| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Endocrinology and Reproduction Research Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892-4510
Address all correspondence and requests for reprints to: Lazar Z. Krsmanovic, Ph.D., Endocrinology and Reproduction Research Branch, Building 49, Room 6A-36, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892. E-mail: lazar{at}mail.nih.gov.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The secretory activities of GnRH neurons in vivo and in vitro are influenced by neurotransmitters (12), catecholamines (13), opiates (14), neuropeptides (15, 16), pituitary hormones (17, 18), and gonadal steroids (19, 20). In addition, the expression of mRNAs for GnRH and GnRH receptor, and the modulation of pulsatile GnRH release by GnRH agonist and antagonist analogs, indicates that an autocrine GnRH regulatory system is operative in native and immortalized GnRH neurons (21, 22). Within the hypothalamus, the autoregulatory control of GnRH neuronal activity is integrated with other neuronal and hormonal inputs to provide a more complex control system with a high degree of redundancy to drive and maintain pulsatile GnRH release and reproductive function.
The serotoninergic system is but one of several neuronal inputs that innervate hypothalamic GnRH neurons (23). The demonstration of synaptic contacts between tritiated 5-HT-labeled buttons and GnRH-immunoreactive neurons by Kiss and Halasz (23) suggested that 5-HT-containing neurons could act directly on GnRH release. In animal studies, 5-HT exerts both stimulatory and inhibitory effects on GnRH release, depending on age, gender, and the signaling pathways of the individual 5-HT receptor subtypes (12, 24, 25, 26).
The five subtypes of G protein-coupled 5-HT receptors are differentially coupled to at least three specific G proteins (5-HT1, primarily to Gi; 5-HT2, primarily to Gq; 5-HT4, 5-HT6, and 5-HT7, primarily to Gs), and have been classified by structural and transductional criteria. Their two major intracellular second messenger pathways are mediated by regulation of adenylyl cyclase (AC) and PLC and phospholipase D. In the present studies, the effects of 5-HT receptor activation on membrane excitability, intracellular signaling, and GnRH secretion were analyzed in native hypothalamic GnRH neurons and immortalized GnRH neurons (GT17 neurons), which have similar cellular and functional properties (21, 27). Identified hypothalamic GnRH neurons were used for electrophysiological recordings, and receptor expression, cellular signaling, and GnRH secretion were analyzed in cultured GT17 neurons. Changes in membrane excitability, intracellular signaling, and neuropeptide secretion were examined during treatment with selective agonist and antagonist analogs to elucidate the roles of individual 5-HT receptor subtypes in the complex regulation of pulsatile GnRH release.
| RESULTS |
|---|
|
|
|---|
|
These time- and dose-dependent differences in the activation of specific second messengers were also reflected in the profile of GnRH release. In perifused GT17 neurons, the GnRH secretory profile was characterized by clearly defined peaks with mean amplitude of 35.4 ± 3.8 pg/ml (n = 3) and interpeak intervals of 39.4 ± 5.3 min. Application of 10 µM 5-HT caused a transient increase in GnRH peak amplitude (to 49.3 ± 4.5 pg/ml; n = 3; P < 0.05) followed by cessation of pulsatile GnRH release (Fig. 1I
).
Expression of Gi-Coupled 5-HT1A Receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses
Analysis of total RNA from cultured GT17 neurons, using gene-specific primers based on the 5-HT1A receptor sequence, gave the expected size fragment of 368 bp. No such products were obtained in the absence of reverse transcribed mRNA, indicating that the RNA preparation was free of genomic DNA contamination. Real-time quantitative RT-PCR revealed 7.4 ± 0.8 x 104 (n = 3) copies of 5-HT1A receptor/µg DNA (Fig. 2A
). DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, because the nucleotide sequences matched the published sequences of the 5-HT1 receptor (data not shown).
|
Expression of Gq-Coupled 5-HT2C receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses
The expression of 5-HT2C receptors in cultured GT17 neurons was demonstrated by real-time RT-PCR. Analysis of total RNA, using gene-specific primers based on sequences of the 5-HT2C receptor, gave the expected fragment size of 452 bp. No such products were obtained in the absence of reverse-transcribed mRNA, indicating that the RNA preparation was free of genomic DNA contamination. Real-time PCR was also used to quantify transcript levels of the individual 5-HT receptors in cultured GT17 neurons. Based on the number of copies present in the cDNA relative to the standard curve, cultured GT17 neurons expressed 3.1 ± 0.4 x 105 (n = 3) copies of 5-HT2C receptor/µg DNA. The expression of 5-HT2C receptor genes in cultured GT17 neurons and the effects of their activation on neuronal firing are shown in Fig. 3A
. DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, which matched the published sequence of the 5-HT2C receptor (data not shown).
|
-methyl-5-hydroxytryptamine (
-methyl 5-HT), a selective agonist for the Gq-coupled 5-HT2 receptor, significantly increased the frequency of AP firing, from basal (0.22 ± 0.05 Hz to 1.14 ± 0.9 Hz; P < 0.01; n = 10) (Fig. 3C
Treatment of GT17 neurons with
-methyl 5-HT stimulated InsP2+3 productions in a dose-dependent manner, with EC50 of 1.3 µM and a maximal response at micromolar agonist concentrations (Fig. 3E
). Treatment with 10 µM
-methyl 5-HT significantly increased GnRH peak amplitude after an initial delay (21.3 ± 2.2 pg/ml control vs. 32.3 ± 3.5 pg/ml treated; n = 3; P < 0.05; Fig. 3F
). This response is consistent with earlier observations that activation of the PLC/InsP3/Ca2+ signaling pathway increases GnRH pulse amplitude and reduces pulse frequency (21, 22).
Expression of Gs-Coupled 5-HT4 Receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses in GnRH Neuronal Cells
Analysis of total RNA from cultured GT17 neurons, using gene-specific primers based on sequences of the Gs-coupled 5-HT4 receptor, gave the expected size fragment of 398 bp (Fig. 4A
). No such products were obtained in the absence of reverse transcribed mRNA. Real-time quantitative RT-PCR detected 5.3 ± 0.8 x 104 (n = 3) copies of 5-HT4 receptor/µg DNA. DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, because the nucleotide sequence matched the known sequence of the 5-HT4 receptor (data not shown). 5-HT7 receptors were also expressed in GT17 neurons at low levels (2.1 x 103 copies/mg DNA).
|
| DISCUSSION |
|---|
|
|
|---|
In addition to the GnRH receptor expressed in GnRH neurons (28), and in other tissues and expression systems (29, 30, 31, 32), neurokinin receptor subtypes (NK1 and NK2) exemplify the ability of certain GPCRs to couple to more than one G protein. Similar to the GnRH receptor, agonist activation of both NK receptors elicits a biphasic response with sequential increases in intracellular calcium and cAMP levels (33, 34). However, the cAMP response can be eliminated by point mutations in the extracellular amino-terminal domain of the receptor (35), suggesting that different receptor conformations could result in distinct activation states that have differential ligand affinities, associated with differential coupling to individual G proteins (36). Similarly, mutation of specific residues in the first intracellular loop of the GnRH receptor that are not essential for activation of the phosphoinositide signaling pathway uncouples the receptor from AC signaling (37).
GnRH receptors expressed in native and immortalized GnRH neurons activate diverse signaling pathways by coupling to at least three G proteins. Such coupling is time and dose dependent, and switches between Gq, Gs, and Gi/o according to the agonist concentration (28). These findings suggest that an agonist concentration-dependent switch in coupling of the GnRH receptor between specific G proteins modulates neuronal Ca2+ signaling via Gs-cAMP-stimulatory and Gi-cAMP-inhibitory mechanisms. Activation of Gi could also inhibit GnRH neuronal function and episodic secretion by regulating membrane ion currents, probably through activation of G protein-regulated inwardly rectifying potassium channels (38, 39).
