Stephen R. Hammes, Department of Internal Medicine, Division of Endocrinology and Metabolism, Department of Pharmacology, University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Boulevard, Dallas, Texas 75390-8857. E-mail: stephen.hammes{at}utsouthwestern.edu.
 |
ABSTRACT
|
|---|
Classical steroid receptors mediate many transcription-independent (nongenomic) steroid responses in vitro, including activation of Src and G proteins. Estrogen-triggered activation of Src can be regulated by the modulator of nongenomic actions of the estrogen receptor (MNAR), which binds to estrogen receptors and Src to create a signaling complex. In contrast, the mechanisms regulating steroid-induced G protein activation are not known, nor are the physiologic responses mediated by MNAR. These studies demonstrate that MNAR regulates the biologically relevant process of meiosis in Xenopus laevis oocytes. MNAR was located throughout oocytes, and reduction of its expression by RNA interference markedly enhanced testosterone-triggered maturation and activation of MAPK. Additionally, Xenopus MNAR augmented androgen receptor (AR)-mediated transcription in CV1 cells through activation of Src. MNAR and AR coimmunoprecipitated as a complex involving the LXXLL-rich segment of MNAR and the ligand binding domain of AR. MNAR and Gß also precipitated together, with the same region of MNAR being important for this interaction. Finally, reduction of MNAR expression decreased Gß
-mediated signaling in oocytes. MNAR therefore appears to participate in maintaining meiotic arrest, perhaps by directly enhancing Gß
-mediated inhibition of meiosis. Androgen binding to AR might then release this inhibition, allowing maturation to occur. Thus, MNAR may augment multiple nongenomic signals, depending upon the context and cell type in which it is expressed.
 |
INTRODUCTION
|
|---|
STEROID RECEPTORS ARE traditionally known to regulate transcription in response to their ligands; however, evidence now indicates that these proteins also mediate transcription-independent, or nongenomic, steroid-triggered signals (1, 2). Whereas transcriptional regulation involves receptor interactions with nuclear signaling molecules such as coactivators and repressors, nongenomic signaling appears to entail steroid receptor contacts with extranuclear signaling molecules. For example, the classical human progesterone receptor activates Src in response to progesterone via a direct interaction between a proline-rich region of the progesterone receptor and the SH3 domain of the Src protein (3). Similarly, classical estrogen receptors (ERs) regulate several nongenomic responses to estrogen, including activation of Src, G proteins, and Akt (4, 5, 6, 7, 8, 9, 10, 11, 12). Interestingly, ER-mediated activation of Src may not involve a direct interaction between the two molecules. Instead, under some conditions, the ER appears to activate Src through an intermediate molecule called the modulator of nongenomic actions of the ER (MNAR), or proline, glutamic acid, and leucine-rich protein 1 (13, 14, 15). MNAR contains multiple LXXLL motifs that can interact with the AF2 domain of the ER, as well as several proline-rich motifs that can interact with Src or other proteins containing SH3 domains. Thus, MNAR may serve as a scaffold that links steroid receptors to Src and perhaps other signaling molecules. In vitro, MNAR enhances ER-mediated genomic and nongenomic signaling in response to estradiol, and both types of signaling appear to be regulated in large part through MNARs nongenomic actions on Src (14, 15). In addition, MNAR interacts with other classical steroid receptors. For example, MNAR coprecipitates with the androgen receptor (AR) in LNCaP prostate cancer cells (16) and is therefore a potential regulator of nongenomic androgen-triggered signals in the prostate.
Although MNAR regulates steroid receptor signaling in vitro, its physiologic purpose remains unknown. Furthermore, MNARs ability to enhance both genomic and nongenomic steroid receptor-mediated signaling in somatic cells complicates dissection of the relative importance of these two pathways. To dissociate nongenomic from genomic steroid-mediated signaling, we have focused on steroid-induced maturation, or meiotic resumption, of Xenopus laevis oocytes. Oocyte maturation serves as a biologically relevant steroid-mediated phenomenon that occurs completely independent of transcription (17, 18). Xenopus oocyte maturation is regulated via a "release of inhibition" mechanism whereby constitutive G protein-mediated signals, including Gß
and G
s, hold cells in meiotic arrest. Steroid-triggered signaling overcomes these inhibitory signals, resulting in meiotic progression (19, 20, 21). Recent evidence suggests that androgens play a critical physiologic role in regulating Xenopus oocyte maturation, and that the classical Xenopus AR at least in part mediates this process (22, 23). The following studies were therefore designed to determine whether MNAR might be regulating nongenomic AR-mediated oocyte maturation.
A cDNA encoding Xenopus MNAR (XeMNAR) was cloned, and its protein expression characterized in oocytes. XeMNAR enhanced Xenopus AR (XeAR)-mediated transcription in a Src-dependent fashion, and formed complexes with both the XeAR and the Xenopus Gß subunit (XeG). In contrast, XeMNAR played a negative role in oocyte maturation, possibly coregulating meiotic arrest through enhancement of the aforementioned constitutive inhibitory Gß
-mediated signaling. These data suggest that MNAR regulates different nongenomic steroid-triggered signals depending upon the cell in which it is expressed.
 |
RESULTS
|
|---|
Cloning and Analysis of the Xenopus laevis MNAR
A cDNA encoding the XeMNAR protein was identified as described in Materials and Methods. The XeMNAR protein sequence is shown in Fig. 1
. XeMNAR consists of 1012 amino acids and has a predicted molecular mass of 110,451 kDa. Similar to the human isoform, the carboxyl region of XeMNAR is very acidic, with 45% of the last 242 amino acids being either aspartic or glutamic acid residues. Additionally, XeMNAR contains seven LXXLL motifs that potentially could interact with the AF2 domains of classical steroid receptors (boxed in Fig. 1
), as well as multiple proline-rich stretches that could serve as possible SH3 or WW binding sites (underlined in Fig. 1
). Unlike the human isoform of MNAR (13, 14); however, the LXXLL motifs and proline-rich sequences are sequestered from one another, with the former being located within the first 530 amino acids, and the latter being found between residues 535 and 950. This suggests that the XeMNAR protein structure is modular, with different regions possibly being important for interacting with alternate signaling molecules.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 1. Protein Sequence of XeMNAR
The 1012 amino acid coding sequence of XeMNAR is depicted. The seven LXXLL motifs (potential steroid receptor binding sequences) are boxed, and the proline-rich motifs (potential SH3 or WW binding domains) underlined. The truncated MNAR523stop protein contains a stop codon just after the lysine residue at position 522 (circled).
|
|
XeMNAR Expression in Oocytes
Expression of mRNA encoding XeMNAR was confirmed in oocytes by RT-PCR using the XeMNAR primers described in Materials and Methods (data not shown). Endogenous XeMNAR in oocyte extracts was unable to be consistently detected by Western blot using rabbit polyclonal antibodies directed against two different regions of the protein; however, XeMNAR protein expression was readily observed by immunohistochemistry using a polyclonal rabbit antibody directed against residues 9911007 of XeMNAR. XeMNAR was expressed throughout the oocyte, including the nucleus and cytoplasm (Fig. 2
; immune, uninjected). In addition, XeMNAR appeared to be present in the plasma membrane, although this increased signal intensity, especially in the upper half of the figure, might have been partially due to melanin deposits near the membrane of the animal pole. Identical treatment of oocytes with an equal amount of the preimmune antibody revealed significantly less staining in the cytoplasm, nucleus, and vegetal membrane (Fig. 2
; preimmune, uninjected), verifying that the signal in the immune sample was specific for XeMNAR. These results were confirmed using another antibody directed against residues 430447 of MNAR (data not shown).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 2. MNAR Is Expressed throughout Xenopus laevis Oocytes
Immunohistochemistry was performed on oocyte sections as described in Materials and Methods. For either the top set or bottom set of samples, oocytes were incubated for an equal amount of time with equal concentrations of protein A-purified rabbit antibodies from the serum of rabbits injected with a peptide containing amino acids 9911007 (immune) or from the corresponding preimmune serum (preimmune). Normal oocytes (uninjected, top) or oocytes injected with double-stranded cRNA corresponding to XeMNAR (dsXeMNAR, bottom) were used. Brown staining depicts expression. More than five sections from five different oocytes were examined for each condition with identical results.
|
|
Notably, XeMNAR expression could be substantially lowered by injection of double-stranded full-length XeMNAR cRNA. Two days after injection of this double-stranded cRNA, staining with the immune antibody was identical with that seen with the preimmune antibody [Fig. 2
; dsXeMNAR (double-stranded cRNA corresponding to XeMNAR], indicating that XeMNAR expression had been significantly reduced.
XeMNAR Enhanced XeAR-Mediated Transcription in a Src-Dependent Fashion
The human MNAR protein enhances ER
-mediated transcription in response to estradiol (13, 14, 15). Interestingly, this enhancement is at least partially dependent on Src, as inhibition of Src activity using the antagonist PP2 significantly reduces reduced MNARs effect on ER-mediated transcription. To test whether the XeMNAR could similarly enhance transcription mediated by a classical steroid receptor, the effects of XeMNAR on XeAR-induced transcription were measured in CV1 cells. Coexpression of XeMNAR with XeAR significantly enhanced testosterone-induced transcription mediated by the mouse mammary tumor virus (MMTV) promoter, raising activity by 2- to 4-fold when 101000 nM testosterone was used (Fig. 3A
). To avoid concerns regarding testosterone metabolism in CV1 cells, similar studies were performed using the more potent and less degradable agonist dihydrotestosterone (DHT). XeMNAR similarly enhanced DHT-induced transcription via the XeAR (Fig. 3B
), most notably at the 1- to 10-nM range. Furthermore, as previously reported with the ER (14, 15), XeMNAR-mediated enhancement of DHT-induced transcription was significantly attenuated by the addition of the Src antagonist PP2, with transcription rates being reduced to those of XeAR-mediated transcription in the absence of XeMNAR (Fig. 3C
; Myc-XeMNAR). Notably, PP2 still slightly attenuated AR-mediated transcription in cells that were not transfected with cDNA encoding XeMNAR (Fig. 3C
; pcDNA), suggesting that endogenous MNAR might be expressed in CV1 cells. Accordingly, RT-PCR using oligonucleotides corresponding to the human MNAR sequence revealed the presence of mRNA encoding MNAR in these cells (data not shown). Together, these results confirmed that XeMNAR was behaving similarly to the human isoform in its ability to enhance XeAR-mediated transcription in a Src-dependent fashion. Furthermore, these studies suggest that XeMNAR might be regulating both genomic and nongenomic androgen-triggered signaling in CV1 cells.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3. XeMNAR Enhances Androgen-Triggered XeAR-Mediated Transcription
A and B, XeAR-mediated transcription was measured in CV1 cells treated for approximately 48 h with either testosterone (A) or DHT (B). Cells were cotransfected with MMTV-luciferase, CMV-galactosidase, XeAR, and either empty pcDNA3.1 vector (open squares) or pcDNA3.1 containing a cDNA encoding Myc-tagged XeMNAR (closed circles). Steroid concentrations are depicted on the x-axis (log scale) and luciferase activity normalized to CMV promoter-driven ß-galactosidase production on the y-axis. C, XeMNARs enhancement of AR-mediated transcription is regulated via Src. CV1 cells were transfected as above, but were treated with either ethanol vehicle or the Src inhibitor PP2 (a gift from William Rainey, University of Texas Southwestern) at a concentration of 4 µM during the 48-h incubation with 10 nM DHT. Each point in each experiment represents the average ± SD (n = 3), and each experiment was performed at least two times with nearly identical results.
|
|
XeMNAR Inhibited Xenopus Oocyte Maturation
Given the difficulties in differentiating between its genomic vs. nongenomic effects in CV1 cells, XeMNARs role in mediating androgen-triggered oocyte maturation was examined. Notably, the entire process of steroid-mediated maturation of Xenopus oocytes occurs completely independent of transcription. In contrast to its effect on transcription in somatic cells, overexpression of XeMNAR in oocytes did not augment nongenomic testosterone-triggered maturation or activation of MAPK (a nongenomic signal that accompanies maturation) in response to testosterone (Fig. 4
, A and B, respectively). This result suggested that either XeMNAR was not regulating these nongenomic effects in oocytes, or that endogenous XeMNAR expression was high enough such that expression of excess protein had little additional activity. To address these possibilities, endogenous XeMNAR expression was reduced by injecting oocytes with double-stranded cRNA containing sequences corresponding to the XeMNAR coding region. XeMNAR expression was significantly lowered, as demonstrated by immunohistochemistry (Fig. 2
, lower panels). Surprisingly, oocytes with reduced XeMNAR levels were much more sensitive to androgen, as demonstrated by the markedly increased maturation and activation of MAPK in response to testosterone (Fig. 4
, A and B; dsXeMNAR). Subsequent injection of cRNA encoding Myc-XeMNAR into cells previously injected with double-stranded XeMNAR cRNA raised Myc-XeMNAR levels (Fig. 4D
) and reduced the amount of testosterone-mediated maturation back to that of mock-injected oocytes (Fig. 4C
). The ability to add back XeMNAR and rescue the effect of the injected double-stranded XeMNAR cRNA confirmed that the enhanced response to testosterone was likely secondary to a specific reduction in XeMNAR protein expression. Injection of nonspecific double-stranded cRNA had minimal effect on oocyte maturation (data not shown), further confirming the specificity of these RNA interference experiments. Together, these results indicated that endogenous XeMNAR might be functioning to maintain meiotic arrest in oocytes.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4. Endogenous MNAR Blocks Meiotic Progression in Xenopus laevis Oocytes
A, Reduction of endogenous MNAR expression in oocytes by RNA interference enhances testosterone-triggered maturation. Xenopus oocytes were injected with either buffer (mock, closed circles), cRNA encoding XeMNAR (open squares), or double-stranded cRNA corresponding the XeMNAR (closed triangles). After 36 h, oocytes were treated overnight with testosterone at the indicated concentrations (x-axis) and maturation determined by detection of germinal vesicle breakdown (percent maturation, y-axis, n = 20 per point). This experiment was performed more than five times with nearly identical results. B, Oocytes were injected as in panel A. After 48 h, oocytes were treated with either ethanol vehicle or 150 nM testosterone for 4 h, and phosphorylated p42 ERK detected by Western blot (upper panel). The blot was then stripped and reprobed for total p42 (lower panel). Phosphorylation of p42 ERK is significantly higher in oocytes injected with dsXeMNAR. This experiment was repeated three times with nearly identical results. C, Oocytes were injected with either buffer (Mock) or double-stranded cRNA corresponding to XeMNAR (dsXeMNAR). The latter oocytes were then injected with single-stranded cRNA encoding Myc-XeMNAR 24 h later. Oocyte maturation was examined as above 24 h later by treating oocytes overnight with 300 nM testosterone. The Myc-tagged XeMNAR was indeed overexpressed in the double-injected cells, as indicated by Western blot using a mouse monoclonal anti-Myc antibody (D). E, Inhibition of Src has minimal effect on testosterone-induced oocyte maturation. Uninjected oocytes were preincubated with either dimethylsulfoxide (DMSO) vehicle (closed circle) or 4 µM PP2 (open square) for 2 h followed by the addition of testosterone at the indicated concentrations. Maturation was determined 16 h later and is indicated on the y-axis.
|
|
Is XeMNAR modulating oocyte maturation by regulating Src activity? The role of Src in mediating steroid-induced maturation has been unclear. Overexpression of activated Src in Xenopus oocytes appears to enhance steroid-triggered maturation (24, 25), suggesting that Src might be positively influencing nongenomic steroid-mediated signaling in oocytes. However, treatment of Xenopus oocytes with inhibitory concentrations of PP2 for 2 h, followed by the addition of testosterone at varying doses, led to only a small inhibition of steroid-triggered maturation (Fig. 4E
). This small effect of PP2 demonstrated that endogenous Src was likely playing a relatively minor role in regulating oocyte maturation, and that endogenous XeMNAR was probably attenuating maturation via alternative mechanisms.
XeMNAR Complexed with XeAR as Well as XeGß
If XeMNAR is not regulating maturation via Src, then what other signaling pathways could be involved? As mentioned in the introduction, meiotic arrest appears to be regulated at least in part by constitutive G protein-mediated signaling (19, 20, 21). Specifically, constitutive Gß
signaling has been reported to occur in Xenopus oocytes, and has been implicated as a regulator of meiotic arrest (19, 20, 26). Given that XeMNAR appeared to be involved in maintaining meiotic arrest, its ability to complex with both the XeAR and the Gß protein was examined.
To start, endogenous XeAR was immunoprecipitated from extracts of Xenopus oocytes that were either treated with ethanol or 1 µM testosterone for 1 h. These immunoprecipitates were then immunoblotted for XeMNAR using rabbit antibodies raised against the carboxyl terminus of XeMNAR. Rabbit polyclonal antibodies raised against the XeAR (23), but not preimmune serum, coprecipitated small amounts of XeMNAR (Fig. 5
, left). Although addition of testosterone seemed to slightly increase the XeMNAR signal in this example, the differences were minimal in all experiments and likely are not significant.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5. Endogenous XeMNAR Coprecipitates with XeAR and XeGß in Oocyte Extracts
Lysates from mock and testosterone-treated oocytes were prepared and immunoprecipitations of XeAR (left) and XeGß (right) were performed as described in Materials and Methods. Samples were precleared with preimmune antibody followed by precipitation with the specific immune antibodies (immunoprecipitation, IP). All precipitates were then blotted with anti-XeMNAR serum directed against residues 430447. This experiment was repeated twice with similar results. In addition, the same MNAR band was identified when precipitates were blotted with the anti-XeMNAR serum directed against residues 991-1007.
|
|
To confirm the immunoprecipitation results seen in oocytes and to further characterize the XeAR/XeMNAR complex, COS cells were transfected with cDNAs encoding XeMNAR, XeAR, or both molecules. Each of the two proteins contained amino-terminal sequences encoding the Myc tag. Rabbit polyclonal antibodies raised against the XeAR (23) were able to coimmunoprecipitate XeMNAR in the presence, but not absence, of XeAR. Again, this interaction appeared to occur independently of androgen, as the results were similar both with and without testosterone (Fig. 6A
, upper panel). In contrast, preimmune antibodies from the rabbit in which the anti-AR antibody was generated did not precipitate either XeAR or XeMNAR (Fig. 6A
, lower panel). Similarly, rabbit antibodies raised against the carboxyl terminus of XeMNAR precipitated XeAR in the presence but not absence of XeMNAR coexpression, whereas preimmune antibodies precipitated neither protein (Fig. 6B
). These studies suggested that XeMNAR and XeAR form an androgen-independent complex under the conditions used for these studies.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6. XeMNAR Coprecipitates with XeAR in COS Cells
COS cells were transfected with a total of 1 µg DNA that consisted of either pcDNA3.1 alone or pcDNA3.1 containing cDNAs encoding Myc-tagged XeMNAR (0.5 µg) or Myc-tagged XeAR (0.5 µg). Transfection was followed 48 h later by coimmunoprecipitation as described in Materials and Methods. Lysates were precleared with preimmune antibodies followed by immunoprecipitation using rabbit polyclonal antibodies directed against either the XeAR or XeMNAR. Blots were then probed with a monoclonal mouse anti-Myc antibody. Precipitations using the immune sera are shown in the top panels (IP, immunoprecipitation), whereas precipitations using the preimmune sera are shown in the lower panels. Total lysates were probed as positive controls for the Western blots, and antibodies used for the precipitations are indicated. A, XeMNAR coprecipitates with XeAR both in the absence (left) and presence (right) of testosterone. B, XeAR coprecipitates with XeMNAR with and without testosterone. C, Cells were transfected with a cDNA encoding a Myc-tagged truncated XeMNAR (MNAR523stop) instead of full-length XeMNAR. MNAR523stop still coprecipitated with XeAR as indicated. D, Cells were transfected with a cDNA encoding a Myc-tagged truncated XeAR (AR527stop) instead of full-length XeAR. AR527stop did not coprecipitate with XeMNAR. All experiments were repeated at least three times with identical results.
|
|
The amino-terminal half of XeMNAR contains multiple LXXLL motifs; thus, if XeMNAR were interacting directly with XeAR, then these sequences might be interacting with the AF2 domain of XeAR. Accordingly, the rabbit anti-AR antibody still coimmunoprecipitated a recombinant protein containing a stop codon near the most carboxyl LXXLL motif of XeMNAR (XeMNAR523stop; see Fig. 1
) with overexpressed XeAR in COS cells (Fig. 6C
). In contrast, a mutated XeAR with a stop codon amino-terminal to the ligand binding and AF2 domains (XeAR527) did not coprecipitate with full-length XeMNAR using the rabbit anti-MNAR antibody (Fig. 6D
). These coimmunoprecipitation experiments indicated that, similar to the human ER and MNAR proteins (15), the LXXLL motifs of XeMNAR might be interacting with the AF2 domain of XeAR.
Can XeMNAR interact with the Gß
heterodimer to assist in maintaining meiotic arrest in oocytes? Immunoprecipitation of endogenous XeGß from oocyte extracts using a rabbit polyclonal antibody directed against Gß revealed the presence of XeMNAR by Western blot analysis (Fig. 5
, right), confirming that XeMNAR and Gß could indeed interact. Again, addition of testosterone had little effect on this interaction. Interestingly, the anti-XeMNAR antibody consistently detected a lower migrating band in the Gß precipitates, which may represent a degraded or cleaved version of endogenous XeMNAR. To confirm and expand upon these results, coimmunoprecipitations in COS cells were performed using amino-terminal Myc-tagged XeMNAR and XeGß proteins. Interestingly, the rabbit antibody generated against XeMNAR coprecipitated XeGß in the presence of XeMNAR, whereas the nonspecific preimmune serum did not (Fig. 7A
). In addition, the anti-XeMNAR antibody was not able to precipitate XeGß in the absence of XeMNAR (Fig. 7A
), indicating that the antibody was not directly interacting with Gß. Finally, the converse experiment whereby endogenous Gß in COS cells was precipitated with a rabbit anti-Gß antibody resulted in coprecipitation of overexpressed XeMNAR (Fig. 7B
). Thus, XeMNAR and Gß appear to be associated in a complex under the conditions used for these experiments. This interaction appears to be regulated via the amino-terminal half of XeMNAR, as precipitation of XeMNAR523stop still coprecipitated XeGß (Fig. 7C
).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7. XeMNAR Coprecipitates with Gß in COS Cells
A, COS cells were transfected with a total of 1 µg DNA that consisted of either pcDNA3.1 alone or pcDNA3.1 containing cDNAs encoding either Myc-tagged XeMNAR or Myc-tagged XeGß. Transfection was followed 48 h later by coimmunoprecipitation as described in Materials and Methods. Lysates were precleared with nonspecific preimmune antibodies followed by immunoprecipitation using rabbit polyclonal antibodies directed against XeMNAR (IP, immunoprecipitation). Blots were then probed with a monoclonal mouse anti-Myc antibody. Precipitations using the immune sera are shown in the top panels, whereas precipitations using the nonspecific preimmune sera are shown in the lower panels. Total lysates were probed as positive controls and precipitates are indicated. B, COS cells were transfected with the indicated plasmids and complexes were precipitated with rabbit anti-Gß serum or nonspecific preimmune sera. Blots were probed with the anti-Myc monoclonal antibody. XeMNAR was precipitated with endogenous Gß. The ability of the anti-Gß antibody to precipitate Gß was confirmed by overexpression of Myc-XeGß in oocytes followed by precipitation with the anti-Gß antibody (far right lane). C, COS cells were transfected as indicated and precipitations performed using the polyclonal antibodies directed against residues 430447 of MNAR. Myc-tagged MNAR523stop and XeGß were detected by Western blot. All experiments were repeated at least three times with identical results.
|
|
XeMNAR Promotes Gß
-Mediated Signaling in Xenopus Oocytes
The ability of XeMNAR to form a complex with Gß suggested that the former might be maintaining meiotic arrest by enhancing Gß
-mediated inhibition of meiosis. To determine whether endogenous XeMNAR could regulate Gß
-mediated signaling in oocytes, XeMNAR expression was reduced by RNA interference as described above. In addition to injecting double-stranded cRNA corresponding to XeMNAR, oocytes were also injected with cRNA encoding the muscarinic 2 receptor (M2R). Stimulation of the M2R with carbachol activates Gß
, which then activates phospholipase Cß and eventually calcium mobilization. In addition, simulation of overexpressed M2R with carbachol significantly attenuates steroid-mediated oocyte maturation, most likely through activation of Gß
-mediated signaling (23). Interestingly, although carbachol triggered calcium mobilization in oocytes injected with only cRNA encoding the M2R, reduction of XeMNAR levels by RNA interference markedly decreased this response, leading to essentially no significant calcium mobilization in response to carbachol (Fig. 8A
). Of note, M2R expression was equal in both samples, and injection of nonspecific double-stranded cRNA had minimal effect on carbachol-mediated activation of calcium mobilization (data not shown). Together, these data confirm that endogenous XeMNAR plays a critical role in enhancing Gß
-mediated signaling in Xenopus oocytes.
 |
DISCUSSION
|
|---|
Recent studies have demonstrated that MNAR can regulate both genomic and nongenomic steroid receptor-mediated signaling in several in vitro models (13, 14, 15). Many of these activities appear to be secondary to MNAR-mediated augmentation of estrogen-triggered activation of Src, with MNAR serving as a scaffold that brings the ER and Src proteins within close proximity. These in vitro data suggest that MNAR may be modulating important nongenomic steroid-mediated processes in vivo, although identification of these physiologic processes has yet to be determined.
The studies presented here address a potential physiologic role of MNAR, demonstrating that the Xenopus laevis isoform might be playing an important part in regulating meiosis in oocytes. First, the MNAR protein was expressed throughout Xenopus oocytes (Fig. 2
). The high nuclear expression of XeMNAR is consistent with its reported subcellular localization in mammalian somatic cells (13, 14), as well as its potential activity as a steroid receptor coactivator of transcription (13). Interestingly, XeMNAR was also detected in the cytoplasm, and possibly plasma membrane, of oocytes, which would be consistent with previous reports regarding subcellular localization of the human isoforms of MNAR in somatic cells (14, 15), as well as with its ability to modulate extranuclear signals.
Second, reduction of XeMNAR expression by RNA interference markedly enhanced testosterone-triggered activation of MAPK and oocyte maturation. This response could be rescued by overexpression of wild-type XeMNAR after microinjection of the cognate cRNA (Fig. 4
), but not by mock injection with buffer (data not shown). Nearly identical enhancement of steroid-triggered maturation occurred when endogenous Gß
-mediated signaling was reduced by sequestration using either overexpressed G
subunits or the carboxyl region of a G protein-receptor kinase (19, 20), suggesting that endogenous XeMNAR might also be involved in maintaining oocytes in meiotic arrest.
Third, coimmunoprecipitation studies demonstrated that the XeAR and XeMNAR proteins formed a complex both in oocytes (Fig. 5
) and when overexpressed in COS cells (Fig. 6
). Just as the human MNAR binds to the ER via interactions between MNARs LXXLL motifs and the ERs AF2 domain (15), the complex between XeMNAR and XeAR was mediated at least in part by the LXXLL-containing amino-terminal half of XeMNAR and the ligand binding domain (which contains the AF2 region) of the XeAR (Fig. 6
). Unlike the human ER binding to MNAR, however, the XeAR/XeMNAR interaction did not appear to be steroid dependent, suggesting that nongenomic androgen-mediated signaling both in CV1 cells and in oocytes might not require changes in binding between these two molecules. Instead, it might involve conformational alterations in these proteins or others that may associate with them. Interestingly, a precedent for hormone-independent interactions and possibly signaling from an MNAR/AR complex has been demonstrated in LNCaP cells. Here, MNAR binding to the AR appears to vary depending upon the passage number, with the older cells demonstrating a hormone-independent complex between the two proteins (16). Alternatively, the lack of a steroid-dependent interaction between XeMNAR and XeAR might be due to limitations in our experimental systems. Notably, although implied, these experiments do not prove that XeAR and XeMNAR are directly interacting with one another, because other molecules in the cellular extracts could be part of the XeMNAR/XeAR complex. Further studies using purified proteins will better address whether these molecules are directly interacting with one another.
Similar to human MNARs actions on the ER, XeMNAR enhanced XeAR-mediated transcription in a Src-dependent fashion. In contrast, Src did not seem to be playing a major role in regulating oocyte meiosis (Fig. 4D
); thus, XeMNARs actions in oocytes appear to be happening independently of Src. Instead, XeMNAR might be interacting with and modulating G protein-mediated signaling in oocytes. XeMNAR and Gß were specifically coimmunoprecipitated in COS cells by both anti-XeMNAR and anti-Gß antibodies. Interestingly, similar to its interaction with the XeAR, the amino-terminal half of XeMNAR appears to be important for complexing with Gß (Fig. 7
), although whether this region is sufficient to mediate nongenomic androgen actions remains to be determined.
Because 1) XeMNAR and Gß can form a complex together, 2) constitutive Gß
signaling is involved in maintaining meiotic arrest (19, 20), and 3) loss of endogenous XeMNAR enhances nongenomic responses to steroid, an intriguing model is that XeMNAR might be potentiating Gß
signaling in oocytes through either a direct interaction with the G protein or in conjunction with other undetermined molecules. Given that G
s has also been implicated in maintaining meiotic arrest, XeMNAR might be altering G
s signaling in oocytes as well (21). When androgens are added to oocytes, they bind to their cognate classical steroid receptors, which might result in conformational changes in the AR/MNAR/G protein complex leading to attenuation of the inhibitory G protein-mediated signaling (Fig. 8B
). In support of this model, reduction of XeMNAR expression by RNA interference almost completely abrogated M2R-mediated calcium mobilization (Fig. 8A
), suggesting that MNAR might indeed directly regulate Gß
-mediated signaling. Further studies need to be performed to determine whether MNAR might similarly be regulating G
s-mediated signaling. Finally, given that similar signals appear to maintain meiotic arrest in mammalian oocytes, and with recent evidence suggesting that steroids are at least capable of promoting mouse oocyte maturation independent of transcription (27), MNAR might be playing a role in regulating meiosis in mammalian oocytes as well. Notably, MNAR appears to be expressed in mouse oocytes because mRNA encoding the mouse isoform of MNAR has been detected by RT-PCR from a pool of mouse oocyte RNA (data not shown).
In summary, these studies suggest that MNAR might be a potential regulator of the now well-described cross talk between nongenomic steroid receptor signaling and G protein-mediated signaling (1, 6, 9, 10). Furthermore, these results imply that MNAR might regulate multiple nongenomic signaling pathways, depending upon both the cell type and perhaps even its location within cells.
 |
MATERIALS AND METHODS
|
|---|
Cloning of the Xenopus MNAR
The XeMNAR coding sequence was discovered by screening the GenBank expressed sequence tag database against the human MNAR sequence (AF547989). IMAGE clone 6643721 was purchased from Open Biosystems (Huntsville, AL) and the XeMNAR coding region sequenced by conventional methods (McDermott Sequencing Facility, University of Texas Southwestern Medical Center). The MNAR coding sequence was then isolated by PCR using the following primersforward, CCCTCTAGAGCCGCCATGGAACAAAAACTGATAAGCGAAGAAGACCTTGAGGTGACAATTGCCGGGATT; reverse, CCCTCTAGATCACGTGCAAGGCTCGGGCAG. Of note, the forward primer encodes the sequence for an amino-terminal Myc tag. The full-length XeMNAR sequence has been deposited into GenBank (AY949838). The cDNA was then inserted into both pcDNA3.1(+) (Invitrogen Life Technologies, Carlsbad, CA) for eukaryotic expression and the pGEMHE (28) for expression in Xenopus oocytes. The XeMNAR cDNA was also inserted into the pGEMHE vector in the reverse direction to make cRNA for the RNA interference studies. The cDNA encoding the truncated XeMNAR523stop protein was similarly cloned by PCR using the same forward primer and the reverse primer: GGGTCTAGACTACCTTCCGACAATCACTGC.
Immunohistochemistry
Rabbit antipeptide antibodies directed against amino acids 430447 (KMSTFVQLGAKKQKVSEV) and amino acids 991-1007 (DAMLADFVDCPPDDDKL) of XeMNAR were generated in collaboration with Biosynthesis Inc. (Lewisville, TX) and partially purified using Protein A Sepharose CL4B beads (Amersham Biosciences, Piscataway, NJ). XeMNAR expression in Xenopus oocytes was then examined by immunohistochemistry in collaboration with Dr. James Richardson in the Department of Pathology, University of Texas Southwestern Medical Center, using techniques describes previously (23).
XeMNAR Overexpression and RNA Interference in Xenopus Oocytes
Stage VVI oocytes were isolated from unprimed Xenopus laevis females (Nasco, Fort Atkinson, WI) using collagenase as described (29). All animals were treated with accepted standards of humane animal care, as outlined in the Ethical Guidelines. XeMNAR cRNA was generated in vitro from the aforementioned XeMNAR pGEMHE plasmid as described (19). Approximately 50 ng cRNA were then injected into oocytes, followed by incubation in modified Barths saline and HEPES (19) for 36 h. For the RNA interference assays, cRNAs were generated that encoded both the forward and reverse MNAR sequences. Equal amounts of the two RNAs were mixed together and heated to 90 C, followed by gradual cooling to room temperature. Ten nanograms of the double-stranded RNA were then injected oocytes, followed by incubation for 3648 h. MNAR expression was examined by both Western blot (for overexpression of Myc-XeMNAR) and immunohistochemistry (for detection of endogenous XeMNAR in the RNA interference studies). After the 36-h incubation, testosterone-induced maturation of oocytes was examined using the steroid at the indicated concentrations. Ethanol concentrations were held constant at 0.1%. Maturation was determined by detection of germinal vesicle breakdown after 16 h. Activation of MAPK was examined in oocytes 48 h after injection as described previously (19). Briefly, oocytes were incubated with the indicated concentrations of steroid (or ethanol alone) for 4 h, followed by cell lysis and Western blot analysis for phosphorylated p42 protein. Blots were subsequently stripped and probed for total p42 protein (19). In all of the maturation and signaling studies, 20 oocytes were used for each condition.
Coimmunoprecipitations
The clone encoding the XeGß protein was isolated by PCR from Xenopus oocyte RNA using the forward primer: GCGCGGATCCCCAGCCATGAGTGAACTAGATCAGCTAC and the reverse primer: TCTAGATTAGTTCCAGATCTAG. A Myc tag was added to the amino terminus by ligating the 5' end at the BamH1 site in the forward primer with the following oligonucleotide hybridized to its complementary oligonucleotide: CCGGGCCAGCCATGGAACAAAAACTGATAAGCGAAGAA. The XeAR was also cloned from Xenopus oocyte RNA as described (22).
COS-7 cells (ATCC, Manassas, VA) were maintained at 37 C in DMEM (Fisher Scientific, Pittsburgh, PA) containing 10% fetal calf serum (Invitrogen Life Technologies, Carlsbad, CA), 100 IU/ml penicillin, and 0.1 mg/ml streptomycin (Invitrogen Life Technologies). Transfections were performed in six-well plates using the Lipofectamine reagent (Invitrogen Life Technologies). Cells in each well were transfected with 1 µg of total DNA, with the amounts of each individual cDNA indicated in the figure legends. Assays were performed 40 h after transfection. At this time, either the indicated steroid (500 nM) or an equal volume of ethanol (0.1%) was incubated with cells for 1 h at 37 C. Cells were then washed two times with cold PBS (pH 7.4) and incubated with 1 ml per well of lysis buffer (19) containing 100 µg/ml phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 0.5 µg/ml leupeptin, and 1 µg/ml pepstatin (Sigma, St. Louis, MO) for 15 min at 4 C with shaking. Cells were removed from the plates by scraping and lysates transferred to 1.5-ml microcentrifuge tubes. Lysates were centrifuged at full speed for 15 min at 4 C and the supernatants transferred to new tubes. The lysate supernatants were then incubated for 1 h at 4 C with either preimmune antibody or commercial normal rabbit IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by incubation with Protein A Sepharose CL4B beads (Amersham Biosciences, Piscataway, NJ) for another hour at 4 C. Lysates were then microfuged at high speed for 1 min at 4 C and the supernatants were transferred to fresh tubes. The protein A Sepharose pellets were washed three times with lysis buffer and combined with an equal volume of 2x SDS loading buffer containing 10% ß-mercaptoethanol. The indicated precipitating antibodies were then added to the supernatants and incubated overnight at 4 C. Rabbit anti-Gß antibodies were a generous gift from Dr. Susan Mumby (University of Texas Southwestern Medical Center). Beads were added and incubated in the lysates for 3 h at 4 C, and then isolated, washed, and stored as above. Samples were then examined by SDS-PAGE and Western blot as described previously and indicated in the figure legends.
Immunoprecipitations of endogenous oocyte XeAR, XeMNAR, and XeGß proteins were performed as described above with a few modifications. Fifty oocytes were used for each condition. Oocytes were stimulated for 1 h with ethanol or 1 µM testosterone, and each samples lysed in 750 µl of the above lysis buffer. Lysates were centrifuged at 14,000 x g for 10 min, and the supernatants cleared by addition of an equal volume of freon (Sigma) followed by vortexing and centrifugation at 14,000 x g for 15 min. Freon-cleared lysates were then treated as above using the antibodies indicated in the legend.
Transcription Assays
AR-mediated transcription was studied in CV-1 cells using an MMTV-luciferase reporter construct as described (23). Briefly, cells were transfected by calcium phosphate precipitation containing 2 µg MMTV luciferase, 0.05 µg myc-XeAR in pcDNA 3.1(+), 5 ng of a cytomegalovirus (CMV)-ß-galactosidase expression plasmid, and either 0.45 µg pcDNA3.1(+) or 0.1 µg myc-XeMNAR in pcDNA 3.1(+) plus 0.35 µg pcDNA 3.1(+). Luciferase expression was measured as described and normalized for transfection efficiency by measuring ß-galactosidase activity (23).
45Calcium Efflux Assay
Oocytes were injected with either cRNA encoding the M2R (14 ng) or the same amount of M2R cRNA plus 14 ng of the double-stranded cRNA corresponding to XeMNAR. 45Ca efflux assays were performed after 48 h as described previously (30). Oocytes were stimulated for the indicated times with 30 µM carbachol.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Boris Cheskis (Wyeth Laboratories, Collegeville, PA) for his invaluable input.
 |
FOOTNOTES
|
|---|
S.R.H. is a W. W. Caruth, Jr. Endowed Scholar in Biomedical Research. D.H. was funded by a National Institutes of Health (NIH) Training Grant (T32 HD007190-25). This work was further supported by funding from the NIH (DK59913) and the Welch Foundation (I-1506).
First Published Online April 14, 2005
Abbreviations: AR, Androgen receptor; CMV, cytomegalovirus; DHT, dihydrotestosterone; dsXeMNAR, double-stranded cRNA corresponding to XeMNAR; ER, estrogen receptor; M2R, muscarinic 2 receptor; MMTV, mouse mammary tumor virus; MNAR, modulator of nongenomic actions of the estrogen receptor; XeAR, Xenopus AR; XeGß, Xenopus Gß subunit; XeMNAR, Xenopus MNAR.
Received for publication December 23, 2004.
Accepted for publication April 8, 2005.
 |
REFERENCES
|
|---|
- Cato AC, Nestl A, Mink S 2002 Rapid actions of steroid receptors in cellular signaling pathways. Sci STKE 2002:RE9
- Edwards DP 2005 Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 67:335376[CrossRef][Medline]
- Boonyaratanakornkit V, Scott MP, Ribon V, Sherman L, Anderson SM, Maller JL, Miller WT, Edwards DP 2001 Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell 8:269280[CrossRef][Medline]
- Pietras RJ, Szego CM 1977 Specific binding sites for oestrogen at the outer surfaces of isolated endometrial cells. Nature 265:6972[CrossRef][Medline]
- Shaul PW 1999 Rapid activation of endothelial nitric oxide synthase by estrogen. Steroids 64:2834[CrossRef][Medline]
- Wyckoff MH, Chambliss KL, Mineo C, Yuhanna IS, Mendelsohn ME, Mumby SM, Shaul PW 2001 Plasma membrane estrogen receptors are coupled to endothelial nitric-oxide synthase through G
(i). J Biol Chem 276:2707127076[Abstract/Free Full Text]
- Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK 2000 Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature 407:538541[CrossRef][Medline]
- Razandi M, Oh P, Pedram A, Schnitzer J, Levin ER 2002 ERs associate with and regulate the production of caveolin: implications for signaling and cellular actions. Mol Endocrinol 16:100115[Abstract/Free Full Text]
- Razandi M, Pedram A, Greene GL, Levin ER 1999 Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ER
and ERß expressed in Chinese hamster ovary cells. Mol Endocrinol 13:307319[Abstract/Free Full Text]
- Razandi M, Pedram A, Merchenthaler I, Greene GL, Levin ER 2004 Plasma membrane estrogen receptors exist and functions as dimers. Mol Endocrinol 18:28542865[Abstract/Free Full Text]
- Song RX, McPherson RA, Adam L, Bao Y, Shupnik M, Kumar R, Santen RJ 2002 Linkage of rapid estrogen action to MAPK activation by ER
-Shc association and Shc pathway activation. Mol Endocrinol 16:116127[Abstract/Free Full Text]
- Kousteni S, Bellido T, Plotkin LI, OBrien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104:719730[Medline]
- Vadlamudi RK, Wang RA, Mazumdar A, Kim Y, Shin J, Sahin A, Kumar R 2001 Molecular cloning and characterization of PELP1, a novel human coregulator of estrogen receptor
. J Biol Chem 276:3827238279[Abstract/Free Full Text]
- Wong CW, McNally C, Nickbarg E, Komm BS, Cheskis BJ 2002 Estrogen receptor-interacting protein that modulates its nongenomic activity-crosstalk with Src/Erk phosphorylation cascade. Proc Natl Acad Sci USA 99:1478314788[Abstract/Free Full Text]
- Barletta F, Wong CW, McNally C, Komm BS, Katzenellenbogen B, Cheskis BJ 2004 Characterization of the interactions of estrogen receptor and MNAR in the activation of cSrc. Mol Endocrinol 18:10961108[Abstract/Free Full Text]
- Unni E, Sun S, Nan B, McPhaul MJ, Cheskis B, Mancini MA, Marcelli M 2004 Changes in androgen receptor nongenotropic signaling correlate with transition of LNCaP cells to androgen independence. Cancer Res 64:71567168[Abstract/Free Full Text]
- Maller JL, Krebs EG 1980 Regulation of oocyte maturation. Curr Top Cell Regul 16:271311[Medline]
- Hammes SR 2004 Steroids and oocyte maturationa new look at an old story. Mol Endocrinol 18:769775[Abstract/Free Full Text]
- Lutz LB, Kim B, Jahani D, Hammes SR 2000 G protein ß
subunits inhibit nongenomic progesterone-induced signaling and maturation in Xenopus laevis oocytes. Evidence for a release of inhibition mechanism for cell cycle progression. J Biol Chem 275:4151241520[Abstract/Free Full Text]
- Sheng Y, Tiberi M, Booth RA, Ma C, Liu XJ 2001 Regulation of Xenopus oocyte meiosis arrest by G protein ß
subunits. Curr Biol 11:405416[CrossRef][Medline]
- Gallo CJ, Hand AR, Jones TL, Jaffe LA 1995 Stimulation of Xenopus oocyte maturation by inhibition of the G-protein
S subunit, a component of the plasma membrane and yolk platelet membranes. J Cell Biol 130:275284[Abstract/Free Full Text]
- Lutz LB, Cole LM, Gupta MK, Kwist KW, Auchus RJ, Hammes SR 2001 Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation. Proc Natl Acad Sci USA 98:1372813733[Abstract/Free Full Text]
- Lutz LB, Jamnongjit M, Yang WH, Jahani D, Gill A, Hammes SR 2003 Selective modulation of genomic and nongenomic androgen responses by androgen receptor ligands. Mol Endocrinol 17:11061116[Abstract/Free Full Text]
- Spivack JG, Erikson RL, Maller JL 1984 Microinjection of pp60v-src into Xenopus oocytes increases phosphorylation of ribosomal protein S6 and accelerates the rate of progesterone-induced meiotic maturation. Mol Cell Biol 4:16311634[Abstract/Free Full Text]
- Spivack JG, Maller JL 1985 Phosphorylation and protein synthetic events in Xenopus laevis oocytes microinjected with pp60v-src. Mol Cell Biol 5:36293633[Abstract/Free Full Text]
- Reuveny E, Slesinger PA, Inglese J, Morales JM, Iniguez-Lluhi JA, Lefkowitz RJ, Bourne HR, Jan YN, Jan LY 1994 Activation of the cloned muscarinic potassium channel by G protein ß
subunits. Nature 370:143146[CrossRef][Medline]
- Gill A, Jamnongjit M, Hammes SR 2004 Androgens promote maturation and signaling in mouse oocytes independent of transcription: a release of inhibition model for mammalian oocyte meiosis. Mol Endocrinol 18:97104[Abstract/Free Full Text]
- Liman ER, Tytgat J, Hess P 1992 Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs. Neuron 9:861871[CrossRef][Medline]
- Vu T-KH, Hung DT, Wheaton VI, Coughlin SR 1991 Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64:10571068[CrossRef][Medline]
- Nanevicz T, Wang L, Chen M, Ishii M, Coughlin SR 1996 Thrombin receptor activating mutations. Alteration of an extracellular agonist recognition domain causes constitutive signaling. J Biol Chem 271:702706[Abstract/Free Full Text]
NURSA Molecule Pages Link:
- Nuclear Receptors:
AR
- Coregulators:
PELP1
- Ligands:
Dihydrotestosterone
This article has been cited by other articles:

|
 |

|
 |
 
M. Li, J.-S. Ai, B.-Z. Xu, B. Xiong, S. Yin, S.-L. Lin, Y. Hou, D.-Y. Chen, H. Schatten, and Q.-Y. Sun
Testosterone Potentially Triggers Meiotic Resumption by Activation of Intra-Oocyte SRC and MAPK in Porcine Oocytes
Biol Reprod,
November 1, 2008;
79(5):
897 - 905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. R. Levin
Rapid signaling by steroid receptors
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2008;
295(5):
R1425 - R1430.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deng, S. Lang, C. Wylie, and S. R. Hammes
The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes
Mol. Endocrinol.,
August 1, 2008;
22(8):
1853 - 1865.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev.,
December 1, 2007;
28(7):
726 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-G. Liang, Y.-Q. Su, H.-Y. Fan, H. Schatten, and Q.-Y. Sun
Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase
Mol. Endocrinol.,
September 1, 2007;
21(9):
2037 - 2055.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Silva and M. A. Shupnik
Integration of Steroid and Growth Factor Pathways in Breast Cancer: Focus on Signal Transducers and Activators of Transcription and Their Potential Role in Resistance
Mol. Endocrinol.,
July 1, 2007;
21(7):
1499 - 1512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Greger, N. Fursov, N. Cooch, S. McLarney, L. P. Freedman, D. P. Edwards, and B. J. Cheskis
Phosphorylation of MNAR Promotes Estrogen Activation of Phosphatidylinositol 3-Kinase
Mol. Cell. Biol.,
March 1, 2007;
27(5):
1904 - 1913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Vasudevan and D. W. Pfaff
Membrane-Initiated Actions of Estrogens in Neuroendocrinology: Emerging Principles
Endocr. Rev.,
February 1, 2007;
28(1):
1 - 19.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Evaul, M. Jamnongjit, B. Bhagavath, and S. R. Hammes
Testosterone and Progesterone Rapidly Attenuate Plasma Membrane G{beta}{gamma}-Mediated Signaling in Xenopus laevis Oocytes by Signaling through Classical Steroid Receptors
Mol. Endocrinol.,
January 1, 2007;
21(1):
186 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rasar, D. B. DeFranco, and S. R. Hammes
Paxillin Regulates Steroid-triggered Meiotic Resumption in Oocytes by Enhancing an All-or-None Positive Feedback Kinase Loop
J. Biol. Chem.,
December 22, 2006;
281(51):
39455 - 39464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kraus, D. Gioeli, T. Vomastek, V. Gordon, and M. J. Weber
Receptor for Activated C Kinase 1 (RACK1) and Src Regulate the Tyrosine Phosphorylation and Function of the Androgen Receptor.
Cancer Res.,
November 15, 2006;
66(22):
11047 - 11054.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Gururaj, S. K. Rayala, R. K. Vadlamudi, and R. Kumar
Novel Mechanisms of Resistance to Endocrine Therapy: Genomic and Nongenomic Considerations
Clin. Cancer Res.,
February 1, 2006;
12(3):
1001s - 1007s.
[Abstract]
[Full Text]
[PDF]
|
 |
|