help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0063
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solá, S.
Right arrow Articles by Rodrigues, C. M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solá, S.
Right arrow Articles by Rodrigues, C. M. P.
Molecular Endocrinology 20 (10): 2292-2303
Copyright © 2006 by The Endocrine Society

Functional Modulation of Nuclear Steroid Receptors by Tauroursodeoxycholic Acid Reduces Amyloid ß-Peptide-Induced Apoptosis

Susana Solá, Joana D. Amaral, Pedro M. Borralho, Rita M. Ramalho, Rui E. Castro, Márcia M. Aranha, Cifford J. Steer and Cecília M. P. Rodrigues

Centro de Patogénese Molecular (S.S., J.D.A., P.M.B., R.M.R., R.E.C., M.M.A., C.M.P.R.), Faculty of Pharmacy, University of Lisbon, Lisbon 1600-083, Portugal; and Departments of Medicine (C.J.S.), and Genetics, Cell Biology, and Development (C.J.S.), University of Minnesota Medical School, Minneapolis, Minnesota 55455

Address all correspondence and requests for reprints to: Dr. Cecília M. P. Rodrigues, Avenida das Forças Armadas, 1600–083 Lisbon, Portugal. E-mail: cmprodrigues{at}ff.ul.pt.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tauroursodeoxycholic acid (TUDCA) prevents amyloid ß-peptide (Aß)-induced neuronal apoptosis, by modulating both classical mitochondrial pathways and specific upstream targets. In addition, activation of nuclear steroid receptors (NSRs), such as the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR) differentially regulates apoptosis in the brain. In this study we investigated whether TUDCA, a cholesterol-derived endogenous molecule, requires NSRs for inhibiting Aß-induced apoptosis in primary neurons. Our results confirmed that TUDCA significantly reduced Aß-induced apoptosis; in addition, the fluorescently labeled bile acid molecule was detected diffusely in both cytoplasm and nucleus of rat cortical neurons. Interestingly, experiments using small interfering RNAs (siRNAs) revealed that, in contrast to GR siRNA, MR siRNA abolished the antiapoptotic effect of TUDCA. Aß incubation reduced MR nuclear translocation while increasing nuclear GR levels. Notably, pretreatment with TUDCA markedly altered Aß-induced changes in NSRs, including MR dissociation from its cytosolic chaperone, heat shock protein 90, and subsequent translocation to the nucleus. Furthermore, when a carboxy terminus-deleted form of MR was used, nuclear trafficking of both MR and the bile acid was abrogated, suggesting that they translocate to the nucleus as a steroid-receptor complex. Transfection experiments with wild-type or mutant MR confirmed that this interaction was required for TUDCA protection against Aß-induced apoptosis. Finally, in cotransfection experiments with NSR response element reporter and overexpression constructs, pretreatment with TUDCA significantly modulated Aß-induced changes in MR and GR transactivation. In conclusion, these results provide novel insights into the specific cellular mechanism of TUDCA antiapoptotic function against Aß-induced apoptosis and suggest targets for potential therapeutic intervention.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ALZHEIMER’S DISEASE (AD) is characterized by a selective damage of synapses and neurons, neurofibrillary tangles, activated glia, and presence of senile plaques (1). In addition, amyloid ß-peptide (Aß) is the major constituent of senile plaques (2), thought to directly induce oxidative stress, inflammation, and neuronal apoptosis (1, 3). Recently, the involvement of apoptosis has been corroborated by studies showing that Aß alters expression of the Bcl-2 family of apoptosis-related genes (4), and that survival signaling pathways are required for protection of Aß-mediated neuronal apoptosis (5).

The endogenous hydrophilic bile acid, ursodeoxycholic acid (UDCA), and its taurine-conjugated derivative, tauroursodeoxycholic acid (TUDCA), play a unique role in modulating mitochondrial apoptosis (6, 7, 8). They also regulate the expression of Bcl-2 family members by modulating molecular targets upstream of the mitochondrial commitment, in a caspase-independent manner (9). Curiously, TUDCA is a potent neuroprotective agent not only in pharmacological and transgenic animal models of Huntington’s disease (10, 11), but also for acute ischemic and hemorrhagic stroke (12, 13). Furthermore, TUDCA improved the survival and function of nigral transplants in a rat model of Parkinson’s disease (14) and partially rescued a Parkinson’s disease model of Caenorhabditis elegans from mitochondrial dysfunction (15). Importantly, TUDCA also prevents Aß-induced neuronal death by both triggering phosphatidylinositol 3-kinase survival signaling (16) and modulating the E2F-1/p53/Bax apoptotic pathway (17).

Nuclear steroid receptors (NSRs) play an heterogeneous function in apoptosis, which is affected by tissue-specific parameters such as alternative initiation sites within nuclear receptor genes, and different effects of comodulators (18, 19). In contrast to its antiapoptotic effect in the liver, the glucocorticoid receptor (GR) up-regulates p53 and proapoptotic Bcl-2 members in neuronal and leukemia cells (20, 21, 22). Interestingly, glucocorticoid receptor (GR) activation has been correlated with neuronal pathological conditions, such as AD (23, 24). The hormone-binding domain of GR is not mutated in AD patients (25), but GR activation enhances oxidative stress-induced cell death in hippocampal neurons (26). Conversely, the mineralocorticoid receptor (MR) is a potent inhibitor of apoptosis in the majority of cell types, including neurons (20, 27). Although MR and GR share considerable structure and functional homology, MR can form heterodimers with GR and inhibit its function via the MR N-terminal domain (28). In neuronal cells, MR decreases p53 levels as well as the ratio of pro- relative to antiapoptotic Bcl-2 members (20).

Bile acids are natural ligands of NSRs, structurally similar to steroid hormones (29). Moreover, UDCA interacts with GR ligand binding domain (LBD) (30), perhaps attenuating the interaction between GR and its coactivators (31). Here, we demonstrate that TUDCA targets a specific region of MR LBD and dissociates the NSR from its cytosolic chaperone, heat shock protein 90 (hsp90). The bile acid/NSR complex is then translocated to the nucleus, thereby modulating NSR transactivation and ultimately reducing Aß-mediated neuronal apoptosis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fluorescent UDCA Is Localized in the Nucleus of Neurons
It has been reported that UDCA and its amino acid-conjugated derivatives prevent neuronal apoptosis from Aß through inhibition of mitochondrial pathways and modulation of upstream targets (16, 17). To further understand the mechanism by which bile acids modulate apoptosis in neuronal cells, we first investigated the subcellular localization of UDCA in primary rat cortical neurons. For this purpose, cells were incubated with a fluorescent UDCA molecule (Fig. 1Go). Unlabeled UDCA did not show any fluorescence at all time points. In contrast, the 3{alpha}-hydroxy-7-nitrobenzoxadiazolyl (NBD)-UDCA molecule was clearly observed in rat cortical neurons. The fluorescent signal was weak at 5 min; however, it became more intense at 15 min and at 1 and 2 h of incubation. Moreover, although the green fluorescence was stronger in the cytosol, the signal was diffuse in all compartments of neurons, including the nucleus. Nuclear localization of the NBD-UDCA molecule was confirmed by Hoechst counterstain (data not shown). Therefore, these results suggest that this bile acid may also have a specific role within the nucleus to protect neurons against apoptosis.


Figure 1
View larger version (74K):
[in this window]
[in a new window]
 
Fig. 1. Nuclear Localization of UDCA in Cortical Neurons

Subcellular distribution of labeled UDCA in primary rat cortical neurons. Cortical neurons were cultured for 3 d as described in Materials and Methods and supplemented with 100 µM of either NBD-UDCA or unlabeled UDCA for 5, 15, and 30 min and 1 and 2 h. Competition studies demonstrated the specificity of the NBD-UDCA molecule in primary rat cortical neurons (data not shown). Representative photographs of fluorescence microscopy of at least three different experiments.

 
TUDCA Prevents Aß-Induced Apoptosis through a NSR-Dependent Mechanism
It has been reported that NSRs modulate apoptosis in neuronal cells (20). In addition, we have previously shown that UDCA prevents hepatocyte apoptosis through an NSR-dependent mechanism (32), and that GR is crucial for the nuclear translocation of the bile acid and attenuation of apoptosis (30). Therefore, we investigated the potential role of NSRs in the protective function of bile acids against Aß-induced apoptosis of neuronal cells. Apoptosis was assessed by changes in nuclear morphology, caspase activity, and poly(ADP-ribose) polymerase (PARP) cleavage (Fig. 2Go). Significant levels of apoptosis were detected in primary rat cortical neurons after incubation with Aß(25–35) peptide, with approximately 50% of cell death (P < 0.01). Notably, UDCA and TUDCA protected Aß-induced nuclear fragmentation by 50% and 65%, respectively (P < 0.01). In addition, the active fragment Aß(1–40) resulted in 40% neuronal apoptosis, and this was reduced 40% and 50% by UDCA and TUDCA, respectively (data not shown). Aß-induced cell death was associated with a 2-fold increase in caspase-3-like activation (P < 0.01), whereas TUDCA almost completely inhibited this effect (P < 0.01). Further, PARP cleavage was evident during Aß-induced cell death (P < 0.05), but significantly reduced by TUDCA (P < 0.05).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. TUDCA Inhibits Apoptosis Induced by Aß in Cortical Neurons

Cortical neurons cultured for 3 d were incubated with 25 µM Aß(25–35), or no addition (control), ± 100 µM UDCA, or TUDCA for 24 h. In coincubation experiments, cells were pretreated with either UDCA or TUDCA for 12 h before incu-bation with Aß. Cells were fixed and stained for evidence of apoptosis; and cytosolic and total proteins were extracted for caspase activity and PARP cleavage, respectively, as described in Material and Methods. A, Fluorescence microscopy of Hoechst staining (top) and percentage of apoptosis (bottom) in control cortical neurons and cells exposed to Aß with or without bile acids. B, DEVD-specific caspase activity in cytosolic fractions after incubation with Aß± bile acids. C, PARP cleavage in total protein extracts after incubation with Aß± bile acids. The results are expressed as mean ± SEM for at least three different experiments. *, P < 0.01; and §, P < 0.05 from control; {dagger}, P < 0.01; and {ddagger}, P < 0.05 from cells exposed to Aß alone.

 
We next determined whether the antiapoptotic effect of TUDCA in rat cortical neurons requires NSR activation by performing posttranscriptional gene silencing experiments for both MR and GR. The results indicated that the decrease in MR and GR expression after transfection with small interfering RNAs (siRNAs) was significant at approximately 80% (P < 0.05), particularly in coincubated neurons (Fig. 3AGo). MR silencing did not affect GR expression, as well as the opposite (data not shown), whereas the nonspecific control duplex did not affect the antiapoptotic function of TUDCA. More importantly, MR-specific siRNA transfection completely abolished TUDCA protection against Aß-mediated apoptosis, as assessed by nuclear morphology (Fig. 3BGo). In contrast, when GR siRNA was used to silence GR expression, the toxicity of Aß was slightly decreased, whereas TUDCA was still protective.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. TUDCA Prevents Aß-Induced Apoptosis via MR in Cortical Neurons

Cortical neurons were incubated with either vehicle or 100 µM TUDCA 4 h after control, MR, or GR siRNA transfections. After an additional 12 h, 25 µM Aß(25–35) was included in the cultures for 24 h. Cells were fixed and stained for apoptosis, as described in Material and Methods. A, Representative immunoblot of MR and GR in cells coincubated with Aß and TUDCA and transfected with control, MR, or GR siRNAs. B, Percentage of apoptosis in cells transfected with control, MR, or GR siRNAs and exposed to Aß± TUDCA. The results are expressed as mean ± SEM for at least four different experiments. To assess silencing, protein levels of MR and GR were quantified by immunoblotting. ß-Actin was used to control for lane loading. *, P < 0.01; and §, P < 0.05 from control; {ddagger}, P < 0.05 from cells exposed to Aß alone.

 
To further clarify the role of NSRs in the antiapoptotic function of TUDCA, both caspase-3-like activity and PARP cleavage were determined in cortical neurons after endogenous silencing of MR and GR (Fig. 4Go). The results showed that caspase-3 activation by Aß was still reduced by TUDCA in control siRNA-transfected cells (P < 0.05), but no longer affected after MR silencing. Moreover, TUDCA protection of PARP cleavage decreased 50% after MR-specific siRNA transfection, reinforcing the role of this receptor during inhibition of apoptosis by TUDCA. MR silencing also reduced the nuclear localization of NBD-UDCA in primary rat cortical neurons (data not shown). Curiously, both Aß-induced caspase-3 activation and PARP cleavage were still significantly decreased by TUDCA after GR silencing (P < 0.05). Thus, NSRs appear to be important regulatory factors in the antiapoptotic function of TUDCA against Aß-induced cell death.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. TUDCA Prevents Aß-Induced Apoptosis via MR in Cortical Neurons

Cortical neurons were incubated with either vehicle or 100 µM TUDCA 4 h after control, MR, or GR siRNA transfections. After an additional 12 h, 25 µM Aß(25–35) was included in the cultures for 24 h. Cytosolic and total proteins were extracted for caspase activity and PARP cleavage, respectively, as described in Materials and Methods. A, DEVD-specific caspase activity; and B, PARP cleavage in cells transfected with control, MR, or GR siRNAs and exposed to Aß± TUDCA. The results are expressed as mean ± SEM for at least four different experiments. To assess silencing, protein levels of MR and GR were quantified by immunoblotting. ß-Actin was used to control for lane loading. *, P < 0.01; and §, P < 0.05 from control; {dagger}, P < 0.01; and {ddagger}, P < 0.05 from cells exposed to Aß alone.

 
TUDCA Differentially Regulates NSR Cellular Distribution in Neurons
Although MR appears to be required for the protective effect of TUDCA during Aß-induced apoptosis, the mechanism by which TUDCA regulates NSRs in neuronal cells is unclear. Therefore, we determined total protein levels of both MR and GR during Aß-induced apoptosis and TUDCA protection (Fig. 5AGo). Interestingly, the results indicated that incubation with Aß alone slightly increased total MR levels in primary rat cortical neurons; however, pretreatment with TUDCA further enhanced MR expression (P < 0.05). In contrast, GR protein expression was not significantly affected by either Aß or TUDCA.


Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. TUDCA Differentially Modulates MR and GR Translocation to the Nucleus

Cortical neurons cultured for 3 d were incubated with 25 µM Aß(25–35), or no addition (control), ± TUDCA for 24 h. In coincubation experiments, TUDCA was added to cells 12 h before incubation with Aß. Total and nuclear proteins were extracted for Western blot analysis as described in Materials and Methods. Representative immunoblots of total (panel A) and nuclear (panel B) levels of MR and GR with mean densitometry values of cells exposed to Aß± TUDCA. The results are expressed as mean ± SEM arbitrary units for at least four different experiments. *, P < 0.01 from control; {dagger}, P < 0.01; and {ddagger}, P < 0.05 from cells exposed to Aß alone.

 
Because NSR activation requires translocation to the nucleus (32, 33), we next investigated the effect of Aß, with or without TUDCA, on the intracellular trafficking of MR and GR (Fig. 5BGo). Our results showed that Aß induces significant changes in nuclear translocation of both NSRs in cortical neurons. In fact, in cells incubated with Aß alone, nuclear levels of MR were 40% lower than those of controls, whereas nuclear GR increased 50% (P < 0.01). Interestingly, the cellular distribution of NSR was not significantly affected by TUDCA alone; however, pretreatment with the bile acid modulated MR and GR changes caused by Aß (P < 0.05). The induction of MR total protein levels by TUDCA in cortical neurons appears to recover the MR nuclear levels, which were decreased by Aß exposure. Further, although GR expression was not modulated by TUDCA, the bile acid inhibited GR nuclear translocation, thereby perhaps preventing Aß-induced cell damage. These results reinforce the notion that NSRs contribute to the antiapoptotic effect of TUDCA during Aß-associated toxicity.

TUDCA Promotes MR Dissociation from Its Cytosolic Chaperone
It has been established that chaperone dissociation of NSRs is a prerequisite for nuclear trafficking and subsequent NSR transactivation (33, 34). The effect of Aß and TUDCA on complex formation between MR and its chaperone hsp90 was analyzed by immunoprecipitation assays (Fig. 6Go). The results revealed a slight, but not significant, increase in the association between MR and hsp90 in Aß-treated neurons. This may be attributed to the fact that Aß marginally increased total levels of MR but had no effect on the nucleus. TUDCA alone induced a slight decrease in MR/hsp90 binding compared with controls. More importantly, coincubation with the bile acid significantly diminished MR/hsp90 binding compared with either control or Aß-treated cells (P < 0.05). Thus, these data confirm that TUDCA promotes MR nuclear translocation by inducing MR/hsp90 dissociation during Aß-induced apoptosis.


Figure 6
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. TUDCA Prevents Aß-Induced Apoptosis by Inducing MR/hsp90 Dissociation

Cortical neurons cultured for 3 d were incubated with 25 µM Aß(25–35), or no addition (control), ± TUDCA for 24 h. In coincubation experiments, TUDCA was added to cortical neurons 12 h before incubation with Aß. Total proteins were extracted for immunoprecipitation assays as described in Materials and Methods. Representative immunoblots with hsp90- and MR-specific antibodies (top), and histogram of MR/hsp90 association (bottom) in cells exposed to Aß± TUDCA for 24 h. All densitometry values for hsp90 were normalized to the respective MR expression, and the results are expressed as mean ± SEM arbitrary units for at least seven different experiments. {ddagger}, P < 0.05 from cells exposed to Aß alone. IP, Immunoprecipitation; WB, Western blot.

 
TUDCA Interacts with the Region of MR LBD to Prevent Aß-Induced Apoptosis
Although TUDCA promotes MR dissociation in cortical neurons, the mechanism of interaction between MR and TUDCA is still unclear. It has been demonstrated that the dissociation of NSRs requires ligand stimulation (35), and bile acids are natural ligands of NSRs (36). Therefore, we determined whether TUDCA requires the LBD region of MR to induce dissociation of MR/hsp90, followed by MR nuclear translocation and subsequent abrogation of apoptosis. We transfected PC12 cells with plasmids expressing green fluorescent protein (GFP) fusion proteins with MR Wt (wild type), GFP-MR Wt, or the LBD mutant form of MR, GFP-MR(1–840) (Fig. 7AGo). In agreement with our previous study (17), TUDCA reduced Aß-induced apoptosis in PC12 cells at 24 h by approximately 70% (P < 0.01) (data not shown). Next, complex formation of the chimeric proteins with hsp90 was analyzed by immunoprecipitation after Aß± TUDCA incubations (Fig. 7BGo). Both chimeric proteins were associated with hsp90; however, MR Wt was readily dissociated from hsp90 after TUDCA coincubation. Indeed, the interaction between MR Wt and hsp90 decreased about 30% and 70% (P < 0.05) with Aß plus TUDCA, compared with controls and Aß alone, respectively. In contrast, deletion of the carboxy terminus of MR LBD(1–840) completely abolished the effect of TUDCA on MR/hsp90 association, indicating that TUDCA requires this specific region to interact with MR. Curiously, this carboxy terminus of MR LBD appears to affect only TUDCA interaction and not chaperone binding. Immunoprecipitation assays using a GFP antibody confirmed the results obtained with the MR antibody (data not shown). Thus, these results suggest that during Aß-induced toxicity, TUDCA interacts with MR LBD to mediate MR/hsp90 dissociation, which, in turn, may induce nuclear translocation of MR.


Figure 7
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. The LBD of MR Affects TUDCA-Induced MR Dissociation

PC12 cells were transfected with Wt and LBD mutant MR, GFP-MR Wt, and GFP-MR(1–840) as described in Materials and Methods. Vehicle or 100 µM TUDCA was added to cells 12 h later. After an additional 12 h, 25 µM Aß(25–35) was included in the cultures for 24 h. Cells were harvested for immunoprecipitation assays as described in Materials and Methods. A, Schematic drawing of Wt and LBD mutant GFP-MR plasmids. B, Histogram of the association between MR Wt and MR(1–840) and hsp90 in cells exposed to Aß± TUDCA. All densitometry for hsp90 was normalized to the respective MR expression. The results are expressed as mean ± SEM arbitrary units for at least six different experiments. {ddagger}, P < 0.05 from cells exposed to Aß alone. IP, Immunoprecipitation; WB, Western blot.

 
To confirm this effect, we analyzed the subcellular distribution of both Wt and LBD mutant forms of GFP-MR by fluorescence microscopy (Fig. 8AGo). MR Wt localized primarily to the cytosol in the absence of either Aß or TUDCA. In contrast, TUDCA further induced nuclear translocation of GFP-MR Wt compared with Aß alone, confirming that TUDCA-induced MR/hsp90 dissociation results in MR nuclear translocation. Nevertheless, TUDCA did not translocate the deleted form of MR LBD(1–840), reinforcing the notion that this specific region is required for TUDCA-induced nuclear trafficking of MR. In addition, we have recently demonstrated that NSRs mediate the nuclear translocation of bile acids (30), probably as bile acid-NSR complexes. In fact, bile acids including UDCA were detected within the nuclei of cells (37). Thus, we explored whether UDCA is translocated to the nucleus of cells together with MR.


Figure 8
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8. The LBD of MR is Required for the Antiapoptotic Effect of TUDCA against Aß

PC12 cells were transfected with Wt and LBD mutant MR, GFP-MR Wt, or GFP-MR(1–840) as described in Materials and Methods. Vehicle or 100 µM TUDCA was added to cells 12 h later. After an additional 12 h, 25 µM Aß(25–35) was included in the cultures for 24 h. Cells were fixed for fluorescent microscopy analysis and Hoechst staining as described in Materials and Methods. A, Fluorescent microscopy of GFP staining in control PC12 cells and cells exposed to Aß± TUDCA. B, Subcellular localization of UDCA in PC12 cells transfected with Wt and LBD mutant forms of GFP-MR plasmids. Representative photographs of unlabeled UDCA (a), NBD-UDCA staining (b), and NBD-UDCA staining in cells transfected with either MR Wt (c) or MR(1–840) (d). Competition studies confirmed the specificity of NBD-UDCA molecule in PC12 cells (data not shown). C, Percentage of apoptosis in cells transfected with MR Wt and MR(1–840) and exposed to Aß± TUDCA. The results are expressed as mean ± SEM for at least three different experiments. *, P < 0.01 from control; {dagger}, P < 0.01 from cells exposed to Aß alone.

 
For this purpose, we analyzed the subcellular location of UDCA-fluorescent molecule in cells overexpressing either Wt or the LBD mutant form of GFP-MR (Fig. 8BGo). GFP fluorescence was undetectable under the conditions used to visualize the NBD fluorescence from the bile acid. The results revealed that unlabeled UDCA did not show any fluorescence. In contrast, the NBD-UDCA molecule was clearly detectable in PC12 cells. In cells overexpressing the Wt form of MR, NBD fluorescence was detected as diffuse staining in the cytosol but more aggregated in the nucleus. Nuclear localization of NBD-UDCA was confirmed by Hoechst counterstain (data not shown). Furthermore, the overexpression of GFP-MR(1–840) resulted in an approximately 30% decrease of UDCA nuclear aggregates, indicating that the interaction between the bile acid and the LBD region is required for nuclear uptake of the bile acid via MR. We next determined whether nuclear migration of the bile acid-MR complex was indeed critical for TUDCA antiapoptotic function against Aß. The results showed that unlike MR Wt, MR LBD(1–840) completely abolished TUDCA protection of apoptosis in Aß-treated cells (Fig. 8CGo). Thus, TUDCA appears to interact with a specific region of MR LBD to induce MR dissociation, followed by nuclear translocation of the bile acid-MR complex, and inhibition of apoptosis induced by Aß.

TUDCA Modulates NSR Transactivation to Prevent Aß-Induced Apoptosis
We recently reported that GR translocation of TUDCA was required to reduce TGF-ß1-induced hepatocyte apoptosis but did not require an increase in NSR transactivation (30). Therefore, we investigated whether the antiapoptotic function of TUDCA against Aß peptide is also NSR transactivation dependent. Cells were cotransfected with a GR/MR-responsive element-reporter construct, pGRE/MRE-luciferase, and either MR (pRShMR) or GR (pRShGR), overexpression plasmids. Surprisingly, our results revealed that TUDCA differentially regulates NSR transactivation during Aß-induced cell death (Fig. 9Go). In fact, when cells were cotransfected with MR overexpression plasmid, pRShMR, Aß significantly decreased MR activity (P < 0.01), whereas the bile acid alone increased MR transactivation by approximately 30% (P < 0.05). Notably, coincubation with TUDCA resulted in approximately 40% greater MR response element activation, as compared with Aß alone (P < 0.05). Nevertheless, when cells were cotransfected with GR overexpression plasmid, pRShGR, Aß induced GR activity by approximately 50% (P < 0.01), whereas TUDCA pretreatment completely inhibited Aß-induced GR transactivation (P < 0.05). Interestingly, the results show that without MR/GR overexpression, Aß has an effect that is more MR- than GR-like. It is possible that other NSRs may account for the modulation of MRE/GRE-dependent reporter activity in PC12 cells, particularly because PC12 cells do not express endogenous MR. Also, in cells cotransfected with MR overexpression plasmid, 10 µM corticosterone diminished TUDCA-induced GRE/MRE transactivation from Aß by approximately 30% (P < 0.05). Interestingly, this effect was greater with 20 µM corticosterone. The competition effect of corticosterone for nuclear translocation of UDCA through MR was also confirmed by fluorescent microscopy in PC12 cells overexpressing GFP-MR Wt (data not shown). Collectively, these results indicate that during Aß-induced apoptosis, TUDCA pretreatment results in differential cellular distribution of NSRs that ultimately affects their transactivation. Thus, modulation of NSR transactivation by TUDCA may be required for bile acid protection against Aß peptide-induced apoptosis.


Figure 9
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 9. TUDCA Prevents Aß-Induced Apoptosis by Regulating NSR Transactivation

PC12 cells were cotransfected with a GR/MR-responsive element-reporter construct, pGRE/MRE-luciferase, and either MR (pRShMR), or GR (pRShGR) overexpression plasmids, as described in Materials and Methods. Vehicle or 100 µM TUDCA was added to cells 12 h later. After an additional 12 h, 25 µM Aß(25–35) was included in the cultures, and cells were harvested for luciferase assays. Transfection efficiencies were determined using a reporter plasmid expressing ß-galactosidase. Based on this control, transfection efficiencies were approximately 70% and did not differ between reporter and expression plasmids. Histogram of the GRE transactivation in cells exposed to Aß for 24 h ± TUDCA, with or without NSR overexpression. Luciferase activity (relative light units/mg protein) was normalized to control PGL3-CAT expression, and the results are expressed as mean ± SEM for eight different experiments. *, P < 0.01; and §, P < 0.05 from control; {dagger}, P < 0.01; and {ddagger}, P < 0.05 from cells exposed to Aß alone.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The accumulation of Aß in the brain has been implicated as a potential cause for the neuronal loss that occurs in AD. Indeed, cell death from Aß-induced toxicity is a complex process involving a number of different pathways, including oxidative stress, perturbation of calcium homeostasis, mitochondrial dysfunction, and caspase activation (1).

In contrast to hydrophobic bile acids, UDCA and TUDCA are nontoxic species and can act as antiapoptotic agents (6, 38). They directly inhibit reactive oxygen species production, collapse of the transmembrane potential, and disruption of the outer mitochondrial membrane (39). We have previously reported that TUDCA is a pleiotropic agent that prevents Aß-induced apoptosis by both inhibiting the mitochondrial pathway of cell death (16) and modulating the E2F-1/p53/Bax pathway (17). Our results provide an extended mechanism of action for TUDCA, in which the bile acid binds to MR and is translocated as a complex to the nucleus of neuronal cells where it protects against Aß-induced apoptosis.

Recent studies have identified an increasing number of ligands for nuclear receptors, including certain bile acids (40, 41, 42). It has been demonstrated that UDCA activates GR in liver cells, in the absence of ligand binding (31, 43), suggesting a modulatory effect for this bile acid. However, UDCA-induced GR modulation has been correlated primarily with its antiinflammatory properties, but not with UDCA’s antiapoptotic function. In fact, nuclear receptors act as ligand-activated transcription factors that regulate expression of target genes to affect a variety of cellular processes, including apoptosis.

It has been demonstrated that a number of apoptosis-related proteins such as p53, Bax, Bcl-2, Bcl-xL, and the cellular inhibitor of apoptosis 2 (c-IAP2) are strongly regulated by NSRs in several cell types (20, 44, 45). Recently, we showed that UDCA modulates hepatocyte apoptosis through a NSR-dependent mechanism (32). However, the modulatory effect of NSRs is cell specific, often involving the expression and attenuation of the same gene between different tissues.

In the present study, using a fluorescently labeled UDCA molecule, we demonstrated that UDCA reaches the nucleus of primary rat cortical neurons. This corroborates previous observations in liver cells (30, 37) and suggests that UDCA may also have specific functions in the nucleus of neuronal cells. In addition, our results clearly showed that NSRs are involved in TUDCA’s antiapoptotic action, because MR silencing resulted in significant blockade of its protective effect in neurons exposed to Aß. Aß significantly increased GR nuclear levels, while slightly increasing total MR expression and markedly reducing nuclear MR. This is consistent with previous studies showing high levels of gr mRNA in the brain of patients with AD (23). Furthermore, GR and MR appear to have opposing effects, in various cell types, inhibiting each other’s transcriptional function, and thus differentially influencing the ultimate fate of the cell (20, 28). Notably, in contrast with UDCA and TUDCA in liver (32), pretreatment with TUDCA differentially modulates MR and GR nuclear translocation in neuronal cells. It has been shown that MR and GR share a significant sequence identity, often binding the same ligands (46). Nevertheless, the effect of TUDCA is not surprising, because NSR ligands mediate effects that are receptor- rather than ligand-specific (47). In addition, ligand-induced nuclear translocation of MR and GR exhibits differential patterns depending on the cell type (48). Curiously, it was demonstrated that the presence or absence of cortisol in the same cell type determines the activation of either GR and MR, or only MR by the same ligand (47). Thus, it is possible that specific comodulators in neuronal cells may somehow induce TUDCA-mediated MR nuclear translocation, rather than GR nuclear traffic. Others have demonstrated that the ability of corticosteroids to stimulate receptor transactivation function is also dependent on the stability of the steroid-receptor complexes (49).

To investigate a possible interaction between TUDCA and MR, and having shown that UDCA binds to a specific GR LBD region in hepatic cells (30), we evaluated the association between TUDCA and MR LBD during Aß-mediated apoptosis. Our results showed that, in the presence of Aß, TUDCA appears to interact with a specific region of MR LBD. This promotes MR dissociation from its cytosolic chaperone, hsp90, and translocation to the nucleus possibly as a bile acid-receptor complex. By competition studies, corticosterone diminished both TUDCA-induced GRE/MRE transactivation and nuclear translocation of the bile acid. In fact, the deleted form of MR(1–840) lacks an important region of the steroid-binding pocket, which is thought to be necessary for the hydrophobic contact between ligands and NSRs (50). This mutation affected nuclear translocation of both MR and the bile acid. In fact, MR LBD appears to be a prerequisite for the antiapoptotic function of TUDCA during Aß-induced apoptosis. MR may be required as the nuclear transporter molecule for TUDCA, and/or may also be transcriptionally modulated by the bile acid to prevent apoptosis. Indeed, the antiapoptotic action of MR has been extensively described in neuronal cells (20, 51, 52, 53). Interestingly, it has been shown that the increase of neuronal survival is reversed by a MR antagonist (27). Thus, to determine whether TUDCA does require modulation of NSR activity to protect Aß-induced apoptosis, we measured both MR and GR transactivation. In contrast to our results in primary rat hepatocytes (30), TUDCA significantly altered MR and GR transactivation in PC12 cells; the transcriptional activity of MR was increased, whereas GR transactivation was reduced by TUDCA pretreatment. It has been postulated that although MR inhibits GR transactivation in lymphocytes, it does not prevent translocation of GR into the nucleus with hormone binding (28). Nevertheless, during Aß-mediated neuronal apoptosis, repression of GR activity by TUDCA may be attributed, in part, to the significant decrease in GR nuclear translocation. In addition, it is important to note that the context of this study is therapeutic and does not immediately apply to physiological modulation of NSR function. In fact, the levels of bile acids used are pharmacological, rather than (patho)physiological, concentrations.

Finally, it remains to be determined which molecular targets are directly affected by TUDCA-mediated regulation of NSR transactivation during Aß-induced apoptosis. The members of both the phosphatidylinositol 3-kinase survival signaling and the E2F-1/p53/Bax apoptotic pathway are good candidates, because we have previously shown that both pathways are modulated by TUDCA during Aß-mediated cell death (16, 17).

Collectively, our studies further expand the antiapoptotic mechanism for TUDCA during Aß-induced cell injury. The results demonstrate that TUDCA preferentially targets MR in neural cells, rather than GR, interacting with a specific region of MR LBD and dissociating MR from its cytosolic chaperone, hsp90. TUDCA is then translocated into the nucleus together with MR, modulating NSR transactivation and thus inhibiting Aß-induced apoptosis. Finally, a complete elucidation of the molecular targets affected by the TUDCA-mediated regulation of NSRs during Aß-induced apoptosis would promise to accelerate development of neuroprotective strategies for the treatment of AD.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Cultures
Primary cultures of rat cortical neurons were prepared from fetuses of 17- to 18-d pregnant Wistar rats as previously described (16). Briefly, after trypsinization, cells were washed twice in Hank’s balanced salt solution without Ca2+ and Mg2+ (HBSS-2), containing 10% fetal calf serum, and resuspended in Neurobasal medium supplemented with 0.5 mM L-glutamine, 25 µM L-glutamic acid, 2% B-27 supplement, and 12 mg/ml gentamicin (Invitrogen, San Diego, CA). Neurons were then plated on tissue culture plates precoated with poly-D-lysine at 2 x 106 cells/ml and maintained at 37 C in a humidified atmosphere of 5% CO2. All experiments were performed using cells cultured for 2–3 d in fresh Neurobasal medium without glutamic acid and B-27 supplement. Neurons were characterized by phase contrast microscopy and indirect immunocytochemistry for neurofilaments and glial fibrillary acidic protein. Neuronal cultures were more than 95% pure. All animals received humane care according to the criteria outlined in the Guide for the Care and Use of Laboratory Animals prepared by the national Academy of Sciences and published by the National Institutes of Health (NIH) (NIH publication 86–23, revised 1985). In DNA plasmid transfection experiments, PC12 cells were grown in RPMI-1640 medium (Sigma Chemical Co., St. Louis, MO) supplemented with 10% heat-inactivated horse serum (Sigma Chemical Co.), 5% fetal bovine serum (Invitrogen), and 1% penicillin/streptomycin, and maintained at 37 C in a humidified atmosphere of 5% CO2. Cells were plated on tissue culture plates precoated with poly-D-lysine at 4 x 105 cells/ml.

Intracellular Distribution of UDCA
Cellular distribution of UDCA was visualized by incubating cells with NBD-UDCA fluorescent molecule, with transport properties similar to those of natural bile acids (54). Cells were incubated in fresh medium supplemented with 100 µM of either NBD-UDCA or unlabeled UDCA for 5, 15, and 30 min and 1 and 2 h. Competition studies were performed by pretreating cells with 500 µM unlabeled UDCA for 5 min, washing, and replacing the medium with 100 µM NBD-UDCA for 1 and 2 h. Attached cells were washed three times with PBS and fixed with 4% paraformaldehyde in PBS, pH 7.4, for 10 min at room temperature. After additional washes, samples were mounted using Fluoromount-G, and fluorescence was visualized using an Axioskop fluorescence microscope (Carl Zeiss GmbH, Jena, Germany). Nuclear localization of the NBD-UDCA molecule was confirmed by Hoechst counterstain.

Induction of Apoptosis
Cells were cultured as described above and then incubated with either 25 µM Aß(25–35) active fragment (Bachem AG, Bubendorf, Switzerland), or no addition (control) for 24 h, with or without UDCA or TUDCA (Sigma Chemical Co.). Aß(1–40) (Bachem AG) at 10 µM was also tested in a subset of experiments. In coincubation studies, cells were pretreated with 100 µM of either UDCA or TUDCA for 12 h before incubation with Aß peptides. Although these bile acid concentrations are greater than physiological levels, they can be achieved after exogenous administration (11). In parallel competition experiments, cells were pretreated with 10 µM of corticosterone (Sigma Chemical Co.), with or without bile acids, 12 h before incubation with Aß peptides. Attached and floating cells were combined to extract cytosolic, nuclear, and total proteins for caspase activity assays, as well as immunoblot and immunoprecipitation analysis. In parallel experiments, cells were also fixed for morphological examination.

Morphological Evaluation of Apoptosis and Caspase Activation
Hoechst labeling of cells was used to detect apoptotic nuclei (9). General caspase-3-like activity was determined by enzymatic cleavage of chromophore p-nitroanilide (pNA) from the substrate N-acetyl-Asp-Glu-Val-Asp-pNA (DEVD-pNA; Sigma Chemical Co.) in cytosolic protein extracts (Complete; Roche Applied Science, Mannheim, Germany) (9). Caspase-3 activation was confirmed by cleavage of PARP, a specific caspase-3 endogenous substrate, in total protein extracts using immunoblot analysis.

Transfections with siRNAs and GFP-MR Chimeric Proteins
siRNA sequences targeting mr (GenBank Accession no. M36074) and gr (GenBank accession no. NM012576) mRNA corresponded to the coding regions 523–543 (GGCGCTGGAGTCAAGTGTCTC) and 129–149 (GGCCAAGGGAGGGGGAGCGTA), respectively. The location of targeting sequences was 51 and 50 nucleotides downstream, relative to the first nucleotide of the start codon for mr and gr, respectively. The 23-nucleotide double-stranded RNAs were prepared by annealing both forward and reverse sequences of MR and GR targeting regions; mr forward 5'-rGrGrCrGrCrUrGrGrArGrUrCrArArGrUrGrUrCrUrCTT-3'; mr reverse 5'-rGrArGrArCrArCrUrUrGrArCrUrCrCrArGrCrGrCrCTT-3'; gr forward 5'-rGrGrCrCrArArGrGrGrArGrGrGrGrGrArGrCrGrUrATT-3'; and gr reverse 5'-rUrArCrGrCrUrCrCrCrCrCrUrCrCrCrUrUrGrGrCrCTT-3'. A nonspecific duplex was used as control (5'-rCrArGrUrGrGrArGrArUrCrArArCrGrUrGrCrArArGUU-3'), which did not significantly affect MR and GR protein levels relative to the untransfected controls. Twelve hours after plating, primary rat cortical neurons at 40% confluence were transfected with approximately 6 µg of siRNA using JetSI Transfection Reagent for siRNA (Polyplus-Transfection, Illkirch, France), according to the manufacturer’s instructions. To assess gene silencing, protein levels of MR and GR were determined by immunoblotting. In addition, PC12 cells were transiently transfected with the expression plasmids for the chimeric proteins of GFP and human MR, including the Wt form, GFP-MR Wt, and a carboxy terminus-deleted form of MR LBD, GFP-MR(1–840). GFP-MR Wt gene expression was under cytomegalovirus-IEP T7 enhancer/promoter control (55, 56). To generate the chimeric plasmid GFP-MR(1–840), the insert hMR-GFP was removed from the pCMX vector and digested with BfrBI and PmlI to delete the carboxy terminus of MR LBD (amino acids 840–990). Upon ligation of the insert, the fragment was recloned into HindIII and XhoI sites of the pCMX original vector. For transfection assays, PC12 cells were washed with PBS to remove dead cells and incubated in RPMI-1640 medium supplemented with 1% heat-inactivated horse serum. At 24 h after plating, cells at approximately 40% confluence were transfected with 5 µg of each construct using Lipofectamine 2000 (Invitrogen), according to the manufacture’s instructions.

Immunoblotting
Steady-state levels of MR, GR, GFP, and hsp90 proteins, as well as NSR distribution and PARP cleavage, were determined by Western blot, using primary rabbit polyclonal antibodies reactive to MR, GR, hsp90, and PARP (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or primary mouse monoclonal antibody to GFP (BD Biosciences, Palo Alto, CA), as well as secondary antibodies conjugated with horseradish peroxidase (Bio-Rad Laboratories, Hercules, CA). Membranes were processed for protein detection using Super Signal substrate (Pierce Chemical Co., Rockford, IL). ß-Actin was used as a loading control. Protein concentrations were determined using the Bio-Rad protein assay kit according to the manufacturer’s specifications.

Immunoprecipitation
Binding of MR to hsp90 was detected by immunoprecipitation analysis. In brief, whole-cell extracts were prepared by lysing cells in M-PER (Mammalian Protein Extraction Reagent) (Pierce). Immunoprecipitation experiments were carried out using the antibody to hsp90 and the Ezview Red Protein G Affinity Gel (Sigma Chemical Co.). Typically, 200 µg of lysate was incubated with 1 µg of primary mouse monoclonal antibody to hsp90 overnight at 4 C. Immunoblots were then probed with the rabbit polyclonal MR antibody. Hsp90 expression was determined in the same membrane after stripping off the immune complex for the detection of MR. In parallel, 20 µg of whole-cell extract was independently used for immunodetection of MR and hsp90. Immunoprecipitation assays using high-detergent conditions as well as Western blot analysis showed absence of nonspecific binding of the hsp90 antibody to MR. In addition, immunoprecipitation assays using the mouse monoclonal antibody reactive to GFP were performed to confirm the results obtained with the MR antibody. Finally, immunoprecipitation assays using the mouse monoclonal antibody reactive to ß-actin showed no detectable association with either hsp90 or MR.

Subcellular Localization of GFP Fusion Proteins
Analysis of intracellular trafficking of GFP-MR in cells was performed by using PC12 cells transiently transfected with chimeric proteins GFP-MR Wt or GFP-MR(1–840). For detection of GFP fluorescence, transfected cells were incubated at 30 C for 4 h, fixed with 4% paraformaldehyde in PBS, pH 7.4, at room temperature for 10 min, washed, and mounted using Fluoromount-G. Fluorescence was visualized using an Axioskop fluorescence microscope (Carl Zeiss GmbH). Nuclear localization of the GFP-MR molecule was confirmed by Hoechst counterstain.

Transactivation of NSRs
Transactivation of NSRs was investigated by cotransfecting PC12 cells with a GR/MR-responsive reporter plasmid, pGRE/MRE-luciferase, and the Wt human MR (pRShMR) or GR (pRShGR). The pGRE/MRE plasmid consisted of the entire human GR/MR-responsive promoter fused to the luciferase gene (57); pRShMR and pRShGR overexpression plasmids were placed under simian virus 40 enhancer/promoter control (55). Twelve hours after plating, cells at approximately 40% confluence were transfected with 3 µg of pGRE/MRE-luciferase plasmid and 10 ng of the receptor expression plasmids, pRShMR or pRShGR. For normalization, cells were cotransfected with the chloramphenicol acetyltransferase (CAT) reporter construct, PGL3-Control vector (Promega Corp., Madison, WI). Transfection efficiencies of approximately 70% were determined in cortical neurons using a reporter plasmid expressing ß-galactosidase and did not differ between reporter and expression plasmids (data not shown). The cells were harvested for luciferase assays (Promega Corp.) and CAT ELISA (Roche Applied Science, Indianapolis, IN), according to the manufacturer’s recommendation.

Densitometry and Statistical Analysis
The relative intensities of protein bands were analyzed using the ImageMaster 1D Elite densitometric analysis program (Amersham Biosciences, Piscataway, NJ). Statistical analysis was performed using GraphPad InStat version 3.00 for Windows 95 (GraphPad Software, San Diego, CA) for the ANOVA and Bonferroni’s multiple comparison tests. Values of P < 0.05 were considered statistically significant.


    ACKNOWLEDGMENTS
 
We thank Dr. Alan F. Hoffman, University of California, San Diego, CA, for the generous gift of NBD-UDCA and Dr. Hirotoshi Tanaka, University of Tokyo, Tokyo, Japan, for providing the pGRE/MRE reporter plasmid, as well as the pRShMR, pRShGR, and GFP-MR Wt overexpression plasmids. We are also deeply grateful to Dr. Elsa Rodrigues, University of Lisbon, Lisbon, Portugal, for her help with the construction of the carboxy terminus-deleted form of MR LBD overexpression plasmid, GFP-MR(1-840).


    FOOTNOTES
 
This work was supported by POCTI/BCI/44929/2002 from Fundação para a Ciência e a Tecnologia, and L-V-595/2004 from Fundação Luso-Americana, Lisbon, Portugal (to C.M.P.R.). S.S. was the recipient of postdoctoral fellowship (SFRH/BPD/20834/2004). J.D.A., P.M.B., R.M.R. and R.E.C. were recipients of Ph.D. fellowships (BD/17799/2004, BD/24165/2005, BD/12641/2003, and BD/12655/2003, respectively) from Fundação para a Ciência e a Tecnologia.

Disclosure of potential conflicts of interest: S.S., J.D.A., P.M.B., R.M.R., R.E.C., M.M.A., C.J.S., and C.M.P.R. have nothing to declare.

First Published Online May 25, 2006

Abbreviations: Aß, Amyloid ß-peptide; AD, Alzheimer’s disease; CAT, chloramphenicol acetyltransferase; DEVD, N-acetyl-Asp-Glu-Val-Asp; GFP, green fluorescent protein; GR, glucocorticoid receptor; GRE, glucocorticoid response element; hsp90, heat shock protein 90; LBD, ligand binding domain; MR, mineralocorticoid receptor; MRE, mineralocorticoid response element; NBD, nitrobenzoxadiazolyl; NSR, nuclear steroid receptor; PARP, poly(ADP-ribose) polymerase; pNA, p-nitroanilide; siRNA, small interfering RNA; TUDCA, tauroursodeoxycholic acid; UDCA, ursodeoxycholic acid; Wt, wild type.

Received for publication February 6, 2006. Accepted for publication May 10, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Selkoe DJ 2001 Alzheimer’s disease: genes, proteins, and therapy. Physiol Rev 81:741–766[Abstract/Free Full Text]
  2. Haass C, Selkoe DJ 1993 Cellular processing of ß-amyloid precursor protein and the genesis of amyloid ß-peptide. Cell 75:1039–1042[CrossRef][Medline]
  3. Culmsee C, Zhu X, Yu QS, Chan SL, Camandola S, Guo Z, Greig NH, Mattson MP 2001 A synthetic inhibitor of p53 protects neurons against death induced by ischemic and excitotoxic insults, and amyloid ß-peptide. J Neurochem 77:220–228[Medline]
  4. Yao M, Nguyen TV, Pike CJ 2005 ß-Amyloid-induced neuronal apoptosis involves c-Jun N-terminal kinase-dependent downregulation of Bcl-w. J Neurosci 25:1149–1158[Abstract/Free Full Text]
  5. Watson K, Fan GH 2005 Macrophage inflammatory protein 2 inhibits ß-amyloid peptide (1–42)-mediated hippocampal neuronal apoptosis through activation of mitogen-activated protein kinase and phosphatidylinositol 3-kinase signaling pathways. Mol Pharmacol 67:757–765[Abstract/Free Full Text]
  6. Rodrigues CMP, Fan G, Ma X, Kren BT, Steer CJ 1998 A novel role for ursodeoxycholic acid in inhibiting apoptosis by modulating mitochondrial membrane perturbation. J Clin Invest 101:2790–2799[Medline]
  7. Rodrigues CMP, Stieers CL, Keene CD, Ma X, Kren BT, Low WC, Steer CJ 2000 Tauroursodeoxycholic acid partially prevents apoptosis induced by 3-nitropropionic acid: evidence for a mitochondrial pathway independent of the permeability transition. J Neurochem 75:2368–2379[CrossRef][Medline]
  8. Rodrigues CMP, Solá S, Brites D 2002 Bilirubin induces apoptosis via the mitochondrial pathway in developing rat brain neurons. Hepatology 35:1186–1195[CrossRef][Medline]
  9. Solá S, Ma X, Castro RE, Kren BT, Steer CJ, Rodrigues CMP 2003 Ursodeoxycholic acid modulates E2F-1 and p53 expression through a caspase-independent mechanism in transforming growth factor ß1-induced apoptosis of rat hepatocytes. J Biol Chem 278:48831–48838[Abstract/Free Full Text]
  10. Keene CD, Rodrigues CMP, Eich T, Linehan-Stieers C, Abt A, Kren BT, Steer CJ, Low WC 2001 A bile acid protects against motor and cognitive deficits and reduces striatal degeneration in the 3-nitropropionic acid model of Huntington’s disease. Exp Neurol 171:351–360[CrossRef][Medline]
  11. Keene CD, Rodrigues CMP, Eich T, Chhabra MS, Steer CJ, Low WC 2002 Tauroursodeoxycholic acid, a bile acid, is neuroprotective in a transgenic animal model of Huntington’s disease. Proc Natl Acad Sci USA 99:10671–10676[Abstract/Free Full Text]
  12. Rodrigues CMP, Spellman SR, Solá S, Grande AW, Linehan-Stieers C, Low WC, Steer CJ 2002 Neuroprotection by a bile acid in an acute stroke model in the rat. J Cereb Blood Flow Metab 22:463–471[Medline]
  13. Rodrigues CMP, Solá S, Nan Z, Castro RE, Ribeiro PS, Low WC, Steer CJ 2003 Tauroursodeoxycholic acid reduces apoptosis and protects against neurological injury after acute hemorrhagic stroke in rats. Proc Natl Acad Sci USA 100:6087–6092[Abstract/Free Full Text]
  14. Duan WM, Rodrigues CMP, Zhao LR, Steer CJ, Low WC 2002 Tauroursodeoxycholic acid improves the survival and function of nigral transplants in a rat model of Parkinson’s disease. Cell Transplant 11:195–205[Medline]
  15. Ved R, Saha S, Westlund B, Perier C, Burnam LG, Sluder A, Hoener M, Rodrigues CMP, Alfonso A, Steer C, Liu L, Przedborski S, Wolozin B 2005 Similar patterns of mitochondrial vulnerability and rescue induced by genetic modification of {alpha}-synuclein, parkin and DJ-1 in C. elegans. J Biol Chem 280:42655–42668[Abstract/Free Full Text]
  16. Solá S, Castro RE, Laires PA, Steer CJ, Rodrigues CMP 2003 Tauroursodeoxycholic acid prevents amyloid-ß peptide-induced neuronal death via a phosphatidylinositol 3-kinase-dependent signaling pathway. Mol Med 9:226–234[Medline]
  17. Ramalho RM, Ribeiro PS, Solá S, Castro RE, Steer CJ, Rodrigues CMP 2004 Inhibition of the E2F-1/p53/Bax pathway by tauroursodeoxycholic acid in amyloid ß-peptide-induced apoptosis of PC12 cells. J Neurochem 90:567–575[CrossRef][Medline]
  18. McCormick JA, Lyons V, Jacobson MD, Noble J, Diorio J, Nyirenda M, Weaver S, Ester W, Yau JL, Meaney MJ, Seckl JR, Chapman KE 2000 5'-Heterogeneity of glucocorticoid receptor messenger RNA is tissue specific: differential regulation of variant transcripts by early-life events. Mol Endocrinol 14:506–517[Abstract/Free Full Text]
  19. Bastian LS, Nordeen SK 1991 Concerted stimulation of transcription by glucocorticoid receptors and basal transcription factors: limited transcriptional synergism suggests mediation by coactivators/adaptors. Mol Endocrinol 5:619–627[Abstract/Free Full Text]
  20. Almeida OF, Conde GL, Crochemore C, Demeneix BA, Fischer D, Hassan AH, Meyer M, Holsboer F, Michaelidis TM 2000 Subtle shifts in the ratio between pro- and antiapoptotic molecules after activation of corticosteroid receptors decide neuronal fate. FASEB J 14:779–790[Abstract/Free Full Text]
  21. Crochemore C, Michaelidis TM, Fischer D, Loeffler JP, Almeida OF 2002 Enhancement of p53 activity and inhibition of neural cell proliferation by glucocorticoid receptor activation. FASEB J 16:761–770[Abstract/Free Full Text]
  22. Wang Z, Garabedian MJ 2003 Modulation of glucocorticoid receptor transcriptional activation, phosphorylation, and growth inhibition by p27Kip1. J Biol Chem 278:50897–50901[Abstract/Free Full Text]
  23. Wetzel DM, Bohn MC, Kazee AM, Hamill RW 1995 Glucocorticoid receptor mRNA in Alzheimer’s diseased hippocampus. Brain Res 679:72–81[CrossRef][Medline]
  24. Rasmuson S, Andrew R, Nasman B, Seckl JR, Walker BR, Olsson T 2001 Increased glucocorticoid production and altered cortisol metabolism in women with mild to moderate Alzheimer’s disease. Biol Psychiatry 49:547–552[CrossRef][Medline]
  25. Tsolakidou AF, Coulocheri SA, Trikkas G, Moutsatsou P 2004 Gene analysis of the glucocorticoid receptor {alpha} in Alzheimer’s disease. Clin Chim Acta 349:167–172[CrossRef][Medline]
  26. Behl C, Lezoualc’h F, Trapp T, Widmann M, Skutella T, Holsboer F 1997 Glucocorticoids enhance oxidative stress-induced cell death in hippocampal neurons in vitro. Endocrinology 138:101–106[Abstract/Free Full Text]
  27. Macleod MR, Johansson IM, Soderstrom I, Lai M, Gido G, Wieloch T, Seckl JR, Olsson T 2003 Mineralocorticoid receptor expression and increased survival following neuronal injury. Eur J Neurosci 17:1549–1555[CrossRef][Medline]
  28. Planey SL, Derfoul A, Steplewski A, Robertson NM, Litwack G 2002 Inhibition of glucocorticoid-induced apoptosis in 697 pre-B lymphocytes by the mineralocorticoid receptor N-terminal domain. J Biol Chem 277:42188–42196[Abstract/Free Full Text]
  29. Mendoza ME, Monte MJ, El-Mir MY, Badia MD, Marin JJ 2002 Changes in the pattern of bile acids in the nuclei of rat liver cells during hepatocarcinogenesis. Clin Sci (Lond) 102:143–150[Medline]
  30. Solá S, Amaral JD, Castro RE, Ramalho RM, Borralho PM, Kren BT, Tanaka H, Steer CJ, Rodrigues CMP 2005 Nuclear translocation of UDCA by the glucocorticoid receptor is required to reduce TGF-ß1-induced apoptosis in rat hepatocytes. Hepatology 42:925–934[CrossRef][Medline]
  31. Miura T, Ouchida R, Yoshikawa N, Okamoto K, Makino Y, Nakamura T, Morimoto C, Makino I, Tanaka H 2001 Functional modulation of the glucocorticoid receptor and suppression of NF-{kappa}B-dependent transcription by ursodeoxycholic acid. J Biol Chem 276:47371–47378[Abstract/Free Full Text]
  32. Solá S, Castro RE, Kren BT, Steer CJ, Rodrigues CMP 2004 Modulation of nuclear steroid receptors by ursodeoxycholic acid inhibits TGF-ß1-induced E2F-1/p53-mediated apoptosis of rat hepatocytes. Biochemistry 43:8429–8438[CrossRef][Medline]
  33. Pratt WB, Toft DO 1997 Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr Rev 18:306–360[Abstract/Free Full Text]
  34. Prima V, Depoix C, Masselot B, Formstecher P, Lefebvre P 2000 Alteration of the glucocorticoid receptor subcellular localization by non steroidal compounds. J Steroid Biochem Mol Biol 72:1–12[CrossRef][Medline]
  35. Bohen SP, Kralli A, Yamamoto KR 1995 Hold ’em and fold ’em: chaperones and signal transduction. Science 268:1303–1304[Free Full Text]
  36. Whitfield GK, Jurutka PW, Haussler CA, Haussler MR 1999 Steroid hormone receptors: evolution, ligands, and molecular basis of biologic function. J Cell Biochem Suppl 32–33:110–122
  37. Setchell KD, Rodrigues CMP, Clerici C, Solinas A, Morelli A, Gartung C, Boyer J 1997 Bile acid concentrations in human and rat liver tissue and in hepatocyte nuclei. Gastroenterology 112:226–235[CrossRef][Medline]
  38. Rodrigues CMP, Ma X, Linehan-Stieers C, Fan G, Kren BT, Steer CJ 1999 Ursodeoxycholic acid prevents cytochrome c release in apoptosis by inhibiting mitochondrial membrane depolarization and channel formation. Cell Death Differ 6:842–854[CrossRef][Medline]
  39. Rodrigues CMP, Solá S, Brito MA, Brondino CD, Brites D, Moura JJ 2001 Amyloid ß-peptide disrupts mitochondrial membrane lipid and protein structure: protective role of tauroursodeoxycholate. Biochem Biophys Res Commun 281:468–474[CrossRef][Medline]
  40. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM 1999 Bile acids: natural ligands for an orphan nuclear receptor. Science 284:1365–1368[Abstract/Free Full Text]
  41. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B 1999 Identification of a nuclear receptor for bile acids. Science 284:1362–1365[Abstract/Free Full Text]
  42. Wang H, Chen J, Hollister K, Sowers LC, Forman BM 1999 Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 3:543–553[Medline]
  43. Tanaka H, Makino Y, Miura T, Hirano F, Okamoto K, Komura K, Sato Y, Makino I 1996 Ligand-independent activation of the glucocorticoid receptor by ursodeoxycholic acid. Repression of IFN-{gamma}-induced MHC class II gene expression via a glucocorticoid receptor-dependent pathway. J Immunol 156:1601–1608[Abstract]
  44. Yamamoto M, Fukuda K, Miura N, Suzuki R, Kido T, Komatsu Y 1998 Inhibition by dexamethasone of transforming growth factor ß1-induced apoptosis in rat hepatoma cells: a possible association with Bcl-xL induction. Hepatology 27:959–966[CrossRef][Medline]
  45. Webster JC, Huber RM, Hanson RL, Collier PM, Haws TF, Mills JK, Burn TC, Allegretto EA 2002 Dexamethasone and tumor necrosis factor-{alpha} act together to induce the cellular inhibitor of apoptosis-2 gene and prevent apoptosis in a variety of cell types. Endocrinology 143:3866–3874[Abstract/Free Full Text]
  46. Rogerson FM, Dimopoulos N, Sluka P, Chu S, Curtis AJ, Fuller PJ 1999 Structural determinants of aldosterone binding selectivity in the mineralocorticoid receptor. J Biol Chem 274:36305–36311[Abstract/Free Full Text]
  47. Lim-Tio SS, Fuller PJ 1998 Intracellular signaling pathways confer specificity of transactivation by mineralocorticoid and glucocorticoid receptors. Endocrinology 139:1653–1661[Abstract/Free Full Text]
  48. Nishi M, Ogawa H, Ito T, Matsuda KI, Kawata M 2001 Dynamic changes in subcellular localization of mineralocorticoid receptor in living cells: in comparison with glucocorticoid receptor using dual-color labeling with green fluorescent protein spectral variants. Mol Endocrinol 15:1077–1092[Abstract/Free Full Text]
  49. Hellal-Levy C, Couette B, Fagart J, Souque A, Gomez-Sanchez C, Rafestin-Oblin M 1999 Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett 464:9–13[CrossRef][Medline]
  50. Stevens A, Garside H, Berry A, Waters C, White A, Ray D 2003 Dissociation of steroid receptor coactivator 1 and nuclear receptor corepressor recruitment to the human glucocorticoid receptor by modification of the ligand-receptor interface: the role of tyrosine 735. Mol Endocrinol 17:845–859[Abstract/Free Full Text]
  51. Hassan AH, von Rosenstiel P, Patchev VK, Holsboer F, Almeida OF 1996 Exacerbation of apoptosis in the dentate gyrus of the aged rat by dexamethasone and the protective role of corticosterone. Exp Neurol 140:43–52[CrossRef][Medline]
  52. Hassan AH, Patchev VK, von Rosenstiel P, Holsboer F, Almeida OF 1999 Plasticity of hippocampal corticosteroid receptors during aging in the rat. FASEB J 13:115–122[Abstract/Free Full Text]
  53. McCullers DL, Herman JP 1998 Mineralocorticoid receptors regulate bcl-2 and p53 mRNA expression in hippocampus. Neuroreport 9:3085–3089[Medline]
  54. Holzinger F, Schteingart CD, Ton-Nu HT, Eming SA, Monte MJ, Hagey LR, Hofmann AF 1997 Fluorescent bile acid derivatives: relationship between chemical structure and hepatic and intestinal transport in the rat. Hepatology 26:1263–1271[Medline]
  55. Yoshikawa N, Makino Y, Okamoto K, Morimoto C, Makino I, Tanaka H 2002 Distinct interaction of cortivazol with the ligand binding domain confers glucocorticoid receptor specificity: cortivazol is a specific ligand for the glucocorticoid receptor. J Biol Chem 277:5529–5540[Abstract/Free Full Text]
  56. Yoshikawa N, Yamamoto K, Shimizu N, Yamada S, Morimoto C, Tanaka H 2005 The distinct agonist properties of the phenylpyrazolosteroid cortivasol reveal interdomain communication within the glucocorticoid receptor. Mol Endocrinol 19:1110–1124[Abstract/Free Full Text]
  57. Makino Y, Yoshikawa N, Okamoto K, Hirota K, Yodoi J, Makino I, Tanaka H 1999 Direct association with thioredoxin allows redox regulation of glucocorticoid receptor function. J Biol Chem 274:3182–3188[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   GR  |  MR



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
J. D. Amaral, R. J. S. Viana, R. M. Ramalho, C. J. Steer, and C. M. P. Rodrigues
Bile acids: regulation of apoptosis by ursodeoxycholic acid
J. Lipid Res., September 1, 2009; 50(9): 1721 - 1734.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solá, S.
Right arrow Articles by Rodrigues, C. M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solá, S.
Right arrow Articles by Rodrigues, C. M. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals