help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0109
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wada, K.
Right arrow Articles by Catt, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wada, K.
Right arrow Articles by Catt, K. J.
Molecular Endocrinology 20 (1): 125-135
Copyright © 2006 by The Endocrine Society

Serotonin (5-HT) Receptor Subtypes Mediate Specific Modes of 5-HT-Induced Signaling and Regulation of Neurosecretion in Gonadotropin-Releasing Hormone Neurons

Keiko Wada, Lian Hu, Nadia Mores1, Carlos E. Navarro, Hirotoshi Fuda, Lazar Z. Krsmanovic and Kevin J. Catt

Endocrinology and Reproduction Research Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892-4510

Address all correspondence and requests for reprints to: Lazar Z. Krsmanovic, Ph.D., Endocrinology and Reproduction Research Branch, Building 49, Room 6A-36, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892. E-mail: lazar{at}mail.nih.gov.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Serotonin (5-HT), the endogenous nonselective 5-HT receptor agonist, activates the inositol 1,4,5-triphosphate/calcium (InsP3/Ca2+) signaling pathway and exerts both stimulatory and inhibitory actions on cAMP production and GnRH release in immortalized GnRH neurons. The high degree of similarity between the signaling and secretory responses elicited by GnRH and 5-HT prompted us to target specific 5-HT receptor subtypes to deconvolute the complex actions of these agonists on signal transduction and GnRH release. Specific mRNA transcripts for 5-HT1A, 5-HT2C, 5-HT4, and 5-HT7 were identified in immortalized GnRH neurons (GT1–7). The rate of firing of spontaneous action potentials (APs) by hypothalamic GnRH neurons and cAMP production and pulsatile GnRH release in GT17 cells were profoundly inhibited during activation of the Gi-coupled 5-HT1A receptor. Treatment with a selective agonist to activate the Gq-coupled 5-HT2C receptor increased the rate of firing of spontaneous APs, stimulated InsP3 production and caused a delayed increase in GnRH release. Selective activation of the Gs-coupled 5-HT4 receptor also increased the rate of firing of APs, stimulated cAMP production, and caused a sustained and robust increase in GnRH release. The ability of 5-HT receptor subtypes expressed in GnRH neurons to activate single or multiple G proteins in a time- and dose-dependent manner differentially regulates the phospholipase C/InsP3/Ca2+, and adenylyl cyclase/cAMP signaling pathways, and thereby regulates the frequency and amplitude of pulsatile GnRH release. This process, in conjunction with the modulation of spontaneous electrical activity of the GnRH neuron, contributes to the control of the pulsatile mode of neuropeptide secretion that is characteristic of GnRH neuronal function in vivo and in vitro.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PULSATILE RELEASE OF GnRH into the hypothalamic/pituitary portal vessels at the median eminence is essential for the maintenance of optimal gonadotropin secretion and normal reproductive function. Several mechanisms for the generation of pulsatile GnRH release have been suggested, including the spontaneous electrical activity of single GnRH neurons (1, 2), bursts of action potentials as in other neuroendocrine cells (3, 4, 5, 6), and cAMP-dependent activation of cyclic nucleotide-gated cation channels in normal and immortalized GnRH neurons (7, 8, 9, 10). GnRH action in GT1–7 neurons is also associated with activation of phospholipase D. This response is mediated by PKC and Ca2+ influx through voltage-sensitive calcium channels, and phospholipase D serves as a common intracellular effector for phospholipase C (PLC)- and voltage-gated signaling pathways in GnRH neurons (11).

The secretory activities of GnRH neurons in vivo and in vitro are influenced by neurotransmitters (12), catecholamines (13), opiates (14), neuropeptides (15, 16), pituitary hormones (17, 18), and gonadal steroids (19, 20). In addition, the expression of mRNAs for GnRH and GnRH receptor, and the modulation of pulsatile GnRH release by GnRH agonist and antagonist analogs, indicates that an autocrine GnRH regulatory system is operative in native and immortalized GnRH neurons (21, 22). Within the hypothalamus, the autoregulatory control of GnRH neuronal activity is integrated with other neuronal and hormonal inputs to provide a more complex control system with a high degree of redundancy to drive and maintain pulsatile GnRH release and reproductive function.

The serotoninergic system is but one of several neuronal inputs that innervate hypothalamic GnRH neurons (23). The demonstration of synaptic contacts between tritiated 5-HT-labeled buttons and GnRH-immunoreactive neurons by Kiss and Halasz (23) suggested that 5-HT-containing neurons could act directly on GnRH release. In animal studies, 5-HT exerts both stimulatory and inhibitory effects on GnRH release, depending on age, gender, and the signaling pathways of the individual 5-HT receptor subtypes (12, 24, 25, 26).

The five subtypes of G protein-coupled 5-HT receptors are differentially coupled to at least three specific G proteins (5-HT1, primarily to Gi; 5-HT2, primarily to Gq; 5-HT4, 5-HT6, and 5-HT7, primarily to Gs), and have been classified by structural and transductional criteria. Their two major intracellular second messenger pathways are mediated by regulation of adenylyl cyclase (AC) and PLC and phospholipase D. In the present studies, the effects of 5-HT receptor activation on membrane excitability, intracellular signaling, and GnRH secretion were analyzed in native hypothalamic GnRH neurons and immortalized GnRH neurons (GT1–7 neurons), which have similar cellular and functional properties (21, 27). Identified hypothalamic GnRH neurons were used for electrophysiological recordings, and receptor expression, cellular signaling, and GnRH secretion were analyzed in cultured GT1–7 neurons. Changes in membrane excitability, intracellular signaling, and neuropeptide secretion were examined during treatment with selective agonist and antagonist analogs to elucidate the roles of individual 5-HT receptor subtypes in the complex regulation of pulsatile GnRH release.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
5-HT-Induced Changes in Electrical Activity of Native GnRH Neurons and Signaling Pathways and Secretory Responses
5-HT, the endogenous nonselective 5-HT receptor agonist, caused biphasic and dose-dependent changes in the firing of action potentials (APs) in hypothalamic GnRH neurons. AP firing significantly increased during treatment with 10 nM 5-HT (1.4 ± 0.1 Hz to 1.9 ± 0.13 Hz; P < 0.01; n = 5; Fig. 1Go, B and E), gradually decreased to the basal rate of firing during treatment with 100 nM 5-HT (Fig. 1Go, C and E), and was significantly reduced during treatment with 1 µM 5-HT (1.4 ± 0.1 Hz to 1.0 ± 0.05 Hz; P < 0.05; n = 5; Fig. 1Go, D and E).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. 5-HT-Induced Changes in Electrical Activity, Signaling Pathways, and Pulsatile Neurosecretion in Native and Immortalized GnRH Neurons

A, Spontaneous firing of APs in identified E-18 hypothalamic GnRH neurons. B, Stimulation of AP firing by low nanomolar 5-HT concentrations. C, Lack of changes in AP firing during treatment with high nanomolar 5-HT concentrations. D, Inhibition of AP firing by micromolar 5-HT concentrations. E, Dose-dependent effect of 5-HT on AP firing in identified GnRH neurons. All AP traces were obtained from identified hypothalamic GnRH neurons. F, Dose-dependent stimulation of InsP2+3 production in GT1–7 neurons. G, Bell-shaped dose-dependent effects of 5-HT on cAMP production in GT1–7 neurons (open circles). Reversal of 5-HT-induced inhibition of cAMP production by pertussis toxin (solid circles). H, Time-dependent action of 5-HT on cAMP production in GT1–7 neurons. Data are means ± SEM of four independent experiments. I, Initial stimulation and subsequent inhibition of pulsatile GnRH release during treatment with 5-HT. A representative profile from three independent perifusion experiments is shown in this and subsequent figures. (M), Molar concentration.

