| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Center for Integrative Genomics, National Center of Competence in Research "Frontiers in Genetics" (L.M., J.N.F., L.G., H.K., B.D., W.W.), and Department of Medicine (T.P.), University of Lausanne, CH-1015 Lausanne, Switzerland
Address all correspondence and requests for reprints to: L. Michalik or W. Wahli, Centre Intégratif de Génomique, Université de Lausanne, Le Génopode, CH-1015 Lausanne, Switzerland. E-mail: liliane.michalik{at}unil.ch or walter.wahli{at}unil.ch.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ß/
in the reparation of the skin after a mechanical injury in the adult mouse. However, the mesenchymal or epithelial cellular compartment in which PPAR and ß/ play a role could not be determined in the null mice used, which have a germ line PPAR gene invalidation. In the present work, the role of PPAR was studied in keratinocytes, using transgenic mice that express a PPAR mutant with dominant-negative (dn) activity specifically in keratinocytes. This dn PPAR lacks the last 13 C terminus amino acids, binds to a PPAR agonist, but is unable to release the nuclear receptor corepressor and to recruit the coactivator p300. When selectively expressed in keratinocytes of transgenic mice, dn PPAR
13 causes a delay in the healing of skin wounds, accompanied by an exacerbated inflammation. This phenotype, which is similar to that observed in PPAR null mice, strongly suggests that during skin healing, PPAR is required in keratinocytes rather than in other cell types. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, ß/, and 
[NR1C1, NR1C2 and NR1C3, respectively (1)] form a subfamily of the nuclear hormone receptors (NHRs). They are key regulators of energy metabolism pathways and are also involved in the regulation of other processes such as inflammation, cell proliferation, and survival (2, 3, 4). A wide variety of natural as well as synthetic compounds, including fatty acids, eicosanoids, and hypolipidemic drugs, has been identified as bona fide PPAR ligands. PPARs bind to DNA as heterodimers with the retinoid X receptor (RXR), on PPAR response elements (PPREs) of the direct repeat type with, in general, one nucleotide separating the repeated core motifs (DR-1) (5). They are structured in four domains: the N-terminal A/B domain is thought to contain a putative ligand-independent activation function, the C domain is the DNA binding domain, the C-terminal E domain [ligand binding domain (LBD)] is linked to the C region by a hinge domain (D domain), and contains the ligand-dependent transactivation function (AF-2). In all the receptors for which the three-dimensional structure of the LBD has been resolved, including PPARs, the AF-2 resides within a C-terminal helix. Interestingly, this helix which usually protrudes beyond the core of the LBD or is very mobile in the absence of ligand, folds over the aperture of the ligand pocket in ligand-bound receptors (6, 7, 8). Presently, it is believed that the ligand-dependent transcriptional activity of the receptors relies on protein-protein interactions between the AF-2 and coactivators (9, 10, 11).
PPAR, ß/, and are expressed in the skin during development in the various layers of the epidermis and the hair pegs (12, 13, 14, 15). After birth, the expression of all three PPARs decreases in the interfollicular epidermis but remains well detectable in the hair follicles. Interestingly, PPAR and PPARß/ expression is up-regulated in the adult epidermis upon proliferation stimuli, inflammation, or injury. Consistent with this pattern of PPAR expression in the epidermis, we have shown that PPAR and ß/, but not PPAR, are necessary for the normal healing of an excisional skin wound. The PPAR-null mice indeed exhibit a transient delay in skin healing during the inflammatory phase of the process, whereas in the PPARß/ mutant mice a delay was observed during the whole process, complete healing being postponed for 2–3 d compared with the wild-type (wt) animals (12). These results revealed important but nonredundant roles of PPAR and ß/ in the regeneration of the skin after an injury in the adult mouse, with the involvement of PPAR in the early inflammatory phase, whereas PPARß/ appears to play a role during the whole healing process. For these previous studies, mutant mice with germ cell invalidation of the PPAR genes were used and, therefore, it was impossible to determine in which part of the skin the absence of PPAR expression was responsible for the healing phenotype. Indeed, the healing of a skin wound after a mechanical injury involves three major cell types (16). In the very early phase of the repair, immune cells are recruited to the wound bed, where they prevent infection by microorganisms and produce important amounts of cytokines and growth factors. The fibroblasts present in the dermis are involved in the production of cytokines, growth factors, extracellular matrix components, and are responsible for wound contraction which is particularly important in mouse. The epidermal and hair follicle keratinocytes produce chemotactic substances to attract immune cells, and they proliferate and migrate to cover the wound and reconstitute the epithelium. In the PPAR null animals, we observed defects in the recruitment of inflammatory cells to the site of injury. As mentioned above, by using classical null animals, we were unable to elucidate whether this defect was due to the absence of PPAR in the immune cells themselves, or to a defect in chemotactic molecules produced by the keratinocytes or fibroblasts.
So far, the consequences on skin wound healing of the absence of a nuclear receptor only in the keratinocytes has not been addressed. In the present study, we were interested to know whether a decreased activity of PPAR in the keratinocytes only, would alter the healing of a mechanical skin injury. We have chosen to express a dominant-negative (dn) PPAR in these cells under the control of the involucrin promoter. Involucrin is a marker of keratinocyte differentiation that is expressed in the suprabasal layers of the epidermis, and which participates in the formation of the cornified envelope.
In a first step, we gathered information allowing the design of the dn PPAR. Deletions as well as mutations in the AF-2 domain were shown to abolish the AF-2 function of the estrogen receptor (ER) (17), thyroid hormone receptor (TR) (18, 19), retinoic acid receptor (RAR) (20) and PPARs (21, 22, 23, 24). Based on these observations, we have created and characterized a PPAR mutant with dn activity. We have then generated a transgenic mouse expressing the dn PPAR in keratinocytes. Finally, we have analyzed the effect of the expression of this mutant receptor in keratinocytes on skin wound healing.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Deletion Mutant with PPAR dn Activity were constructed as depicted in Fig. 1A
(PPAR13, PPAR29, PPAR62), subcloned into a mammalian expression vector, and their activity was assessed in a transient transactivation assay using a PPRE reporter gene. The mPPAR13 deletion mutant was unable to stimulate the reporter gene, but instead repressed the ligand-dependent activity of the wt PPAR protein up to 80% (Fig. 1B). In contrast, PPAR29 and PPAR62 had a weaker or much weaker repressing action on the wt ligand-dependent PPAR activity, respectively. Therefore, we did not pursue the study of PPAR29 and PPAR62, and only PPAR13 was selected for further characterization. Increasing amounts of PPAR13 were produced in transfected cells along with constant quantities of wt mPPAR, ß/, or in the presence of the corresponding selective ligands (Wy14,643 100 µM, L165041 1 µM, and Rosiglitazone 5 µM, respectively) to calibrate the repressing activity (Figs. 1B and 2A). Cotransfection of an equimolar ratio of the PPAR13 mutant and the wt PPAR expression vectors significantly affected PPAR-dependent transcription (60% inhibition), whereas repression of PPARß/ and was less efficient (20% inhibition) (Fig. 2A). When transfected at a 10-fold molar excess, PPAR13 was able to suppress wt PPAR-dependent transcription up to 90% but only up to 50% those of PPARß/ or PPAR (Fig. 2A). No repression of the activity of RAR, ß, and , TR, or ER was observed (Fig. 2B and data not shown), suggesting that PPAR13 exerts a selective dn activity toward PPARs, with maximum efficiency toward PPAR.
|
|
13 Mutant13 Mutant.13, this mutant was first tested for its ability to bind to a PPAR response element (PPRE) derived from the promoter of the acyl-coenzyme A oxidase gene (ACO-A). EMSA was performed in the presence of wt PPAR or PPAR13 and of the PPAR heterodimerization partner RXRß. In the presence of its dimerization partner, PPAR13 was able to bind to the ACO-A probe (Fig. 3A). Although the binding efficiency was only 50% compared with that of the wt protein (Fig. 3B), competition for DNA binding is most probably part of the mechanism of action of the PPAR13 mutant.
|
13 with its obligate partner RXR. To address this question, we performed pull-down experiments, in which the amount of radiolabeled PPAR recovered after precipitation with histidine tagged-RXR was quantified by autoradiography (Fig. 3C
). The wt PPAR was efficiently coprecipitated with RXR in a weak ligand-dependent manner. The amount of PPAR13 interacting with RXR corresponded to 50% of that of the wt receptor, in the presence or the absence of ligand, indicating reduced ability of the truncated receptor to dimerize with its partner. These data suggest that the deletion of the AF-2 domain of PPAR significantly impairs protein-protein interaction between the truncated receptor and RXR, and that this reduced interaction ability of PPAR13 most probably participates to its defect in DNA binding.
The PPAR13 Mutant Can Bind a PPAR Ligand but Does Not Recruit the Coactivator p300.
