help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0099
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
20/10/2584    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Molecular Endocrinology 20 (10): 2584-2590
Copyright © 2006 by The Endocrine Society

A Novel Hypothyroid Dwarfism Due to the Missense Mutation Arg479Cys of the Thyroid Peroxidase Gene in the Mouse

Shuji Takabayashi, Kazumi Umeki, Etsuko Yamamoto, Tohru Suzuki, Akihiko Okayama and Hideki Katoh

Institute for Experimental Animals (S.T., E.Y., H.K.), and Department of Parasitology (T.S.), Hamamatsu University School of Medicine, Hamamatsu, Shizuoka 431-3192, Japan; and Clinical Laboratory (K.U.), University of Miyazaki Hospital, and Department of Rheumatology, Infectious Diseases and Laboratory Medicine, Faculty of Medicine (A.O.), University of Miyazaki, Kihara 5200, Kiyotake, Miyazaki 889-1692, Japan

Address all correspondence and requests for reprints to: Hideki Katoh, Institute for Experimental Animals, Hamamatsu University School of Medicine, 1-20-1 Handayama, Hamamatsu, Shizuoka 431-3192, Japan. E-mail: Hideki-k{at}hama-med.ac.jp.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recently, we found a novel dwarf mutation in an ICR closed colony. This mutation was governed by a single autosomal recessive gene. In novel dwarf mice, plasma levels of the thyroid hormones, T3 and T4, were reduced; however, TSH was elevated. Their thyroid glands showed a diffuse goiter exhibiting colloid deficiency and abnormal follicle epithelium. The dwarfism was improved by adding thyroid hormone in the diet. Gene mapping revealed that the dwarf mutation was closely linked to the thyroid peroxidase (Tpo) gene on chromosome 12. Sequencing of the Tpo gene of the dwarf mice demonstrated a C to T substitution at position 1508 causing an amino acid change from arginine (Arg) to cysteine (Cys) at codon 479 (Arg479Cys). Western blotting revealed that TPO protein of the dwarf mice was detected in a microsomal fraction of thyroid tissue, but peroxidase activity was not detected. These findings suggested that the dwarf mutation caused a primary congenital hypothyroidism by TPO deficiency, resulting in a defect of thyroid hormone synthesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
MANY SPONTANEOUS MUTATIONS have been found in inbred strains derived from an ICR closed colony of mice (1, 2, 3). Recently, we found that a Jcl:ICR male mouse had an autosomal recessive mutation in our colony, because some of the backcross mice obtained using a DBA/2JJcl female mouse showed dwarfism. Dwarf mice were noticeably smaller than their normal littermates and showed primary congenital hypothyroidism (CH) with goiter.

Six autosomal recessive mutations related to dwarfism have been found in mice, e.g. dw [dwarf, chromosome 16, 43.5 centimorgans (cM)] (4, 5), df (chromosome 11, 25.0 cM) (6, 7), lit (little, chromosome 6, 26.0 cM) (8), hyt (hypothyroid, chromosome 12, 37.0 cM) (9), cog (congenital goiter, chromosome 15, 36.4 cM) (10), and grt (growth-retarded, chromosome 5, 59.0 cM) (11, 12). The dw and df mutations are a primary hypopituitarism, which does not produce prolactin, TSH, and GH (13, 14, 15). The lit mutation has a GH deficiency (16). In contrast, the hyt, cog, and grt mutations have primary CH, which show low thyroid hormone (T3 and T4) and elevated plasma TSH levels. Recently, Pax8–/– created using a homologous recombination technique showed congenital hypothyroidism (17).

In this study, we found a novel dwarf mutant mouse that has different characters from other dwarf mutations. We showed that the responsible gene in our novel dwarf mice was mapped on a position close to the thyroid peroxidase (Tpo) gene on chromosome 12 (18) and that sequence analysis demonstrated a missense mutation, Arg479Cys, of the Tpo gene. To date, dwarfisms caused by any mutation of the Tpo gene have not been reported in mice. The mouse dwarfism reported in this study is the first one to be discovered that is caused by Tpo gene mutation. We also showed hormone therapy improved phenotypes of the dwarfism.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Phenotype of Dwarf Mice
Typical phenotypes of adult dwarf mice were characterized by a short trunk and prominent forehead and eyes (Fig. 1Go). As shown in Fig. 2Go, dwarf mice (6.46 ± 0.36 g; n = 8) at 15 d after birth were significantly smaller than the normal littermates (8.95 ± 0.32 g; n = 6; P < 0.01). At 30 d after birth, dwarf mice (6.54 ± 0.25 g) were extremely small compared with the normal littermates (20.96 ± 0.68 g; P < 0.001). Their mean life span was approximately 3 months.