 
In GT1–7 neurons, treatment with 5-HT activated the inositol 1,4,5-triphosphate (InsP3)/Ca2+ signaling pathway and caused a monophasic, dose-dependent increase in inositol bisphosphate + inositol trisphosphate (InsP2+3) production (Fig. 1FGo). In addition to stimulating the inositol phosphate/Ca2+-signaling pathway via Gq/11, 5-HT also regulates cAMP production. The action of 5-HT on cAMP production in GT1–7 neurons was also biphasic and dose dependent. 5-HT concentrations of up to 1 µM caused a progressive increase in cAMP production, but at higher concentrations 5-HT had an inhibitory effect on cAMP production that was prevented by treatment with pertussis toxin (PTX). The bell-shaped dose-response curve and the reversal of the inhibitory actions of high 5-HT concentrations on cAMP production by PTX are consistent with the activation of Gi-related proteins (Fig. 1GGo). In time studies, 5-HT treatment elicited a biphasic response in cAMP production. During sustained treatment, an initial increase during the first 30 min was followed by a reduction in cAMP production to below the basal level after 60 min (Fig. 1HGo). The InsP2+3 and cAMP responses were differentially regulated by increasing agonist concentrations, such that IP2+3 production was maximal at high 5-HT concentrations, when cAMP production was minimal. In contrast, maximal cAMP production occurred during stimulation with low 5-HT concentrations, at which IP2+3 production was half-maximal (Fig. 1Go, F and G).

These time- and dose-dependent differences in the activation of specific second messengers were also reflected in the profile of GnRH release. In perifused GT1–7 neurons, the GnRH secretory profile was characterized by clearly defined peaks with mean amplitude of 35.4 ± 3.8 pg/ml (n = 3) and interpeak intervals of 39.4 ± 5.3 min. Application of 10 µM 5-HT caused a transient increase in GnRH peak amplitude (to 49.3 ± 4.5 pg/ml; n = 3; P < 0.05) followed by cessation of pulsatile GnRH release (Fig. 1IGo).

Expression of Gi-Coupled 5-HT1A Receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses
Analysis of total RNA from cultured GT1–7 neurons, using gene-specific primers based on the 5-HT1A receptor sequence, gave the expected size fragment of 368 bp. No such products were obtained in the absence of reverse transcribed mRNA, indicating that the RNA preparation was free of genomic DNA contamination. Real-time quantitative RT-PCR revealed 7.4 ± 0.8 x 104 (n = 3) copies of 5-HT1A receptor/µg DNA (Fig. 2AGo). DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, because the nucleotide sequences matched the published sequences of the 5-HT1 receptor (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. Expression of 5-HT1A Receptor Transcripts and Ligand-Induced Changes in Electrical Activity, Second Messengers, and Pulsatile Neurosecretion in Native and Immortalized GnRH Neurons

A, Expression of 5-HT1A receptors in cultured GT1–7 neurons was demonstrated using gene-specific primers and was confirmed by DNA sequencing of the purified band. B, Spontaneous firing of APs in identified cultured E-18 hypothalamic GnRH neurons. C and D, Time-dependent inhibition of AP firing in native GnRH neurons during treatment with PAPP, a 5-HT1A receptor agonist. E, Resumption of spontaneous AP firing during washout of PAPP. All AP traces were obtained from identified hypothalamic GnRH neurons. F, Dose-dependent inhibition of cAMP production during treatment with 2-MPP, another 5-HT1A receptor agonist. The data are means from four independent experiments. G, Inhibition of pulsatile GnRH secretion during treatment with 2-MPP (solid circles), and resumption of pulsatile GnRH release during the washout period. (M), Molar concentration; RT, reverse transcription.

 
The basal rate of AP firing in hypothalamic GnRH neurons (Fig. 2BGo) was markedly reduced during treatment with the selective 5-HT1A receptor agonist, 4-[2-[4-[3-(trifluoromethyl)phenyl]-1-piperazinyl]ethyl]benzeneamine p-aminophenethyl-m-trifluoromethylphenyl piperazine (PAPP) (10 µM), from 0.4 ± 0.05 Hz to 0.1 ± 0.03 Hz (P < 0.01; n = 8) after 1.5 min of treatment and was almost completely abolished after 7 min (Fig. 2DGo). Spontaneous AP firing resumed during washout of the agonist and returned to the control level (Fig. 2EGo). Treatment of GT1–7 neurons with 1-(2-methoxyphenyl)piperazine (2-MPP), another potent and selective agonist for Gi/o-coupled 5-HT1A receptors, inhibited cAMP production in a dose-dependent manner (open circles). This inhibitory response to 2-MPP was prevented by treatment with PTX, consistent with its activation of Gi-related proteins (Fig. 2FGo, solid circles). Pulsatile GnRH release was also markedly inhibited during selective activation of the Gi-coupled 5HT1A receptor with 2-MPP (Fig. 2GGo). The characteristic pulsatile GnRH release from perifused GT1–7 neurons was completely abolished, and the mean basal GnRH release decreased from 28.3 ± 0.3 pg/ml to 18.4 ± 0.3 pg/ml in cultures perifused with 100 µM 2-MPP. Pulsatile GnRH release subsequently resumed during the washout period.

Expression of Gq-Coupled 5-HT2C receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses
The expression of 5-HT2C receptors in cultured GT1–7 neurons was demonstrated by real-time RT-PCR. Analysis of total RNA, using gene-specific primers based on sequences of the 5-HT2C receptor, gave the expected fragment size of 452 bp. No such products were obtained in the absence of reverse-transcribed mRNA, indicating that the RNA preparation was free of genomic DNA contamination. Real-time PCR was also used to quantify transcript levels of the individual 5-HT receptors in cultured GT1–7 neurons. Based on the number of copies present in the cDNA relative to the standard curve, cultured GT1–7 neurons expressed 3.1 ± 0.4 x 105 (n = 3) copies of 5-HT2C receptor/µg DNA. The expression of 5-HT2C receptor genes in cultured GT1–7 neurons and the effects of their activation on neuronal firing are shown in Fig. 3AGo. DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, which matched the published sequence of the 5-HT2C receptor (data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Expression of 5-HT2C Receptor Transcripts and Ligand-Induced Changes in Electrical Activity, Second Messengers, and Pulsatile Neurosecretion in Native and Immortalized GnRH Neurons

A, Expression of 5-HT2C receptors in cultured GT1–7 neurons as demonstrated with gene-specific primers. DNA sequencing of the purified band confirmed the authenticity of the amplified fragment and matched the published sequence of the 5-HT2C receptor. B, Spontaneous firing of APs in identified cultured E-18 hypothalamic GnRH neurons. Recordings were obtained from single isolated GnRH neurons to eliminate the influences of electrical and synaptic coupling between cells. C, Increased frequency of AP firing in native GnRH neurons treated with {alpha}-methyl-5-HT. D, Reduction of spontaneous AP firing during washout of the 5-HT2C receptor agonist. All traces were obtained from identified hypothalamic GnRH neurons. E, Dose-dependent stimulation of IP2+3 production during treatment with a 5-HT2C receptor agonist (open circles). Prevention of the stimulatory action of the 5-HT2C receptor agonist on InsP2+3 production in the presence of the selective agonist (solid circles). Data are the means from three independent experiments. F, Prominent increase in GnRH peak amplitude during treatment with a 5-HT2C receptor agonist (solid circles), and resumption of basal pulsatile GnRH release during the washout period. (M), Molar concentration; RT, reverse transcription.

 
Whole-cell recordings from native GnRH neurons consistently exhibited spontaneous AP firing, and most of the cells (70%) showed irregular spiking activity (Fig. 3BGo). Treatment with 10 µM {alpha}-methyl-5-hydroxytryptamine ({alpha}-methyl 5-HT), a selective agonist for the Gq-coupled 5-HT2 receptor, significantly increased the frequency of AP firing, from basal (0.22 ± 0.05 Hz to 1.14 ± 0.9 Hz; P < 0.01; n = 10) (Fig. 3CGo). During washout of the agonist, spontaneous AP firing returned to the control level after 3 min (Fig. 3D).

Treatment of GT1–7 neurons with {alpha}-methyl 5-HT stimulated InsP2+3 productions in a dose-dependent manner, with EC50 of 1.3 µM and a maximal response at micromolar agonist concentrations (Fig. 3EGo). Treatment with 10 µM {alpha}-methyl 5-HT significantly increased GnRH peak amplitude after an initial delay (21.3 ± 2.2 pg/ml control vs. 32.3 ± 3.5 pg/ml treated; n = 3; P < 0.05; Fig. 3FGo). This response is consistent with earlier observations that activation of the PLC/InsP3/Ca2+ signaling pathway increases GnRH pulse amplitude and reduces pulse frequency (21, 22).

Expression of Gs-Coupled 5-HT4 Receptors and Their Effects on Electrical Activity, Second Messengers, and Secretory Responses in GnRH Neuronal Cells
Analysis of total RNA from cultured GT1–7 neurons, using gene-specific primers based on sequences of the Gs-coupled 5-HT4 receptor, gave the expected size fragment of 398 bp (Fig. 4AGo). No such products were obtained in the absence of reverse transcribed mRNA. Real-time quantitative RT-PCR detected 5.3 ± 0.8 x 104 (n = 3) copies of 5-HT4 receptor/µg DNA. DNA sequencing of the purified band confirmed the authenticity of the amplified fragment, because the nucleotide sequence matched the known sequence of the 5-HT4 receptor (data not shown). 5-HT7 receptors were also expressed in GT1–7 neurons at low levels (2.1 x 103 copies/mg DNA).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4. Expression of 5-HT4 Receptor Transcripts and Ligand-Induced Changes in Electrical Activity, Second Messengers, and Pulsatile Neurosecretion in Native and Immortalized GnRH Neurons

A, Expression of 5-HT4 receptors in cultured GT1–7 neurons was demonstrated using gene-specific primers and was confirmed by DNA sequencing of the purified band. B, Spontaneous firing of APs in identified cultured E-18 hypothalamic GnRH neurons. C, Increased frequency of AP firing in native GnRH neurons treated with the 5-HT4 receptor agonist, SC 53116. D, Reduction of spontaneous AP firing during washout of the 5-HT4 receptor agonist. All traces were obtained from identified hypothalamic GnRH neurons. E, Dose-dependent stimulation of cAMP production during treatment with SC 53116. Data are the means from four independent experiments. F, Prolonged and prominent increase in GnRH secretion during treatment with SC 53116 (solid circles), and resumption of basal pulsatile GnRH release during the washout period. (M), Molar concentration; SC 53116, (1s,8s)-n-[(hexahydro-1H-pyrrolizin-1-yl)methyl)]-4-amino-5-chloro-2-methoxy-benzamide.

 
In native GnRH neurons, the basal rate of AP firing (Fig. 4BGo) was significantly increased during treatment with 10 µM SC 531116, a selective agonist for the Gs-coupled 5-HT4 receptor, from basal (0.5 ± 0.05 Hz to 1.1 ± 0.2 Hz; P < 0.01; n = 12) (Fig. 4CGo). Spontaneous AP firing decreased during washout of the agonist and returned to the control level after 3 min (Fig. 4DGo). Treatment of GT1–7 neurons with SC 531116 caused dose-dependent stimulation of cAMP production, which was maximal at 100 nM SC 53116 and showed no further increase at micromolar concentrations (Fig. 4EGo). Activation of the 5-HT4 receptor with SC 53116 also caused a sustained and robust increase in GnRH release, which increased from 23.2 ± 3.6 pg/ml in controls to 58.4 ± 6.4 pg/ml in treated cells (P < 0.01; n = 3) and returned to the basal level during the washout period (Fig. 4FGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The complexity of GnRH-induced intracellular signaling and its regulation of gene expression, ion channels, enzyme activity, and hormone secretion in native and immortalized GnRH neurons reflects the existence of diverse signaling pathways activated by the single GnRH receptor. In contrast, multipathway signaling induced by other G protein-coupled receptor (GPCR) agonists is often attributable to their effects on diverse receptor subtypes. Recent research has identified additional mechanisms that can increase the diversity of signaling pathways emanating from a single GPCR. These include the existence of multiple endogenous ligands with differential affinities for a particular receptor subtype that activate different responses and the ability of individual receptors to couple to multiple G protein isoforms.

In addition to the GnRH receptor expressed in GnRH neurons (28), and in other tissues and expression systems (29, 30, 31, 32), neurokinin receptor subtypes (NK1 and NK2) exemplify the ability of certain GPCRs to couple to more than one G protein. Similar to the GnRH receptor, agonist activation of both NK receptors elicits a biphasic response with sequential increases in intracellular calcium and cAMP levels (33, 34). However, the cAMP response can be eliminated by point mutations in the extracellular amino-terminal domain of the receptor (35), suggesting that different receptor conformations could result in distinct activation states that have differential ligand affinities, associated with differential coupling to individual G proteins (36). Similarly, mutation of specific residues in the first intracellular loop of the GnRH receptor that are not essential for activation of the phosphoinositide signaling pathway uncouples the receptor from AC signaling (37).

GnRH receptors expressed in native and immortalized GnRH neurons activate diverse signaling pathways by coupling to at least three G proteins. Such coupling is time and dose dependent, and switches between Gq, Gs, and Gi/o according to the agonist concentration (28). These findings suggest that an agonist concentration-dependent switch in coupling of the GnRH receptor between specific G proteins modulates neuronal Ca2+ signaling via Gs-cAMP-stimulatory and Gi-cAMP-inhibitory mechanisms. Activation of Gi could also inhibit GnRH neuronal function and episodic secretion by regulating membrane ion currents, probably through activation of G protein-regulated inwardly rectifying potassium channels (38, 39).

In contrast to the single GnRH receptor, RT-PCR analysis of RNA isolated from cultured GT1–7 neurons revealed the expression of mRNAs encoding three specific 5-HT receptors, including the Gi-coupled 5-HT1A, Gq-coupled 5-HT2C, and Gs-coupled 5-HT4 and 5-HT-7 receptors. Treatment of native hypothalamic neurons with 5-HT, the endogenous nonselective 5-HT receptor agonist, caused both stimulation and inhibition of AP firing consistent with time- and dose-dependent activation of multiple 5-HT receptor subtypes. Treatment of GT1–7 neurons with 5-HT likewise activates the InsP3/Ca2+ signaling pathway and exerts dose- and time-dependent stimulatory and inhibitory actions on cAMP production and GnRH release in GT1–7 cells. Such changes in InsP3/Ca2+ signaling, cAMP production, and GnRH release were similar to those elicited by activation of the neuronal GnRH receptor (21, 22, 28). These findings indicate that the actions of 5-HT are mediated by activation of multiple signaling pathways, which can account for its previously observed diverse actions on GnRH release (12, 24, 26). Earlier reports on the actions of 5-HT on gonadotropin release indicate that it also has a dual effect on this response that is dependent on estradiol concentration (40), the receptor subtype (41, 42), and interactions with the opiate and adrenergic systems (43).

In addition to its role in the regulation of GnRH release from hypothalamic neurons, 5-HT is an important factor in the early development of the GnRH neuronal system. In Tg8 mice lacking the gene encoding monoamine oxidase A, the number of GnRH neurons in the forebrain was significantly reduced. This suggests that an excess of 5-HT inhibits the proliferation of GnRH neuronal precursor cells and stimulates GnRH neuronal migration to their final location in the septo-preoptic region (44, 45).

A large family of 5-HT1 receptors is negatively coupled to AC via Gi proteins. In addition to inhibiting AC, 5-HT1A receptors are directly coupled to voltage-sensitive K+ channels via a Gi-coupled protein and therefore are not solely dependent on second messenger signaling (46, 47, 48). RT-PCR analysis of total RNA isolated from cultured GT1–7 neurons also revealed the expression of 5-HT1A Gi-coupled receptors. Quantitative real-time RT-PCR analysis showed that the expression level of 5-HT1A receptors was similar to that of 5-HT2C receptors. Treatment of identified hypothalamic GnRH neurons with a 5-HT1A receptor agonist (PAPP) caused pronounced inhibition of spontaneous AP firing. This effect was reversible, and spontaneous firing of APs recovered during washout of the 5-HT1A agonist. The inhibitory action of 5-HT1A receptor activation on spontaneous AP firing in hypothalamic GnRH neurons could be related to the release of ß{gamma}-subunits from Gi (or Go), with consequent actions on plasma membrane ion channels (49). Such effects could include both inhibition of voltage-dependent calcium channels (50) and activation of inwardly rectifying potassium channels (51, 52).

Treatment of GT1–7 neurons with the selective 5-HT1A receptor agonist, 2-MPP, activated the Gi-mediated AC/cAMP-inhibitory signaling pathway. This response was prevented by PTX, consistent with coupling to an inhibitory Gi protein. The resulting decrease in cAMP production was associated with marked inhibition of pulsatile GnRH release. In cultured hypothalamic cells and GT1–7 neurons, such inhibition of pulsatile GnRH release was also observed during activation of Gi-coupled LH receptors (18), M2 muscarinic receptors (53), GnRH receptors (28), and estrogen receptors (20). It is evident from our data, and studies by others, that the convergence of signaling from Gi/o-coupled receptors expressed in native and GT1–7 neurons to the AC/cAMP-inhibitory signaling pathway decreases membrane excitability, reduces the rate of AP firing, and inhibits pulsatile GnRH release. In addition to this process, studies on the role of 5-HT-liberated {gamma}-subunits in synaptic transmission have revealed another inhibitory action of Gß{gamma} on neurosecretion that is distal to Ca2+ entry and cAMP signaling, and acts directly on the exocytotic fusion machinery (54). This mechanism involves binding of ß{gamma}-subunits to the C terminus of SNAP25 and interference with the Ca2+-induced soluble N-ethylmaleimide-sensitive factor attachment protein receptor machinery for vesicle fusion and secretory granule exocytosis (55, 56).

The Gq-coupled 5-HT2C receptors expressed in GT1–7 neurons were identified by quantitative RT-PCR as the most abundant of the 5-HT receptors in these cells. In electrophysiological studies, activation of 5-HT2 receptors in identified embryonic d 18 (E-18) hypothalamic GnRH neurons with the specific receptor agonist, {alpha}-methyl 5-HT, significantly increased the frequency of AP firing. This was associated with membrane depolarization, consistent with data obtained during analysis of 5-HT2C receptor function in other tissues and expression systems (57). The functional correlates of PLC activation by 5-HT2 receptors are multiple. An increase in intracellular calcium concentration that induces a rapid Cl current through a Ca2+-dependent chloride channel has been characterized for the three members of the 5-HT2 receptor family and appears to be mediated through the PLC/InsP3 pathway (58, 59, 60). 5-HT2A receptor activation also induces the closing of a K+ channel, leading to depolarization of the cell. In Xenopus oocytes coexpressing 5-HT2C receptors and a brain-derived K+ channel, the suppression of K+ conductance by 5-HT involves a calcium/calmodulin-activated phosphatase, which has been postulated to dephosphorylate the K+ channel, leading to its closing. Recovery from such suppression may be due to the action of a protein kinase, because it was prevented by the kinase inhibitor H-7 (61).

Members of the 5-HT2 receptor family are primarily coupled to PLC, and selective activation of these receptors in GT1–7 neurons increased InsP2+3 production in a dose-dependent manner. This response was pertussis toxin insensitive and was blocked by ketanserine, indicating the involvement of a Gq-type protein. GnRH release was also affected by selective activation of 5-HT2C receptors, which increased both the peak amplitude and the interpulse interval. Similar increases in GnRH pulse amplitude were observed during activation of M1 muscarinic receptors and activation of GnRH receptors expressed in GT1–7 neurons (28, 53). Thus, increased membrane excitability and the convergence of signaling from Gq-coupled receptors expressed in GT1–7 cells to common effectors could regulate PLC/InsP3/Ca2+ signaling and increase GnRH peak amplitude.

Stimulation of adenylate cyclase was the first signal transduction pathway to be linked to 5-HT receptors (62). Analysis of the expression of 5-HT4 receptors in cultured GT1–7 neurons by real-time RT-PCR showed their level of expression to be less than that of 5-HT2C receptors. Examination of the electrophysiological properties of Gs-coupled 5-HT4 receptors in E-18 hypothalamic GnRH neurons revealed that their spontaneous electrical activity increased during selective agonist treatment with (1s,8s)-n-[(hexahydro-1H-pyrrolizin-1-yl)methyl)]-4-amino-5-chloro-2-methoxy-benzamide. This increase in AP firing was associated with increased bursting activity and the appearance of lower-amplitude broad APs. This effect has been attributed to cAMP, based on the ability of 8-bromo cAMP and forskolin, a direct activator of adenylate cyclase, to mimic the actions of 5-HT (63). Depression of K+ current may lead to depolarization, calcium influx, and subsequent enhancement of GnRH release (8).

Selective activation of 5-HT4 receptors in GT1–7 neurons increased cAMP production in a dose-dependent manner and caused a robust and sustained increase in GnRH secretion during perifusion studies. Similar increases in GnRH release were observed during activation of ß1-adrenergic receptors (64) and application of 8-bromo cAMP and forskolin (18, 65). Our observations, and those of others, indicate that cAMP signaling from Gs-coupled receptors expressed in GT1–7 cells increases membrane excitability and causes prominent and sustained increases in GnRH secretion (8, 66).

In summary, the marked inhibitory effect of Gi-coupled 5-HT1A receptors on spontaneous AP firing, cAMP production, and inhibition of pulsatile GnRH secretion suggests their involvement in negative regulation during pulsatile GnRH release. Activation of 5-HT2 Gq-coupled receptors triggers the PLC/InsP3/Ca2+ signaling pathway and promotes spike-like increases in GnRH release. Selective targeting of 5-HT4 receptors activates the Gs-AC-cAMP signaling pathway, increases cAMP production and AP firing frequency, and stimulates basal GnRH release. In addition to the GnRH receptor, native and immortalized GnRH neurons express several 5-HT and other G protein-coupled receptors. These observations indicate that the convergence of signaling from specific GPCRs to common effector systems provides a powerful mechanism for the control of pulsatile GnRH release.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tissue and Cell Culture
Hypothalamic tissue was removed from fetuses of 17-d pregnant Sprague Dawley rats (Charles River Laboratories, Wilmington, MA). The borders of the excised hypothalami were delineated by the anterior margin of the optic chiasm, the posterior margin of the mammillary bodies, and laterally by the hypothalamic sulci. After dissection, hypothalami were placed in ice-cold dissociation buffer containing 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 25 mM HEPES, and 100 mg/liter gentamicin, pH 7.4. The tissues were washed and then incubated in a sterile flask with dissociation buffer supplemented with 0.2% collagenase, 0.4% BSA, 0.2% glucose, and 0.05% DNase I. After 60 min incubation in a 37 C water bath with shaking at 60 cycles/min, the tissue was gently triturated by repeated aspiration into a smooth-tipped Pasteur pipette. Incubation was continued for another 30 min, after which the tissue was again dispersed. The cell suspension was passed through sterile mesh (200 µm) into a 50-ml tube, sedimented by centrifugation for 10 min at 200 x g, and washed once in dissociation buffer and once in culture medium consisting of 500 ml DMEM containing 0.584 g/liter L-glutamate and 4.5 g/liter glucose, mixed with 500 ml F-12 medium containing 0.146 g/liter L-glutamine, 1.8 g/liter glucose, 100 µg/ml gentamicin, 2.5 g/liter sodium bicarbonate, and 10% heat-inactivated fetal calf serum. Each dispersed hypothalamus yielded about 1.5 x 106 cells. Immortalized GnRH neurons (GT1–7 cells) were provided by Dr. Richard Weiner (University of California at San Francisco) and were cultured under the same conditions as primary hypothalamic cells.

Cell Perifusion Procedure and Hormone Measurement
Bead-attached GT1–7 cells were perifused at a flow rate of 0.15 ml/min at 37 C, and fractions collected at 5-min intervals were stored at –20 C before RIA of their GnRH content. GnRH was measured using 125I-labeled GnRH (Amersham Biosciences Corp., Piscataway, NJ), GnRH standards (Peninsula Laboratories, Belmont, CA), and primary antibody donated by Dr. V. D. Ramirez (University of Illinois, Urbana, IL). The intra- and interassay coefficients of variation at 50% binding in standard samples (15 pg/ml) were 5% and 7%, respectively. The sensitivity of the assay, defined as twice the SD at zero dose, was 0.2 pg/tube (n = 6). In previous studies, pulsatile GnRH secretion and its regulation have been found to be identical in GT1–7 cells and cultured hypothalamic neurons.

cAMP Production
For studies on cAMP release, GnRH-producing cells were stimulated in serum-free medium (1:1 DMEM/F-12) containing 0.1% BSA, 30 mg/liter bacitracin, and 1 mM 3-isobutyl-1-methylxanthine. RIA of cAMP was performed as previously described, using a specific cAMP antiserum at a titer of 1:5000 (67). The intraassay coefficient of variation of the assay was 4% at 50% displacement.

Inositol Phosphate Production
Cells were labeled for 24 h in inositol-free medium containing 20 mCi/ml [3H]inositol as described previously (68), and then washed with inositol-free M199 medium and stimulated at 37 C in the presence of 10 mM LiCl. Inositol phosphates were fractionated by anion exchange chromatography, and the InsP2+3 fractions eluted with 1 M ammonium formate in 0.1 M formic acid (3 ml/wash) were analyzed by liquid scintillation b-spectrometry.

Whole-Cell Recording of GnRH Neurons
For whole-cell recording, hypothalamic cells were cultured on collagen-coated cover slips and continuously perifused with artificial extracellular solution at a rate of 0.6 ml/min. The extracellular solution contained (in mM): 140 NaCl, 5 KCl, 10 HEPES, 10 D-glucose, 2 CaCl2, 1 MgCl2. pH was adjusted to 7.4 with NaOH. The cells were viewed under an inverted Olympus IX70 microscope with a x40, long working distance objective (Olympus Corp., Lake Success, NY). All recordings were done at room temperature (23–25 C). Patch pipettes (3–5 M{Omega}) were pulled from thick-wall borosilicate capillary glass (1.5-mm outer diameter and 0.86-mm inner diameter, WPI, Inc., Sarasota, FL) on a Flaming/Brown puller model P-87 (Sutter Instruments Co., Novato, CA). The pipette solution was prepared containing (in millimolar concentration): 70 KCl, 70 potassium gluconate, 0.1 CaCl2, 2 MgCl2, 10 HEPES, 2 ATP potassium salt (K2ATP), 0.1 Na2GTP, 5 EGTA, with pH adjusted to 7.2 with KOH. An Ag/AgCl pellet was used as the reference electrode. Spontaneous activities were recorded under I-clamp mode with a Multi-Clamp700A amplifier (Axon Instruments, Foster City, CA), filtered at 2 kHz, and digitized at 10 kHz through Digidata 1320A (Axon Instruments). Acquisition and subsequent analysis of the experimental data were performed using Clampex 9.0 software (Axon Instruments). Traces and voltage-current curves were plotted using "Origin 7" computer software (MicroCal Software, Northampton, MA). After recordings, the cytoplasmic contents of the recorded neuron were harvested under visual control, and single-cell RT-PCR was used to identify the presence of GnRH transcripts as previously reported (27, 69). Hypothalamic cells that did not show typical GnRH neuronal morphology were used as controls. Firing of APs in identified cultured E-18 hypothalamic GnRH neurons was obtained from single isolated GnRH neurons to eliminate the influence of electrical and synaptic coupling between cells.

RT-PCR Analysis of 5-HT Receptor Subtype
Total RNA was extracted from GT1–7 cells using Absolutely RNA RT-PCR Miniprep Kits (Stratagene, La Jolla, CA). RNA was digested with DNase in a low-salt buffer to remove any remaining DNA. Reverse transcription was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). Briefly, using 5 µg of total RNA as a template, first-strand cDNA was made using 500 ng of oligo(dT)12–18 and 1 ml of 10 mM deoxynucleotide triphosphate Mix (Invitrogen) in a 13-µl reaction volume. After heat denaturing at 65 C for 5 min, and addition of 4 µl of 5x First Strand Buffer, 1 µl of 0.1 M dithiothreitol, 1 µl of RNase OUT recombinant RNase inhibitor (Invitrogen), and 200 U of SuperScript III Reverse Transcriptase, reverse transcription was performed at 55 C for 50 min. RNA complementary to the cDNA was removed by addition of 1 µl of E. coli RNase H and incubation at 37 C for 20 min. An 0.5-µl aliquot of cDNA was used as template. Primers used were 5'-G[nucleotide (nt) 442] CATTTCTTTTTCCCTCCCTTCC (nt 464)-3' (sense) and 5'-T(nt 809) GACCCAGAGTCCACTTGTTGAG (nt 787)-3' (antisense) for 5-HT1A receptor; 5'-T(nt 2345) CTCCCTTCCTTCCGTATTCCC (nt 2366)-3' (sense) and 5'-T(nt 2796) GGCATCCTTCCACTTCTGTAGTC (nt 2773)-3' (antisense) for 5-HT2C receptor; 5'-T(nt 25) GAGTTCCAACGAGGGTTTCAG (nt 46)-3' (sense) and 5'-T (nt 422) AATGCGATGCGTAGAGGGG (nt 403)-3' (antisense) for 5-HT4 receptor; and 5'-G(nt 1137) CTGCCGTTTTTCCTCTTGTC (nt 1157)-3' (sense) and 5'-C(nt 1513) AATGGTTTCGTTGTTTCCCC (nt 1494)-3' (antisense) for 5-HT7 receptor; and 5'-A(nt 152) ACGACCCCTTCATTGAC (nt 1169)-3' (sense) and 5'-T(nt 342) CCACGACATACTCAGCAC (nt 324)-3' (antisense) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The expected sizes of 5HT1, 5-HT2C, 5-HT4, 5HT7, and GAPDH were 321, 347, 315, 431, and 191 bp, respectively. PCR conditions were: denaturing at 94 C for 2 min, followed by 30 cycles of denaturing at 94 C for 30 sec, annealing at 55 C for 30 sec, and extension at 72 C for 60 sec. PCR products were analyzed by electrophoresis using 2% agarose gels.

Real-Time RT-PCR Analysis of 5-HT Receptor Expression
mRNA of 5HT receptors were quantified by real-time RT-PCR performed in a Light Cycler (Roche, Branchburg, NJ) using SYBR Green I as a double-strand DNA-specific binding dye according to the manufacturer’s instructions, continuously monitoring the cycle-by-cycle accumulation of each fluorescently labeled PCR product. Amplifications were carried out using 1 U Platinum Taq DNA polymerase (Invitrogen), 0.5 µM of each primer, 3 mM MgCl2, 10xPlatinum Taq DNA polymerase buffer (200 µmol/liter Tris-HCL, pH 8.4; 500 µmol/liter KCl), 200 µM deoxynucleotide triphosphate, 1 mg/ml BSA, 1 µl 1:2000 dilution of SYBR Green I nucleic acid gel stain (BioWhittaker Molecular Applications, Rockland, ME), and 2 µl 1:5 dilution of cDNA in a total volume of 20 µl. The real-time PCR conditions were preheat denaturation at 95 C for 5 min, annealing at 59 C for 10 sec, and extension at 72 C for 12 sec; cycle number 45. SYBR Green I fluorescence was detected at 72 C at the end of each cycle to monitor the amount of PCR product formed. A melting curve analysis of the amplification products was performed at the end of the PCR run by rapidly increasing the temperature to 95 C, followed by immediate cooling to 65 C for 15 sec, after which the temperature was gradually increased to 95 C at a rate of 0.1 C per second with continuous measurement of fluorescence to confirm amplification of specific transcripts. The melting temperature profile for 5-HT1A, 5-HT2C, 5-HT4, 5-HT7 receptors and GAPDH demonstrated single peaks at 85.5 C, 86 C, 90 C, 86 C, and 89 C, respectively.

External cDNA standards for 5-HT receptors and GAPDH were produced by inserting PCR products, which were generated using the same primers used for RT-PCR and GT1–7 cell cDNA as a template, into the pCR2.1 vector using the TOPO TA Cloning Kit (Invitrogen). Vector constructs were used to transform DH5{alpha}, and plasmid DNA was prepared by Wizard plus Minipreps DNA purification System (Promega Corp., Madison WI). The inserts of control vectors for 5-HT receptors were verified by sequencing. The concentration of standard was determined by measuring the OD260, and the copy number was calculated.

Materials
Oligonucleotides were obtained from Gene Probe Technologies (Gaithersburg MD). Absolutely RNA RT-PCR Miniprep Kit was purchased from Stratagene (La Jolla, CA). SuperScript III RNase H radical extender. Reverse Transcriptase, Platinum Taq DNA polymerase, pCR2.1 vector, and TOPO TA cloning kit were purchased from Invitrogen. Wizard plus Minipreps DNA purification system was purchased from Promega Corp.

5-HT, the nonselective endogenous 5-HT receptor agonist, was purchased from Sigma-Aldrich (St. Louis, MO). Selective 5-HT1 receptor agonist analogs, 2-MPP and PAPP, were purchased from Sigma-Aldrich. Selective 5-HT2 receptor agonist analog {alpha}-methyl-5-HT maleate ({alpha}-methylserotonin maleate), and ketanserin tartrate-selective 5-HT2 antagonist were purchased from Sigma-Aldrich. The (1s,8s)-n-[(hexahydro-1H-pyrrolizin-1-yl)methyl)]-4-amino-5-chloro-2-methoxy-benzamide-selective 5-HT4 agonist was a gift from Searle Pharmaceuticals (High Wycombe, UK).

Data Analysis
GnRH pulses were identified and their parameters determined by computerized cluster analysis (70). Individual point SDs were calculated using a power function variance model from the experimental duplicates. A 2 x 2 cluster configuration and a t statistic of 2 for the upstroke and downstroke were used to maintain false-positive and false-negative error rates below 10%. The pulse parameters were analyzed by ANOVA and results expressed as mean ± SEM. Statistical comparisons were performed using the Kruskal-Wallis test followed by the Mann-Whitney U test.


    FOOTNOTES
 
This work was supported by the Intramural Research Program of the National Institutes of Health, National Institute of Child Health and Human Development.

First Published Online August 18, 2005

1 At the time of this study, N.M. was on leave from the Department of Pharmacology, Catholic University of the Sacred Heart, 00168 Rome, Italy. Back

Abbreviations: AC, Adenylyl cyclase; AP, action potential; E-18, embryonic d 18; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPCR, G protein-coupled receptor; 5-HT, serotonin; InsP2+3, inositol biphosphate + inositol triphosphate; InsP3, inositol 1,4,5-triphosphate; {alpha}-methyl 5-HT, {alpha}-methyl-5-hydroxytryptamine; 2-MPP, 1-(2-methoxyphenyl)piperazine; NK, neurokinin; nt, nucleotide; PAPP, 4-[2-[4-[3-(trifluoromethyl)phenyl]-1-piperazinyl]ethyl]benzeneamine p-aminophenethyl-m-trifluoromethylphenyl piperazine; PLC, phospholipase C; PTX, pertussis toxin.

Received for publication March 3, 2005. Accepted for publication August 8, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Van Goor F, Krsmanovic LZ, Catt KJ, Stojilkovic SS 1999 Control of action potential-driven calcium influx in GT1 neurons by the activation status of sodium and calcium channels. Mol Endocrinol 13:587–603[Abstract/Free Full Text]
  2. Van Goor F, Krsmanovic LZ, Catt KJ, Stojilkovic SS 1999 Coordinate regulation of gonadotropin-releasing hormone neuronal firing patterns by cytosolic calcium and store depletion. Proc Natl Acad Sci USA 96:4101–4106[Abstract/Free Full Text]
  3. Kusano K, Fueshko S, Gainer H, Wray S 1995 Electrical and synaptic properties of embryonic luteinizing hormone-releasing hormone neurons in explant cultures. Proc Natl Acad Sci USA 92:3918–3922[Abstract/Free Full Text]
  4. Spergel DJ, Kruth U, Hanley DF, Sprengel R, Seeburg PH 1999 GABA- and glutamate-activated channels in green fluorescent protein-tagged gonadotropin-releasing hormone neurons in transgenic mice. J Neurosci 19:2037–2050[Abstract/Free Full Text]
  5. Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT, Dudek FE, Moenter SM 2000 Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology. Endocrinology 141:412–419[Abstract/Free Full Text]
  6. Kuehl-Kovarik MC, Pouliot WA, Halterman GL, Handa RJ, Dudek FE, Partin KM 2002 Episodic bursting activity and response to excitatory amino acids in acutely dissociated gonadotropin-releasing hormone neurons genetically targeted with green fluorescent protein. J Neurosci 22:2313–2322[Abstract/Free Full Text]
  7. Sakakibara H, Conti M, Weiner RI 1998 Role of phosphodiesterases in the regulation of gonadotropin-releasing hormone secretion in GT1 cells. Neuroendocrinology 68:365–373[CrossRef][Medline]
  8. Vitalis EA, Costantin JL, Tsai PS, Sakakibara H, Paruthiyil S, Iiri T, Martini JF, Taga M, Choi AL, Charles AC, Weiner RI 2000 Role of the cAMP signaling pathway in the regulation of gonadotropin-releasing hormone secretion in GT1 cells. Proc Natl Acad Sci USA 97:1861–1866[Abstract/Free Full Text]
  9. El Majdoubi M, Weiner RI 2002 Localization of olfactory cyclic nucleotide-gated channels in rat gonadotropin-releasing hormone neurons. Endocrinology 143:2441–2444[Abstract/Free Full Text]
  10. Paruthiyil S, eL Majdoubi M, Conti M, Weiner RI 2002 Phosphodiesterase expression targeted to gonadotropin-releasing hormone neurons inhibits luteinizing hormone pulses in transgenic rats. Proc Natl Acad Sci USA 99:17191–17196[Abstract/Free Full Text]
  11. Zheng L, Stojilkovic SS, Hunyady L, Krsmanovic LZ, Catt KJ 1994 Sequential activation of phospholipase-C and -D in agonist-stimulated gonadotrophs. Endocrinology 134:1446–1454[Abstract/Free Full Text]
  12. Moguilevsky JA, Wuttke W 2001 Changes in the control of gonadotrophin secretion by neurotransmitters during sexual development in rats. Exp Clin Endocrinol Diabetes 109:188–195[CrossRef][Medline]
  13. Becu-Villalobos D, Libertun C 1995 Development of gonadotropin-releasing hormone (GnRH) neuron regulation in the female rat. Cell Mol Neurobiol 15:165–176[CrossRef][Medline]
  14. Barraclough CA 1992 Neural control of the synthesis and release of luteinizing hormone-releasing hormone. Ciba Found Symp 168:233–246[Medline]
  15. Woller MJ, McDonald JK, Reboussin DM, Terasawa E 1992 Neuropeptide Y is a neuromodulator of pulsatile luteinizing hormone-releasing hormone release in the gonadectomized rhesus monkey. Endocrinology 130:2333–2342[Abstract/Free Full Text]
  16. Williams CL, Nishihara M, Thalabard JC, Grosser PM, Hotchkiss J, Knobil E 1990 Corticotropin-releasing factor and gonadotropin-releasing hormone pulse generator activity in the rhesus monkey. Electrophysiological studies. Neuroendocrinology 52:133–137[Medline]
  17. Milenkovic L, D’Angelo G, Kelly PA, Weiner RI 1994 Inhibition of gonadotropin hormone-releasing hormone release by prolactin from GT1 neuronal cell lines through prolactin receptors. Proc Natl Acad Sci USA 91:1244–1247[Abstract/Free Full Text]
  18. Mores N, Krsmanovic LZ, Catt KJ 1996 Activation of LH receptors expressed in GnRH neurons stimulates cyclic AMP production and inhibits pulsatile neuropeptide release. Endocrinology 137:5731–5734[Abstract]
  19. Lindzey J, Wetsel WC, Couse JF, Stoker T, Cooper R, Korach KS 1998 Effects of castration and chronic steroid treatments on hypothalamic gonadotropin-releasing hormone content and pituitary gonadotropins in male wild-type and estrogen receptor-{alpha} knockout mice. Endocrinology 139:4092–4101[Abstract/Free Full Text]
  20. Navarro CE, Abdul Saeed S, Murdock C, Martinez-Fuentes AJ, Arora KK, Krsmanovic LZ, Catt KJ 2003 Regulation of cyclic adenosine 3',5'-monophosphate signaling and pulsatile neurosecretion by Gi-coupled plasma membrane estrogen receptors in immortalized gonadotropin-releasing hormone neurons. Mol Endocrinol 17:1792–1804[CrossRef][Medline]
  21. Krsmanovic LZ, Martinez-Fuentes AJ, Arora KK, Mores N, Navarro CE, Chen HC, Stojilkovic SS, Catt KJ 1999 Autocrine regulation of gonadotropin-releasing hormone secretion in cultured hypothalamic neurons. Endocrinology 140:1423–1431[Abstract/Free Full Text]
  22. Krsmanovic LZ, Stojilkovic SS, Mertz LM, Tomic M, Catt KJ 1993 Expression of gonadotropin-releasing hormone receptors and autocrine regulation of neuropeptide release in immortalized hypothalamic neurons. Proc Natl Acad Sci USA 90:3908–3912[Abstract/Free Full Text]
  23. Kiss J, Halasz B 1985 Demonstration of serotoninergic axons terminating on luteinizing hormone-releasing hormone neurons in the preoptic area of the rat using a combination of immunocytochemistry and high resolution autoradiography. Neuroscience 14:69–78[CrossRef][Medline]
  24. Li S, Pelletier G 1995 Involvement of serotonin in the regulation of GnRH gene expression in the male rat brain. Neuropeptides 29:21–25[CrossRef][Medline]
  25. Hery M, Becquet D, Francois-Bellan AM, Deprez P, Fache MP, Hery F 1995 Stimulatory effects of 5HT1A receptor agonists on luteinizing hormone-releasing hormone release from cultured fetal rat hypothalamic cells: interactions with progesterone. Neuroendocrinology 61:11–18[Medline]
  26. Hery M, Francois-Bellan AM, Hery F, Deprez P, Becquet D 1997 Serotonin directly stimulates luteinizing hormone-releasing hormone release from GT1 cells via 5-HT7 receptors. Endocrine 7:261–265[Medline]
  27. Martinez-Fuentes AJ, Hu L, Krsmanovic LZ, Catt KJ 2004 Gonadotropin-releasing hormone (GnRH) receptor expression and membrane signaling in early embryonic GnRH neurons: role in pulsatile neurosecretion. Mol Endocrinol 18:1808–1817[Abstract/Free Full Text]
  28. Krsmanovic LZ, Mores N, Navarro CE, Arora KK, Catt KJ 2003 An agonist-induced switch in G protein coupling of the gonadotropin-releasing hormone receptor regulates pulsatile neuropeptide secretion. Proc Natl Acad Sci USA 100:2969–2974[Abstract/Free Full Text]
  29. Stanislaus D, Ponder S, Ji TH, Conn PM 1998 Gonadotropin-releasing hormone receptor couples to multiple G proteins in rat gonadotrophs and in GGH3 cells: evidence from palmitoylation and overexpression of G proteins. Biol Reprod 59:579–586[Abstract/Free Full Text]
  30. Grosse R, Schmid A, Schoneberg T, Herrlich A, Muhn P, Schultz G, Gudermann T 2000 Gonadotropin-releasing hormone receptor initiates multiple signaling pathways by exclusively coupling to Gq/11 proteins. J Biol Chem 275:9193–9200[Abstract/Free Full Text]
  31. McArdle CA, Franklin J, Green L, Hislop JN 2002 The gonadotrophin-releasing hormone receptor: signalling, cycling and desensitisation. Arch Physiol Biochem 110:113–122[Medline]
  32. Finch AR, Green L, Hislop JN, Kelly E, McArdle CA 2004 Signaling and antiproliferative effects of type I and II gonadotropin-releasing hormone receptors in breast cancer cells. J Clin Endocrinol Metab 89:1823–1832[Abstract/Free Full Text]
  33. Hermans E 2003 Biochemical and pharmacological control of the multiplicity of coupling at G-protein-coupled receptors. Pharmacol Ther 99:25–44[CrossRef][Medline]
  34. Holst B, Hastrup H, Raffetseder U, Martini L, Schwartz TW 2001 Two active molecular phenotypes of the tachykinin NK1 receptor revealed by G-protein fusions and mutagenesis. J Biol Chem 276:19793–19799[Abstract/Free Full Text]
  35. Lecat S, Bucher B, Mely Y, Galzi JL 2002 Mutations in the extracellular amino-terminal domain of the NK2 neurokinin receptor abolish cAMP signaling but preserve intracellular calcium responses. J Biol Chem 277:42034–42048[Abstract/Free Full Text]
  36. Kenakin T 2003 Ligand-selective receptor conformations revisited: the promise and the problem. Trends Pharmacol Sci 24:346–354[CrossRef][Medline]
  37. Arora KK, Krsmanovic LZ, Mores N, O’Farrell H, Catt KJ 1998 Mediation of cyclic AMP signaling by the first intracellular loop of the gonadotropin-releasing hormone receptor. J Biol Chem 273:25581–25586[Abstract/Free Full Text]
  38. Dascal N 1997 Signalling via the G protein-activated K+ channels. Cell Signal 9:551–573[CrossRef][Medline]
  39. Finley M, Arrabit C, Fowler C, Suen KF, Slesinger PA 2004 ßL-ßM loop in the C-terminal domain of G protein-activated inwardly rectifying K+ channels is important for G ß{gamma} subunit activation. J Physiol 555:643–657[Abstract/Free Full Text]
  40. Meyer DC 1989 Serotonin stimulation of the period of in vitro LHRH release is estradiol dependent. Brain Res Bull 22:525–530[CrossRef][Medline]
  41. Vitale ML, Chiocchio SR 1993 Serotonin, a neurotransmitter involved in the regulation of luteinizing hormone release. Endocr Rev 14:480–493[Abstract/Free Full Text]
  42. Siddiqui A, Kotecha K, Salicioni AM, Kalia V, Murray JF, Wilson CA 2000 Serotonin inhibits luteinizing hormone release via 5-HT1A receptors in the zona incerta of ovariectomised, anaesthetised rats primed with steroids. Neuroendocrinology 72:272–283[CrossRef][Medline]
  43. Gore AC, Terasawa E 2001 Neural circuits regulating pulsatile luteinizing hormone release in the female guinea-pig: opioid, adrenergic and serotonergic interactions. J Neuroendocrinol 13:239–248[CrossRef][Medline]
  44. Pronina T, Ugrumov M, Calas A, Seif I, Tramu G 2003 Influence of monoamines on differentiating gonadotropin-releasing hormone neurones in foetal mice. J Neuroendocrinol 15:925–932[CrossRef][Medline]
  45. Pronina T, Ugrumov M, Adamskaya E, Kuznetsova T, Shishkina I, Babichev V, Calas A, Tramu G, Mailly P, Makarenko I 2003 Influence of serotonin on the development and migration of gonadotropin-releasing hormone neurones in rat foetuses. J Neuroendocrinol 15:549–558[Medline]
  46. Andrade R, Malenka RC, Nicoll RA 1986 A G protein couples serotonin and GABA-B receptors to the same channels in hippocampus. Science 234:1261–1265[Abstract/Free Full Text]
  47. Jeong HJ, Han SH, Min BI, Cho YW 2001 5-HT1A receptor-mediated activation of G-protein-gated inwardly rectifying K+ current in rat periaqueductal gray neurons. Neuropharmacology 41:175–185[CrossRef][Medline]
  48. Craven RM, Grahame-Smith DG, Newberry NR 2001 5-HT1A and 5-HT2 receptors differentially regulate the excitability of 5-HT-containing neurones of the guinea pig dorsal raphe nucleus in vitro. Brain Res 899:159–168[CrossRef][Medline]
  49. Wickman K, Clapham DE 1995 Ion channel regulation by G proteins. Physiol Rev 75:865–885[Abstract/Free Full Text]
  50. Ikeda K, Kobayashi T, Kumanishi T, Niki H, Yano R 2000 Involvement of G-protein-activated inwardly rectifying K (GIRK) channels in opioid-induced analgesia. Neurosci Res 38:113–116[CrossRef][Medline]
  51. Hille B 1994 Modulation of ion-channel function by G-protein-coupled receptors. Trends Neurosci 17:531–536[CrossRef][Medline]
  52. Hill RH, Svensson E, Dewael Y, Grillner S 2003 5-HT inhibits N-type but not L-type Ca2+ channels via 5-HT1A receptors in lamprey spinal neurons. Eur J Neurosci 18:2919–2924[CrossRef][Medline]
  53. Krsmanovic LZ, Mores N, Navarro CE, Saeed SA, Arora KK, Catt KJ 1998 Muscarinic regulation of intracellular signaling and neurosecretion in gonadotropin-releasing hormone neurons. Endocrinology 139:4037–4043[Abstract/Free Full Text]
  54. Blackmer T, Larsen EC, Takahashi M, Martin TF, Alford S, Hamm HE 2001 G protein ß{gamma} subunit-mediated presynaptic inhibition: regulation of exocytotic fusion downstream of Ca2+ entry. Science 292:293–297[Abstract/Free Full Text]
  55. Gerachshenko T, Blackmer T, Yoon EJ, Bartleson C, Hamm HE, Alford S 2005 Gß{gamma} acts at the C terminus of SNAP-25 to mediate presynaptic inhibition. Nat Neurosci 8:597–605[CrossRef][Medline]
  56. Blackmer T, Larsen EC, Bartleson C, Kowalchyk JA, Yoon EJ, Preininger AM, Alford S, Hamm HE, Martin TF 2005 G protein ß{gamma} directly regulates SNARE protein fusion machinery for secretory granule exocytosis. Nat Neurosci 8:421–425[Medline]
  57. Aghajanian GK 1990 Serotonin-induced inward current in rat facial motoneurons: evidence for mediation by G proteins but not protein kinase C. Brain Res 524:171–174[CrossRef][Medline]
  58. Foguet M, Hoyer D, Pardo LA, Parekh A, Kluxen FW, Kalkman HO, Stuhmer W, Lubbert H 1992 Cloning and functional characterization of the rat stomach fundus serotonin receptor. EMBO J 11:3481–3487[Medline]
  59. Lubbert H, Snutch TP, Dascal N, Lester HA, Davidson N 1987 Rat brain 5-HT1C receptors are encoded by a 5–6 kbase mRNA size class and are functionally expressed in injected Xenopus oocytes. J Neurosci 7:1159–1165[Abstract]
  60. Pritchett DB, Bach AW, Wozny M, Taleb O, Dal Toso R, Shih JC, Seeburg PH 1988 Structure and functional expression of cloned rat serotonin 5HT-2 receptor. EMBO J 7:4135–4140[Medline]
  61. Hoger JH, Walter AE, Vance D, Yu L, Lester HA, Davidson N 1991 Modulation of a cloned mouse brain potassium channel. Neuron 6:227–236[CrossRef][Medline]
  62. Dumuis A, Bouhelal R, Sebben M, Cory R, Bockaert J 1988 A nonclassical 5-hydroxytryptamine receptor positively coupled with adenylate cyclase in the central nervous system. Mol Pharmacol 34:880–887[Abstract]
  63. Andrade R, Chaput Y 1991 5-Hydroxytryptamine4-like receptors mediate the slow excitatory response to serotonin in the rat hippocampus. J Pharmacol Exp Ther 257:930–937[Abstract/Free Full Text]
  64. Martinez de la Escalera G, Choi AL, Weiner RI 1992 ß1-Adrenergic regulation of the GT1 gonadotropin-releasing hormone (GnRH) neuronal cell lines: stimulation of GnRH release via receptors positively coupled to adenylate cyclase. Endocrinology 131:1397–1402[Abstract/Free Full Text]
  65. Weiner RI, Charles A 2001 Regulation of gonadotropin-releasing hormone release by cyclic AMP signalling pathways. Growth Horm IGF Res 11(Suppl A):S9–S15
  66. Charles A, Weiner R, Costantin J 2001 cAMP modulates the excitability of immortalized hypothalamic (GT1) neurons via a cyclic nucleotide gated channel. Mol Endocrinol 15:997–1009[Abstract/Free Full Text]
  67. Fujita K, Aguilera G, Catt KJ 1979 The role of cyclic AMP in aldosterone production by isolated zona glomerulosa cell. J Biol Chem 254:8567–8574[Abstract/Free Full Text]
  68. Arora KK, Cheng Z, Catt KJ 1996 Dependence of agonist activation on an aromatic moiety in the DPLIY motif of the gonadotropin-releasing hormone receptor. Mol Endocrinol 10:979–986[Abstract/Free Full Text]
  69. Skynner MJ, Sim JA, Herbison AE 1999 Detection of estrogen receptor {alpha} and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:5195–5201[Abstract/Free Full Text]
  70. Urban RJ, Johnson ML, Veldhuis JD 1989 In vivo biological validation and biophysical modeling of the sensitivity and positive accuracy of endocrine peak detection. I. The LH pulse signal. Endocrinology 124:2541–2547[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Neurophysiol.Home page
H. J. Yu and A. Yamaguchi
5-HT2C-Like Receptors in the Brain of Xenopus laevis Initiate Sex-Typical Fictive Vocalizations
J Neurophysiol, August 1, 2009; 102(2): 752 - 765.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. L Henderson, D. J Hodson, S. J Gregory, J. Townsend, and D. J Tortonese
Gonadotropin-Releasing Hormone Stimulates Prolactin Release from Lactotrophs in Photoperiodic Species Through a Gonadotropin-Independent Mechanism
Biol Reprod, February 1, 2008; 78(2): 370 - 377.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Constantin and S. Wray
Gonadotropin-Releasing Hormone-1 Neuronal Activity Is Independent of Cyclic Nucleotide-Gated Channels
Endocrinology, January 1, 2008; 149(1): 279 - 290.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
B. L. Antonsen and D. H. Edwards
Mechanisms of Serotonergic Facilitation of a Command Neuron
J Neurophysiol, December 1, 2007; 98(6): 3494 - 3504.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Quaynor, L. Hu, P. K. Leung, H. Feng, N. Mores, L. Z. Krsmanovic, and K. J. Catt
Expression of a Functional G Protein-Coupled Receptor 54-Kisspeptin Autoregulatory System in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Mol. Endocrinol., December 1, 2007; 21(12): 3062 - 3070.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. E. Campbell and A. E. Herbison
Definition of Brainstem Afferents to Gonadotropin-Releasing Hormone Neurons in the Mouse Using Conditional Viral Tract Tracing
Endocrinology, December 1, 2007; 148(12): 5884 - 5890.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. J. Spergel
Calcium and Small-Conductance Calcium-Activated Potassium Channels in Gonadotropin-Releasing Hormone Neurons before, during, and after Puberty
Endocrinology, May 1, 2007; 148(5): 2383 - 2390.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H. S. Kim, S. Yumkham, J. H. Choi, G. H. Son, K. Kim, S. H. Ryu, and P.-G. Suh
Serotonin stimulates GnRH secretion through the c-Src-PLC {gamma}1 pathway in GT1-7 hypothalamic cells.
J. Endocrinol., September 1, 2006; 190(3): 581 - 591.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Hu, K. Wada, N. Mores, L. Z. Krsmanovic, and K. J. Catt
Essential Role of G Protein-gated Inwardly Rectifying Potassium Channels in Gonadotropin-induced Regulation of GnRH Neuronal Firing and Pulsatile Neurosecretion
J. Biol. Chem., September 1, 2006; 281(35): 25231 - 25240.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wada, K.
Right arrow Articles by Catt, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wada, K.
Right arrow Articles by Catt, K. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals