help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0071
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
20/10/2369    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jankiewicz, M.
Right arrow Articles by Desrivières, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jankiewicz, M.
Right arrow Articles by Desrivières, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Molecular Endocrinology 20 (10): 2369-2381
Copyright © 2006 by The Endocrine Society

Mammalian Target of Rapamycin Regulates the Growth of Mammary Epithelial Cells through the Inhibitor of Deoxyribonucleic Acid Binding Id1 and Their Functional Differentiation through Id2

Marcin Jankiewicz, Bernd Groner and Sylvane Desrivières

Georg Speyer Haus, Institute for Biomedical Research, D-60596 Frankfurt am Main, Germany

Address all correspondence and requests for reprints to: Sylvane Desrivières, Georg Speyer Haus, Institute for Biomedical Research, Paul-Ehrlich-Strasse 42-44, D-60596 Frankfurt am Main, Germany. E-mail: Desrivieres{at}em.uni-frankfurt.de.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Organ development requires the integration of multiple extracellular signals to assure a proper balance between proliferation and differentiation and to achieve and maintain specialized functions. Considerable progress has been made in the study of hormones and growth factors and in the understanding of the regulated intracellular pathways and transcriptional events that contribute to mammogenesis. Cell culture experiments have pointed out crucial pathways and components, which were subsequently validated in vivo experiments. We found that the mammalian target of rapamycin (mTOR) pathway is essential for both growth and differentiation of mammary epithelial cells and that the action of mTOR is mediated through the induction of the helix-loop-helix transcriptional regulators Id1 and Id2. Pharmacological inhibition of mTOR activity in HC11 mammary epithelial cells reduced cellular proliferation and prevented the lactogenic hormone-induced expression of milk proteins. Treatment of female mice with rapamycin impaired mammary gland differentiation and milk protein synthesis. The effects of mTOR on proliferation and differentiation require the functions of the helix-loop-helix proteins Id1 and Id2. Rapamycin treatment of HC11 cells resulted in a suppression of Id1 expression and an inhibition of proliferation. This effect of rapamycin was reversed by the forced expression of Id1. Rapamycin also prevented the induction of Id2 by lactogenic hormones and milk protein gene expression. Expression of a Id2 transgene bypassed the requirement of mTOR activity for ß-casein induction. These data suggest that mTOR activity has distinguishable functions in the proliferative and the differentiated state of mammary epithelial cells: it is a prerequisite for proliferation through the induction of Id1 and for differentiation-specific gene expression through the induction of Id2. The relative strengths of these proliferation and differentiation signals reflected by the expression levels of the individual Id proteins are crucial to the functional life cycle of mammary epithelial cells and might be disturbed in tumorigenesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE MAMMARY GLAND is a most dynamic organ in which epithelial cells undergo sequential and distinct proliferation and differentiation steps during the puberty, pregnancy, lactation, and involution phases of mammals. Multiple signaling pathways have been identified, which contribute to the cellular phenotypes during the individual phases. Cytokine action, particularly the function of prolactin and the induction of Jak2 and Stat5, has been studied in great detail. It is obvious from the plethora of signaling molecules that are important for mammary gland differentiation that the Jak/Stat pathway has to be augmented by other components. We have directed our attention to the role of a serine/threonine kinase that regulates both cell growth and cell cycle progression and that is activated by nutrients and growth factors.

The target of rapamycin kinase (TOR) is a member of the phosphatidylinositol kinase-related protein kinase family (PIKK) family and can be found in yeast, fungi, plants, worms, flies, and mammals. It is an essential protein in eukaryotes and affects the regulation of such central cell fates as proliferation, differentiation, apoptosis, and transformation. It functions as a sensor for mitogen, energy, and nutrient levels (reviewed in Ref. 1). A part of its actions is mediated through the regulation of translation initiation. Phosphorylation and activation of the ribosomal protein S6 kinases (S6Ks) by mTOR leads to increased translation of mRNAs with a 5' TOP (terminal oligopyrimidine tract). These mRNAs largely encode components of the translation machinery, such as ribosomal proteins and elongation factors. In addition, mTOR-mediated phosphorylation of the eukaryotic translation initiation factor 4E-binding proteins (4E-BPs) releases the eukaryotic translation initiation factor 4E (eIF4E) from an inactive complex with 4E-BP1 and allows eIF4E to participate in the formation of the eIF4F complex. This complex is required for the translation of cap-dependent mRNAs encoding, e.g. Cyclin D1, ODC1, c-Myc, and HIF1{alpha}. Although most mRNAs possess a cap structure at their 5' end, it is believed that, upon mitogenic stimulation, the translation machinery preferentially translates a small number of mRNAs that drive progression through the cell cycle (2, 3).

Given the central role of mTOR in regulating translation, it is not surprising that dysregulation of TOR signaling has detrimental consequences for an organism. The bacterially derived drug rapamycin (also known as sirolimus) is a potent and specific inhibitor of mTOR. Treatment of cells with rapamycin results in reduced cell proliferation (4). Further demonstration of the requirement of mTOR for proliferation came from two recent studies showing early embryonic lethality of mTOR–/– mice, due to inability of embryonic stem cells to proliferate (5, 6). Pende et al. (7) showed that the absence of S6K1 and S6K2 profoundly impairs cell size and animal viability but does not affect proliferation, suggesting that the effect of mTOR on proliferation is mediated by regulation of eIF4E and cap-dependant translation.

The discovery that the tumor suppressor proteins tuberous sclerosis 1 and 2 and the Ras-homolog enriched in brain (Rheb) are upstream regulators of mTOR provided a link between the insulin/phosphatidylinositol 3-kinase (PI3K)/Akt pathway and the mTOR pathway (8, 9, 10). Mutations in upstream regulatory elements of the PI3K/Akt/mTOR pathway, causing an enhanced activity of mTOR, and overexpression of downstream effectors of mTOR, e.g. components of the translation initiation apparatus (eIF4E), can frequently be found in human tumors. Recent literature highlights the essential role for protein synthesis in cellular transformation (11, 12, 13, 14, 15, 16) and describes the therapeutic potential of selective inhibitors of the TOR pathway (11, 17). Direct involvement of the translation initiation machinery in suppressing apoptosis and promoting tumorigenesis of breast epithelial cells has recently been demonstrated (18).

We have investigated the function of mTOR during normal mammary gland development. Development of the mammary gland and sexual maturation of the organism comprises the embryonic, prepubertal, pubertal, pregnancy, lactation, and involution stages (19). During pregnancy, intense proliferation of mammary epithelial cells results in the formation of lobulo-alveoli composed of differentiated cells capable of responding to the stimulus of the lactogenic hormones and the synthesis of milk. In addition to prolactin, which activates the prolactin receptor, Jak2, and Stat5, multiple signaling components have been found to participate in these processes, among them the serine/theronine kinase Akt/PKB and the inhibitor of DNA binding protein Id2 (19). However, the molecular connections between many of these components are still ill defined. Here, we identify mTOR, a downstream effector of the PI3K/Akt pathway, as a central regulator of mammary gland function. It controls both proliferation and differentiation in the developing gland and exerts its function through the induction of the Id1 and Id2 transcriptional regulator proteins.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
mTOR Is Induced by Lactogenic Hormone Treatment of Mammary Epithelial Cells and Its Activity Is Required for Growth, Morphological and Functional Differentiation in Vitro
The molecular analysis of signal transduction events in mammary epithelial cells owes many important observations to an in vitro model system that recapitulates lactogenic hormone action. The mammary epithelial cell line HC11 has a normal, nontransformed morphology, and its most important feature is the retention of the ability to differentiate and respond to hormonal stimulation (20). Epidermal growth factor promotes the growth of these cells and causes the formation of predifferentiated cells, competent to respond to the lactogenic hormone stimulus with the synthesis of milk proteins (21, 22). The lactogenic hormones, insulin, glucocorticoids, and prolactin are able to induce the terminally differentiated phenotype, and the milk protein ß-casein has been used as a marker for this stage (23). We have analyzed these cells at three stages: undifferentiated, exponentially growing cells; the contact inhibited, dense, nonproliferative, predifferentiated cells; and the differentiated cells induced with lactogenic hormones.

Growth factor-induced activation of PI3K and Akt leads to increased activity of mTOR. This can be monitored through the detection of mTOR phosphorylation on Ser2448 (24, 25). To investigate whether mTOR activation is involved in the differentiation of mammary epithelial cells, we visualized its phosphorylation status during various stages of HC11 cells growth (Fig. 1Go). We observed low levels of Ser2448 phosphorylation in undifferentiated and predifferentiated cells (Fig. 1Go, lanes 1–5). A strong increase in Ser2448 phosphorylation of mTOR was associated with the lactogenic hormone induction of the cells (Fig. 1Go, lanes 6–9). The hormonal treatment also resulted in the induction of the milk protein ß-casein.


Figure 1
View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. mTOR Becomes Phosphorylated during the Lactogenic Hormone Induction of HC11 Cells

HC11 cells were left undifferentiated (G; lane 1), predifferentiated (competent; lanes 2–5), or induced to differentiate by stimulation with lactogenic hormones (lanes 6–9). Total proteins were isolated at the indicated time points and phosphorylation of mTOR was monitored by Western blotting using an anti-phospho-mTOR (Ser2448) antibody.

 
This correlation caused us to investigate whether mTOR induction might be functionally relevant in the differentiation of mammary epithelial cells. For this purpose, we analyzed the effects of the specific TOR inhibitor rapamycin on the ability of HC11 cells to differentiate in culture (Fig. 2Go). When HC11 cells are embedded into a three-dimensional matrix, like collagen I or Matrigel, and cultured in the presence of lactogenic hormones, they form branched structures reminiscent of the ductal morphology of the mammary gland in vivo. We analyzed the effect of rapamycin on the ability of HC11 cells to assemble into such structures and observed that rapamycin completely prevented their formation (Fig. 2AGo). Also, the cell number in the rapamycin-treated cultures was much reduced, indicating that rapamycin impeded proliferation of HC11 cells. We also measured the effects of rapamycin on the ability of HC11 cells to respond to lactogenic hormone treatment with the induction of ß-casein synthesis. ß-Casein is readily induced in cells cultured in the presence of the lactogenic hormones without rapamycin (Fig. 2Go, B and C, lane 3). Addition of rapamycin to the induction medium blocked ß-casein mRNA accumulation and protein expression (Fig. 2Go, B and C, lanes 4 and 6). The simultaneous addition of the lactogenic hormones and rapamycin to the cells largely reduced ß-casein mRNA accumulation (Fig. 2BGo, lane 4); prior addition of rapamycin to the hormonal induction totally prevented ß-casein mRNA accumulation (Fig. 2BGo, lane 6). These data show that mTOR activity is essential for the proliferation, and the morphological and the functional differentiation of mammary epithelial cells in vitro.


Figure 2
View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2. Rapamycin Blocks the Differentiation of HC11 Cells

A, Rapamycin inhibits morphological changes associated with differentiation of mammary epithelial cells in three-dimensional cultures. HC11 cells were seeded into collagen I or Matrigel and induced to differentiate by treatment with lactogenic hormones (dexamethasone, insulin, and prolactin), in the presence (+Rap) or absence (control) of 10 nM rapamycin. B and C, Rapamycin prevents expression of the milk protein ß-casein. HC11 cells were left undifferentiated (lane 1), predifferentiated (lane 2), or induced to differentiate (lanes 3–7) in the presence of 1 nM rapamycin (lanes 4 and 6) or with DMSO as control (lanes 5 and 7). Lanes 4 and 5, Drug was added just before induction of differentiation; lanes 6 and 7, drug was added 4 d before induction of differentiation. Expression of the differentiation marker ß-casein was assessed by RT-PCR (B) and Western blotting (C).

 
Inhibition of mTOR Impairs Mammary Gland Growth and Secretory Function
We explored the consequences of systemic mTOR inhibition in mice for mammary gland growth and milk protein synthesis. For this purpose, we injected rapamycin ip into 3-wk-old virgin mice. This did not affect formation and elongation of the mammary epithelium in these mice (data not shown), suggesting that mTOR does not exert its function at early stages of ductal development. We then investigated the effects of rapamycin in pregnant female mice. Rapamycin caused the death of the embryos when injected into females from d 10–19 of the analysis of the effects of rapamycin on the mammary gland during pregnancy (data not shown). Rapamycin-induced abortion of pregnancy precluded the analysis of the effects of rapamycin on the mammary gland during pregnancy. The effect of rapamycin on embryonic development is not unexpected, because the disruption of the mTOR gene has been shown to cause postimplantation lethality and interferes with embryonic stem cell development (5, 6, 26).

For this reason, we decided to treat animals with rapamycin in which the development of the embryos and the mammary glands had further progressed. Mice were treated with rapamycin for 12 d, starting at d 19 of gestation, just before parturition, before the mammary glands were collected. Pups were born and nursed by their mothers during the treatment period. The mammary glands from the rapamycin-treated mice appeared smaller, with less epithelial component, than that of control mice (Fig. 3AGo). We did not detect drastic effects of rapamycin on the alveolar compartment in the histological analysis of the whole glands. A more careful examination of paraffin-embedded sections of mammary glands harvested during lactation and stained with hematoxylin and eosin revealed that alveolar lumens of glands from rapamycin-treated animals were undersized, and the surrounding connective tissue that normally regresses in matured glands was still prominent. This is in contrast to vehicle-treated mice whose mammary glands were well developed with large, expanded alveoli due to accumulation of milk (Fig. 3BGo). The weight of these glands was reduced by 50% (Fig. 3CGo). Analysis of milk proteins showed a decreased production (Fig. 3DGo). This was reflected in a reduced growth rate of rate of the litters (data not shown). These data indicate that mTOR is required for proper secretory function of mammary epithelial cells during lactation.


Figure 3
View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. Inhibition of mTOR Impairs Terminal Differentiation of the Mammary Gland

Mice were injected daily with rapamycin (n = 3) or vehicle as a control (n = 3) for 12 d, starting at d 19 of gestation. Mammary glands of lactating mice (lactation d 10) were collected and analyzed. A, Thoracic glands (four) from vehicle- and rapamycin-treated animals were collected and photographed. Note evident milk secretion in glands from vehicle-treated mice (arrows) that is not detected in glands from rapamycin-treated animals. B, Paraffin wax-embedded sections from thoracic glands (four) harvested from control and rapamycin-treated mice during lactation and stained with hematoxylin and eosin. C, Reduced wet weight of frozen glands (fourth gland) harvested from lactating rapamycin-treated mice (+Rap) compared with vehicle-treated mice (control) (n = 3). D, Expression of ß-casein protein is reduced in glands of mice treated with rapamycin (+Rap). Proteins were extracted from individual frozen glands (four glands) harvested from control mice (n = 3) or rapamycin-treated mice (n = 3) and analyzed for expression of ß-casein by Western blotting.

 
Rapamycin Does Not Interfere with Jak2-Stat5 Signaling
We investigated the molecular events underlying the differentiation defects in rapamycin-treated mammary epithelial cells. Among the signaling pathways that drive proliferation and differentiation of the mammary epithelium, the Jak/Stat pathway induced by the prolactin receptor has been shown to be of central importance (27). Mouse models have been derived in which the activation of Stat5 by prolactin in the mammary gland is compromised. These animals have led to the conclusion that Stat5 controls proliferation and differentiation of mammary alveolar epithelium during pregnancy and lactation (28, 29, 30). Stat5 is also required for the maintenance of their differentiated functions (31) and influences the course of apoptosis during the involution stage (32).

Because both pathways, the Jak/Stat pathway and the PI3K/Akt-mTOR pathway, play essential roles in the process of mammary epithelial cell differentiation, it is not unreasonable to suspect that they might be functionally linked. To gauge a connection between these pathways, we analyzed the effects of rapamycin on Stat5 activation. For this purpose, HC11 cells were induced with the lactogenic hormones in the absence and the presence of rapamycin. Activation of Stat5 was visualized in immunoblots with a phosphotyrosine-specific Stat5 antibody (Fig. 4AGo). The time course of Stat5 activation was found to be indistinguishable in the absence and presence of rapamycin. We also investigated the induction of a Stat5-dependent reporter gene. This gene comprises the proximal promoter region of the ß-casein gene and a luciferase moiety. Differently from the endogenous ß-casein gene (Fig. 4CGo), the transfected reporter gene construct was inducible in the presence of rapamycin (Fig. 4BGo). These experiments clearly show that the tyrosine phosphorylation-mediated activation of Stat5 and its transcriptional transactivation function are not affected by the inhibition of mTOR and mTOR mediates its effects on mammary epithelial cell function independently of Stat5.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Effects of Rapamycin on Stat5 Signaling

A, HC11 cells were cultured in the presence (+Rap) or absence (control) of rapamycin and stimulated with lactogenic hormones for the indicated times. Total proteins were isolated and tyrosine phosphorylation of Stat5 was monitored by Western blot using specific antibodies. B and C, Rapamycin does not prevent transactivation of ß-casein promoter by lactogenic hormones. HC11 cells stably expressing a ß-casein luciferase reporter construct were cultured in the presence (Rap) or absence (DMSO) of 1 nM rapamycin and stimulated with lactogenic hormones (DIP). Cell extracts were prepared and luciferase activities determined in triplicate (B), and RNA was extracted and expression of endogenous ß-casein mRNA quantitated by real time RT-PCR (C).

 
Rapamycin Inhibits Proliferation and Differentiation of Mammary Epithelial Cells by Interference with the Expression of the Transcriptional Regulators Id1 and Id2
A third set of regulatory signaling molecules whose function is mandatory for the proper maturation of mammary glands during pregnancy are the inhibitors of DNA binding Id proteins. Id proteins function as dominant-negative regulators of basic helix-loop-helix transcription factors, which represent a very large family of transcription factors. These transcription factors coordinate essential processes of life like embryogenesis and cell lineage determination. We decided to investigate two members of the Id family, Id1 and Id2, for a possible connection to the action of mTOR. Id1 has been found to be expressed at high levels in proliferating mammary epithelial cells in vitro and in vivo, and its expression was seen to decline in quiescent and differentiating cells. Id2 also plays a role in mammary cell development; Id2-deficient mice are not able to form lobular alveoli and exhibit severe lactation defects (33). Ectopic expression of Id2 in cultured mammary epithelial cells was found to accelerate differentiation and milk protein production, down-regulation of Id2 blocked differentiation (34).

We examined the relationship between mTOR induction during lactogenic hormone treatment of HC11 cells and Id2 expression. For this purpose, HC11 cells were induced with the lactogenic hormones in the absence and presence of rapamycin and Id2 mRNA was measured. Rapamycin blocked the induction of Id2 mRNA and protein in HC11 cells by the lactogenic hormones nearly completely (Fig. 5Go, A and C). Observations confirming the suppressive effect of mTOR inhibition on Id2 expression were made in mammary gland tissues of rapamycin-treated mice (Fig. 5DGo). These results suggest that mTOR activity is required for Id2 expression in differentiated mammary epithelial cells.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. Rapamycin Suppresses the Induction of Id1, Id2, and ß-Casein mRNA

A, HC11 cells were maintained in a proliferating state (G), predifferentiated (C), or induced for 16 h with lactogenic hormones (DIP) in presence (+Rap) or absence of 10 nM rapamycin, and Id1, Id2, and ß-casein mRNAs were quantitated by real-time RT-PCR. B, Proliferating HC11 cells were treated for 24 h with 10 nM rapamycin, with equivalent dilution of the vehicle (DMSO) or left untreated and expression of Id1 protein by Western blotting. C, HC11 cells were induced for 16 h with lactogenic hormones in presence (Rap) or absence of 10 nM rapamycin, and Id2 protein levels were analyzed by Western blotting. D, Id1, Id2, and ß-casein mRNA levels were determined in mammary glands of lactating mice (lactation d 10). The mice were injected with rapamycin (+Rap) or vehicle (control) for 12 d starting 19 d postcoitum before collection of the glands. RNAs were extracted and mRNA expression was determined by real-time quantitative RT-PCR. Expression level of each mRNA was compared, and samples with the lowest levels were taken as reference.

 
Proliferating mammary epithelial cells express Id1. It stimulates proliferation, prevents differentiation (35), and supports invasive behavior (36) of the cells. Coordinated regulation of Id1 and Id2 levels is crucial for normal mammary gland development, and a model in which Id1 could be an inhibitor of Id2 expression has been proposed (34, 37). We have also observed counteracting effects of the expression of Id1 on Id2 in the developing mammary gland and in HC11 cells (data not shown). We observed that Id1 mRNA levels increase slightly during early pregnancy, strongly decrease later during pregnancy and lactation, and increase again in the involuting gland. Conversely, Id2 mRNA levels show a strong and progressive increase during pregnancy and lactation and decrease during involution. In HC11 cells, Id1 expression was high in cells maintained under proliferative conditions (growing cells) and decreased in confluent cultures (competent cells). Stimulation of the cells with lactogenic hormones induced a rapid and transient increase of Id1 mRNA, reaching a maximum 1 h after stimulation. Id2 expression inversely correlated with that of Id1, increasing in confluent cells and remaining high in differentiated cells.

We tested the effect of mTOR activity on the expression levels of the Id1 and found that rapamycin treatment results in reduced Id1 expression in HC11 cells (Fig. 5Go, A and B) and in mammary glands of treated mice (Fig. 5DGo). This reduction also slowed cell growth (Fig. 6CGo). Our results show that mTOR controls both the expression of the Id1 and Id2 proteins.


Figure 6
View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6. Overexpression of Id Proteins Counteracts the Effects of Rapamycin Treatment

A, Expression of Id1 and Id2 in lentivirally transduced HC11 cells. B, HC11 cells transduced with Id1-encoding vector express high levels of Id1 protein and are resistant against the down-regulating effect of rapamycin on Id1 protein expression. This enforced expression of Id1 stimulates proliferation of HC11 cells (C) even in the presence of rapamycin. D, Overexpression of Id1 prevents expression of Id2 and induction of ß-casein by lactogenic hormones, whereas overexpression of Id2 allows ß-casein expression in the presence of rapamycin.

 
Ectopic Expression of Id1 and Id2 Overrides the Detrimental Effects of mTOR Inhibition on Mammary Epithelial Cell Growth and Functional Differentiation
Our results show that rapamycin treatment regulates the expression levels of two transcriptional repressors that are important for mammary cell proliferation, Id1, or functional differentiation, Id2. An interesting interpretation, that Id1 and Id2 directly mediate the effects of mTOR on proliferation and differentiation, can be tested experimentally. If Id1 and Id2 are downstream effectors of mTOR, forced expression of these proteins should counteract the rapamycin-induced phenotypes on mammary epithelial cells.

For this purpose, we transduced HC11 cells with Id1 or Id2 encoding lentiviral gene transfer vectors. The transduction efficiency with these vectors is very high and approaches 100% (data not shown). The expression levels of Id1 and Id2 in the respective, transduced cell populations are markedly enhanced (Fig. 6AGo). Introduction of Id1-expressing vector made HC11 cells resistant against the down-regulating effect of rapamycin on Id1 protein expression (Fig. 6BGo). The growth kinetics of HC11 cells ectopically expressing Id1 were compared with untransduced cells in the absence and presence of rapamycin. The Id1-overexpressing cells grew faster than the control cells and were completely resistant to the growth-inhibitory effect of rapamycin (Fig. 6CGo). This indicates that Id1 is a major downstream target of mTOR and mediates its effects on proliferation. Interestingly, overexpression of Id1 totally blocked lactogenic hormone-induced expression of Id2 and ß-casein (Fig. 6DGo). This indicates that Id1 promotes proliferation, but at the same time prevents differentiation by inhibiting expression of the differentiation-promoting Id2 protein.

We also derived HC11 cells overexpressing Id2 (Fig. 6AGo, lower panel). When these cells were exposed to lactogenic hormones in the presence of rapamycin, the induction of ß-casein synthesis could be observed (Fig. 6DGo). Id2 expression in HC11 cells was able to partially restore the responsiveness to the lactogenic hormones in the rapamycin-treated cells. These experiments indicate that mTOR controls differentiation of mammary epithelial cells via the induction of Id2 expression. We propose that mTOR controls the transition from proliferation to differentiation. It regulates the expression of Id1 mainly responsible for proliferation and induces differentiation by regulating expression of Id2.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have carried out experiments in which the serine/threonine kinase mTOR has been inhibited with rapamycin in mammary epithelial cells, and the consequences for cell growth and morphological and functional differentiation have been observed. These experiments have identified mTOR as an essential regulator of the mammary gland that controls both proliferation and differentiation events in this organ. mTOR is strongly activated in differentiating mammary epithelial cells. Inhibition of mTOR prevented proliferation and the lactogenic hormone-induced expression of milk proteins in cultured cells. Treatment of female mice with rapamycin during lactation impaired milk protein production. The reduced proliferation observed after treatment of mammary epithelial cells with rapamycin was due to decreased expression of the helix-loop-helix protein Id1. Overexpression of this protein completely reversed the inhibition of proliferation in rapamycin-treated cells. Moreover, we demonstrated that, in addition to promoting proliferation, Id1 prevents differentiation by inhibiting expression of the Id2 protein. mTOR inhibition in differentiating cells also results in the inhibition of Id2 expression and prevents the lactogenic hormone induction of the ß-casein protein. Ectopic expression of Id2 bypassed the requirement of mTOR for ß-casein expression. Our results demonstrate a central role for mTOR in the integration of proliferation and differentiation signals in the developing mammary gland and identify Id1 and Id2 as downstream mediators of mTOR.

A model based on our observations and describing mTOR signaling via Id1 and Id2 is depicted in Fig. 7Go. Insulin and other growth factors induce mTOR activity. This leads to the differential induction of Id proteins. We propose that low activity of this pathway causes Id1 expression and induction of proliferation. The high activity of mTOR promotes Id2 expression and causes differentiation. Enhanced Id1 expression promotes proliferation and prevents differentiation by inhibiting Id2 expression. Because Id proteins are dominant-negative regulators of basic helix-loop-helix (bHLH) transcription factors, Id1 probably mediates these effects by counteracting the antiproliferative action of a bHLH protein (E1). Conversely, Id2 might promote differentiation by restraining the action of an inhibitor of differentiation (E2).


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. Model of the mTOR Signaling Pathway Promoting Proliferation and Differentiation by Controlling Expression Levels of the Id1 and Id2 Proteins

Low activity of this pathway is associated with Id1 expression and induction of proliferation, whereas increased activity promotes Id2 expression and differentiation. Id1 promotes proliferation and inhibits Id2 expression, presumably by counteracting the antiproliferative action of a basic helix-loop-helix protein (E1). Conversely, Id2 might promote differentiation by restraining the action of an inhibitor of differentiation (E2).

 
A number of observations that have been published recently support our model. Precise control of proliferation and differentiation is crucial for proper organ development. An important role for TOR has been assigned in controlling differentiation in Drosophila and in mammalian cells (38, 39). Our data show that this control can be exerted by the action of the mTOR pathway on Id protein expression. Different members of the Id family are induced at different times and fulfill opposite functions. This mechanism allows the organism to switch a proliferation program in favor of a differentiation program in response to developmental cues. A role for the insulin receptor/TOR pathway in temporal control of differentiation in Drosophila has recently been reported (39). It would be of interest to determine whether Drosophila Id-like proteins are involved in this process.

If mTOR is required for proliferation as well as for differentiation, it seems reasonable to ask what determines the outcome. We can suspect that the extent of mTOR activity varies depending on the differentiation stage of the cells. This is supported by our observation that phosphorylation of mTOR at Ser2448, a site known to be phosphorylated by Akt upon insulin stimulation (24, 25, 40, 41), drastically increases during late stages of differentiation. Furthermore, enforced activation of Akt disrupts acinar architecture of mammary epithelial cells in an mTOR-dependent manner (42). High or low activity might be a determinant of the regulation of downstream targets. Alternatively, distinct mTOR-containing complexes with different output signals (43) might be active at given stages of development. Formation and/or activity of those might be regulated by the differential expression of downstream effectors, for example of Id1 and Id2 in the developing mammary gland.

Rapamycin was initially characterized as an inhibitor of the G1 phase of the cell cycle (44, 45) and interfered with early embryonic development (26). For this reason, it is not surprising that rapamycin blocked cell proliferation in cell culture and had lethal effects on early embryos. The lactating mammary gland is well suited to study the in vivo role of mTOR in developmentally regulated metabolic switches. The gland is metabolically very active and requires glucose to satisfy the increased demands of energy for continuous production of milk. We observed robust phosphorylation of mTOR on Ser2448 in differentiating mammary epithelial cells, especially at late stages of differentiation. The importance of activation of the insulin/PI3K/Akt pathway in the functional differentiation of the mammary gland has been shown in genetic inhibition studies. Overexpression of active PTEN, a negative regulator of the pathway, in mammary epithelium causes a marked reduction in cell proliferation, an incomplete functional differentiation, and failure to lactate (46). Also, expression of constitutively activated Akt in the mammary glands of transgenic mice results in impaired lactation with excess lipid synthesis (47). Thus, in the mammary gland, exact temporal and measured activation of the PI3K/Akt/mTOR pathway is required for proper differentiation of the epithelial cells and milk production.

The effects of rapamycin on lactating mammary glands were reminiscent of the phenotypes of mice carrying a deletion of the transcription factor hypoxia inducible factor 1 (HIF1). Although these mice displayed normal alveolar development during pregnancy, milk production and lactation were impeded (48). Transcriptional activation by HIF1 requires the insulin/PI3K/TOR pathway (49, 50). It is reasonable to consider that effects of rapamycin in lactating mammary glands are due, at least partly, to inhibition of HIF1. Moreover, in neuroblastoma cell lines, Id2 has recently been shown to be transcriptionally induced by HIF1 in response to hypoxia (51). It is at least conceivable that the function of mTOR in the mammary gland during lactation is the induction of HIF1 protein expression, which in turn activates transcription of Id2. This would finally favor the secretory differentiation and milk production.

Id proteins (Id1 to Id4) are key regulators in a wide range of cellular and developmental processes. They sequester bHLH transcription factors and prevent their DNA binding. It is thought that Id proteins exert negative control on cell fate decisions and differentiation pathways initiated by bHLH factors (for review, see Refs. 37 and 52). Generally, Id proteins have been viewed as inhibitors of differentiation and positive regulators of cell proliferation and oncogenesis. This does not seem to be the case for Id2. Id2 was first considered an inhibitor of differentiation, because its expression was found to be down-regulated after induction of differentiation in several cell types (53). This was supported by the observation that Id2 promotes proliferation in the nervous system and the hematopoietic compartment by counteracting the actions of the retinoblastoma tumor suppressor proteins (54, 55). However, there is now increasing support for a role for Id2 as an activator of differentiation. In the mammary gland, expression of Id1 correlates with proliferation, whereas Id2 is induced as mammary epithelial cells lose their proliferative capacity and initiate differentiation (34). In addition, Id2-null mice fail to differentiate lobuloalveolar epithelial cells in the mammary gland during pregnancy, resulting in a lactation defect (33). They also showed differentiation defects in the intestinal epithelium (56) and developed intestinal tumors. This suggests a potential role for Id2 as a tumor suppressor and confirms an in vitro study showing a function of Id2 in the maintenance of the differentiated and noninvasive phenotype of breast cancer cells (57). Thus, at least in epithelial cells, Id2 is required for cellular differentiation. Although Id1 is mandatory for proliferation of the mammary epithelial cells in vitro (35), Id1-null mice do not have an apparent mammary gland phenotype. They are, however, defective in T cell migration (58). This suggests that Id proteins have redundant functions in vivo, as exemplified by the combined deletion of Id1 and Id3 (59). Our experiments suggest that Id1 and Id2 have opposing functions in the mammary gland; Id1 is required for proliferation and for the prevention of premature differentiation, whereas Id2 is needed for functional differentiation of the epithelial cells.

If mTOR is required for the regulation of Id1 and Id2 expression, how does it exert this control? In mammals, the only known function of TOR is to promote efficient protein synthesis by orchestrating the formation of active eIF3 preinitiation complexes (60). For this reason, it seems plausible that mTOR influences transcription of Id1 and Id2 indirectly. This could happen through the regulation of the translation of an mRNA encoding a critical protein that determines cell fate. A number of key regulatory proteins involved in proliferation and differentiation are regulated at the translational level. One such protein is the CCAAT/enhancer binding (C/EBPß). C/EBPß belongs to a family of basic leucine-zipper (bZIP) transcription factors involved in proliferation and differentiation in a number of cell and tissue types, including the mammary gland (reviewed in Ref. 61). Various C/EBPß isoforms arise by differential translation of a unique intronless mRNA, producing proteins that differ in their activity based on inclusion of the N-terminal transactivation domain. The ratio of activating and repressing isoforms is crucial for expression of targets genes (62) and is tightly regulated during development of the mammary gland (63) and during the progression of breast cancer (64, 65). We have carried out experiments in which we measured the levels of the truncated isoform of C/EBPß (LIP) as a function of time after lactogenic hormone induction of HC11 cells. We observed a rapid increase upon the induction of differentiation, reaching a maximum 1 h after lactogenic hormone stimulation and declining again 2 h after stimulation. Pretreatment of the cells with rapamycin blocked the induction of C/EBPß expression (data not shown). C/EBPß expression has been previously associated with cell proliferation and inhibition of differentiation. Therefore, control of the ratio of C/EBP isoforms by mTOR (66) might be a mechanism by which this protein regulates proliferation and differentiation (67, 68). Interestingly, C/EBPß-null mice do not undergo lobulo-alveolar development of the mammary gland during pregnancy (63, 69), a phenotype that resembles that of Id2-null mice (33). Evidence linking C/EBPß and Id2 was recently provided by Karaya et al. (70),who showed that Id2 is a direct target of C/EBPß. Alternative mechanisms have to be taken into consideration and experimentally tested. It is also possible that targets of mTOR for regulated expression of Id proteins might vary depending on development stage, and a potential target of the mTOR pathway in this process might be HIF1{alpha}.

In conclusion, we have identified a new regulatory mechanism by which mTOR modulates cell fate, namely by controlling the expression of Id proteins with opposing functions. The deregulation of individual Id protein expression levels leads to altered proliferation, differentiation, and invasiveness (52), events that contribute to cellular transformation. Our findings might have important implications for the study of breast cancer and the design of rational therapies.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
HC11 cells were maintained in RPMI 1640 medium containing 10% fetal calf serum, 5 µg/ml insulin, and 10 ng/ml epidermal growth factor, 2 mM [SCAP];l-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. To induce differentiation, the cells were first rendered competent for hormonal induction by cultivation in medium lacking insulin for 4 d after reaching confluency. Subsequently, the cells were incubated for up to 4 d in medium containing the lactogenic hormones dexamethasone (1 µM), insulin (5 µg/ml), and prolactin (5 µg/ml). Differentiation was monitored by measuring expression of the milk protein ß-casein (20, 71).

Growth of HC11 Cells in Matrigel and Collagen
Cultivation of HC11 cells in Matrigel and collagen I gels was performed as described previously (72). Cells were suspended in RPMI 10% FCS to a cell density of 4–6 x 104 cells/ml and mixed to an equal volume (100–200 µl) of rat-tail collagen I solution (BD Biosciences, Mountain View, CA) or Matrigel (BD Biosciences). One hundred microliters of the gel/cell suspension were dispensed as a drop into the center of a well and allowed to polymerize first for 10 min at room temperature, and then for 30 min at 37 C before addition of culture medium.

Rapamycin Treatment of Cells and Animals
Rapamycin (Calbiochem, La Jolla, CA) was dissolved in dimethylsulfoxide (DMSO) (1 mg/ml) and added to the culture medium to final concentrations of 1 nM or 10 nM. DMSO only was used in negative controls. For injections, pregnant NMRI female mice were treated daily for 12 d with 1.5 mg/kg of rapamycin (sirolimus; Wyeth, Collegeville, PA) starting at 19 d postcoitum. A stock solution of 4 mg/ml rapamycin was prepared and the drug was dissolved in N,N-dimethylacetamide, polysorbat 80, and polyethylenglycol 400 (2:1:7). Control animals were treated with carrier alone. All animal experimentation was conducted in accordance with accepted standards of humane animal care.

Histological Staining of Mammary Glands
Mammary glands (four) were spread on a glass slide and fixed in 10% formalin for 16 h, washed serially for 15 min in 70, 50, and 25% ethanol, and stained in hematoxylin solution overnight. Stained tissues were washed in 70 and 95% ethanol for 15 min each before embedding in paraffin for sectioning.

Western Blot Analysis
Cells were harvested in ice-cold lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40, and protease and phosphatase inhibitors]. Extracts were incubated for 15 min on ice, and cellular debris removed by centrifugation for 15 min at 12,000 x g. Protein concentrations were determined by the Bradford assay. Equal amounts of proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes. Blots were stained with Ponceau-S to visualize the loaded proteins, and immunodetection was performed using specific antibodies. Anti-TOR and anti-phospho TOR (Ser2448) antibodies were purchased from Cell Signaling Technology (Beverly, MA), anti-ß-tubulin from Sigma-Aldrich (St. Louis, MO), and anti-phospho Stat5 (Tyr694/699) from Upstate (Lake Placid, NY). Other antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA).

Preparation of RNA
Cells were washed twice with cold PBS before being directly extracted using the NucleoSpin RNAII kit (Macherey Nagel, Duren, Germany), following the manufacturer’s instructions. To prepare total RNA from tissues, snap-frozen tissue was pulverized with a mortar and pestle directly in liquid nitrogen and homogenized in chilled Trizol (Invitrogen, San Diego, CA), and RNA was prepared according to manufacturer’s instructions.

Reverse Transcription and PCR
RNA was reverse-transcribed using Superscript II reverse transcriptase (Invitrogen), following the manufacturer’s instructions. PCRs were performed with 5 µl of the cDNA diluted 1:5, 100 pmol of primers, 12.5 nmol dNTPs and 2.5 U AmpliTaq DNA polymerase (PerkinElmer, Wellesley, MA) in 50-µl reaction. Primers used for PCRs were as follows: ß-casein sense, ACTACATTTACTGTATCCTCTGA; ß-casein antisense, GTGCTACTTGCTGCAGAAAGTACAG; GAPDH sense, GTGAAGGTCGGTGTGAACGGATTTGGCCGT; GAPDH antisense, CCACCACCCTGTTGCTGTAG. Real-time quantitative PCR were performed in SYBR Green mix (Bio-Rad, Hercules, CA) using a iCycler (Bio-Rad). Primers used for real-time PCR were as follows: ß-casein sense, TCACTCCAGCATCCAGTCACA; ß-casein antisense, GGCCCAAGAGATGGCACCA; 18S sense, CGTTGGTGTGGGGAGTGAATGGTG; 18S antisense, GCGTGGGGGTTGGCGGAAAGAGAA; Id1 sense, TGGTCTGTCGGAGCAAAGC; Id1 antisense, GCAGCCGTTCATGTCGTAGAG; Id2 sense, ACTCGCATCCCACTATCGTCAGC; Id2 antisense, TGACCACCCTGAACACGGACAT. Target gene mRNA expression was first normalized to 18S rRNA, and then expressed as amount relative to the sample with lowest expression.

Cell Proliferation Assays
HC11 cells were seeded in 96-well plates, and relative viable cell numbers at various time points were quantified using the XTT-based proliferation kit II (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer’s protocol. This assay assesses cell viability, quantifying bioreduction of a tetrazolium compound by measuring absorbance at 490 nm. Triplicate measurements were performed for each time point.

Luciferase Assays
HC11 cells stably transfected with a ß-casein gene promoter (–344 to –1) luciferase reporter construct (27) were induced to differentiate by treatment with lactogenic hormones for 16 h before harvesting. Luciferase activity was determined in triplicate samples using the luciferase assay system as described previously (73). Total light emission was measured during the first 30 sec of the reaction using a luminometer (Microlumat; Berthold, Gaithersburg, MD). Activity was normalized to protein amount.

Lentiviral Gene Transfer Constructs
We used a HIV-1-derived self-inactivating lentiviral gene transfer construct, SiEW, similar to the enhanced green fluorescent protein (eGFP)-encoding vector pHR'SIN.cPPT-SEW (74), except that an IRES sequence was inserted 3' of the internal SFFV promoter. This allows the coexpression of a gene of interest and eGFP from the same promoter. Vectors for overexpression of Id1 or Id2 were created by inserting PCR fragments containing the open reading frames of Id1 or Id2 downstream of the SFFV promoter.

Lentiviral Gene Transduction
Vector DNA was transiently introduced into 293T cells by triple cotransfection (calcium phosphate coprecipitation) with the packaging construct pCMVR8.91 (75) and the pseudotyping construct pMD2.VSVG (76) coding for the vesicular stomatitis virus glycoprotein. Viral supernatants were collected and filtered. HC11 cells were transduced with virus supernatants in the presence of 8 µg/ml polybrene. After spinoculation (1250 x g, 30 min, 32 C), the cells were incubated for an additional 16 h at 37 C with the virus before the medium was changed. eGFP expression was analyzed by FACS analysis and fluorescence microscopy at various time points.


    ACKNOWLEDGMENTS
 
We thank Dr. Karsten Brinck (Wyeth Pharma GmbH, Münster, Germany) for the generous gift of rapamycin, Dr. Manuel Grez for the lentiviral vectors, and Dr. Stefan Stein and Hana Kunkel for help with virus production.


    FOOTNOTES
 
This work was supported by Deutsche Forschungsgemeinschaft Grant GR 536/9-1.

The authors have nothing to disclose.

First Published Online June 13, 2006

Abbreviations: bHLH, Basic helix-loop-helix; C/EBP, CCAAT/enhancer binding; DMSO, dimethylsulfoxide; eGFP, enhanced green fluorescent protein; eIF4E, eukaryotic translation initiation factor 4E; HIF1, hypoxia inducible factor 1; mTOR, mammalian target of rapamycin; PI3K, phosphatidylinositol 3-kinase; S6K, S6 kinase; TOR, target of rapamycin.

Received for publication February 10, 2006. Accepted for publication June 6, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Fingar DC, Blenis J 2004 Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 23:3151–3171[CrossRef][Medline]
  2. Barbet NC, Schneider U, Helliwell SB, Stansfield I, Tuite MF, Hall MN 1996 TOR controls translation initiation and early G1 progression in yeast. Mol Biol Cell 7:25–42[Abstract]
  3. Gingras AC, Raught B, Sonenberg N 2001 Regulation of translation initiation by FRAP/mTOR. Genes Dev 15:807–826[Free Full Text]
  4. Sehgal SN 2003 Sirolimus: its discovery, biological properties, and mechanism of action. Transplant Proc 35:7S–14S[CrossRef]
  5. Gangloff YG, Mueller M, Dann SG, Svoboda P, Sticker M, Spetz JF, Um SH, Brown EJ, Cereghini S, Thomas G, Kozma SC 2004 Disruption of the mouse mTOR gene leads to early postimplantation lethality and prohibits embryonic stem cell development. Mol Cell Biol 24:9508–9516[Abstract/Free Full Text]
  6. Murakami M, Ichisaka T, Maeda M, Oshiro N, Hara K, Edenhofer F, Kiyama H, Yonezawa K, Yamanaka S 2004 mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol Cell Biol 24:6710–6718[Abstract/Free Full Text]
  7. Pende M, Um SH, Mieulet V, Sticker M, Goss VL, Mestan J, Mueller M, Fumagalli S, Kozma SC, Thomas G 2004 S6K1–/–/S6K2–/– mice exhibit perinatal lethality and rapamycin-sensitive 5'-terminal oligopyrimidine mRNA translation and reveal a mitogen-activated protein kinase-dependent S6 kinase pathway. Mol Cell Biol 24:3112–3124[Abstract/Free Full Text]
  8. Gao X, Zhang Y, Arrazola P, Hino O, Kobayashi T, Yeung RS, Ru B, Pan D 2002 Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat Cell Biol 4:699–704[CrossRef][Medline]
  9. Inoki K, Li Y, Zhu T, Wu J, Guan KL 2002 TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4:648–657[CrossRef][Medline]
  10. Tee AR, Fingar DC, Manning BD, Kwiatkowski DJ, Cantley LC, Blenis J 2002 Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)-mediated downstream signaling. Proc Natl Acad Sci USA 99:13571–13576[Abstract/Free Full Text]
  11. Bjornsti MA, Houghton PJ 2004 Lost in translation: dysregulation of cap-dependent translation and cancer. Cancer Cell 5:519–523[CrossRef][Medline]
  12. Pandolfi PP 2004 Aberrant mRNA translation in cancer pathogenesis: an old concept revisited comes finally of age. Oncogene 23:3134–3137[CrossRef][Medline]
  13. Schmidt EV 2004 The role of c-myc in regulation of translation initiation. Oncogene 23:3217–3221[CrossRef][Medline]
  14. Bader AG, Vogt PK 2004 An essential role for protein synthesis in oncogenic cellular transformation. Oncogene 23:3145–3150[CrossRef][Medline]
  15. De Benedetti A, Graff JR 2004 eIF-4E expression and its role in malignancies and metastases. Oncogene 23:3189–3199[CrossRef][Medline]
  16. Rajasekhar VK, Holland EC 2004 Postgenomic global analysis of translational control induced by oncogenic signaling. Oncogene 23:3248–3264[CrossRef][Medline]
  17. Easton JB, Houghton PJ 2004 Therapeutic potential of target of rapamycin inhibitors. Expert Opin Ther Targets 8:551–564[CrossRef][Medline]
  18. Avdulov S, Li S, Michalek V, Burrichter D, Peterson M, Perlman DM, Manivel JC, Sonenberg N, Yee D, Bitterman PB, Polunovsky VA 2004 Activation of translation complex eIF4F is essential for the genesis and maintenance of the malignant phenotype in human mammary epithelial cells. Cancer Cell 5:553–563[CrossRef][Medline]
  19. Hennighausen L, Robinson GW 2005 Information networks in the mammary gland. Nat Rev Mol Cell Biol 6:715–725[CrossRef][Medline]
  20. Ball RK, Friis RR, Schoenenberger CA, Doppler W, Groner B 1988 Prolactin regulation of ß-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J 7:2089–2095[Medline]
  21. Hynes NE, Taverna D, Harwerth IM, Ciardiello F, Salomon DS, Yamamoto T, Groner B 1990 Epidermal growth factor receptor, but not c-erbB-2, activation prevents lactogenic hormone induction of the ß-casein gene in mouse mammary epithelial cells. Mol Cell Biol 10:4027–4034[Abstract/Free Full Text]
  22. Taverna D, Groner B, Hynes NE 1991 Epidermal growth factor receptor, platelet-derived growth factor receptor, and c-erbB-2 receptor activation all promote growth but have distinctive effects upon mouse mammary epithelial cell differentiation. Cell Growth Differ 2:145–154[Abstract]
  23. Doppler W, Hock W, Hofer P, Groner B, Ball RK 1990 Prolactin and glucocorticoid hormones control transcription of the ß-casein gene by kinetically distinct mechanisms. Mol Endocrinol 4:912–919[Abstract]
  24. Nave BT, Ouwens M, Withers DJ, Alessi DR, Shepherd PR 1999 Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J 344:427–431[CrossRef][Medline]
  25. Sekulic A, Hudson CC, Homme JL, Yin P, Otterness DM, Karnitz LM, Abraham RT 2000 A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res 60:3504–3513[Abstract/Free Full Text]
  26. Hentges KE, Sirry B, Gingeras AC, Sarbassov D, Sonenberg N, Sabatini D, Peterson AS 2001 FRAP/mTOR is required for proliferation and patterning during embryonic development in the mouse. Proc Natl Acad Sci USA 98:13796–13801[Abstract/Free Full Text]
  27. Gouilleux F, Wakao H, Mundt M, Groner B 1994 Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 13:4361–4369[Medline]
  28. Ormandy CJ, Binart N, Kelly PA 1997 Mammary gland development in prolactin receptor knockout mice. J Mammary Gland Biol Neoplasia 2:355–364[CrossRef][Medline]
  29. Shillingford JM, Miyoshi K, Robinson GW, Grimm SL, Rosen JM, Neubauer H, Pfeffer K, Hennighausen L 2002 Jak2 is an essential tyrosine kinase involved in pregnancy-mediated development of mammary secretory epithelium. Mol Endocrinol 16:563–570[Abstract/Free Full Text]
  30. Miyoshi K, Shillingford JM, Smith GH, Grimm SL, Wagner KU, Oka T, Rosen JM, Robinson GW, Hennighausen L 2001 Signal transducer and activator of transcription (Stat) 5 controls the proliferation and differentiation of mammary alveolar epithelium. J Cell Biol 155:531–542[Abstract/Free Full Text]
  31. Cui Y, Riedlinger G, Miyoshi K, Tang W, Li C, Deng CX, Robinson GW, Hennighausen L 2004 Inactivation of Stat5 in mouse mammary epithelium during pregnancy reveals distinct functions in cell proliferation, survival, and differentiation. Mol Cell Biol 24:8037–8047[Abstract/Free Full Text]
  32. Iavnilovitch E, Groner B, Barash I 2002 Overexpression and forced activation of stat5 in mammary gland of transgenic mice promotes cellular proliferation, enhances differentiation, and delays postlactational apoptosis. Mol Cancer Res 1:32–47[Abstract/Free Full Text]
  33. Mori S, Nishikawa SI, Yokota Y 2000 Lactation defect in mice lacking the helix-loop-helix inhibitor Id2. EMBO J 19:5772–5781[CrossRef][Medline]
  34. Parrinello S, Lin CQ, Murata K, Itahana Y, Singh J, Krtolica A, Campisi J, Desprez PY 2001 Id-1, ITF-2, and Id-2 comprise a network of helix-loop-helix proteins that regulate mammary epithelial cell proliferation, differentiation, and apoptosis. J Biol Chem 276:39213–39219[Abstract/Free Full Text]
  35. Desprez PY, Hara E, Bissell MJ, Campisi J 1995 Suppression of mammary epithelial cell differentiation by the helix-loop-helix protein Id-1. Mol Cell Biol 15:3398–3404[Abstract]
  36. Desprez PY, Lin CQ, Thomasset N, Sympson CJ, Bissell MJ, Campisi J 1998 A novel pathway for mammary epithelial cell invasion induced by the helix-loop-helix protein Id-1. Mol Cell Biol 18:4577–4588[Abstract/Free Full Text]
  37. Desprez PY, Sumida T, Coppe JP 2003 Helix-loop-helix proteins in mammary gland development and breast cancer. J Mammary Gland Biol Neoplasia 8:225–239[CrossRef][Medline]
  38. Raslova H, Baccini V, Loussaief L, Comba B, Larghero J, Debili N, Vainchenker W 2005 Mammalian target of rapamycin (mTOR) regulates both proliferation of megakaryocyte progenitors and late stages of megakaryocyte differentiation. Blood 107:2303–2310[Medline]
  39. Bateman JM, McNeill H 2004 Temporal control of differentiation by the insulin receptor/tor pathway in Drosophila. Cell 119:87–96[CrossRef][Medline]
  40. Scott PH, Brunn GJ, Kohn AD, Roth RA, Lawrence Jr JC 1998 Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling pathway. Proc Natl Acad Sci USA 95:7772–7777[Abstract/Free Full Text]
  41. Reynolds IV TH, Bodine SC, Lawrence Jr JC 2002 Control of Ser2448 phosphorylation in the mammalian target of rapamycin by insulin and skeletal muscle load. J Biol Chem 277:17657–17662[Abstract/Free Full Text]
  42. Debnath J, Walker SJ, Brugge JS 2003 Akt activation disrupts mammary acinar architecture and enhances proliferation in an mTOR-dependent manner. J Cell Biol 163:315–326[Abstract/Free Full Text]
  43. Martin DE, Hall MN 2005 The expanding TOR signaling network. Curr Opin Cell Biol 17:158–166[CrossRef][Medline]
  44. Morice WG, Brunn GJ, Wiederrecht G, Siekierka JJ, Abraham RT 1993 Rapamycin-induced inhibition of p34cdc2 kinase activation is associated with G1/S-phase growth arrest in T lymphocytes. J Biol Chem 268:3734–3738[Abstract/Free Full Text]
  45. Terada N, Lucas JJ, Szepesi A, Franklin RA, Domenico J, Gelfand EW 1993 Rapamycin blocks cell cycle progression of activated T cells prior to events characteristic of the middle to late G1 phase of the cycle. J Cell Physiol 154:7–15[CrossRef][Medline]
  46. Dupont J, Renou JP, Shani M, Hennighausen L, LeRoith D 2002 PTEN overexpression suppresses proliferation and differentiation and enhances apoptosis of the mouse mammary epithelium. J Clin Invest 110:815–825[CrossRef][Medline]
  47. Schwertfeger KL, McManaman JL, Palmer CA, Neville MC, Anderson SM 2003 Expression of constitutively activated Akt in the mammary gland leads to excess lipid synthesis during pregnancy and lactation. J Lipid Res 44:1100–1112[Abstract/Free Full Text]
  48. Seagroves TN, Hadsell D, McManaman J, Palmer C, Liao D, McNulty W, Welm B, Wagner KU, Neville M, Johnson RS 2003 HIF1{alpha} is a critical regulator of secretory differentiation and activation, but not vascular expansion, in the mouse mammary gland. Development 130:1713–1724[Abstract/Free Full Text]
  49. Treins C, Giorgetti-Peraldi S, Murdaca J, Semenza GL, Van Obberghen E 2002 Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J Biol Chem 277:27975–27981[Abstract/Free Full Text]
  50. Dekanty A, Lavista-Llanos S, Irisarri M, Oldham S, Wappner P 2005 The insulin-PI3K/TOR pathway induces a HIF-dependent transcriptional response in Drosophila by promoting nuclear localization of HIF-{alpha}/Sima. J Cell Sci 118:5431–5441[Abstract/Free Full Text]
  51. Lofstedt T, Jogi A, Sigvardsson M, Gradin K, Poellinger L, Pahlman S, Axelson H 2004 Induction of ID2 expression by hypoxia-inducible factor-1: a role in dedifferentiation of hypoxic neuroblastoma cells. J Biol Chem 279:39223–39231[Abstract/Free Full Text]
  52. Perk J, Iavarone A, Benezra R 2005 Id family of helix-loop-helix proteins in cancer. Nat Rev Cancer 5:603–614[CrossRef][Medline]
  53. Sun XH, Copeland NG, Jenkins NA, Baltimore D 1991 Id proteins Id1 and Id2 selectively inhibit DNA binding by one class of helix-loop-helix proteins. Mol Cell Biol 11:5603–5611[Abstract/Free Full Text]
  54. Lasorella A, Noseda M, Beyna M, Yokota Y, Iavarone A 2000 Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407:592–598[CrossRef][Medline]
  55. Iavarone A, King ER, Dai XM, Leone G, Stanley ER, Lasorella A 2004 Retinoblastoma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 432:1040–1045[CrossRef][Medline]
  56. Russell RG, Lasorella A, Dettin LE, Iavarone A 2004 Id2 drives differentiation and suppresses tumor formation in the intestinal epithelium. Cancer Res 64:7220–7225[Abstract/Free Full Text]
  57. Itahana Y, Singh J, Sumida T, Coppe JP, Parrinello S, Bennington JL, Desprez PY 2003 Role of id-2 in the maintenance of a differentiated and noninvasive phenotype in breast cancer cells. Cancer Res 63:7098–7105[Abstract/Free Full Text]
  58. Sikder H, Huso DL, Zhang H, Wang B, Ryu B, Hwang ST, Powell JD, Alani RM 2003 Disruption of Id1 reveals major differences in angiogenesis between transplanted and autochthonous tumors. Cancer Cell 4:291–299[CrossRef][Medline]
  59. Lyden D, Young AZ, Zagzag D, Yan W, Gerald W, O’Reilly R, Bader BL, Hynes RO, Zhuang Y, Manova K, Benezra R 1999 Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature 401:670–677[CrossRef][Medline]
  60. Holz MK, Ballif BA, Gygi SP, Blenis J 2005 mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 123:569–580[CrossRef][Medline]
  61. Grimm SL, Rosen JM 2003 The role of C/EBPß in mammary gland development and breast cancer. J Mammary Gland Biol Neoplasia 8:191–204[CrossRef][Medline]
  62. Descombes P, Schibler U 1991 A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67:569–579[CrossRef][Medline]
  63. Seagroves TN, Krnacik S, Raught B, Gay J, Burgess-Beusse B, Darlington GJ, Rosen JM 1998 C/EBPß, but not C/EBP{alpha}, is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes Dev 12:1917–1928[Abstract/Free Full Text]
  64. Raught B, Gingras AC, James A, Medina D, Sonenberg N, Rosen JM 1996 Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein ß isoform and up-regulation of the eukaryotic translation initiation factor 2{alpha} are correlated with neoplastic transformation of mammary epithelial cells. Cancer Res 56:4382–4386[Abstract/Free Full Text]
  65. Zahnow CA, Younes P, Laucirica R, Rosen JM 1997 Overexpression of C/EBPß-LIP, a naturally occurring, dominant-negative transcription factor, in human breast cancer. J Natl Cancer Inst 89:1887–1891[Abstract/Free Full Text]
  66. Calkhoven CF, Muller C, Leutz A 2000 Translational control of C/EBP{alpha} and C/EBPß isoform expression. Genes Dev 14:1920–1932[Abstract/Free Full Text]
  67. Jundt F, Raetzel N, Muller C, Calkhoven CF, Kley K, Mathas S, Lietz A, Leutz A, Dorken B 2005 A rapamycin derivative (everolimus) controls proliferation through down-regulation of truncated CCAAT enhancer binding protein ß and NF-{kappa}B activity in Hodgkin and anaplastic large cell lymphomas. Blood 106:1801–1807[Abstract/Free Full Text]
  68. Kim JE, Chen J 2004 regulation of peroxisome proliferator-activated receptor-{gamma} activity by mammalian target of rapamycin and amino acids in adipogenesis. Diabetes 53:2748–2756[Abstract/Free Full Text]
  69. Robinson GW, Johnson PF, Hennighausen L, Sterneck E 1998 The C/EBPß transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland. Genes Dev 12:1907–1916[Abstract/Free Full Text]
  70. Karaya K, Mori S, Kimoto H, Shima Y, Tsuji Y, Kurooka H, Akira S, Yokota Y 2005 Regulation of Id2 expression by CCAAT/enhancer binding protein ß. Nucleic Acids Res 33:1