Ligand binding and coactivator recruitment are necessary for the transcriptional activity of PPARs. The binding of a PPAR selective ligand to PPAR13 was assessed using 3H-radiolabeled Wy14,643 followed by competition with the nonradiolabeled ligand. As shown on Fig. 4A, PPAR13 retained its ability to bind to the PPAR agonist, with similar efficiency as wt PPAR. Then, recruitment of the coactivator p300 by the wt and the truncated PPAR was assessed by pull-down assays, using a glutathione-S-transferase (GST)-p300 fusion protein and 35S-radiolabeled PPARs. In the absence of agonist, neither wt PPAR nor PPAR13 were able to recruit the coactivator p300 (Fig. 4B). Upon binding to Wy14,643, wt PPAR efficiently recruited p300, whereas PPAR13 failed to show any interaction with the coactivator. These data demonstrate that, although the lack of the 13 last amino acids did not affect agonist binding, it totally abolished the recruitment of the coactivator p300 (Fig. 4B). Consistent with these data, transient transfections performed with PPAR, ß/, or LBD fused to the Gal4 DNA binding domain, together with a Gal4 reporter plasmid, showed that PPAR13 does not inhibit the activity of the fusion proteins, suggesting that the titration of a common coactivator is most likely not involved in the dominant activity of the truncated PPAR mutant protein (data not shown).
|
13 Recruits the Nuclear Receptor Corepressor (NCoR), which Is Not Released by the Mutant Receptor upon Ligand Binding. functions is not fully elucidated yet, wt PPAR LBD was shown to interact with a motif of the corepressor SMRT (27). We therefore studied the binding of PPAR13 to the corepressor GST-NCoR fusion protein, in the absence or presence of the Wy14,643 agonist, in a pull-down assay. As shown on Fig. 4B, the unliganded wt PPAR strongly interacts with the NCoR fusion protein, and releases the corepressor in the presence of Wy14,643. Very interestingly, PPAR13 also shows strong interaction with NCoR but, unlike the wt PPAR, the truncated receptor fails to release the corepressor even in the presence of the ligand.
Altogether, these data demonstrate that the truncated PPAR13 mutant receptor can form a heterodimer with RXR and can interact with PPREs, although significantly less efficiently compared with wt PPAR. It also binds efficiently to a PPAR agonist. However, unlike wt PPAR, the liganded form of PPAR13 is unable to release the corepressor NCoR and to recruit the coactivator p300. This suggests that PPAR13 inhibits the transcriptional activity of the wt PPAR via recruitment of corepressors to the promoter of target genes.
Selective Inhibition of PPAR Activity in Keratinocytes Is Sufficient to Transiently Delay Skin Wound Healing in Vivo
Expression of a PPAR13 Transgene in the Epidermis of Transgenic Mice.
Next, we used the dn PPAR13 as a functional inhibitor of PPAR in the epidermis in vivo. A transgenic mouse was created using the PPAR13 cDNA driven by the involucrin promoter, a stratified epithelia-selective promoter, whose activity has been previously characterized in vivo (see Fig. 5A for the transgene construct) (28, 29). The expression level of the PPAR13 transgene was compared with that of the wt PPAR in unchallenged skin and esophagus (Fig. 5, B and C, respectively), as well as in the liver and kidney as negative controls (Fig. 5, D and E, respectively). Consistent with the expression profile of involucrin and characterization of its promoter activity in transgenic mice (29), the PPAR13 transgene was expressed at high and low levels in skin and esophagus, respectively, whereas it was not expressed in liver and kidney. The expression of PPAR13 was then further characterized by comparing wounded to unchallenged skin (compare Figs. 5B and 6A). In both the wt and the transgenic mice samples, the level of expression of the wt PPAR mRNA was similar. As expected, the PCR signal of the PPAR13 RNA was in the background values in the skin of wt animals. In the transgenic animals, the PPAR13 RNA was present at a 5.5- and 4-fold excess compared with the wt RNA, in unchallenged skin (Fig. 5B) and d 3 healing wounds (Fig. 6A), respectively. Based on the data obtained in transient transfection assays (Fig. 2A), these results suggest that the expression of the transgene is sufficient to strongly inhibit the activity of wt PPAR in keratinocytes in vivo.
|
|
13 Transgenic Animals. in the interfollicular epidermis of adult mice (12), the expression of the PPAR13 transgene did not alter the physiology of the epidermis of transgenic mice (data not shown). The consequences of the functional inhibition of PPAR by the PPAR dn mutant in keratinocytes in vivo was assessed in a skin wound healing model. A full thickness skin biopsy was taken on the back of the animals, and the skin was then allowed to heal. Using the same experimental model, PPAR and PPARß/ knockout animals were shown to exhibit a delay in the healing of the wound. This delay was transient in the PPAR null mice, whereas the PPARß/ null animals finally healed a few days later compared with their wt counterparts (12). A similar excisional injury was made on the back of the transgenic animals, and the healing kinetic was compared with that of the wt mice. As illustrated on Fig. 6B, the healing of the wounds was delayed in the transgenic mice, a phenotype that was exacerbated in aged animals. The delay in healing was transient, overlapping with the inflammatory phase of the process, and these mice finally healed at the same time as their wt counterparts.
