Molecular Endocrinology, doi:10.1210/me.2004-0502
Molecular Endocrinology 19 (8): 2175-2186
Copyright © 2005 by The Endocrine Society
Endogenous CCAAT/Enhancer Binding Protein ß and p300 Are Both Regulated by Growth Hormone to Mediate Transcriptional Activation
Tracy Xiao Cui,
Graciela Piwien-Pilipuk,
Jeffrey S. Huo,
Julianne Kaplani,
Roland Kwok and
Jessica Schwartz
Department of Molecular & Integrative Physiology (T.X.C., G.P.-P., J.K., J.S.), Program in Cellular and Molecular Biology (J.S.H., J.S.), Departments of Biological Chemistry and Obstetrics & Gynecology (R.K.), University of Michigan, Ann Arbor, Michigan 48109
Address all correspondence and requests for reprints to: Dr. Jessica Schwartz, Department of Molecular & Integrative Physiology, University of Michigan Medical School, Ann Arbor, Michigan 48109-0622. E-mail: jeschwar{at}umich.edu.
 |
ABSTRACT
|
|---|
The regulation of c-fos transcription by GH involves multiple factors, including CCAAT/enhancer binding protein (C/EBP) ß. Knockdown of C/EBPß by RNA interference prevents stimulation of endogenous c-fos mRNA by GH, indicating a key role for C/EBPß in GH-stimulated c-fos transcription. GH rapidly increases the occupancy of both endogenous C/EBPß and p300 on the c-fos promoter in 3T3-F442A preadipocytes as indicated by chromatin immunoprecipitation. The transient occupancy of p300 on c-fos and the presence of p300 in the anti-C/EBPß immunoprecipitate coincide with the transient increase in c-fos transcription with GH, suggesting that a nuclear complex containing both p300 and C/EBPß occupies the c-fos promoter in response to GH. Expression of p300 with C/EBPß markedly increases c-fos promoter activity when neither alone is effective, indicating that p300 coactivates C/EBPß-mediated c-fos promoter activation. Such coactivation can determine a baseline for c-fos activation by GH. Furthermore, the occupancy of phosphorylated murine C/EBPß (T188) on c-fos upon GH treatment is simultaneous with increased occupancy by p300, suggesting that phospho-C/EBPß recruits p300 in response to GH. Thus, endogenous C/EBPß and p300 on c-fos are dynamically regulated by GH to determine transcriptional activation. Phosphorylated C/EBPß and p300 appear to function as part of a regulated complex that mediates GH-stimulated transcription.
 |
INTRODUCTION
|
|---|
EUKARYOTIC TRANSCRIPTION involves coordination of multicomponent complexes that include transcription factors, coactivators, corepressors, and other nuclear proteins, which in combination enhance or repress transcription (1, 2, 3, 4, 5). The coactivators p300 and the homologous cAMP response element binding protein-binding protein (CBP) have been documented to enhance transcription through interactions with a variety of DNA-bound transcription factors, facilitating activation of the basal transcription machinery (6, 7). The formation and components of such complexes provide potential targets for regulation of transcription, in some instances by recruitment of factors to complexes, or by modification of components of the complexes, which leads to changes in their function. For example, estrogen modulates cyclical recruitment to the estrogen receptor of coactivators, chromatin remodeling factors, and components of the mediator complex on the cathepsin D and pS2 promoters (8, 9). In addition, modifications such as phosphorylation, acetylation, and sumoylation can alter the function of transcription factors, coregulators, and other components of nucleoprotein complexes (10, 11, 12). Some of the effects of coactivators on transcription are related to their ability to function as acetyltransferases that acetylate histones or other proteins, leading to changes such as chromatin remodeling (13, 14, 15, 16).
GH regulates normal growth by modulating gene expression. Among GH-responsive genes, c-fos is rapidly and transiently stimulated in various cell types (17, 18), including 3T3-F442A preadipocytes which require GH to differentiate to adipocytes (19). The activation of c-fos by GH is mediated by an enhancer/promoter region, which contains multiple sequences that are regulated by transcription factors in a GH-dependent manner, based on in vitro studies. Among these GH-regulated factors are CCAAT/enhancer binding protein (C/EBP) ß and C/EBP
, which bind to the C/EBP site (20, 21, 22); serum response factor (SRF) and Elk-1, which bind to the serum response element (SRE) (23, 24, 25); and signal transducers and activators of transcription (Stats) 1 and 3, which bind to the Sis-inducible element (26, 27, 28). Although each of these factors can mediate transcriptional activation in response to GH, whether and how they are coordinated to regulate c-fos expression is not known. The possibility that p300 plays a coordinating role is suggested by observations that each of these transcription factors can interact individually with the coactivators p300/CBP (29, 30, 31, 32, 33, 34). Therefore, determining whether p300 is involved in GH-regulated events in c-fos promoter activation can provide insight into whether a nucleoprotein complex contributes to the coordinated regulation of c-fos by GH.
Among the GH-regulated transcription factors binding to the c-fos promoter, C/EBPß has been well studied. GH stimulates the binding of murine C/EBPß to the c-fos C/EBP site and stimulates its phosphorylation via MAPK at Thr188 to determine its transcriptional activation (20, 35, 36). This study establishes a critical role for C/EBPß in GH-stimulated expression of endogenous c-fos mRNA, and in c-fos promoter activation because these responses to GH are blocked when C/EBPß is knocked down by RNA interference. Endogenous C/EBPß and endogenous p300 are shown to occupy the c-fos promoter in response to GH. Not only does GH dynamically induce the rapid and transient occupancy of endogenous C/EBPß and p300 on c-fos in a manner that corresponds with GH-stimulated transcription, but p300 coactivates C/EBPß on c-fos, establishing a transcriptional baseline that determines the extent of GH-stimulated c-fos expression. The presence of phosphorylated C/EBPß on c-fos in response to GH suggests that phospho-C/EBPß and p300 function as part of a regulated nuclear complex that mediates GH-stimulated transcription.
 |
RESULTS
|
|---|
GH-Stimulated c-fos Expression Is Dependent on C/EBPß
The transcription of c-fos is stimulated by GH rapidly and transiently in various cell types, including 3T3-F442A preadipocytes (17, 18, 37) and Chinese hamster ovary (CHO) cell lines stably expressing GH receptors (CHO-GHR) (38). Quantitative real-time PCR (QT-PCR) confirms that c-fos mRNA expression peaks 30 min after GH treatment in 3T3-F442A and CHO-GHR cells, then subsides within 1 h and is almost undetectable at later times (Fig. 1A
), consistent with previous Northern analysis (17, 37, 38). The pattern of the response to GH is comparable in both cell types, although the magnitude of the response to GH is about five times greater in highly responsive 3T3-F442A preadipocytes than in CHO-GHR cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1. GH-Induced c-fos Expression Depends on C/EBPß
A, 3T3-F442A or CHO-GHR cells were treated with GH for various times (min). Total RNA was prepared and used for QT-PCR with c-fos primers. c-fos Expression was analyzed for each sample and normalized to GAPDH. The increase in c-fos mRNA expression due to GH is presented as the ratio of GH to control (GH/C) for each time point. Similar results were obtained in three independent experiments. B, Plasmid siC/EBPß or vector mU6pro was expressed in CHO-GHR cells. Cells were treated 48 h later with or without GH for 30 min, and RNA was prepared for QT-PCR with c-fos primers. Expression of c-fos mRNA with GH or siC/EBPß is presented relative to vector in untreated cells. Similar results were obtained in three independent experiments. C, CHO-GHR cells were transfected with the plasmid siC/EBPß or vector (200 ng each) in the presence of fos-Luc (0.4 µg) and CMV-ßgal (0.1 µg). Cells were treated with (black bars) or without (open bars) GH and analyzed for luciferase activity as described. c-fos Promoter activation is expressed as RLU compared with vector control = 1. Data are expressed as mean ± SE in this and subsequent figures (n = 3 independent experiments). The increase due to GH is significant (P < 0.05) in cells transfected with vector, but not in cells transfected with siC/EBPß. D, Plasmid siC/EBPß (siß) or vector (V, 5 µg each) was coexpressed with or without CMV-C/EBPß in indicated amounts (µg) in CHO-GHR cells. Nuclear extracts were analyzed by immunoblotting using anti-C/EBPß (1:1000, upper panel). Antibody against -tubulin (1:1000) was used to determine loading (lower panel).
|
|
The GH-regulated transcription factor C/EBPß is expressed in both 3T3-F442A (20, 39, 40) and CHO-GHR cells (data not shown). The dependence of GH-stimulated endogenous c-fos expression on cellular C/EBPß is demonstrated by blockade of the response to GH in the absence of C/EBPß. RNA interference against C/EBPß using a hairpin short interfering RNA (siC/EBPß) inhibits GH-induced expression of endogenous c-fos mRNA in CHO-GHR cells detected by QT-PCR (Fig. 1B
). Consistent with its inhibition of endogenous c-fos mRNA expression, siC/EBPß also inhibits the ability of GH to stimulate c-fos promoter activation when a luciferase reporter gene driven by a c-fos enhancer sequence (379 to +1, fos-Luc) is coexpressed with siC/EBPß in GH-treated CHO-GHR cells (Fig. 1C
). Interestingly, the basal c-fos expression is not altered by siC/EBPß (Fig. 1
, B and C). In the same experimental setting, neutralization of cellular C/EBPß protein is demonstrated by the fact that when increasing amounts of C/EBPß are expressed (Fig. 1D
, lanes 36), siC/EBPß completely reduces C/EBPß even when the endogenous protein levels of C/EBPß are too low to be detected under these conditions (Fig. 1D
, lanes 12). Taken together, these findings demonstrate that endogenous C/EBPß plays a key role in GH-stimulated c-fos expression.