In contrast to the single GnRH receptor, RT-PCR analysis of RNA isolated from cultured GT17 neurons revealed the expression of mRNAs encoding three specific 5-HT receptors, including the Gi-coupled 5-HT1A, Gq-coupled 5-HT2C, and Gs-coupled 5-HT4 and 5-HT-7 receptors. Treatment of native hypothalamic neurons with 5-HT, the endogenous nonselective 5-HT receptor agonist, caused both stimulation and inhibition of AP firing consistent with time- and dose-dependent activation of multiple 5-HT receptor subtypes. Treatment of GT17 neurons with 5-HT likewise activates the InsP3/Ca2+ signaling pathway and exerts dose- and time-dependent stimulatory and inhibitory actions on cAMP production and GnRH release in GT17 cells. Such changes in InsP3/Ca2+ signaling, cAMP production, and GnRH release were similar to those elicited by activation of the neuronal GnRH receptor (21, 22, 28). These findings indicate that the actions of 5-HT are mediated by activation of multiple signaling pathways, which can account for its previously observed diverse actions on GnRH release (12, 24, 26). Earlier reports on the actions of 5-HT on gonadotropin release indicate that it also has a dual effect on this response that is dependent on estradiol concentration (40), the receptor subtype (41, 42), and interactions with the opiate and adrenergic systems (43).
In addition to its role in the regulation of GnRH release from hypothalamic neurons, 5-HT is an important factor in the early development of the GnRH neuronal system. In Tg8 mice lacking the gene encoding monoamine oxidase A, the number of GnRH neurons in the forebrain was significantly reduced. This suggests that an excess of 5-HT inhibits the proliferation of GnRH neuronal precursor cells and stimulates GnRH neuronal migration to their final location in the septo-preoptic region (44, 45).
A large family of 5-HT1 receptors is negatively coupled to AC via Gi proteins. In addition to inhibiting AC, 5-HT1A receptors are directly coupled to voltage-sensitive K+ channels via a Gi-coupled protein and therefore are not solely dependent on second messenger signaling (46, 47, 48). RT-PCR analysis of total RNA isolated from cultured GT17 neurons also revealed the expression of 5-HT1A Gi-coupled receptors. Quantitative real-time RT-PCR analysis showed that the expression level of 5-HT1A receptors was similar to that of 5-HT2C receptors. Treatment of identified hypothalamic GnRH neurons with a 5-HT1A receptor agonist (PAPP) caused pronounced inhibition of spontaneous AP firing. This effect was reversible, and spontaneous firing of APs recovered during washout of the 5-HT1A agonist. The inhibitory action of 5-HT1A receptor activation on spontaneous AP firing in hypothalamic GnRH neurons could be related to the release of ß
-subunits from Gi (or Go), with consequent actions on plasma membrane ion channels (49). Such effects could include both inhibition of voltage-dependent calcium channels (50) and activation of inwardly rectifying potassium channels (51, 52).
Treatment of GT17 neurons with the selective 5-HT1A receptor agonist, 2-MPP, activated the Gi-mediated AC/cAMP-inhibitory signaling pathway. This response was prevented by PTX, consistent with coupling to an inhibitory Gi protein. The resulting decrease in cAMP production was associated with marked inhibition of pulsatile GnRH release. In cultured hypothalamic cells and GT17 neurons, such inhibition of pulsatile GnRH release was also observed during activation of Gi-coupled LH receptors (18), M2 muscarinic receptors (53), GnRH receptors (28), and estrogen receptors (20). It is evident from our data, and studies by others, that the convergence of signaling from Gi/o-coupled receptors expressed in native and GT17 neurons to the AC/cAMP-inhibitory signaling pathway decreases membrane excitability, reduces the rate of AP firing, and inhibits pulsatile GnRH release. In addition to this process, studies on the role of 5-HT-liberated Gß
-subunits in synaptic transmission have revealed another inhibitory action of Gß
on neurosecretion that is distal to Ca2+ entry and cAMP signaling, and acts directly on the exocytotic fusion machinery (54). This mechanism involves binding of ß
-subunits to the C terminus of SNAP25 and interference with the Ca2+-induced soluble N-ethylmaleimide-sensitive factor attachment protein receptor machinery for vesicle fusion and secretory granule exocytosis (55, 56).
The Gq-coupled 5-HT2C receptors expressed in GT17 neurons were identified by quantitative RT-PCR as the most abundant of the 5-HT receptors in these cells. In electrophysiological studies, activation of 5-HT2 receptors in identified embryonic d 18 (E-18) hypothalamic GnRH neurons with the specific receptor agonist,
-methyl 5-HT, significantly increased the frequency of AP firing. This was associated with membrane depolarization, consistent with data obtained during analysis of 5-HT2C receptor function in other tissues and expression systems (57). The functional correlates of PLC activation by 5-HT2 receptors are multiple. An increase in intracellular calcium concentration that induces a rapid Cl current through a Ca2+-dependent chloride channel has been characterized for the three members of the 5-HT2 receptor family and appears to be mediated through the PLC/InsP3 pathway (58, 59, 60). 5-HT2A receptor activation also induces the closing of a K+ channel, leading to depolarization of the cell. In Xenopus oocytes coexpressing 5-HT2C receptors and a brain-derived K+ channel, the suppression of K+ conductance by 5-HT involves a calcium/calmodulin-activated phosphatase, which has been postulated to dephosphorylate the K+ channel, leading to its closing. Recovery from such suppression may be due to the action of a protein kinase, because it was prevented by the kinase inhibitor H-7 (61).