Interestingly, these data are similar to those described using the same skin injury model on PPAR null mice obtained after germ cell invalidation of the PPAR gene, suggesting that, similarly to the PPAR null mice, the transgenic animals may suffer from impaired inflammatory reaction (12). However, because the PPAR13 protein is also able to inhibit PPARß/ to a certain extent, although less efficiently than PPAR, the phenotype of the transgenic animals may also be due to partial inhibition of this PPAR isotype in the keratinocytes. During skin healing, PPARß/ participates in the control of keratinocyte proliferation, survival, and migration (30). Therefore, to identify the defect responsible for the phenotype of the PPAR13 expressing mice, we quantified the expression levels of two major inflammatory cytokines (IL-1ß and TNF) in skin biopsies. In addition, we determined the apoptosis and proliferation levels on skin sections using the terminal deoxynucleotidyl transferase-mediated uridine 5'-triphosphate-biotin nick end labeling assay and immunolabeling of Ki67, respectively. Finally, the migration of keratinocytes was analyzed using skin explant ex vivo cultures. No differences were observed in keratinocyte apoptosis, proliferation, or migration in the PPAR13 expressing unchallenged, wounded, and cultured epidermis when compared with wt samples, suggesting that inhibition of PPARß/ is not responsible for the observed phenotype (data not shown). Analysis of TNF and IL-1ß expression showed that both cytokines were at PCR background value levels in the unchallenged skin of transgenic and wt animals (Fig. 6, C and D). Their expression strongly increased in wounded skin (d 3 after injury). Interestingly, whereas the increase of IL-1ß expression was similar in wt and transgenic mice, the increase in the expression of TNF was exacerbated in the wounded skin of the PPAR13 mice, reflecting an exaggerated inflammatory reaction (Fig. 6C). This is reminiscent of the deregulated control of inflammation in PPAR null animals (31, 32).
These observations suggest that selective inhibition of PPAR activity in the keratinocytes is sufficient to impair skin wound healing in a way that is similar to a total invalidation of the PPAR gene. Thus, although a contribution of the other cell types involved cannot be totally ruled out before tissue-selective invalidation of PPAR in fibroblasts and immune cells is analyzed, our results suggest that the defect observed in the PPAR null mice is mainly the consequence of a lack of PPAR activity in the keratinocytes.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-helices forming a characteristic three-layer antiparallel -helical sandwich comprising a small four-stranded sheet, which delimitate a large Y-shape hydrophobic pocket, the ligand binding cavity (34, 35, 36, 37, 38). Based on the homologies with several members of the nuclear hormone receptor superfamily, the AF-2 function of PPARs has been identified within the extreme C-terminal amphipatic -helix, known as helix 12. It is thought that ligands activating PPARs stabilize the LBD such that helix 12 is in a conformation that promotes binding of coactivator proteins. Helix 12 has thus a critical function in the stimulation of PPAR target genes (8, 34). In this work, we have characterized a mPPAR mutant obtained after deletion of the 13 extreme C-terminal amino acids 456-LHPLLQEIYRDMY-468. This particular sequence of the protein contains the core amino acid sequence motif FFXE/DFF, where F represents hydrophobic residues and X, in general, residues with long hydrophobic, neutral, or polar side chains. In all members of the NHR superfamily, this region forms the AF-2 core amphipathic -helix. Analysis of this region of PPARs has revealed that their AF-2 motif consists of 10 amino acids that form two overlapping AF-2 core elements, each composed of six amino acids. In the mPPAR, these two motifs consist of LLQEIY and IYRDMY, and the full-length AF-2 core element consists of LLQEIYRDMY (see Fig. 1A, gray boxes). Truncating the last 13 amino acids of mPPAR therefore leads to the entire deletion of the core motif of the PPAR AF-2 domain. Consistent with the recently proposed mechanism of NHR activation and transcriptional activity, the PPAR13 mutant was thus expected to have strongly reduced or even abolished transcriptional activity. In accordance with this hypothesis, we indeed demonstrated that PPAR13 has no transcriptional activity although retaining the ability to bind the PPAR ligand Wy14,643.
Mutation or Truncation of the AF-2 Domain Generates a NHR with dn Activity
Several cases of mutations or truncations of the AF-2 domain, either natural or artificial, were described to generate mutant receptors with dn activities. These mutants have no transcriptional activation capacities, and, very interestingly, are able to inhibit the activity of the native receptor when present together in the same cell. These nuclear hormone receptor mutants are thus functional inhibitors of their native counterparts, although their mode of action is not clear yet. For instance, natural helix 12 mutants of TRß are dn receptors that inhibit the activity of the wt TRß receptor, leading to the syndrome of resistance to thyroid hormones (39, 40, 41). The AF-2 domain is truncated in the viral oncogene v-erbA, a potent dn inhibitor of TR and RAR (42, 43). Artificial mutations have been introduced in a subset of nuclear receptors, producing similar dn receptors. One of the first dn receptors that has been generated was a RAR mutant truncated at the C-terminal end (44). When expressed under the control of a keratinocyte-selective promoter in a transgenic animal model, this mutant was proven to be a potent inhibitor of the activity of RARs in the epidermis in vivo, an approach that demonstrated the involvement of these receptors in epidermal lipid processing (45, 46). In a similar experiment, a RXR mutant lacking the AF-2 domain was expressed in the suprabasal layers of the mouse epidermis (47). This dn mutant efficiently reduced the expression of RAR target genes and the effect of all-trans retinoic acid when topically applied on the skin of the transgenic animals. However, wound healing was not studied in these two models. With regard to PPARs, PPARß/, and PPAR mutants with dn activity have both been described. A dn form of PPARß/ was obtained after substitution of glutamate 411 by a proline in the region immediately preceding the AF-2 domain of the receptor. When expressed in transfected cells, this functional inhibitor of PPARß/ was able to significantly alter the adipogenic action of fatty acids (23). More striking was the identification of two natural variants of human PPAR in patients with severe insulin resistance, diabetes, and early onset hypertension (25, 26). This study suggests that partial loss of PPAR function, associated to dn activity of the protein derived from the mutated allele, could be associated to severe pathologies, a mechanism that is similar to that observed in the case of TRß and the development of the syndrome of resistance to thyroid hormones. In a different study, a human PPAR mutant was generated by substitution of two highly conserved residues in the AF-2 domain of NHRs (24). This mutant is unable to recruit coactivators even when bound to the PPAR activator Rosiglitazone. Highly interestingly, it was proposed to interact with the two corepressors SMRT and NCoR, which probably mediate its dn activity toward the endogenous native PPAR. Similarly, corepressor recruitment has been proposed to be the mechanism of action of another PPAR mutant carrying a single mutation L466A (21). Recently, a PPAR mutant harboring two point mutations in its LBD, was identified as a dn receptor (22). This protein has no transcriptional activity but interferes with PPAR signaling, most probably because of impaired interaction with coactivators and recruitment of corepressors. Altogether, these studies show that mutations or truncations near or in the AF-2 domain of NHR, and particularly of PPARs, leads to mutants with dn properties. As illustrated above with PPAR mutants, the existence of dn forms of PPARs may be of physiological relevance in human health. In a recent study, the L466A PPAR dn mutant was introduced in mice via knock-in mutation. This model has proven to be a very potent tool to study in vivo the involvement of impaired PPAR function in the development of the metabolic syndrome (48).
As mentioned above, truncating the last 13 amino acids of mPPAR entirely deletes its AF-2 domain, without altering binding of PPAR13 to the PPAR ligand Wy14,643. Indeed, radiolabeled Wy14,643 binds to PPAR13 with similar efficiency compared with the native PPAR, which demonstrates that deletion of helix 12 leaves intact the ligand binding pocket. Like the other NHR dn forms, PPAR13 was shown to have no transcriptional activity on its own in transfected cells (data not shown). However, when cotransfected with the wt version of PPAR, the truncated mutant was able to inhibit up to 90% of PPAR transcriptional activity. This PPAR truncated version is thus an efficient inhibitor of PPAR, which is particularly valuable because no antagonist was available for this member of the NHR superfamily at the moment of the study. The molecular mechanism of action of this dn mutant includes competition for PPRE binding as well as constitutive association with the corepressor NCoR, and lack of p300 coactivator recruitment. The DNA binding properties of PPARs on the ACO-A PPRE used in the present study, as well as on several other natural PPREs, were characterized previously (49). Interestingly, PPARß/ and were shown to bind to the ACO-A PPRE more strongly than PPAR, explaining partly why PPAR13 competes, and thus inhibits, more efficiently PPAR than PPARß/ and .
A dn Form of PPAR Is a Valuable Tool to Study PPAR Functions in Cells and in Vivo
The PPAR13 may be used in cell culture, as well as in vivo, to inhibit the activity of PPAR. We took advantage of this functional inhibitor to get further information about the role of PPAR during the healing of injured epidermis of the transgenic mouse. Although the PPAR and PPARß/ null mice allowed to unveil important and new functions of these NHRs in the skin during wound healing (12, 30), they did not allow to discriminate the functions of PPARs in the epidermis vs. the dermis or the immune system. We therefore chose to express PPAR13 in vivo under the control of the involucrin promoter. This promoter has been well characterized in transfected cells and in vivo using the ß-galactosidase assay (28, 29). As quantified using real-time PCR, this promoter was sufficient to direct the expression of high amounts of PPAR13 RNA in the epidermis, in sufficient proportion to significantly inhibit the activity of PPAR. Using full thickness skin biopsies as previously described (12), we demonstrate that in vivo inhibition of endogenous PPAR by PPAR13 leads to impaired skin wound healing. Indeed, a transient delay, overlapping with the inflammatory phase of the healing process, was observed in the PPAR13 transgenic animals, compared with the wt controls. Interestingly, this phenotype is very similar to the phenotype we previously described using the same model of skin wound healing in the PPAR null mice. In these PPAR classical null mice, we showed that impaired recruitment of immune cells to the wound bed correlated with the healing delay. In the present study, we demonstrate that the selective inhibition of the activity of PPAR in keratinocytes, but not in fibroblasts or immune cells, leads to a phenotype similar to PPAR invalidation in the whole organism. Indeed, the expression of PPAR13 in keratinocytes results in exacerbated inflammation. Very interestingly, this strongly suggests that the role of PPAR during skin repair is major in keratinocytes vs. other cell types.
In conclusion, our observations demonstrate that, like in several other nuclear hormone receptors, deleting the extreme C-terminal end of PPAR leads to a loss of transcriptional activity and acquisition of dn properties. Moreover, we show that the resulting truncated mutant, PPAR13 can still bind to RXR and to a PPRE, recruit a nuclear hormone receptor corepressor that is not released upon ligand binding. We also show that PPAR13 is unable to recruit the coactivator p300. This molecular behavior of the PPAR13 is responsible for the dn activity of this truncated receptor. Due to its dn activity, PPAR13 is an important tool to inhibit the activity of PPAR in vitro and in vivo. This concept was demonstrated here in vivo where we took advantage of this dn property to show that PPAR plays a major role in keratinocytes rather than in fibroblasts or immune cells during wound healing.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Constructions
PPAR.
The nucleotide sequence 166-2081 of the wt mPPAR cDNA (GenBank accession no. X57638) was subcloned into the mammalian expression vector pSG5 using BamH1 restriction sites. The PPAR truncated mutants pSG5PPAR13, pSG5PPAR29, and pSG5PPAR62 were obtained by digestion of the wt cDNA with Eco47III (nucleotide 1530), SphI (nucleotide 1487), and PmlI (nucleotide 1384) restriction enzymes, respectively. The construct used for the in vivo transgene is derived from the involucrin promoter/ß-galactosidase reporter plasmid described by Carroll et al. (28, 29). Briefly, the PPAR13 cDNA was digested from the pSG5 vector (BamHI-EcoRV) and subcloned in the NotI sites of the involucrin construct in replacement of the ß-galactosidase reporter gene. The final construct includes the 3.7-kb involucrin promoter sequence, the simian virus 40 (SV40) intron, the PPAR13 cDNA and the SV40 polyA signal sequence (Fig. 5A)
NCoR.
The cDNA corresponding to the NCoR nuclear receptor interacting domain (residues 2204–2453) was cloned into the EcoRI site of the pGexT2 plasmid (Amersham Biosciences, Switzerland). The following oligos were used in a PCR after a RT-PCR with an oligo-deoxythymidine on total mouse liver RNA: 5'-GGAATTCCCTACTTGCCTTCATTCTTCAC-3' and 5'-GGAATTCCCCATCATTTCTTCCTCATCCA-3'.
p300.
GST-p3002–516 fusion protein was purified as described previously (50) pEYFPC1-mPPAR has been previously described (51) and pEYFPC1-mPPAR13 was cloned in pEYFP-C1 after PCR amplification of nucleotides 1–1365 of the mPPAR cDNA with forward and reverse primers flanked with the XhoI and BamHI sites, respectively.
HeLa Cell Transfections and Chloramphenicol Acetyltransferase (CAT) Assays
Cell culture and transfections were performed as described (52). HeLa cells were cultured in DMEM supplemented with 10% fetal calf serum, 10 U/ml nystatin and antibiotics. For transfection, 4 x 105 cells were placed into 6-cm diameter dishes with 10% delipidated fetal calf serum. The next day, the medium was replaced and cells were transfected with the pSG5 expression vectors containing wt PPARs or truncated mutants as indicated in the legends, 4.2 µg of pRSV-Luc and 1.5 µg of CAT reporter plasmid [ACO-A pBL-CAT8+ (52) using the calcium phosphate precipitation technique. In addition, sonicated salmon sperm carrier DNA was used to obtain a constant total of 8 µg DNA. Ligands in fresh medium were added 6 and 24 h after transfection. Forty-eight hours after transfection, cell extracts were prepared by freeze-thawing and were assayed for luciferase activity, which was used to normalize the CAT assay.
EMSAs
A total of 0.5–5 µl of in vitro-translated pSG5PPAR or pSG5PPAR13 (similar efficiency in translation was checked using 35S-labeled proteins) and 2 µl of nuclear extract containing baculovirus-expressed recombinant mRXRß or controls were incubated on ice for 15 min as previously described (53). One microliter of the PPRE ACO-A double-stranded oligonucleotide (CCCGAACGTGACCTTTGTCCTGGTCC) (1 ng/µl) labeled with 32P by fill-in with the Klenow polymerase was added and the incubation was continued for 10 min at room temperature. Samples were then separated by electrophoresis as described (53).
Ligand Binding Assay
Cos-7 cells grown in 60-mm dishes were transfected with 12 µg of vector encoding YFP-PPAR wt or YFP-PPAR13 and lysed in ice-cold lysis buffer (Tris 20 mM, KCl 420 mM, dithiothreitol 2 mM, EDTA 0.1 mM, glycerol 20%) supplemented with complete protease inhibitors. Expression levels were adjusted by Western blot with an anti-green fluorescent protein antibody (Roche) by diluting the samples in extracts from nontransfected cells. Two hundred micrograms of the adjusted lysates were incubated at 4 C for 2 h with 10 µM of 3H-Wy14643 (American Radiolabeled Chemicals; 7.5 Ci/mmol) alone or with 3 mM of cold Wy14,643. The bound ligand was then separated from the free ligand on a 1 ml Sephadex G25 column (Amersham Biosciences) and the radioactivity in the second 200-µl fraction was measured by scintillation counting using 10 ml of Ultima Gold scintillation fluid [American Radiolabeled Chemicals (ANAWA Trading SA, Wangen, Switzerland), Packard (Utrecht, The Netherlands)].
GST-Pull-Down Assays
The GST-p3002–516 (50, 54) or GST-NCoR2204-2453 fusion proteins were expressed in Escherichia coli grown until OD600nm reaches 0.6 and induced for 4 h with 0.8 mM isopropyl-ß-D-thiogalactopyranoside, and purified on a glutathione affinity matrix (Pharmacia, Dubendorf, Switzerland). PPARs were produced in vitro with reticulocyte lysates (TNT T7 quick translation/transcription system) and labeled with 35S-methionine. The GST-p300 and GST-NCoR fusion proteins or the GST protein alone (3 µg each) were then incubated with 15 µl of programmed reticulocyte lysates in 500 µl of binding buffer [Tris-HCl (pH 7.4), 25 mM, EDTA 1 mM, NaCl 100 mM, Triton X-100 0.1%, BSA 0.1%, phenylmethylsulfonyl fluoride 0.2 mM, protease inhibitor cocktail] supplemented with 0.5% dry milk, during 4 h at 4 C, in the presence or absence of the PPAR ligand Wy14,643 at 100 µM. Beads were washed three times with binding buffer and samples were boiled with 40 ml of 2x SDS-PAGE buffer (12.5 mM Tris-HCl, 20% glycerol, 0.002% Bromophenol Blue, 5% ß-mercaptoethanol), separated on a 10% SDS-PAGE gel, transferred onto a nitrocellulose membrane and exposed to a PhosphorImager (Storm 840, Molecular Dynamics, Otelfingen, Switzerland).
His-tagged mRXR was produced in SF9 cells and purified on a nickel column (Ni-NTA, QIAGEN, Hombrechtikon, Switzerland) as described before (55). 35S-labeled wt PPAR and PPAR13 were produced with reticulocyte lysates and incubated with approximately 3 µg of RXR-His on nickel beads, or beads only, in the presence or absence of the PPAR ligand Wy14,643 at 100 µM in 500 µl of binding buffer supplemented with 50 mM imidazole, during 4 h at 4 C. Beads were washed three times with binding buffer supplemented with 50 mM imidazole, and samples were boiled in 40 µl of 2x SDS-PAGE buffer, separated on a 10% SDS-PAGE gel, transferred onto a nitrocellulose membrane and exposed to a PhosphorImager.
Generation of Transgenic Mice
The transgene was obtained by digesting the involucrin promoter/PPAR13-containing construct with SalI. Transgenic mice were generated as described (56). Briefly, the transgene, composed of the involucrin promoter fused to the PPAR13 fragment, was microinjected into the pronucleus of fertilized eggs from NMRI mice. Injected eggs were implanted in the uterus of foster mothers. The genotype of the offspring was determined by PCR screening on genomic tail DNA using the following primers: forward (PPAR-specific sequence) 5' CCCAGCATTGAGAAGATGCAGGAGAGCATTGTG 3'; reverse (transgene construct-specific sequence) 5' GCAGCTTATAATGGTTACAA 3'.
Wound-Healing Experiments
All mice used for this study were individually caged, housed in a temperature-controlled room (23 C) on a 10-h dark, 14-h light cycle, and fed with the standard mouse chow diet. All experiments were conducted according to the Swiss standards of animal care. Skin wounds were performed and healing kinetics were measured as previously described (12). Briefly, a 0.5 x 0.5-cm biopsy was excised on the back of each animal. The wound was then allowed to heal until completion, and surface measurement were done in a double blind fashion. Wound areas were quantified (SigmaScan, Aspire Software International, Leesburg, VA) and were standardized and expressed as percentage of the initial wound size (d 0 = 100%) To quantify the expression of PPAR and PPAR13 at the site of the wound, the animals were killed at d 3 after the injury, an area including the epithelial edges of the wound was excised for RNA extraction. For each mouse, a control of healthy dorsal skin was taken at a distance away from the wounded tissue.
Real-Time PCR
Expression levels of the endogenous PPAR and PPAR13 in the liver, kidney, esophagus, and skin of transgenic mice was analyzed by real-time PCR. RNA were isolated from skin samples using TRIZOL reagent according to the manufacturer’s instructions. Reverse transcription was done using the Gene Amp Gold RNA PCR reagent kit according to the manufacturer’s instructions, using random hexamers. The quantitative real-time PCR was performed using SYBR Green I kit, using the following proportions: 2.5 µl buffer 10x, 1.75 µl 50 mM MgCl2, 1.0 µl 5 mM deoxynucleotide triphosphate, 0.9 µl SYBR Green, 10 µl mix primer (Mix primer concentrations: PPAR and PPAR13, skin tissue: 150 nM; PPAR and PPAR13, liver, kidney, and esophagus: 500 nM; IL-1ß and TNF: 500 nM, basic transcription fractor 3: 150 nM), 3.75 µl H2O, 0.1 µl Hot Taq transcriptase 5 U/µl. Twenty microliters of mix were added to 5 ml of cDNA diluted 5x. Thermal conditions: 95 C during 10 min, 37–40 cycles of 95 C, 15 sec; 62 C 1 min. The housekeeping gene BTF3 was used for normalization.
Primer sequences wt PPAR, forward: 5' GACATGTACTGATCTTTCCTGAGATGG 3'; reverse, 5' AGGGAGGCCCTCTGTGCAAATC 3'. PPAR13: forward, 5'GCATGCGCAGCTCGTACA3'; reverse, 5'GATCCTAGACTAGTCTAGATGCTGCG3'. TNF forward: 5'CACCACCATCAAGGACTCAAAT3'; reverse, 5'TCATTCTGAGACAGAGGCAACC3'. IL-1ß forward: 5'CTGGAGAGTGTGGATCCCAAG3'; reverse, 5'ACCGTTTTTCCATCTTCTTCTTTG3'. BTF3: forward, 5' CTGACTAGTTTAAGGAGACTGGCTGAA3'; reverse, 5'TCATCCTCT CCAGTAGCAAGGG 3'.
The amplification was performed using the ABI Prism 7700 Sequence detector with the software Applied Biosystem-Sequence detection system 1.9.1. The efficiencies of the reactions were calculated using LinRegPCR 7.4. Amplification specificity was checked by measuring dissociation curves for each primer pair.
|
ACKNOWLEDGMENTS |
|---|
, ß, and cDNA were kindly provided by Pr. Chambon [Institut Clinique de la Souris (ICS), CU de Strasbourg, France]. |
FOOTNOTES |
|---|
Present address for H.K.: Novartis Institutes for Biomedical Research, CH-4002 Basel, Switzerland.
First Published Online May 12, 2005
Abbreviations: ACO-A, Acyl-coenzyme A oxidase gene; AF-2, activation function-2; CAT, chloramphenicol acetyltransferase; dn, dominant negative; ER, estrogen receptor; GST, glutathione-S-transferase; LBD, ligand binding domain; m, mouse; NCoR, nuclear receptor corepressor; NHR, nuclear hormone receptor; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; SMRT, silencing mediator for retinoid and thyroid hormone receptors; RAR, retinoic acid receptor; RXR, retinoid X receptor; SV40, simian virus 40; TR, thyroid hormone receptor; wt, wild type.
Received for publication January 29, 2005. Accepted for publication May 2, 2005.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
regulates amino acid metabolism. FASEB J 15:1971–1978 and PPARß mutant mice. J Cell Biol 154:799–814 during hair follicle development. Mol Cell Biol 25:1696–1712 mutant shows altered cofactor recruitment and inhibits adipogenesis in 3T3–L1 cells. Diabetologia 46:365–377[Medline]
is a constitutive transcriptional corepressor and inhibits signaling through all PPAR isoforms. Endocrinology 146:1871–1882 activity affect fatty acid-controlled adipose differentiation. J Biol Chem 275:38768–38773 (PPAR) mutant is a constitutive repressor and inhibits PPAR