GH Increases the Occupancy of Endogenous C/EBPß on the c-fos Promoter
To examine in vivo how GH promotes c-fos activation via C/EBPß, the occupancy of endogenous C/EBPß on the c-fos promoter was evaluated using chromatin immunoprecipitation (ChIP). Chromatin-bound proteins were immunoprecipitated with anti-C/EBPß from nuclei of 3T3-F442A cells treated with or without GH for various times. DNA fragments associated with immunoprecipitated proteins were amplified by PCR using primers (p5 and p3), which generate a 330-bp fragment of the c-fos promoter (Fig. 2
; and supplemental Fig. 8A published on The Endocrine Societys Journals Online web site at http://mend.endojournals.org). Endogenous C/EBPß immunoprecipitates with c-fos promoter DNA in untreated cells (Fig. 2
, t = 0), consistent with previous observations by EMSA of constitutive binding of C/EBPß (20, 35). Nevertheless, within 15 min of GH treatment, the amount of endogenous C/EBPß which occupies the c-fos promoter in vivo is consistently greater in GH-treated cells than in controls. The occupancy of C/EBPß on the c-fos promoter peaks at 30 min and subsides by 60 min but remains elevated relative to untreated cells. Immunoblotting shows that the amount of endogenous C/EBPß in the immunoprecipitates used for the ChIP assay does not change with GH treatment (supplemental Fig. 9), indicating that it is the amount of C/EBPß occupying the c-fos promoter that increases. By ChIP, the bands representing c-fos promoter DNA identified with anti-C/EBPß contrast with the complete lack of signal when no antibody (Fig. 2
; control) or normal rabbit IgG (data not shown) is used in place of anti-C/EBPß. The amounts of phosphorylated RNA polymerase II (P-Pol II) and acetylated histone 4 (Ac-H4) associated with the c-fos promoter also increase 15 and 30 min after GH treatment and subside by 60 min. This timing for activation of Pol II by phosphorylation and for acetylation of H4 associated with the c-fos promoter parallels the timing of the activation of c-fos transcription by GH (17). Taken together, these findings indicate that GH increases the occupancy of endogenous C/EBPß on c-fos, most likely by recruiting additional C/EBPß to the c-fos promoter as it initiates transcription.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2. GH Increases Occupancy of Endogenous C/EBPß and p300 on the c-fos Promoter
Schematic at top shows the c-fos promoter (379 to +1) containing multiple GH-regulated sites including a C/EBP site (not to scale). Arrows indicate the locations of primers (p5 and p3) used for ChIP PCR. For ChIP (lower panels), 3T3-F442A cells were treated with GH for the indicated times (min). ChIP was performed using anti-C/EBPß (4 µg), anti-p300 (6 µg), anti-P-Pol II (4 µg), anti-Ac-H4 (3 µg), or no antibody (control). Proteins recognized by IP are indicated on right. 1% Input is shown in bottom panel. Purified DNA was used for PCR (33 cycles). Similar data were obtained in four other experiments.
|
|
GH Induces the Transient Occupancy of Endogenous p300 on the c-fos Promoter
Transcription complexes are thought to assemble on promoters by association of nuclear proteins, including coactivators such as p300, with the DNA-bound transcription factors such as C/EBPß. In fact, p300 can associate with C/EBPß (data not shown; and Refs. 29 and 30). The occupancy of p300 with the c-fos promoter in response to GH was therefore examined for insight into whether GH regulates the appearance of a coactivator on c-fos, possibly in conjunction with C/EBPß and activation of transcription. GH was found to increase the occupancy of endogenous p300 on the c-fos promoter within 15 min (Fig. 2
; p300). Not only does the GH-stimulated increase in p300 coincide with the rapid increase in transcription of c-fos in response to GH, but the association of p300 with the promoter subsides to control levels by 60 min, as c-fos transcription does. The same time course for p300 was detected with two different antibodies against p300 (data not shown), suggesting that the changes in p300 are unlikely to reflect factors such as epitope masking during hormone treatment and cross-linking (41). p300 Appears to be slightly detectable on the c-fos promoter in untreated cells. The protein levels of p300 in the lysates for ChIP are not altered by GH treatment (data not shown). These findings indicate that GH increases the occupancy of p300 on the promoter at the same time (1530 min) that it increases the occupancy of C/EBPß on c-fos, opening the possibility that GH promotes rapid assembly of C/EBPß and p300 on c-fos as part of a transcription complex.
The ability of GH to increase the occupancy of p300 on the c-fos promoter suggests that p300 may be involved in GH-stimulated c-fos transcription. Consistent with the latter, expression of the adenoviral E1A oncoprotein, which interacts with p300 and can repress its coactivator functions (42, 43), inhibits the GH-induced expression of endogenous c-fos mRNA in CHO-GHR cells (Fig. 3A
). The stimulation by GH of c-fos promoter activation was also blocked by coexpression of E1A with fos-Luc in CHO-GHR cells (Fig. 3B
). Thus, inhibition of GH stimulation by E1A is suggestive that p300 contributes to GH-stimulated c-fos expression. The transient nature of GH-stimulated c-fos transcription may therefore be related to the transient increase in the occupancy of p300 observed on the c-fos promoter in response to GH.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 3. E1A Interferes with GH-Stimulated c-fos Expression
A, Plasmid E1A or vector pRc/RSV (5 µg each) was expressed in CHO-GHR cells. Cells were treated without (open bars) or with (black bars) GH for 30 min, and RNA was prepared for QT-PCR with c-fos and GAPDH primers. Expression of endogenous c-fos mRNA is presented relative to vector-transfected cells without GH treatment (C = 1). Similar data were obtained in three independent experiments. B, The plasmid fos-Luc was expressed with a plasmid for E1A or vector (0.5 µg each) in CHO-GHR cells. Cells were treated without (C, open bars) or with GH (black bars) and luciferase measured (n = 3 experiments). The increase due to GH (P < 0.05) in controls with vector is significantly inhibited (P < 0.05) in the presence of E1A.
|
|
A Complex Containing Endogenous C/EBPß and p300 Occupies the c-fos Promoter upon GH Treatment
Because C/EBPß binds directly to the c-fos promoter, and because C/EBPß and p300 can form a complex, it is likely that the association of p300 with c-fos DNA is mediated by a DNA-bound factor, such as C/EBPß. To assess whether C/EBPß and p300 occupy the same c-fos promoter DNA, a Re-ChIP assay was employed. After GH treatment, cross-linked nuclear lysates were first immunoprecipitated with anti-C/EBPß. Then the immunoprecipitate was washed and the DNA with the associated protein complex was eluted from the beads and subjected to a second immunoprecipitation with anti-p300 before processing for PCR. The first IP confirms that GH increases the occupancy of C/EBPß on c-fos promoter DNA within 15 min (Fig. 4
; 1st IP). The second IP identifies p300 in the C/EBPß immunoprecipitate (Fig. 4
; 2nd IP, bottom), indicating that a complex containing both p300 and C/EBPß occupies the same c-fos promoter DNA. Conversely, when the first anti-p300 immunoprecipitate was similarly reimmunoprecipitated with anti-C/EBPß, C/EBPß was also identified in the p300 complex associated with c-fos DNA (Fig. 4
; 2nd IP, top). These findings indicate that in response to 15 min GH treatment, a complex containing both p300 and C/EBPß occupies c-fos promoter DNA.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 4. GH Promotes the Occupancy of a Complex Containing both C/EBPß and p300 on the c-fos Promoter in Vivo
3T3-F442A cells were treated with GH for 0 or 15 min. Primary ChIP was performed using anti-C/EBPß (4 µg), anti-p300 (4 µg) or anti-P-Pol II (4 µg) as described for Fig. 2 . The beads from the first IP were washed and eluted for the second IP as described. The eluate from the first IP with anti-C/EBPß was used for the second IP with anti-p300 (4 µg) or no antibody as control (2nd IP, bottom). The eluate from the first IP with anti-p300 was used for the second IP with anti-C/EBPß (4 µg) or no antibody as control (2nd IP, top). Proteins recognized by IP are indicated on right. 1% Input is also shown. Results of PCR (35 cycles) are shown. Brackets indicate which of the first IP was used for second IP. Similar data were obtained in another experiment.