Members of the 5-HT2 receptor family are primarily coupled to PLC, and selective activation of these receptors in GT17 neurons increased InsP2+3 production in a dose-dependent manner. This response was pertussis toxin insensitive and was blocked by ketanserine, indicating the involvement of a Gq-type protein. GnRH release was also affected by selective activation of 5-HT2C receptors, which increased both the peak amplitude and the interpulse interval. Similar increases in GnRH pulse amplitude were observed during activation of M1 muscarinic receptors and activation of GnRH receptors expressed in GT17 neurons (28, 53). Thus, increased membrane excitability and the convergence of signaling from Gq-coupled receptors expressed in GT17 cells to common effectors could regulate PLC/InsP3/Ca2+ signaling and increase GnRH peak amplitude.
Stimulation of adenylate cyclase was the first signal transduction pathway to be linked to 5-HT receptors (62). Analysis of the expression of 5-HT4 receptors in cultured GT17 neurons by real-time RT-PCR showed their level of expression to be less than that of 5-HT2C receptors. Examination of the electrophysiological properties of Gs-coupled 5-HT4 receptors in E-18 hypothalamic GnRH neurons revealed that their spontaneous electrical activity increased during selective agonist treatment with (1s,8s)-n-[(hexahydro-1H-pyrrolizin-1-yl)methyl)]-4-amino-5-chloro-2-methoxy-benzamide. This increase in AP firing was associated with increased bursting activity and the appearance of lower-amplitude broad APs. This effect has been attributed to cAMP, based on the ability of 8-bromo cAMP and forskolin, a direct activator of adenylate cyclase, to mimic the actions of 5-HT (63). Depression of K+ current may lead to depolarization, calcium influx, and subsequent enhancement of GnRH release (8).
Selective activation of 5-HT4 receptors in GT17 neurons increased cAMP production in a dose-dependent manner and caused a robust and sustained increase in GnRH secretion during perifusion studies. Similar increases in GnRH release were observed during activation of ß1-adrenergic receptors (64) and application of 8-bromo cAMP and forskolin (18, 65). Our observations, and those of others, indicate that cAMP signaling from Gs-coupled receptors expressed in GT17 cells increases membrane excitability and causes prominent and sustained increases in GnRH secretion (8, 66).
In summary, the marked inhibitory effect of Gi-coupled 5-HT1A receptors on spontaneous AP firing, cAMP production, and inhibition of pulsatile GnRH secretion suggests their involvement in negative regulation during pulsatile GnRH release. Activation of 5-HT2 Gq-coupled receptors triggers the PLC/InsP3/Ca2+ signaling pathway and promotes spike-like increases in GnRH release. Selective targeting of 5-HT4 receptors activates the Gs-AC-cAMP signaling pathway, increases cAMP production and AP firing frequency, and stimulates basal GnRH release. In addition to the GnRH receptor, native and immortalized GnRH neurons express several 5-HT and other G protein-coupled receptors. These observations indicate that the convergence of signaling from specific GPCRs to common effector systems provides a powerful mechanism for the control of pulsatile GnRH release.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Perifusion Procedure and Hormone Measurement
Bead-attached GT17 cells were perifused at a flow rate of 0.15 ml/min at 37 C, and fractions collected at 5-min intervals were stored at 20 C before RIA of their GnRH content. GnRH was measured using 125I-labeled GnRH (Amersham Biosciences Corp., Piscataway, NJ), GnRH standards (Peninsula Laboratories, Belmont, CA), and primary antibody donated by Dr. V. D. Ramirez (University of Illinois, Urbana, IL). The intra- and interassay coefficients of variation at 50% binding in standard samples (15 pg/ml) were 5% and 7%, respectively. The sensitivity of the assay, defined as twice the SD at zero dose, was 0.2 pg/tube (n = 6). In previous studies, pulsatile GnRH secretion and its regulation have been found to be identical in GT17 cells and cultured hypothalamic neurons.
cAMP Production
For studies on cAMP release, GnRH-producing cells were stimulated in serum-free medium (1:1 DMEM/F-12) containing 0.1% BSA, 30 mg/liter bacitracin, and 1 mM 3-isobutyl-1-methylxanthine. RIA of cAMP was performed as previously described, using a specific cAMP antiserum at a titer of 1:5000 (67). The intraassay coefficient of variation of the assay was 4% at 50% displacement.
Inositol Phosphate Production
Cells were labeled for 24 h in inositol-free medium containing 20 mCi/ml [3H]inositol as described previously (68), and then washed with inositol-free M199 medium and stimulated at 37 C in the presence of 10 mM LiCl. Inositol phosphates were fractionated by anion exchange chromatography, and the InsP2+3 fractions eluted with 1 M ammonium formate in 0.1 M formic acid (3 ml/wash) were analyzed by liquid scintillation b-spectrometry.
Whole-Cell Recording of GnRH Neurons
For whole-cell recording, hypothalamic cells were cultured on collagen-coated cover slips and continuously perifused with artificial extracellular solution at a rate of 0.6 ml/min. The extracellular solution contained (in mM): 140 NaCl, 5 KCl, 10 HEPES, 10 D-glucose, 2 CaCl2, 1 MgCl2. pH was adjusted to 7.4 with NaOH. The cells were viewed under an inverted Olympus IX70 microscope with a x40, long working distance objective (Olympus Corp., Lake Success, NY). All recordings were done at room temperature (2325 C). Patch pipettes (35 M
) were pulled from thick-wall borosilicate capillary glass (1.5-mm outer diameter and 0.86-mm inner diameter, WPI, Inc., Sarasota, FL) on a Flaming/Brown puller model P-87 (Sutter Instruments Co., Novato, CA). The pipette solution was prepared containing (in millimolar concentration): 70 KCl, 70 potassium gluconate, 0.1 CaCl2, 2 MgCl2, 10 HEPES, 2 ATP potassium salt (K2ATP), 0.1 Na2GTP, 5 EGTA, with pH adjusted to 7.2 with KOH. An Ag/AgCl pellet was used as the reference electrode. Spontaneous activities were recorded under I-clamp mode with a Multi-Clamp700A amplifier (Axon Instruments, Foster City, CA), filtered at 2 kHz, and digitized at 10 kHz through Digidata 1320A (Axon Instruments). Acquisition and subsequent analysis of the experimental data were performed using Clampex 9.0 software (Axon Instruments). Traces and voltage-current curves were plotted using "Origin 7" computer software (MicroCal Software, Northampton, MA). After recordings, the cytoplasmic contents of the recorded neuron were harvested under visual control, and single-cell RT-PCR was used to identify the presence of GnRH transcripts as previously reported (27, 69). Hypothalamic cells that did not show typical GnRH neuronal morphology were used as controls. Firing of APs in identified cultured E-18 hypothalamic GnRH neurons was obtained from single isolated GnRH neurons to eliminate the influence of electrical and synaptic coupling between cells.
RT-PCR Analysis of 5-HT Receptor Subtype
Total RNA was extracted from GT17 cells using Absolutely RNA RT-PCR Miniprep Kits (Stratagene, La Jolla, CA). RNA was digested with DNase in a low-salt buffer to remove any remaining DNA. Reverse transcription was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). Briefly, using 5 µg of total RNA as a template, first-strand cDNA was made using 500 ng of oligo(dT)1218 and 1 ml of 10 mM deoxynucleotide triphosphate Mix (Invitrogen) in a 13-µl reaction volume. After heat denaturing at 65 C for 5 min, and addition of 4 µl of 5x First Strand Buffer, 1 µl of 0.1 M dithiothreitol, 1 µl of RNase OUT recombinant RNase inhibitor (Invitrogen), and 200 U of SuperScript III Reverse Transcriptase, reverse transcription was performed at 55 C for 50 min. RNA complementary to the cDNA was removed by addition of 1 µl of E. coli RNase H and incubation at 37 C for 20 min. An 0.5-µl aliquot of cDNA was used as template. Primers used were 5'-G[nucleotide (nt) 442] CATTTCTTTTTCCCTCCCTTCC (nt 464)-3' (sense) and 5'-T(nt 809) GACCCAGAGTCCACTTGTTGAG (nt 787)-3' (antisense) for 5-HT1A receptor; 5'-T(nt 2345) CTCCCTTCCTTCCGTATTCCC (nt 2366)-3' (sense) and 5'-T(nt 2796) GGCATCCTTCCACTTCTGTAGTC (nt 2773)-3' (antisense) for 5-HT2C receptor; 5'-T(nt 25) GAGTTCCAACGAGGGTTTCAG (nt 46)-3' (sense) and 5'-T (nt 422) AATGCGATGCGTAGAGGGG (nt 403)-3' (antisense) for 5-HT4 receptor; and 5'-G(nt 1137) CTGCCGTTTTTCCTCTTGTC (nt 1157)-3' (sense) and 5'-C(nt 1513) AATGGTTTCGTTGTTTCCCC (nt 1494)-3' (antisense) for 5-HT7 receptor; and 5'-A(nt 152) ACGACCCCTTCATTGAC (nt 1169)-3' (sense) and 5'-T(nt 342) CCACGACATACTCAGCAC (nt 324)-3' (antisense) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The expected sizes of 5HT1, 5-HT2C, 5-HT4, 5HT7, and GAPDH were 321, 347, 315, 431, and 191 bp, respectively. PCR conditions were: denaturing at 94 C for 2 min, followed by 30 cycles of denaturing at 94 C for 30 sec, annealing at 55 C for 30 sec, and extension at 72 C for 60 sec. PCR products were analyzed by electrophoresis using 2% agarose gels.
Real-Time RT-PCR Analysis of 5-HT Receptor Expression
mRNA of 5HT receptors were quantified by real-time RT-PCR performed in a Light Cycler (Roche, Branchburg, NJ) using SYBR Green I as a double-strand DNA-specific binding dye according to the manufacturers instructions, continuously monitoring the cycle-by-cycle accumulation of each fluorescently labeled PCR product. Amplifications were carried out using 1 U Platinum Taq DNA polymerase (Invitrogen), 0.5 µM of each primer, 3 mM MgCl2, 10xPlatinum Taq DNA polymerase buffer (200 µmol/liter Tris-HCL, pH 8.4; 500 µmol/liter KCl), 200 µM deoxynucleotide triphosphate, 1 mg/ml BSA, 1 µl 1:2000 dilution of SYBR Green I nucleic acid gel stain (BioWhittaker Molecular Applications, Rockland, ME), and 2 µl 1:5 dilution of cDNA in a total volume of 20 µl. The real-time PCR conditions were preheat denaturation at 95 C for 5 min, annealing at 59 C for 10 sec, and extension at 72 C for 12 sec; cycle number 45. SYBR Green I fluorescence was detected at 72 C at the end of each cycle to monitor the amount of PCR product formed. A melting curve analysis of the amplification products was performed at the end of the PCR run by rapidly increasing the temperature to 95 C, followed by immediate cooling to 65 C for 15 sec, after which the temperature was gradually increased to 95 C at a rate of 0.1 C per second with continuous measurement of fluorescence to confirm amplification of specific transcripts. The melting temperature profile for 5-HT1A, 5-HT2C, 5-HT4, 5-HT7 receptors and GAPDH demonstrated single peaks at 85.5 C, 86 C, 90 C, 86 C, and 89 C, respectively.
External cDNA standards for 5-HT receptors and GAPDH were produced by inserting PCR products, which were generated using the same primers used for RT-PCR and GT17 cell cDNA as a template, into the pCR2.1 vector using the TOPO TA Cloning Kit (Invitrogen). Vector constructs were used to transform DH5
, and plasmid DNA was prepared by Wizard plus Minipreps DNA purification System (Promega Corp., Madison WI). The inserts of control vectors for 5-HT receptors were verified by sequencing. The concentration of standard was determined by measuring the OD260, and the copy number was calculated.