Figure 1
View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. A Dwarf (left) and a Normal (right) Mouse at 3 Months

The dwarf mouse is identified by the small body size. Eye opening of the dwarf mouse was delayed for a few days more than that (15 d old) of the normal mouse. Ossification activities in the digit joints of the dwarf mouse were lower than those of the normal.

 

Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Growth Curves of Dwarf, Normal, and Dwarf Mice with Thyroid Therapy

 
Bone and spleen, known as target organs of the thyroid hormone, were observed. As shown in Fig. 1Go, no ossification was observed in dwarf mice compared with normal. Also, spleens of dwarf mice at 3 months after birth were significantly smaller than those of normal mice (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Morphological, Hematological, and Endocrinological Values of the Normal and Dwarf Mice at 3 Months after Birth

 
Genetics and Chromosomal Mapping of the Dwarf Gene
Genetic crosses revealed that dwarfism was inherited in a Mendelian fashion as an autosomal recessive gene, because no dwarf mice were observed in F1 progeny. The ratio of dwarf and normal mice in the F2 generation was 24:74 (1:3). To identify the gene that causes dwarfism, linkage analysis was performed using 24 dwarf mice of the F2 generation. A significant linkage was observed between the dwarf gene and the microsatellite markers on the proximal region approximately 13 cM of chromosome 12. As shown in Fig. 3Go, no recombination between the dwarf gene and D12Mit136 marker close to the Tpo gene was observed.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Map Position of the Gene Responsible for a Novel Dwarfism on Chromosome 12

The number of recombinants between the responsible gene and the microsatellite markers observed in dwarf mice (n = 24) at the F2 generation is indicated.

 
Histology of the Thyroid Gland
Figure 4Go shows typical thyroid glands of 3-month-old dwarf (A1 and A2) and normal mice (B1 and B2). Thyroid glands of the dwarf mouse displayed hypertrophy and diffuse goiter (A1) compared with thyroid glands of the normal mouse (B1). Weights of the thyroid glands of dwarf and normal mice were 45.0 ± 6.8 mg (n = 4) and 15.0 ± 2.0 mg (n = 5), respectively.


Figure 4
View larger version (111K):
[in this window]
[in a new window]
 
Fig. 4. Thyroid Glands of Dwarf (A1 and A2) and Normal Mice (B1 and B2)

Enlarged thyroid glands due to a diffuse goiter were observed in the dwarf mice. The asterisks show colloids.

 
Thyroid follicles of the dwarf mouse showed diminished and disordered colloids, because of hyperproliferation and hypertrophy of the thyrofollicular cells (A2). No lymphoid infiltration was observed in the thyroid of the dwarf mouse.

Hematology and Endocrinology
Hematological data of dwarf and normal mice are shown in Table 1Go. Hematocrit values and the number of red blood cells of dwarf mice were significantly lower than those of normal mice.

Because dwarf mice showed a typical goiter, concentrations of three thyroid-related hormones (T3, T4, and TSH) in plasma were measured (Table 1Go). T3 and T4 were extremely reduced in dwarf mice. However, TSH of dwarf mice was approximately 20 times higher than that of normal mice. These results strongly suggested that TPO is an etiology of goitrous hypothyroidism.

TPO protein and TPO oxidation activity were measured by Western blotting and guaiacol assay, respectively. TPO protein was detected in the microsomal fraction of both mice (Fig. 5Go). TPO oxidation activity in the microsomal fraction of normal mice was detected, but that of dwarf mice was undetectable (Table 1Go).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Detection of TPO Protein in Thyroid Microsomal Fractions Using Western Blotting with Antihuman TPO Antibody

Lane 1, Positive control (Chinese hamster ovary-K1 cells transfected with human TPO cDNA); lane 2, the novel dwarf mouse; lane 3, control (normal mouse)

 
Sequencing of the Tpo Gene
The whole genomic Tpo gene length including 18 exons is approximately 150 kb. mRNA of the Tpo gene is 3281 bp long (19). In this study, Tpo cDNA of dwarf and normal mice was amplified by RT-PCR, and nucleotide sequences were compared. There was no difference in the lengths of their fragments. Therefore, this suggests that there are no gross changes of nucleotide sequence in the mutant allele such as insertion or deletion.