|
|
p300 Coactivates C/EBPß-Mediated c-fos Promoter Activation in the Absence and Presence of GH
Because endogenous C/EBPß and p300 occupy the same c-fos promoter after GH treatment, it was of interest to examine whether p300 modulates C/EBPß-mediated c-fos promoter activation. Expression of C/EBPß alone, or of increasing amounts of p300 alone, slightly increases c-fos promoter activity compared with control (Fig. 5A
). In contrast, when the same amounts of p300 are coexpressed in combination with C/EBPß, c-fos promoter activity is markedly increased (Fig. 5A
, black bars). The enhanced activation of transcription with p300 increases as the amount of p300 is increased. The increase in transcription with the combined expression of C/EBPß and p300 was much greater than the modest increase observed with expression of either alone. Immunoblotting shows that the protein level of C/EBPß is not increased by p300 (supplemental Fig. 10). Overall, these results indicate that p300 coactivates C/EBPß-mediated c-fos promoter activation. The role of p300 is substantiated by reversal of coactivation when E1A is coexpressed with C/EBPß and p300 (Fig. 5B
). Taken together, these findings indicate that p300 can interact with C/EBPß and coactivate transcription on the c-fos promoter.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5. p300 Coactivates C/EBPß-Mediated c-fos Promoter Activity
A, Plasmids for C/EBPß (ß, light gray bar, 5 ng) and p300 (gray bars) were transfected at 0.1, 0.5, or 1 µg/well, alone or in combination (black bars), together with fos-Luc (open bar) in CHO-GHR cells. Luciferase activity 48 h after transfection is shown. The increase in c-fos promoter activation over control is significant only with the combination of C/EBPß and p300, when p300 is used at 0.5 µg (P < 0.05) and 1.0 µg (P < 0.01). B, The plasmid fos-Luc was expressed with plasmids for C/EBPß (ß, 5 ng) plus p300 (1 µg) (ß + p300), or control DNA, in CHO-HGR cells. Additionally, E1A or its vector (0.5 µg each) was coexpressed. Control RLU without E1A is set at 1.0 (n = 3 experiments). The coactivation in the presence of C/EBPß plus p300 is significantly (P < 0.01) inhibited by E1A.
|
|
To examine whether the coactivation of C/EBPß by p300 contributes to GH-stimulated c-fos promoter activation, cells were additionally treated with GH. GH typically elicits a significant and reproducible doubling of the activation of the c-fos promoter compared with untreated cells (Fig. 6
). Stimulation by GH (Fig. 6
, black bars) also occurs when C/EBPß or p300 alone is expressed. Even when coactivation in the combined presence of C/EBPß and p300 raises the level of c-fos promoter activity, GH significantly increases transcription above the elevated level (Fig. 6
, rightmost pair of bars). It appears that C/EBPß and p300 modulate transcription via the c-fos promoter in untreated cells, resetting the basal levels, which are highest when they are expressed in combination. GH appears to activate transcription above whatever basal level prevails. These findings raise the possibility that beyond coactivation, an additional GH-dependent event occurs upon occupancy of C/EBPß and p300 on the c-fos promoter.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6. GH Increases c-fos Promoter Activation in the Presence of C/EBPß and p300
The plasmid fos-Luc was coexpressed with C/EBPß (5 ng) or p300 (0.5 µg) alone or in combination in CHO-GHR cells. Cells were treated 48 h later without (open bars) or with GH (black bars) and luciferase was measured (n = 3). The increase due to GH is statistically significant (P < 0.04) for each pair.
|
|
GH Promotes Transient Occupancy of Phosphorylated C/EBPß on the c-fos Promoter in Vivo
GH transiently increases MAPK-dependent phosphorylation of mouse C/EBPß on Thr188 (P-C/EBPß, corresponding to Thr235 of human C/EBPß), a modification which is required for c-fos promoter activation by C/EBPß in response to GH (36). To determine whether GH regulates the occupancy of endogenous P-C/EBPß on the c-fos promoter in vivo, ChIP was performed with an antibody specific for P-C/EBPß. GH was found to increase the presence of endogenous P-C/EBPß on the c-fos promoter within 15 min of treatment, as detected by ChIP (Fig. 7
). The presence of P-C/EBPß was barely evident without GH treatment and was almost undetectable 60 min after GH. The timing of the transient occupancy by P-C/EBPß in vivo is consistent with previous findings that GH transiently increases phosphorylation of C/EBPß at Thr188 in 15 min, and that P-C/EBPß transiently binds to the c-fos C/EBP site in vitro (36). The pattern of occupancy of P-C/EBPß on the c-fos promoter in vivo coincides with the transient pattern of occupancy of p300 on the same region of the c-fos promoter DNA (Figs. 2
, 4
, and 7
), and coincides with the timing of GH-induced c-fos transcription. These findings suggest that a posttranslational modification such as phosphorylation, stimulated by GH on C/EBPß, might play a role in GH-stimulated c-fos gene expression in vivo, possibly by recruiting factors such as p300 into a complex on c-fos promoter DNA.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 7. GH Induces the Occupancy of Phosphorylated C/EBPß on the c-fos Promoter in Vivo
3T3-F442A cells were treated with GH for 0, 15, or 60 min. ChIP was performed using anti-P-C/EBPß (4 µg), anti-C/EBPß (4 µg), anti-p300 (6 µg), anti-P-Pol II (4 µg), or no antibody (control). Proteins recognized by IP are indicated on right. 1% Input is also shown. Purified DNA was used for PCR (33 cycles). Similar data were obtained in two other experiments.
|
|
 |
DISCUSSION
|
|---|
Endogenous C/EBPß Is Essential for GH-Stimulated c-fos Transcription
These studies establish the physiological relevance of endogenous C/EBPß for the stimulation of c-fos transcription by GH. Neutralization of C/EBPß by RNA interference blocks both the ability of GH to stimulate endogenous c-fos mRNA expression, and to activate the c-fos promoter. The requirement for C/EBPß in vivo is consistent with reduction of GH-stimulated c-fos promoter activation when the C/EBP site is mutated to prevent the binding of C/EBPß (data not shown). Interestingly, neutralization of C/EBPß by siC/EBPß does not alter basal c-fos mRNA expression or promoter activation, suggesting that C/EBPß is necessary to mediate regulated, but not basal c-fos transcription. The present studies suggest that phosphorylation of endogenous C/EBPß in vivo is one of the events involved in the regulation of c-fos transcription by GH.
The importance of C/EBPß for GH-stimulated c-fos expression is consistent with another novel finding in this study, that GH regulates the occupancy of endogenous C/EBPß on c-fos promoter DNA in vivo. Upon addition of GH to 3T3-F442A cells, the occupancy of C/EBPß on the c-fos promoter increases within 15 min, coincident with the timing of activation of c-fos transcription by GH (17). The C/EBPß associated with c-fos increases even though the total amount of C/EBPß present in GH-treated cells is unaltered. This implies that C/EBPß is redistributed within the nucleus in response to GH, and may be related to our previous observations of rapid (515 min) relocalization of C/EBPß in nuclei of 3T3-F442A cells treated with GH (44). C/EBPß remains associated with c-fos DNA 60 min after GH, even though GH-induced transcription has subsided by this time. This difference in timing implicates regulatory events in addition to enhanced binding to DNA in modulating the dynamics of C/EBPß in the transcriptional response to GH.
In addition to C/EBPß, GH also regulates other transcription factors that can mediate activation of c-fos transcription on the same c-fos promoter sequence (379 bp to +1 bp), including Elk-1 (25), SRF (23, 24), Stats 1 and 3 (26, 27, 45, 46), and C/EBP
(20), which is not neutralized by siC/EBPß (Kaplani, J., and J. Schwartz, data not shown). C/EBPß may work in coordination with these or other transcription factors on c-fos in responding to GH because interactions of C/EBPß with SRF and Elk-1 have been reported (47, 48). Neutralization of C/EBPß by siC/EBPß may disrupt its ability to form a complex with other proteins associated with c-fos, thereby interfering with transcription of the gene. The substantial reduction in c-fos expression when C/EBPß function is impaired reinforces that C/EBPß has a central role in stimulation of c-fos transcription by GH, and that C/EBPß makes a major contribution in this regard in an endogenous setting. C/EBPß may play a similar role in the regulation by GH of other genes known to bind C/EBPß, such as genes for Spi2.1 (49), IGF-I (50), or alcohol dehydrogenase (51).
GH Promotes the Recruitment of Endogenous p300 to the c-fos Promoter
GH was found to increase the occupancy of p300 on the c-fos promoter in vivo. The timing of the response to GH is notable both because p300 increases within 15 min of GH treatment and because p300 is no longer evident 60 min after GH. The rapid and transient appearance of p300 on c-fos coincides with the timing of GH-stimulated transcription of c-fos (17), making it tempting to speculate that the presence of p300 is a feature that determines the pattern of c-fos transcription.
The appearance of p300 and C/EBPß on the c-fos promoter in response to GH is accompanied by a simultaneous increase in the presence of Ac-H4 and phosphorylated RNA Pol II on c-fos. Acetylation of lysines on the tails of H4 at the nucleosome core (52) is believed to mediate c-fos activation by facilitating the unwinding of DNA in chromatin, allowing regulated transcription factors, such as C/EBPß, to associate with the promoter. The parallel timing of the increase in P-Pol II, an indicator of transcription initiation, on the c-fos promoter in response to GH suggests that the simultaneous occupancy of these proteins on c-fos is part of a coordinated set of changes in proteins associated with the DNA that leads to the rapid and transient increase in transcription with GH treatment.
These studies also show that p300 and C/EBPß occupy the same c-fos promoter DNA in response to GH, suggesting that they are part of a complex. Furthermore, GH simultaneously increases the occupancy of p300 and C/EBPß. It is not clear whether C/EBPß and p300 form a complex upon the binding of C/EBPß to the DNA, or whether a preformed complex of endogenous C/EBPß and p300 associates with the DNA in response to GH. Because GH regulates the phosphorylation of C/EBPß, this modification may be a factor in its ability to recruit p300 in response to GH, as it appears to be for association of C/EBPß with SRF (53) and components of the mediator complex (54) in Ras-expressing cells. It is also possible that the association of p300 with other proteins bound to c-fos is involved in the formation of complexes containing p300 and enhances c-fos transcription because p300 serves widely as a scaffold for nucleoprotein complexes (55, 56). The pattern of transient recruitment of p300 in response to GH follows a kinetic profile comparable to that reported for c-fos after T cell activation. This transient pattern is distinct from a sustained recruitment of p300 to the promoters for p21 and other genes (57). An alternative pattern is evident on the phosphoenolpyruvate carboxykinase promoter, where occupancy by CBP is reduced by insulin, in part by displacement of the activating liver-enriched activating protein form of C/EBPß with the inhibitory liver-enriched transcriptional inhibitory protein form (41). These observations indicate the importance of the distinct pattern of occupancy by p300 and simultaneous occupancy by phosphorylated C/EBPß in response to GH for determining c-fos transcription.
p300 Coactivates C/EBPß on the c-fos Promoter
The interaction of C/EBPß and p300 on the native c-fos promoter can result in coactivation. Others have reported coactivation of C/EBPß by p300 on other promoters (29, 30). Here, coactivation may be related to the simultaneous recruitment of p300 and C/EBPß to the c-fos promoter. These studies suggest that the formation of a complex containing C/EBPß and p300 on the c-fos promoter determines transcription in untreated cells expressing the proteins. When C/EBPß is overexpressed in 293T cells, it is constitutively phosphorylated at the MAPK site as well as other sites (36). Phosphorylation of at least some of the expressed C/EBPß at T188 was also observed in CHO-GHR cells (data not shown). Whether constitutive phosphorylation of C/EBPß expressed in CHO-GHR cells in these experiments is required for the coactivation remains to be determined. Conversely, the association of C/EBPß with p300 or CBP promotes avid phosphorylation of these coactivators, which contributes to their ability to coactivate C/EBPß-dependent transcription (30, 58). Other modifications, such as acetylation of either C/EBPß [Cesena, T. I., and J. Schwartz, unpublished observations (59)] or p300/CBP (60, 61, 62), possibly mediated by the acetyltransferase activity associated with p300/CBP, which can contribute to c-fos activation (63), may also contribute to recruitment and/or coactivation.
C/EBPß Phosphorylation May Mediate Recruitment of p300 for GH-Induced c-fos Promoter Activation
In cells expressing C/EBPß or p300 alone or in combination, GH stimulates c-fos promoter activation. The ability of GH to increase c-fos transcription two to three times basal values is consistently observed and depends on C/EBPß. The actual level of transcription achieved in the presence of GH varies depending on the prevailing basal level of transcription in the cell, which in turn is determined by the expression of C/EBPß and p300 in these experiments. The changing baseline affords great flexibility and range to the responsiveness of the c-fos promoter to a regulator such as GH. Presumably, when overexpressed, C/EBPß and p300 associate with c-fos either alone or in combination, and determine transcription in the absence of GH. In response to GH, the additional C/EBPß and p300 that rapidly occupy the c-fos promoter appear to mediate the increase in promoter activation above basal levels.
In addition to recruitment, the GH-dependent event that may trigger the increase in transcription above basal levels is likely to be related to the phosphorylation of C/EBPß. Its transient phosphorylation at T188 in response to GH, mediated by ERKs 1 and 2, has been found to determine its binding and is required for GH-stimulated c-fos transcription (36). It has been proposed that phosphorylation of C/EBPß at this site is associated with activation of transcription by derepression (64, 65). The present studies show that the GH-stimulated increase in occupancy by phosphorylated C/EBPß on c-fos is simultaneous with the ability of GH to increase the occupancy of p300 on the promoter. Furthermore, C/EBPß and p300 occupy the same promoter DNA in GH-treated cells. Thus, the transient time course for GH-stimulated phosphorylation that parallels p300 occupancy also parallels the time course of GH-stimulated transcription of c-fos. Taken together, these observations suggest that phosphorylation of C/EBPß may determine the ability of GH to recruit p300 and to increase transcription. Thus, phosphorylation of C/EBPß at T188 may contribute to formation of an active regulatory complex on c-fos promoter DNA, leading to the transient stimulation of c-fos expression in response to GH. Different proteins may be recruited to a complex when C/EBPß is phosphorylated. In this context, it is of interest that dephosphorylation of C/EBPß, likely at a GSK3 site, is observed 60 min after GH treatment (supplemental Fig. 9, lane 3; and Ref. 35), and might contribute to reducing c-fos expression by altering the complex on the promoter.
GH may also induce additional phosphorylation at other sites on C/EBPß, or other modifications of C/EBPß and/or p300, as well as participation of other proteins in a complex with them. A newly assembled complex may enable GH to stimulate transcription beyond the prevailing baseline level. These events may mediate integration of the function of C/EBPß with other transcription factors or nuclear proteins that are regulated in diverse ways upon GH treatment (22). Such events may involve formation of an enhanceosome (3, 66, 67) containing additional nuclear proteins, including other coregulators (66), associated deacetylases (59) or other enzymatic activities, and/or architectural proteins such as high-mobility group protein I (HMG I/Y) (68). The present findings that GH elicits a simultaneous increase in the occupancy of both endogenous P-C/EBPß and p300 on c-fos, and that C/EBPß and p300 on c-fos determine a baseline for promoter activation in response to GH, are likely to be components among multiple events which are integrated in the nucleus to contribute to GH-regulated transcription.
 |
MATERIALS AND METHODS
|
|---|
Materials
Murine 3T3-F442A preadipocytes were provided by H. Green (Harvard University, Cambridge, MA) and M. Sonenberg (Sloan-Kettering, New York, NY). CHO cells stably expressing a truncated GH receptor (CHO-GHR, GHR1454) were provided by G. Norstedt (Karolinska Institute, Stockholm, Sweden) and N. Billestrup (Novo Nordisk, Gentofte, Denmark) (69) and used as described (35, 38). Human GH was generously provided by Eli Lilly Inc. (Indianapolis, IN). Culture media, calf serum, fetal calf serum, L-glutamine, and antibiotic-antimycotic were purchased from Invitrogen (Carlsbad, CA). BSA (CRG7) was from Serologicals Corp. (Norcross, GA). The protease inhibitors leupeptin and aprotinin were purchased from Roche Molecular Biochemicals (Indianapolis, IN), phenylmethylsulfonylfluoride (PMSF) from Mallinckrodt, and sodium orthovanadate from Sigma (St. Louis, MO). RNA STAT60 was purchased from Tel-Test B, Inc. (Friendswood, TX), and Taqman Reverse Transcription Kit and SYBR green I from Applied Biosystems (Foster City, CA). The Ac-H4 ChIP assay kit was purchased from Upstate (Lake Placid, NY). Formaldehyde was purchased from Sigma. Immobilized Protein A was purchased from Repligen, sonicated salmon sperm DNA from Stratagene (La Jolla, CA), and the PCR Purification Kit from QIAGEN (Valencia, CA). Luciferin was purchased from Promega (Madison, WI), ß-galactosidase chemiluminescence reagents from Tropix (Bedford, MA), and the enhanced chemiluminescence detection system from Amersham Biosciences (Arlington Heights, IL). Protein molecular weight standards were from Invitrogen.
Cell Culture and GH Treatment
3T3-F442A cells were grown in DMEM containing 4.5 g/liter glucose and 8% calf serum in an atmosphere of 10% CO2/95% air at 37 C. CHO-GHR cells were grown in Hams F-12 medium containing 10% fetal calf serum and 0.5 mg/ml G418 in an atmosphere of 5% CO2/95% air at 37 C. All media were supplemented with 1 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin. Before GH treatment, cells were deprived of serum for 1820 h in the appropriate medium containing 1% BSA instead of serum, and then treated with GH (500 ng/ml, 23 nM) for the times indicated.
Plasmids and Antibodies
The plasmid for rat C/EBPß encoding liver-enriched activating protein driven by the cytomegalovirus (CMV) promoter (referred to as CMV-C/EBPß) was a gift from U. Schibler (University of Geneva, Geneva, Switzerland) and L. Sealy (Vanderbilt University, Nashville, TN). The expression plasmid for hemagglutinin-tagged p300 (CMV-p300) was provided by D. Livingston (Harvard Medical School, Boston, MA), courtesy of O. MacDougald (University of Michigan). To reduce the expression of C/EBPß, a hairpin short interfering RNA sequence (siC/EBPß, 5'GAGCGACGAGTACAAGATG3'), which is present in mouse, rat, and human C/EBPß, was inserted into BbsI and XbaI sites in the mU6pro vector. Sequences were confirmed by the University of Michigan Sequencing Core. The mU6pro vector containing the mouse U6 promoter for RNA polymerase III was kindly provided by D. Turner (University of Michigan) (70). The plasmids encoding E1A289 and its backbone vector pRc/RSV were gifts from J. Lundblad (Oregon Health Sciences University, Portland, OR) (71). The reporter plasmid fos-Luc containing the mouse c-fos enhancer (379 to +1, referred to as "promoter" throughout), upstream of the luciferase gene was provided by W. Wharton (University of Southern Florida, Gainesville, FL) and B. Cochran (Tufts University, Boston, MA) (72). pBR322 DNA, provided by M. Lomax (University of Michigan) was used to normalize amounts of transfected DNA. The plasmid CMV-ß galactosidase (CMV-ß gal) was provided by M. Uhler (University of Michigan).
Rabbit antibody against the C terminus of C/EBPß, against the N terminus of p300, and against the C-terminal sequence (YSPT[PS]PS) of phosphorylated RNA polymerase II (P-Pol II), as well as normal rabbit IgG were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Antibodies against Ac-H4 and against the C terminus of p300 were from Upstate. Antibody against phospho-Thr188 of mouse C/EBPß (equivalent to Thr235 of human C/EBPß) was from Cell Signaling Technology, Inc. (Beverly, MA) (36). Antibodies against porcine
tubulin (residues 1451), and horseradish peroxidase-conjugated antirabbit IgG were from Santa Cruz. IRDye800-conjugated antirabbit and antimouse IgG were obtained from Rockland Inc. (Gilbertsville, PA).
RNA Interference
To establish that siC/EBPß reduces expression of C/EBPß, plasmids for siC/EBPß or mU6pro vector (5 µg each) were coexpressed with CMV-C/EBPß (0, 0.5, or 1.0 µg) in CHO-GHR cells (10-cm dish) using calcium phosphate precipitation. Forty-eight hours after transfection cells were scraped in ice cold PBS containing inhibitors [1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin, and 1 mM dithiothreitol (DTT)]. After centrifugation, cell pellets were resuspended in hypotonic buffer [20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM EGTA, 0.2% Triton X-100, containing inhibitors as above] and centrifuged (10,000 x g, 30 sec) to obtain a nuclear pellet. The nuclear pellet was dissolved in lysis buffer [50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 6 mM EGTA, 150 mM NaCl, 0.1% Nonidet P-40 containing inhibitors as above] and subjected to immunoblot analysis. Alternatively, RNA was prepared from CHO-GHR cells for c-fos QT-PCR as described in QT-PCR. For functional measurements, siC/EBPß or mU6pro vector (200 ng each) were cotransfected with the reporter plasmid fos-luc (0.4 µg) in CHO-GHR cells. Forty-eight hours after transfection cells were treated with or without GH for 4 h, lysed, and luciferase activity measured (35).
QT-PCR
Total RNA was isolated from 3T3-F442A or CHO-GHR cells with RNA STAT60 and reverse transcribed with the Taqman Reverse Transcription Kit. The resulting cDNAs were used to perform QT-PCR in duplicate with the iCycler system (Bio-Rad Laboratories, Hercules, CA) using SYBR green I. The primer pair to amplify mouse c-fos was 5'-TTCCTGGCAATAGCGTGTTC-3' (forward) and 5'-TTCAGACCACCTCGACAATG-3' (reverse) (73), and to amplify control murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (not responsive to GH, data not shown) was 5'-ATGTTCCAGTATGACTCCACTCACG-3' (forward) and 5'-GAAGACACCAGTAGACTCCACGACA-3' (reverse) (74). Results were analyzed using iCycler iQ real-time detection system software (Bio-Rad Laboratories). All c-fos values were normalized to GAPDH. When GH was administered for various times, results are expressed as the ratio of GH to control (GH/C) at each time point. In some experiments, plasmids for siC/EBPß or mU6pro vector (5 µg each), or for E1A or Rc/Rsv vector (5 µg each) were transfected in CHO-GHR cells as described (35). Forty-eight hours later, serum-deprived CHO-GHR cells were treated with or without GH for 30 min before RNA preparation. When siC/EBPß or E1A were expressed, mRNA expression for each condition, normalized to GAPDH, is presented.
ChIP
After GH treatment, 3T3-F442A preadipocytes were rinsed with cold PBS and cross-linked with 1% formaldehyde in PBS for 10 min. The cells were scraped in ice cold PBS containing 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin, and 1 mM DTT. After centrifugation, cell pellets were resuspended in hypotonic buffer [20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM EGTA, 0.2% Triton X-100, containing inhibitors 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin, and 1 mM DTT] and centrifuged (10,000 x g, 30 sec) to obtain a nuclear pellet. The ChIP assay was performed following the instructions for the Ac-H4 ChIP Assay kit. The nuclear pellet was dissolved in ChIP sodium dodecyl sulfate (SDS) lysis buffer [50 mM Tris-HCl (pH 8), 10 mM EDTA, 1% SDS, with 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin, and 1 mM DTT] and nuclear extracts were sheared to generate DNA fragments of 500800 bp (15 sec, seven times, at 4.5 output of Hert Systems sonicator) (supplemental Fig. 8B). Samples were diluted 1:10 with ChIP dilution buffer [16.7 mM Tris-HCl (pH 8.0), 167 mM NaCl, 1.2 mM EDTA, 0.01% SDS, 1.1% Triton X-100, containing 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin] and precleared with 10 µg of salmon sperm DNA (41) and 80 µl of packed Protein A-agarose beads per ml ChIP dilution buffer. For immunoprecipitation, samples containing 100 µg of nuclear protein were incubated overnight at 4 C with the following antibodies individually: anti-C/EBPß, anti-P-C/EBPß, anti-p300, anti-Ac-H4, or antiphosphorylated Pol II (P-Pol II). Normal rabbit IgG and samples with no antibody served as negative controls. Then, each immunoprecipitate was incubated for 1 h with 10 µg of salmon sperm DNA (41) and 40 µl of protein A agarose beads. The beads were washed, and eluted, and DNA purified with a PCR purification kit. A single 330-bp fragment (364 bp to 34 bp) of the mouse c-fos promoter (supplemental Fig. 8A) was amplified with 3135 cycles of PCR (94 C for 20 sec, 60 C for 20 sec, and 72 C for 30 sec) using ChIP primers p5 (5' GGCTGCAGCCGGCGAGCTG 3') and p3 (5' AGAAGCGCTGTGAATGGATG 3'). In each experiment, all of the immunoprecipitated samples were analyzed with the same PCR conditions, for insight into relative amounts of each protein associated with the promoter. Samples were separated on 2% agarose gels and stained with ethidium bromide. Images were visualized and band density calculated using a BioImaging Systems (Ultra-Violet Products, Ltd., Cambridge, UK). When proteins were analyzed in the immunoprecipitates, half of the beads were washed and eluted for immunoblotting analysis under the conditions used for ChIP.
Re-ChIP was performed as described (8) with the following modifications: after the primary immunoprecipitation (1st IP), the beads were washed and incubated with 20 mM DTT at 37 C for 30 min and diluted 1:50 with re-ChIP dilution buffer [20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, containing 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM sodium pyrophosphate, 10 µg/ml each of aprotinin and leupeptin]. The supernatants were precleared with 10 µg salmon sperm DNA and 80 µl of protein A beads/ml sample. Then the reimmunoprecipitation (2nd IP) with the second antibodies (or control with no antibody) followed the procedures described for the primary immunoprecipitations. After purification of the second IP samples with a PCR purification kit, 35 cycles of PCR were performed with same conditions and primers described for the primary ChIP.
Immunoblotting Analysis
Nuclear extracts or IP eluates were separated by SDS-PAGE (12%), transferred to polyvinylidene difluoride membrane, and incubated with the indicated antibodies overnight at 4 C, as described previously (20). The immunoprecipitated proteins were visualized using enhanced chemiluminescence (supplemental Fig. 9) or with IRDye 800-coupled antirabbit IgG (1:12000) or antimouse IgG (1:12,000) on an Odyssey infrared scanning system (LI-COR, Inc., Lincoln, NE). Molecular weight was estimated using protein molecular weight standards from Invitrogen.
Luciferase Assay
CHO-GHR cells (2 x 105 cells/well) were transiently transfected as described (35, 75) with the fos-Luc reporter plasmids (0.5 µg/well), and plasmids for C/EBPß, p300, siC/EBPß, E1A or their respective control vectors, as indicated. Cotransfection with CMV-ß-gal (10 ng) was used to normalize for transfection efficiency in all experiments. Approximately 24 h after transfection, cells were deprived of serum by incubation in the appropriate medium containing 1% BSA for 18 h. When indicated, cells were treated with GH for 4 h, then, were lysed for measurement of luciferase and ß-galactosidase using an Opticomp Luminometer as described previously (20, 35). Lysates were also used for immunoblotting. Results of luciferase assays, normalized for ß-gal, are shown as RLU (relative luciferase units). Controls are set to 1. Luciferase activity is presented as mean ± SE for at least three independent experiments, each performed in triplicate. Statistical analysis of the increment due to GH, or in the presence of other plasmids, was performed using t test or two-way ANOVA (Prism version 3; www.GraphPad.com).
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank J. Winnay, Dr. G. Hammer, Dr. R. Menon and Dr. C. Lu for advice on the ChIP assay, Boyoung Song for technical assistance, and Dr. L. Argetsinger for critical reading of the manuscript.
 |
FOOTNOTES
|
|---|
This work was supported by National Institutes of Health (NIH) Grant DK46072 and National Science Foundation (NSF) Grant 00-80193 (to J.S.) and by the Michigan Diabetes Research and Training Center (NIH5P60 DK20572) (to R.W.K.). G.P.P. is recipient of a postdoctoral fellowship from the Center for Organogenesis, University of Michigan, and a recipient of Grant PICT-01-14123 from Agencia de Promoción Cientifica de Argentina. J.S.H. is recipient of predoctoral fellowships from National Defense Science and Engineering Graduate Program and NSF, and is a fellow in the Medical Scientist Training Program.
Current address for G.P.-P.: Instituto Investigaciones Bioquimicas Fundación Instituto Leloir, Universidad Buenos Aires and Consejo Nacional de Investigaciones Cientifícas y Te
nicas.
First Published Online April 28, 2005
Abbreviations: Ac-H4, Acetylated histone 4; C/EBP, CCAAT/enhancer binding protein; ChIP, chromatin immunoprecipitation; CBP, cAMP response element binding protein-binding protein; CHO, Chinese hamster ovary; CMV, cytomegalovirus; DTT, dithiothreitol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PMSF, phenylmethylsulfonylfluoride; QT-PCR, quantitative real-time PCR; P-Pol II, phosphorylated RNA polymerase II; RLU, relative luciferase units; SDS, sodium dodecyl sulfate; siC/EBPß, a hairpin short interfering RNA targeting C/EBPß; SRF, serum response factor; Stat, signal transducers and activators of transcription.
Received for publication December 10, 2004.
Accepted for publication April 14, 2005.
 |
REFERENCES
|
|---|
- Cosma MP 2002 Ordered recruitment: gene-specific mechanism of transcription activation. Mol Cell 10:227236[CrossRef][Medline]
- Emerson BM 2002 Specificity of gene regulation. Cell 109:267270[CrossRef][Medline]
- Carey M 1998 The enhanceosome and transcriptional synergy. Cell 92:58[CrossRef][Medline]
- Ito M, Roeder RG 2001 The TRAP/SMCC/Mediator complex and thyroid hormone receptor function. Trends Endocrinol Metab 12:127134[CrossRef][Medline]
- McKenna NJ, OMalley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465474[CrossRef][Medline]
- Goodman RH, Smolik S 2000 CBP/p300 in cell growth, transformation and development. Genes Dev 14:15531577[Free Full Text]
- Vo N, Goodman RH 2001 CREB-binding protein and p300 in transcriptional regulation. J Biol Chem 276:1350513508[Free Full Text]
- Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843852[CrossRef][Medline]
- Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751763[CrossRef][Medline]
- Holmberg CI, Tran SE, Eriksson JE, Sistonen L 2002 Multisite phosphorylation provides sophisticated regulation of transcription factors. Trends Biochem Sci 27:619627[CrossRef][Medline]
- Kouzarides T 2000 Acetylation: a regulatory modification to rival phosphorylation? EMBO J 19:11761179[CrossRef][Medline]
- Muller S, Ledl A, Schmidt D 2004 SUMO: a regulator of gene expression and genome integrity. Oncogene 23:19982008[CrossRef][Medline]
- Orgyzko VV, Schitz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953959[CrossRef][Medline]
- Gu WG, Roeder RG 1997 Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595606[CrossRef][Medline]
- Liu L, Scolnick DM, Trievel RC, Zhang HB, Marmorstein R, Halazonetis TD, Berger SL 1999 p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA damage. Mol Cell Biol 19:12021209[Abstract/Free Full Text]
- Lu Q, Hutchins AE, Doyle CM, Lundblad JR, Kwok RP 2003 Acetylation of cAMP-responsive element-binding protein (CREB) by CREB-binding protein enhances CREB-dependent transcription. J Biol Chem 278:1572715734[Abstract/Free Full Text]
- Gurland G, Ashcom G, Cochran BH, Schwartz J 1990 Rapid events in growth hormone action. Induction of c-fos and c-jun transcription in 3T3-F442A preadipocytes. Endocrinology 127:31873195[Abstract/Free Full Text]
- Sumantran VN, Tsai M-L, Schwartz J 1992 Growth hormone induces c-fos and c-jun expression in cells with varying requirements for differentiation. Endocrinology 130:20162024[Abstract/Free Full Text]
- Green H 1985 A dual effector theory of growth hormone action. Differentiation 29:195198[CrossRef][Medline]
- Liao J, Piwien-Pilipuk G, Ross SE, Hodge CL, Sealy L, MacDougald OA, Schwartz J 1999 CCAAT/enhancer-binding protein ß (C/EBPß) and C/EBP
contribute to growth hormone-regulated transcription of c-fos. J Biol Chem 274:3159731604[Abstract/Free Full Text]
- Smit LS, Meyer DJ, Argetsinger LS, Schwartz J, Carter-Su C 1999 Molecular events in growth hormone-receptor interaction and signaling. In: Kostyo JL, ed. Handbook of physiology. New York: Oxford University Press; 445480
- Piwien-Pilipuk G, Huo JS, Schwartz J 2002 Growth hormone signal transduction. J Pediat Endocrinol Metab 15:771786[Medline]
- Meyer DJ, Stephenson EW, Johnson L, Cochran BH, Schwartz J 1993 The serum response element can mediate induction of c-fos by growth hormone. Proc Nat Acad Sci USA 90:67216725[Abstract/Free Full Text]
- Liao J, Hodge CL, Meyer DJ, Ho PS, Rosenspire KC, Schwartz J 1997 Growth hormone regulates ternary complex factors and serum response factor associated with the c-fos serum response element. J Biol Chem 272:2595125958[Abstract/Free Full Text]
- Hodge C, Liao J, Stofega M, Guan K, Carter-Su C, Schwartz J 1998 Growth hormone stimulates phosphorylation and activation of Elk-1 and expression of c-fos, egr-1, and junB through activation of extracellular signal-regulated kinases 1 and 2. J Biol Chem 273:3132731336[Abstract/Free Full Text]
- Meyer DJ, Campbell GS, Cochran BH, Argetsinger LS, Larner AC, Finbloom DS, Carter-Su C, Schwartz J 1994 Growth hormone induces a DNA binding factor related to the interferon-stimulated 91-kDa transcription factor. J Biol Chem 269:47014704[Abstract/Free Full Text]
- Campbell GS, Meyer DJ, Raz R, Levy DE, Schwartz J, Carter-Su C 1995 Activation of acute phase response factor (APRF)/Stat3 transcription factor by growth hormone. J Biol Chem 270:39743979[Abstract/Free Full Text]
- Gronowski AM, Rotwein P 1994 Rapid changes in nuclear protein tyrosine phosphorylation after growth hormone treatment in vivo. Identification of phosphorylated mitogen-activated protein kinase and stat91. J Biol Chem 269:78747878[Abstract/Free Full Text]
- Mink S, Haenig B, Klempnauer KH 1997 Interaction and functional collaboration of p300 and C/EBPß. Mol Cell Biol 17:66096617[Abstract/Free Full Text]
- Kovacs KA, Steinmann M, Magistretti PJ, Halfon O, Cardinaux JR 2003 CCAAT/enhancer-binding protein family members recruit the coactivator CREB-binding protein and trigger its phosphorylation. J Biol Chem 278:3695936965[Abstract/Free Full Text]
- Janknecht R, Nordheim A 1996 MAP kinase-dependent transcriptional coactivation by Elk-1 and its cofactor CBP. Biochem Biophys Res Commun 228:831837[CrossRef][Medline]
- Yang C, Shapiro LH, Rivera M, Kumar A, Brindle PK 1998 A role for CREB binding protein and p300 transcriptional coactivators in Ets-1 transactivation functions. Mol Cell Biol 18:22182229[Abstract/Free Full Text]
- Ramirez S, Ait Si Ali S, Robin P, Trouche D, Harel-Bellan A 1997 The CREB-binding protein (CBP) cooperates with the serum response factor for transactivation of the c-fos serum response element. J Biol Chem 272:3101631021[Abstract/Free Full Text]
- Horvai AE, Xu L, Korzus E, Brard G, Kalafus D, Mullen TM, Rose DW, Rosenfeld MG, Glass CK 1997 Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc Natl Acad Sci USA 94:10741079[Abstract/Free Full Text]
- Piwien-Pilipuk G, Van Mater D, Ross SE, MacDougald OA, Schwartz J 2001 Growth hormone regulates phosphorylation and function of C/EBP ß by modulating Akt and glycogen synthase kinase-3. J Biol Chem 276:1966419671[Abstract/Free Full Text]
- Piwien-Pilipuk G, MacDougald OA, Schwartz J 2002 Dual regulation of phosphorylation and dephosphorylation of C/EBPß modulate its transcriptional activation and DNA binding in response to growth hormone. J Biol Chem 277:4455744565[Abstract/Free Full Text]
- Doglio A, Dani C, Grimaldi P, Ailhaud G 1989 Growth hormone stimulates c-fos gene expression by means of protein kinase C without increasing inositol lipid turnover. Proc Natl Acad Sci USA 86:11481152[Abstract/Free Full Text]
- Gong T-WL, Meyer DJ, Liao J, Hodge CL, Campbell GS, Wang X, Billestrup N, Carter-Su C, Schwartz J 1998 Regulation of glucose transport and c-fos and egr-1 expression in cells with mutated or endogenous growth hormone receptors. Endocrinology 139:18631871[Abstract/Free Full Text]
- Clarkson RWE, Chen CM, Harrison S, Wells C, Muscat GEO, Waters MJ 1995 Early responses of trans-activating factors to growth hormone in preadipocytes: differential regulation of CCAAT enhancer-binding protein-ß (C/EBPß) and C/EBP
. Mol Endocrinol 9:108120[Abstract/Free Full Text]
- Hodge CL 1999 Molecular events by which Fos mediates growth hormone action cellular and molecular biology. Ann Arbor, MI: University of Michigan; 170
- Duong DT, Waltner-Law ME, Sears R, Sealy L, Granner DK 2002 Insulin inhibits hepatocellular glucose production by utilizing liver-enriched transcriptional inhibitory protein to disrupt the association of CREB-binding protein and RNA polymerase II with the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 277:3223432242[Abstract/Free Full Text]
- Lundblad JR, Kwok RP, Laurance ME, Harter ML, Goodman RH 1995 Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP. Nature 374:8588[CrossRef][Medline]
- Eckner R, Ludlow JW, Lill NL, Oldread E, Arany Z, Modjtahedi N, DeCaprio JA, Livingston DM, Morgan JA 1996 Association of p300 and CBP with simian virus 40 large T antigen. Mol Cell Biol 16:35453464[Abstract/Free Full Text]
- Piwien-Pilipuk G, Galigniana MD, Schwartz J 2003 Subnuclear localization of C/EBPß is regulated by growth hormone and dependent on MAPK. J Biol Chem 278:3566835677[Abstract/Free Full Text]
- Gronowski AM, Zhong Z, Wen Z, Thomas MJ, Darnell Jr JE, Rotwein P 1995 Nuclear actions of growth hormone: Rapid tyrosine phosphorylation and activation of Stat1 and Stat3 after in vivo growth hormone treatment. Mol Endocrinol 9:171177[Abstract/Free Full Text]
- Sotiropoulos A, Moutoussamy S, Renaudie F, Clauss M, Kayser C, Gouilleux F, Kelly PA, Finidori J 1996 Differential activation of Stat3 and Stat5 by distinct regions of the growth hormone receptor. Mol Endocrinol 10:9981009[Abstract/Free Full Text]
- Hanlon M, Sealy L 1999 Ras regulates the association of serum response factor and CCAAT/enhancer-binding protein ß. J Biol Chem 274:1422414228[Abstract/Free Full Text]
- Hanlon M, Bundy LM, Sealy L 2000 C/EBPß and Elk-1 synergistically transactivate the c-fos serum response element. BMC Cell Biol 1:2[CrossRef][Medline]
- Rossi V, Rouayrenc JF, Paquereau L, Vilarem MJ, Le Cam A 1992 Analysis of proteins binding to the proximal promoter region of two rat serine protease inhibitor genes. Nucleic Acids Res 20:10611068[Abstract/Free Full Text]
- Umayahara Y, Kajimoto Y, Fujitani Y, Gorogawa S, Yasuda T, Kuroda A, Ohtoshi K, Yoshida S, Kawamori D, Yamasaki Y, Hori M 2002 Protein kinase C-dependent, CCAAT/enhancer binding protein ß-mediated expression of insulin-like growth factor I gene. J Biol Chem 277:1526115270[Abstract/Free Full Text]
- Potter JJ, Mezey E, Christy RJ, Crabb DW, Stein PM, Yang VW 1991 CCAAT/enhancer binding protein binds and activates the promoter of the rat class I alcohol dehydrogenase gene. Arch Biochem Biophys 285:246251[CrossRef][Medline]
- Alberts AS, Geneste O, Treisman R 1998 Activation of SRF-regulated chromosomal templates by Rho-family GTPases requires a signal that also induces H4 hyperacetylation. Cell 92:475487[CrossRef][Medline]
- Hanlon M, Sturgill TW, Sealy L 2001 ERK2- and p90Rsk2-dependent pathways regulate the CCAAT/enhancer-binding protein-ß interaction with serum response factor. J Biol Chem 276:3844938456[Abstract/Free Full Text]
- Mo X, Kowenz-Leutz E, Xu H, Leutz A 2004 Ras induces mediator complex exchange on C/EBPß. Mol Cell 13:241250[CrossRef][Medline]
- Thanos D, Maniatis T 1995 Virus induction of human IFN ß gene expression requires the assembly of an enhanceosome. Cell 83:10911100[CrossRef][Medline]
- Stein GS, Lian JB, van Wijnen AJ, Stein JL, Javed A, Montecino M, Zaidi SK, Young D, Choi JY, Gutierrez S, Pockwinse S 2004 Nuclear microenvironments support assembly and organization of the transcriptional regulatory machinery for cell proliferation and differentiation. J Cell Biochem 91:287302[CrossRef][Medline]
- Smith JL, Freebern WJ, Collins I, De Siervi A, Montano I, Haggerty CM, McNutt MC, Butscher WG, Dzekunova I, Petersen DW, Kawasaki E, Merchant JL, Gardner K 2004 Kinetic profiles of p300 occupancy in vivo predict common features of promoter structure and coactivator recruitment. Proc Nat Acad Sci USA 101:1155411559[Abstract/Free Full Text]
- Schwartz C, Beck K, Mink S, Schmolke M, Budde B, Wenning D, Klempnauer KH 2003 Recruitment of p300 by C/EBPß triggers phosphorylation of p300 and modulates coactivator activity. EMBO J 22:882892[CrossRef][Medline]
- Xu M, Nie L, Kim SH, Sun XH 2003 STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBPß. EMBO J 22:893904[CrossRef][Medline]
- Herrera JE, Bergel M, Yang XJ, Nakatani Y, Bustin M 1997 The histone acetyltransferase activity of human GCN5 and PCAF is stabilized by coenzymes. J Biol Chem 272:2725327258[Abstract/Free Full Text]
- Kalkhoven E, Teunissen H, Houweling A, Verrijzer CP, Zantema A 2002 The PHD type zinc finger is an integral part of the CBP acetyltransferase domain. Mol Cell Biol 22:19611970[Abstract/Free Full Text]
- Thompson PR, Wang D, Wang L, Fulco M, Pediconi N, Zhang D, An W, Ge Q, Roeder RG, Wong J, Levrero M, Sartorelli V, Cotter RJ, Cole PA 2004 Regulation of the p300 HAT domain via a novel activation loop. Nat Struct Mol Biol 11:308315[CrossRef][Medline]
- Fass DM, Butler JE, Goodman RH 2003 Deacetylase activity is required for cAMP activation of a subset of CREB target genes. J Biol Chem 278:4301443019[Abstract/Free Full Text]
- Kowenz-Leutz E, Twamley G, Ansieau S, Leutz A 1994 Novel mechanism of C/EBPß (NF-M) transcriptional control: activation through derepression. Genes Dev 8:27812791[Abstract/Free Full Text]
- Williams SC, Baer M, Dillner AJ, Johnson PF 1995 CRP2 (C/EBPß) contains a bipartite regulatory domain that controls transcriptional activation, DNA binding and cell specificity. EMBO J 14:31703183[Medline]
- Kim DW, Cheriyath V, Roy AL, Cochran BH 1998 TFII-I enhances activation of the c-fos promoter through interactions with upstream elements. Mol Cell Biol 18:33103320[Abstract/Free Full Text]
- Merika M, Thanos D 2001 Enhanceosomes. Curr Opin Gen Dev 11:205208[CrossRef][Medline]
- Gowri PM, Yu JH, Shaufl A, Sperling MA, Menon RK 2003 Recruitment of a repressosome complex at the growth hormone receptor promoter and its potential role in diabetic nephropathy. Mol Cell Biol 23:815825[Abstract/Free Full Text]
- Moller C, Hansson A, Enberg B, Lobie PE, Norstedt G 1992 Growth hormone (GH) induction of tyrosine phosphorylation and activation of mitogen-activated protein kinase in cells transfected with rat GH receptor cDNA. J Biol Chem 267:2340323408[Abstract/Free Full Text]
- Yu JY, DeRuiter SL, Turner DL 2002 RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci USA 99:60476052[Abstract/Free Full Text]
- Madison DL, Yaciuk P, Kwok RP, Lundblad JR 2002 Acetylation of the adenovirus-transforming protein E1A determines nuclear localization by disrupting association with importin-
. J Biol Chem 277:3875538763[Abstract/Free Full Text]
- Harvat BL, Wharton W 1995 Serum response element and flanking sequences mediate the synergistic transcriptional activation of c-fos by 12-O-tetradecanoylphorbol-13-acetate and cholera toxin in AKR-2B cells. Cell Growth Diff 6:955964[Abstract]
- Wurmbach E, Yuen T, Ebersole BJ, Sealfon SC 2001 Gonadotropin-releasing hormone receptor-coupled gene network organization. J Biol Chem:4719547201
- LeCouter J, Lin R, Frantz G, Zhang Z, Hillan K, Ferrara N 2003 Mouse endocrine gland-derived vascular endothelial growth factor: a distinct expression pattern from its human ortholog suggests different roles as a regulator of organ-specific angiogenesis. Endocrinology 144:26062616[Abstract/Free Full Text]
- Chen D, Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:27452752[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Hua, H. Ma, W. K. Samson, and J. Ren
Neuronostatin inhibits cardiac contractile function via a protein kinase A- and JNK-dependent mechanism in murine hearts
Am J Physiol Regulatory Integrative Comp Physiol,
September 1, 2009;
297(3):
R682 - R689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, G. Lin, J. S. Huo, D. Barney, Z. Wang, T. Livshiz, D. J. States, Z. S. Qin, and J. Schwartz
Computational and Functional Analysis of Growth Hormone (GH)-Regulated Genes Identifies the Transcriptional Repressor B-Cell Lymphoma 6 (Bc16) as a Participant in GH-Regulated Transcription
Endocrinology,
August 1, 2009;
150(8):
3645 - 3654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ohoka, S. Kato, Y. Takahashi, H. Hayashi, and R. Sato
The Orphan Nuclear Receptor ROR{alpha} Restrains Adipocyte Differentiation through a Reduction of C/EBP{beta} Activity and Perilipin Gene Expression
Mol. Endocrinol.,
June 1, 2009;
23(6):
759 - 771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhong, H. J. Armbrecht, and S. Christakos
Calcitonin, a Regulator of the 25-Hydroxyvitamin D3 1{alpha}-Hydroxylase Gene
J. Biol. Chem.,
April 24, 2009;
284(17):
11059 - 11069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Transcriptional Regulation of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter by Transcriptional Activators and Repressor
Mol. Endocrinol.,
March 1, 2009;
23(3):
373 - 387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Manzel, C. L. Chin, M. A. Behlke, and D. C. Look
Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins
Am. J. Respir. Cell Mol. Biol.,
February 1, 2009;
40(2):
200 - 210.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Buzzelli, M. Nagarajan, J. F. Radtka, M. L. Shumate, M. Navaratnarajah, C. H. Lang, and R. N. Cooney
Nuclear Factor-{kappa}B Mediates the Inhibitory Effects of Tumor Necrosis Factor-{alpha} on Growth Hormone-Inducible Gene Expression in Liver
Endocrinology,
December 1, 2008;
149(12):
6378 - 6388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Poon, B.-S. An, W.-K. So, G. L. Hammond, and P. C. K. Leung
Temporal Recruitment of Transcription Factors at the 3',5'-Cyclic Adenosine 5'-Monophosphate-Response Element of the Human GnRH-II Promoter
Endocrinology,
October 1, 2008;
149(10):
5162 - 5171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. X. Cui, R. Kwok, and J. Schwartz
Cooperative regulation of endogenous cAMP-response element binding protein and CCAAT/enhancer-binding protein in GH-stimulated c-fos expression
J. Endocrinol.,
January 1, 2008;
196(1):
89 - 100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Koria and S. T. Andreadis
KGF promotes integrin {alpha}5 expression through CCAAT/enhancer-binding protein-beta
Am J Physiol Cell Physiol,
September 1, 2007;
293(3):
C1020 - C1031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. V. Laz, M. G. Holloway, C.-S. Chen, and D. J. Waxman
Characterization of Three Growth Hormone-Responsive Transcription Factors Preferentially Expressed in Adult Female Liver
Endocrinology,
July 1, 2007;
148(7):
3327 - 3337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. I. Cesena, J.-R. Cardinaux, R. Kwok, and J. Schwartz
CCAAT/Enhancer-binding Protein (C/EBP) beta Is Acetylated at Multiple Lysines: ACETYLATION OF C/EBPbeta AT LYSINE 39 MODULATES ITS ABILITY TO ACTIVATE TRANSCRIPTION
J. Biol. Chem.,
January 12, 2007;
282(2):
956 - 967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Seymour, L. E. Roberts, M. A. Fini, L. A. Parmley, T. L. Oustitch, and R. M. Wright
Stress Activation of Mammary Epithelial Cell Xanthine Oxidoreductase Is Mediated by p38 MAPK and CCAAT/Enhancer-binding Protein-beta
J. Biol. Chem.,
March 31, 2006;
281(13):
8545 - 8558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Huo, R. C. McEachin, T. X. Cui, N. K. Duggal, T. Hai, D. J. States, and J. Schwartz
Profiles of Growth Hormone (GH)-regulated Genes Reveal Time-dependent Responses and Identify a Mechanism for Regulation of Activating Transcription Factor 3 By GH
J. Biol. Chem.,
February 17, 2006;
281(7):
4132 - 4141.
[Abstract]
[Full Text]
[PDF]
|
 |
|