Materials
Oligonucleotides were obtained from Gene Probe Technologies (Gaithersburg MD). Absolutely RNA RT-PCR Miniprep Kit was purchased from Stratagene (La Jolla, CA). SuperScript III RNase H radical extender. Reverse Transcriptase, Platinum Taq DNA polymerase, pCR2.1 vector, and TOPO TA cloning kit were purchased from Invitrogen. Wizard plus Minipreps DNA purification system was purchased from Promega Corp.
5-HT, the nonselective endogenous 5-HT receptor agonist, was purchased from Sigma-Aldrich (St. Louis, MO). Selective 5-HT1 receptor agonist analogs, 2-MPP and PAPP, were purchased from Sigma-Aldrich. Selective 5-HT2 receptor agonist analog
-methyl-5-HT maleate (
-methylserotonin maleate), and ketanserin tartrate-selective 5-HT2 antagonist were purchased from Sigma-Aldrich. The (1s,8s)-n-[(hexahydro-1H-pyrrolizin-1-yl)methyl)]-4-amino-5-chloro-2-methoxy-benzamide-selective 5-HT4 agonist was a gift from Searle Pharmaceuticals (High Wycombe, UK).
Data Analysis
GnRH pulses were identified and their parameters determined by computerized cluster analysis (70). Individual point SDs were calculated using a power function variance model from the experimental duplicates. A 2 x 2 cluster configuration and a t statistic of 2 for the upstroke and downstroke were used to maintain false-positive and false-negative error rates below 10%. The pulse parameters were analyzed by ANOVA and results expressed as mean ± SEM. Statistical comparisons were performed using the Kruskal-Wallis test followed by the Mann-Whitney U test.
| FOOTNOTES |
|---|
First Published Online August 18, 2005
1 At the time of this study, N.M. was on leave from the Department of Pharmacology, Catholic University of the Sacred Heart, 00168 Rome, Italy. ![]()
Abbreviations: AC, Adenylyl cyclase; AP, action potential; E-18, embryonic d 18; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPCR, G protein-coupled receptor; 5-HT, serotonin; InsP2+3, inositol biphosphate + inositol triphosphate; InsP3, inositol 1,4,5-triphosphate;
-methyl 5-HT,
-methyl-5-hydroxytryptamine; 2-MPP, 1-(2-methoxyphenyl)piperazine; NK, neurokinin; nt, nucleotide; PAPP, 4-[2-[4-[3-(trifluoromethyl)phenyl]-1-piperazinyl]ethyl]benzeneamine p-aminophenethyl-m-trifluoromethylphenyl piperazine; PLC, phospholipase C; PTX, pertussis toxin.
Received for publication March 3, 2005. Accepted for publication August 8, 2005.
| REFERENCES |
|---|
|
|
|---|
knockout mice. Endocrinology 139:40924101
subunit activation. J Physiol 555:643657
subunit-mediated presynaptic inhibition: regulation of exocytotic fusion downstream of Ca2+ entry. Science 292:293297
acts at the C terminus of SNAP-25 to mediate presynaptic inhibition. Nat Neurosci 8:597605[CrossRef][Medline]
directly regulates SNARE protein fusion machinery for secretory granule exocytosis. Nat Neurosci 8:421425[Medline]
and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:51955201This article has been cited by other articles:
![]() |
H. L Henderson, D. J Hodson, S. J Gregory, J. Townsend, and D. J Tortonese Gonadotropin-Releasing Hormone Stimulates Prolactin Release from Lactotrophs in Photoperiodic Species Through a Gonadotropin-Independent Mechanism Biol Reprod, February 1, 2008; 78(2): 370 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Constantin and S. Wray Gonadotropin-Releasing Hormone-1 Neuronal Activity Is Independent of Cyclic Nucleotide-Gated Channels Endocrinology, January 1, 2008; 149(1): 279 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Antonsen and D. H. Edwards Mechanisms of Serotonergic Facilitation of a Command Neuron J Neurophysiol, December 1, 2007; 98(6): 3494 - 3504. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Quaynor, L. Hu, P. K. Leung, H. Feng, N. Mores, L. Z. Krsmanovic, and K. J. Catt Expression of a Functional G Protein-Coupled Receptor 54-Kisspeptin Autoregulatory System in Hypothalamic Gonadotropin-Releasing Hormone Neurons Mol. Endocrinol., December 1, 2007; 21(12): 3062 - 3070. [Abstract] [Full Text] [PDF] |
||||
![]() |
|