Sequence analyses revealed that the Tpo gene of the dwarf mouse has a nucleotide change from C to T at position 1508 in exon 9. This missense mutation leads to an amino acid exchange from Arg to Cys at amino acid residue 479 (Fig. 6Go, middle). The male ICR no. 8 mouse, which is the founder, was heterozygous for the Tpo gene (Fig. 6Go, right).


Figure 6
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Nucleotide Sequence (1502–1510) of the Tpo Gene in the Novel Dwarf Mouse, Normal Mice, and Their Founder (ICR no. 8)

Arrows in chromatograms show the nucleotide substitution of C to T at the codon.

 
Hormone Therapy in Dwarf Mice
Dwarf mice were given a thyroid powder-supplemented diet at 30 d after birth. After 1 wk, the body weight of dwarf mice was significantly increased, as shown in Fig. 2Go. Body weight of dwarf mice with the diet was 11.25 ± 0.06 g (n = 4), whereas that of untreated dwarf mice was significantly lower (7.03 ± 0.35 g, n = 3; P < 0.01). Body weights of untreated dwarf mice, treated dwarf mice, and normal mice, 30 d after the beginning of hormone therapy, were 10.73 ± 0.52 g (n = 4), 19.75 ± 0.06 g (n = 4), and 24.76 ± 0.35 g (n = 5), respectively. Improved dwarf mice showed normal fertility.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Flamant et al. (17) reported that Pax8–/minus] mice show congenital hypothyroid and that the development of bone, spleen, and brain, which are target organs of thyroid hormone, was not observed in these mice. We observed that our dwarf mice lacking T4 and T3 showed the same phenotypes in bone and spleen.

TPO is a member of the peroxidase superfamily and a key protein in the biosynthesis of thyroid hormone. TPO, which is located on the apical membrane surface of the thyroid follicular cell, mainly catalyzes tyrosine iodination and the coupling of iodotyrosine on trans-Golgi network to form T4 and T3 (20). TPO functions as a membrane enzyme containing a heme protein, which is essential for the catalytic site. Ambrugger et al. (21) reported that exon 9 of the TPO gene plays an important role for the proper structure and function of the TPO enzyme in humans. Many missense mutations of exon 9 have been reported in human CH patients (21, 22, 23). The first CH mouse, reported in this study, had a missense Arg479Cys mutation of the Tpo gene. In the peroxidase superfamily, the amino acid sequence from Arg 479 to His 482 is completely conserved. A substitution from Arg to Cys at 479 could lead to a change of tertiary structure of TPO that does not bind heme and does not have enzyme activity. Generally, Cys plays an important role in the tertiary structure of protein through a disulfide bond. The major extracellular portion of the TPO molecule corresponds to amino acid residues 1–745 in humans and 1–733 in mice. The sequence from 473Phe to 484Thr in mice is conserved in humans, rats, pigs, and dogs. The codon Arg479 in mice corresponds to the codon Arg491 in humans. In human CH patients, a missense mutation at codon 491 (Arg491His) has been reported (21), and mutations in the coding region of the TPO gene have been also described (24, 25, 26).

Primary CH in the human is a well-documented syndrome that is a common endocrine disease in neonates and leads to reduced growth and mental retardation. Newborn screening data in humans revealed that 1 in 4000 neonates has CH and 15–20% of CH patients show functional disorders in hormone synthesis (27). In human CH patients, thyroid hormone therapy is given to improve their disease symptoms. We attempted this therapy using dwarf mice. As a result, dwarf mice gained almost normal body weight (80% of normal mice) and sexual maturity. This mutant mouse could be useful for future studies such as gene therapy and thyrocyte transplantation that should be undertaken for improvement of a patient’s quality of life.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genetic Crosses and Gene Mapping
ICR, DBA/2JJcl, and C57BL/6JJcl mice were purchased from CLEA Japan (Tokyo, Japan). Genetic crosses were performed to find spontaneous recessive mutations existing in ICR closed colony mice. Dwarf mice were segregated from the normal mice in litters of backcrossing of F1 (DBA/2JJcl x ICR no. 8) x ICR no. 8.

Linkage analysis between the dwarf gene and microsatellite markers on autosomes was performed using the F2 progeny derived from the cross ICR no. 8 with C57BL/6JJcl. The F2 progeny were produced by intercrossing of F1 (C57BL/6JJcl x ICR no. 8) mice. Eighty-three markers on chromosome 1 to chromosome 19 showing genetic polymorphisms between ICR no.8 and C57BL/6JJcl were selected (Table 2Go). Microsatellite DNA markers were amplified by PCR followed by agarose gel electrophoresis. The procedures were described elsewhere (3). Primer sets for microsatellite markers were purchased from Invitrogen (Carlsbad, CA).


View this table:
[in this window]
[in a new window]
 
Table 2. Microsatellite Markers Used for Gene Mapping

 
Anatomical and Histological Phenotyping
Body and tissue weights of dwarf and normal mice were measured using an electronic balance. Thyroid tissues were removed and fixed in Bouin’s solution for 24 h. They were embedded in paraffin and were sectioned 5 µm in thickness. After staining in hematoxylin and eosin solution, histological diagnosis was performed.

The removed skin and all organs and tissues of dwarf and normal mice were fixed in 95% ethanol overnight and then stained by alcian blue followed by alizarin red. After destaining for 72 h in 1% KOH, samples were subsequently treated in 20%, 40%, 60%, and 80% (vol/vol) glycerol solutions prepared in 1% KOH for 48–72 h before soaking in 100% glycerol.

Measurement of Hormones
Heparinized blood samples were collected from 3-month-old dwarf and normal mice to measure plasma TSH and thyroid hormones. The plasma was stored at –30 C until use. Plasma levels of T3, T4, and TSH were measured using RIA kits purchased from Abbott Japan Corp. (Tokyo, Japan), Diagnostic Products Corp. (Los Angeles, CA) and Amersham Biosciences (Piscataway, NJ), respectively. TPO activity was measured using 30 mmol/liter Guaiacol and 0.1 mmol/liter HB2BOB2B in 0.1 mol/liter potassium phosphate buffer (pH 7.4) at 30 C. Guaiacol oxidation of 1 µmol/min was defined as one unit (28).

Sequencing of the Tpo Gene
Entire coding regions corresponding to exons 2–18 of the Tpo gene of dwarf and normal mice were amplified using the five following primer pairs: Tpo-F1/R1, caaaggctggaaccctaa/tggacacagtagggttca; Tpo-F2/R2, tacaaccccactgtgaac/gcacaaagttcccattgtcc; Tpo-F3/R3, gccttccgtattggaaag/cacatgagatggaagctac; Tpo-F4/F4, cctcctgtgcgaatagaggt/gtgactggaccgtaacgaga; and Tpo-F8/R8, gctctagaatgagaacacttgg/gccgtggtataagaaattaggg. Nucleotide sequences of these primers were obtained from NCBI/GenBank accession no. X60703.

Nucleotide sequences were determined by the dideoxy chain terminating method with a BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA), and then applied to an automated DNA sequencer ABI PRISM 3100 (Applied Biosystems).

Measurement of TPO Activity in Thyroid Tissue
Microsomal and supernatant fractions of thyroid tissues of 3-month-old dwarf and normal mice were prepared by the method of Hosoya and Morrison (29) as modified by Nakagawa et al. (30). Concentration of protein in the fractions was measured using the Bradford method with bovine serum as a standard (31).

Western Blots
Thyroid microsomes and Chinese hamster ovary-K1 cells expressing recombinant human TPO (32) were electrophoresed using a 7.5% sodium dodecyl sulfate polyacrylamide gel. The gel was transferred to a Hybond-P polyvinylidene difluoride membrane (Amersham Biosciences). After blocking with 5% skim milk, the membrane was incubated in a solution containing affinity-purified rabbit antihuman TPO antibody (5 µg/ml) and then reacted with 1:5000 diluted antirabbit IgG antibody conjugated with alkaline phosphatase (Promega Corp., Madison, WI) (33). Antihuman TPO antibody (primary antibody) showed cross-reaction with murine and porcine TPOs (data not shown).

Thyroid Hormone Therapy
To observe effects of thyroid hormone on dwarf mice, the animals were given a diet containing 0.01% thyroid powder (Sigma-Aldrich, St. Louis, MO) for 30 d after weaning according to the method of Beamers et al. (9, 10). Body weights were recorded for 30 d after the beginning of the therapy.


    ACKNOWLEDGMENTS
 
We thank Jiro Kimura for technical assistance.


    FOOTNOTES
 
This work was partially supported by the Ministry of Education, Science, Sports and Culture, Grant-in-Aid for Young Scientists (B), no. 16700347, 2004–2005.

Disclosure statement: The authors have nothing to disclose.

First Published Online June 8, 2006

Abbreviations: CH, Congenital hypothyroidism; TPO, thyroid peroxidase.

Received for publication March 1, 2006. Accepted for publication May 30, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Makino S, Kunimoto K, Muraoka Y, Mizushima Y, Katagiri K, Tochino Y 1980 Breeding of a non-obese, diabetic strain of mice. Jikken Dobutsu 29:1–13[Medline]
  2. Katoh H, Endo F, Suzuki K, Matsuda I 1991 Hereditary hypertyrosinemia mouse. Mouse Genome 89:572
  3. Takabayashi T, Katoh H 2005 A mutant mouse with severe anemia and skin abnormalities controlled by a new allele of the flaky skin (fsn) locus. Exp Anim 54:339–347[CrossRef][Medline]
  4. Snell GD 1929 Dwarf, a new Mendelian recessive character of the house mouse. Proc Natl Acad Sci USA 15:733–734[Free Full Text]
  5. Eicher EM, Beamer WG 1980 New mouse dw allele: genetic location and effects on lifespan and growth hormone levels. J Hered 71:187–190[Free Full Text]
  6. Schaible RH, Gowen JW 1961 df– Ames dwarf. Mouse News Lett 25:35
  7. Buckwalter MS, Katz RW, Camper SA 1991 Localization of the panhypopituitary dwarf mutation (df) on mouse chromosome 11 in an intersubspecific backcross. Genomics 10:515–526[CrossRef][Medline]
  8. Eicher EM, Beamer WG 1976 Inherited ateliotic dwarfism in mice: characteristics of the mutation, little, on chromosome 6. J Hered 67:87–91[Free Full Text]
  9. Beamer WJ, Eicher EM, Maltais LJ, Southard JL 1981 Inherited primary hypothyroidism in mice. Science 212:61–63[Abstract/Free Full Text]
  10. Beamer WG, Maltais LJ, DeBeats MH, Eicher EM 1987 Inherited congenital goiter in mice. Endocrinology 120:838–840[Abstract]
  11. Yoshida T, Yamanaka K, Atsumi S, Tsumura H, Sasaki R, Tomita K, Ishikawa E, Ozawa H, Watanabe K, Totsuka T 1994 A novel hypothyroid ‘growth-retarded’ mouse derived from Snell’s dwarf mouse. J Endocrinol 142:435–446[Abstract]
  12. Agui T, Miyamoto T, Tsumura H, Yoshida T 1997 Mapping of the grt locus to mouse chromosome 5. Mamm Genome 18:944
  13. Camper SA, Saunders TL, Katz RW, Reeves RH 1990 The Pit-1 transcription factor gene is a candidate for the murine Snell dwarf mutation. Genomics 8:586–590[CrossRef][Medline]
  14. Ingraham HA, Albert VR, Chen R, Crenshaw III EB, Elsholtz HP, He X, Kapiloff MS, Mangalam HJ, Swanson LW, Treacy MN, Rosenfeld MG 1990 A family of POU-domain and Pit-1 tissue-specific transcription factors in pituitary and neuroendocrine development. Annu Rev Physiol 52:773–791[CrossRef][Medline]
  15. Karin M, Theill L, Castrillo J-L, McCormic A, Brady H 1990 Tissuespecific expression of the growth hormone gene and its control by growth hormone factor-1. Recent Prog Horm Res 46:43–58[Medline]
  16. Lin SC, Lin CR, Gukovsky I, Lusis AJ, Sawchenko PE, Rosenfeld MG 1993 Molecular basis of the little mouse phenotype and implications for cell type-specific growth. Nature 364:208–213[CrossRef][Medline]
  17. Flamant F, Poguet A-L, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A, Samarut J 2002 Congenital hypothyroid. Pax8(–/–) mutant mice can be rescued by inactivating the TR{alpha} gene. Mol Endocrinol 16:24–32[Abstract/Free Full Text]
  18. Taylor BA, Reifsnyder PC, DiLauro R 1992 Linkage of the thyroid peroxidase locus (Tpo) to markers in the proximal part of chromosome 12 of the mouse. Cytogenet Cell Genet 60:250–251[Medline]
  19. Kotani T, Umeki K, Yamamoto I, Takeuchi M, Takechi S, Nakayama T, Ohtaki S 1993 Nucleotide sequence of the cDNA encoding mouse thyroid peroxidase. Gene 123:289–290[CrossRef][Medline]
  20. Ohtaki S, Nakagawa H, Nakamura M, Kotani T 1996 Thyroid peroxidase: experimental and clinical integration. Endocr J 43:1–14[Medline]
  21. Ambrugger P, Stoeva I, Biebermann H, Torresani T, Leitner C, Gruters A 2001 Novel mutations of the thyroid peroxidase gene in patients with permanent congenital hypothyroidism. Eur J Endocrinol. 145:19–24
  22. Bakker B, Bikker H, Vulsma T, de Randamie JS, Wiedijk BM, De Vijlder JJ 2000 Two decades of screening for congenital hypothyroidism in The Netherlands: TPO gene mutations in total iodide organification defects. J Clin Endocrinol Metab 85:3708–3712[Abstract/Free Full Text]
  23. Wu JY, Shu SG, Yang CF, Lee CC, Tsai FJ 2002 Mutation analysis of thyroid peroxidase gene in Chinese patients with total iodide organification defect: identification of five novel mutations. J Endocrinol 172:627–635[Abstract]
  24. Mangklabruks A, Billerbeck AE, Wajchenberg B, Knobel M, Cox NJ, DeGroot LJ, Medeiros-Neto G 1991 Genetic linkage studies of thyroid peroxidase (TPO) gene in families with TPO deficiency. J Clin Endocrinol Metab 72:471–476[Abstract]
  25. Kotani T, Umeki K, Yamamoto I, Maesaka H, Tachibana K, Ohtaki S 1999 A novel mutation in the human thyroid peroxidase gene resulting in a total iodide organification defect. J Endocrinol 160:267–273[Abstract]
  26. Santos CL, Bikker H, Rego KG, Nascimento AC, Tambascia M, De Vijlder JJ, Medeiros-Neto G 1999 A novel mutation in the TPO gene in goitrous hypothyroid patients with iodide organification defect. Clin Endocrinol (Oxf) 51:165–172[CrossRef][Medline]
  27. Gruters A 1992 Congenital hypothyroidism. Pediatr Ann 21:15, 18–21:24–28[Medline]
  28. Hosoya T 1960 Turnip peroxidase. II. The reaction mechanisms of turnip peroxidase A1, A2 and D. J Biochem 47:794[Free Full Text]
  29. Hosoya T, Morrison M 1967 A study of the hemoprotein of thyroid microsomes with emphasis on the thyroid peroxidase. Biochemistry 6:1021–1026[CrossRef][Medline]
  30. Nakagawa H, Kotani T, Ohtaki S, Kawano J, Aikawa E, Imagawa M, Hashida S, Ishikawa E 1985 Characterization of a monoclonal antibody to hog thyroid peroxidase and its use for immuno-histochemical localization of the peroxidase in the thyroid gland. J Biochem 97:1709–1718[Abstract/Free Full Text]
  31. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  32. Hata J, Yamashita S, Yagihashi S, Kato H, Kabeno S, Hirai K, Kuma K, Kimura S, Umeki K, Kotani T, Ohtaki S 1989 Stable high level expression of human thyroid peroxidase in cultured Chinese hamster ovary cells. Biochem Biophys Res Commun 164:1268–1273[CrossRef][Medline]
  33. Umeki K, Kotani T, Kawano J, Suganuma T, Yamamoto I, Aratake Y, Furujo M, Ichiba Y 2002 Two novel missense mutations in the thyroid peroxidase gene, R665W and G771R, result in a localization defect and cause congenital hypothyroidism. Eur J Endocrinol 146:491–498[Abstract]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
K. Kano, C. Marin de Evsikova, J. Young, C. Wnek, T. P. Maddatu, P. M. Nishina, and J. K. Naggert
A Novel Dwarfism with Gonadal Dysfunction Due to Loss-of-Function Allele of the Collagen Receptor Gene, Ddr2, in the Mouse
Mol. Endocrinol., August 1, 2008; 22(8): 1866 - 1880.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. R. Johnson, C. C. Marden, P. Ward-Bailey, L. H. Gagnon, R. T. Bronson, and L. R. Donahue
Congenital Hypothyroidism, Dwarfism, and Hearing Impairment Caused by a Missense Mutation in the Mouse Dual Oxidase 2 Gene, Duox2
Mol. Endocrinol., July 1, 2007; 21(7): 1593 - 1602.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
20/10/2584    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals