help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0107
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaelin, C. B.
Right arrow Articles by MacKenzie, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaelin, C. B.
Right arrow Articles by MacKenzie, R. G.
Molecular Endocrinology 20 (10): 2591-2602
Copyright © 2006 by The Endocrine Society

Signal Transducer and Activator of Transcription (Stat) Binding Sites But Not Stat3 Are Required for Fasting-Induced Transcription of Agouti-Related Protein Messenger Ribonucleic Acid

Christopher B. Kaelin, Lijie Gong, Allison Wanting Xu, Fayi Yao, Kristin Hockman, Gregory J. Morton, Michael W. Schwartz, Gregory S. Barsh and Robert G. MacKenzie

Departments of Genetics and Pediatrics (C.B.K., A.W.X., G.S.B.), Stanford University School of Medicine, Stanford, California 94305; Department of Psychiatry and Behavioral Neurosciences (L.G., F.Y., K.H., R.G.M.), Wayne State University School of Medicine, Detroit, Michigan 48201; and Department of Medicine (G.J.M., M.W.S.), Harborview Medical Center, University of Washington, Seattle, Washington 98104

Address all correspondence and requests for reprints to: Gregory S. Barsh, Departments of Genetics and Pediatrics, Stanford University School of Medicine, Stanford, California 94305. E-mail: gbarsh{at}stanford.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Energy homeostasis depends on the regulation of hypothalamic neurons by leptin, an adipocyte hormone whose circulating levels communicate body energy stores. Leptin activates the transcription factor signal transducer and activator of transcription 3 (Stat3) in hypothalamic neurons, including neuronal subtypes producing Agouti-related protein (Agrp), a neuropeptide that stimulates feeding. Previous studies have suggested a model in which high levels of Agrp transcription during fasting represent a default state that is actively repressed by phospho-Stat3 induced by leptin signaling in the fed state. We identify putative Stat3 binding elements in the Agrp promoter that have been highly conserved during vertebrate evolution. Using a reporter assay in transgenic mice that faithfully recapitulates normal regulation of Agrp, we show that these sites are required, but in a way opposite to that predicted by the existing model: mutation of the sites leads to a default state characterized by a low level of Agrp transcription and insensitivity to fasting. We also find that removing activatable Stat3 from Agrp neurons has no detectable effect on steady-state levels of Agrp mRNA in the fed or fasted state. These results suggest a new model for transcriptional regulation of orexigenic neuropeptides in which the default level of expression is low in the fed state, and transcriptional activation in response to fasting is mediated by factors other than Stat3.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
HOMEOSTATIC REGULATION OF body weight depends on the ability of hypothalamic control centers to sense and respond to changes in peripheral energy stores. A central aspect of this process is the ability of leptin, an adipocyte-derived hormone whose circulating levels reflect body fat stores, to modulate transcription of the gene that encodes Agouti-related protein (Agrp) (reviewed in Ref. 1). Agrp is a hypothalamic neuropeptide whose mRNA levels are inversely related to normal diurnal changes in body fat mass and leptin (2); after prolonged fasting when leptin levels decline, increased Agrp levels are thought to help drive compensatory hyperphagia (3). Central nervous system (CNS) injection of Agrp provokes a robust and persistent increase in food intake (4), and transgenic mice that overexpress Agrp develop obesity and increased linear growth (5, 6).

Agrp is normally expressed in one of two neuronal subpopulations in the arcuate nucleus of the hypothalamus that are thought to comprise opposing circuits involved in energy homeostasis, and to directly sense bloodborne nutrients and hormones. The other neuronal subpopulation is marked by expression of pro-opiomelanocortin (Pomc), which gives rise to the anorexigenic hormone {alpha}-MSH and directly opposes the action of Agrp at central melanocortin receptors (reviewed in Refs. 7 and 8). Like Agrp, transcription of Pomc is also modulated by leptin, but in an opposite direction; leptin-deficient animals exhibit decreased levels of Pomc mRNA and increased levels of Agrp mRNA. However, whether provoked by food deprivation or leptin deficiency, the magnitude of the increase in Agrp mRNA tends to be greater, typically 8- to 10-fold, than the magnitude of the decrease in Pomc mRNA, typically 1.5- to 2-fold (3, 5, 9, 10) (reviewed in Ref. 11).

One of the most well-characterized signaling pathways downstream of the leptin receptor involves the signal transducer and activator of transcription 3 (Stat3), which belongs to a family of intracellular signaling molecules that interact directly with cytokine receptors on the cell surface and are phosphorylated as a consequence of ligand binding. Phosphorylation promotes the dimerization and nuclear translocation of Stat proteins, where they directly bind DNA to modulate the transcription of target genes (reviewed in Refs. 12, 13, 14).

Direct evidence for the role of phosphorylated Stat3 (pStat3) in central energy homeostasis comes from studies involving the targeted deletion of Stat3 in mice. Although Stat3 knockout mice die during early embryogenesis (15), mice with a broad neural deletion of Stat3 [generated with a NestinCre transgene (16)] or a partial deletion of Stat3 within the hypothalamus [generated with a RIPCre transgene (17)] develop obesity and have other phenotypes characteristic of Lepob/ob or Leprdb/db. Although demonstrating a critical role for Stat3 in central energy homeostasis, these experiments do not address which neural subtypes require Stat3 or the precise function of Stat3 in those neurons.

Several observations suggest that leptin directly regulates Agrp transcription via Stat3. Many Agrp neurons also express the leptin receptor (18), leptin administration causes a rapid accumulation of pStat3 in Agrp neurons (19), mice with mutated leptin receptors that cannot bind Stat3 are obese with elevated Agrp mRNA (20), and consensus sites for pStat binding exist in the 5' flanking region of Agrp (21). In most contexts, Stat3 (and other Stat proteins) function as transcriptional activators. However, the inverse relationship between leptin receptor occupancy and Agrp mRNA levels implies that pStat3, if it does regulate Agrp in vivo, should act as a transcriptional repressor rather than a transcriptional activator. Indeed, an oft-cited conceptual framework to account for the differential action of leptin on expression of Agrp and Pomc mRNA levels posits that leptin directly activates Stat3 signaling in both neurons, with Stat3 stimulating transcription of Pomc but inhibiting transcription of Agrp (reviewed in Ref. 12). The same model applies to neuropeptide Y (Npy), a potent orexigen that is coexpressed with Agrp in the arcuate nucleus of the hypothalamus (22). Nonetheless, leptin signaling affects other intracellular mediators in addition to Stat3 in these neurons, including phosphoinositide 3-kinase and the MAPK signaling cascades (23, 24, 25). Important questions remain regarding the extent to which each of these pathways contributes to the response of Agrp/Npy and Pomc neurons and the specific role of Stat3 signaling.

Understanding the precise mechanism by which leptin modulates Agrp transcription in vivo would have both basic and clinical implications. However, these mechanisms are challenging to study for several reasons. The arcuate nucleus of the hypothalamus is part of a circuit in which there exists the potential for cross talk and feedback, Agrp/Npy neurons represent a small fraction of the hypothalamus and cannot be distinguished anatomically, and there is no bona fide system for studying regulation of Agrp transcription in cultured cells.

We have previously identified a 40-kb region upstream of the Agrp locus that recapitulates both the cell type-specific and fasting-responsive nature of Agrp expression in transgenic mice (26). Here, we describe how an extension of this observation has been applied in two different ways to study the potential role of Stat3 in Agrp/Npy neurons. Using recently developed genomic tools and resources for comparative sequence analysis, we identify several noncoding motifs that have been under strong evolutionary constraint during the last 200 million years, including two putative Stat binding sites in the Agrp promoter. By studying an Agrp transgene engineered to prevent Stat binding, we find that these sites are not required for cell type-specific expression in the arcuate nucleus of the hypothalamus but, surprisingly, are required for fasting-induced increases in Agrp expression. To investigate whether this unexpected finding can be explained solely by loss of pStat3, we use a Cre transgene driven by Agrp regulatory elements to remove activatable Stat3 from Agrp/Npy neurons, and determine the consequences on regulation of Agrp and Npy mRNA. Our findings reveal a previously unappreciated complexity to the system in which the ability of Agrp mRNA to respond to altered metabolic state depends on the Stat3 binding sites of the Agrp promoter but not on the presence of activatable Stat3.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Potential Stat3 Binding Sites Flanking Agrp under Evolutionary Constraint
Comparative sequence analysis provides a powerful tool to identify cis-acting control regions for genes whose transcriptional regulation has been conserved during mammalian evolution (reviewed in Ref. 27). In previous studies comparing the mouse and human Agrp genes (26), we identified three evolutionarily conserved regions located either 35 kb upstream (distal conserved regions 1 and 2) or immediately upstream (proximal conserved region) of the Agrp transcriptional initiation site (Fig. 1AGo). Genome sequence from many additional vertebrates has recently become available, such that the strength of comparative analysis is limited only by phylogenetic scope. For example, brain administration of Agrp mimetics or antagonists perturbs food intake in fish (28) and in avians (29). In goldfish and zebrafish, Agrp is expressed specifically in the hypothalamus, and up-regulated in response to fasting (28, 30); however, in chickens, Agrp is expressed throughout the body and (at least in broiler chickens) fails to respond to leptin treatment (31, 32). Thus, Agrp early in vertebrate evolution probably exhibited the same function and pattern of expression as currently observed in rodents; however, certain aspects of transcriptional regulation may have been lost in some vertebrates. These observations should be reflected in the conservation pattern of cis-acting elements across different phyla.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Cross-Species Comparison and Mutagenesis of Agrp Flanking Sequences

A, A diagram (upper) illustrating the genomic context of human Agrp relative to other genes and conserved noncoding sequences (in pink) as described by Kaelin et al. (26 ). The proximal conserved region can be divided into two areas using a Vista plot (lower), which depicts the percent identity across a 100-bp window between human and each of five other vertebrate sequences (57 ), plotted as a function of position along the human sequence. Exons and noncoding sequences showing 75% sequence identity over a 100-bp window are shaded blue and pink, respectively. The positions of conserved Stat sites are shown with broken lines. B, Stat sites (in gray) are also present in opossum, platypus, and chicken. C, Mutagenesis of the putative Stat sites on an Agrp BAC reporter construct (BAC172ßgeo). The altered nucleotide positions are shown in red.

 
We identified genomic sequence upstream of Agrp from 10 different mammals and two nonmammalian vertebrates. Using the Avid and zBlast alignment tools, regions of high sequence similarity are apparent within Agrp protein-coding regions (exons 2, 3, and 4) for all eutherian mammals, including human, mouse, rat, and dog (Fig. 1AGo), and cat, chimpanzee, cow, and tenrec. Conservation is also apparent for untranslated regions (exon 1 and part of exon 4) as well as a 760-bp 5' flanking area corresponding to the proximal conserved region (Fig. 1AGo). Similar comparisons of more distantly related species (including opossum, platypus, chicken, and pufferfish) did not identify any regions of high sequence similarity outside of Agrp exon 4, even when the parameters for defining conservation were relaxed (Fig. 1AGo). Thus, despite the functional similarities of Agrp among vertebrates, genomic sequences comprising and surrounding the Agrp transcriptional unit have diverged to the extent that regional conservation (i.e. >75% over a 100-bp window) between distantly related vertebrate species is no longer detectable.

Within the 760-bp proximal conserved region are two separate peaks (labeled A and B in Fig. 1Go), and within each of these, we noticed two putative Stat binding sites that are almost perfectly conserved (Fig. 1BGo; supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Identical sites are also found upstream of Agrp in opossum and platypus, which is especially notable given the overall lack of similarity for Agrp exons 1–3 between opossum or platypus and eutherian mammal sequence. Nonetheless, the two putative Stat sites in opossum and platypus sequence are found the same distance apart from each other, and the same distance from Agrp exon 4 as in other mammalian sequences. This level of evolutionary constraint is extremely high—greater, for example, than protein coding regions in exons 2 and 3—and suggests that the region is a target for one or more trans-acting factors that regulates Agrp expression. We also identified a potential Stat binding site in the chicken Agrp upstream sequences; however, its significance is less certain because only a single site has been identified (Fig. 1BGo).

An in Vivo Assay for the Evolutionarily Conserved Stat Binding Sites
We mutated each of the putative Stat sites in the context of a BAC reporter construct that efficiently drives arcuate specific and fasting-responsive lacZ expression in transgenic mice (26). Using homologous recombination in Escherichia coli, we altered the BAC construct such that one of the sites was changed from TTCCAGGAA to TTCCAGAGG, and the other from TTCCTGGAA to TTCCTCGAG (Fig. 1CGo); these alterations were chosen based on previous in vitro studies of Stat binding specificity and surveys of physiological Stat target sites (33, 34).

Multiple transgenic lines were established from independent founders injected with either the control BAC reporter construct (BAC172ßgeo) or the one carrying mutated Stat sites (BAC172ßgeoMUT). We observed reporter expression in the arcuate nucleus of both control and mutated transgenic lines (7 of 9 and 5 of 14, respectively), indicating that the putative Stat binding elements are not necessary to drive Agrp expression in the arcuate nucleus (Fig. 2Go, A and B).


Figure 2
View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of Stat Site Mutagenesis in Transgenic Mice

A and B, X-gal staining (blue) in coronal brain slices from fasted, transgenic animals carrying either an unmodified Agrp BAC transgene (BAC172ßgeo) or an Agrp BAC transgene with mutated Stat sites (BAC172ßgeoMUT); insets show higher magnification of X-gal staining in the arcuate nucleus. C, Scoring system used for D, E, and G, where X-gal staining scores are shown for every animal, with different transgenic lines arranged in columns and labeled alphabetically. Black bars indicate the average of all scores within a single column. Individual scores are shown for BAC172ßgeo (D; red) or BAC172ßgeoMUT (E; blue) transgenic animals fasted for 48 h. F, The mean of average scores for BAC172ßgeo and BAC172ßgeoMUT transgenic lines (black bars in C and D; P ≤ 0.01, two-tailed Mann-Whitney test). G, X-gal staining scores from brain slices of BAC172ßgeoMUT transgenic animals that were either fasted for 48 h or free-fed. H, X-gal-positive cells on the surface of coronal slices from BAC172ßgeoMUT line N transgenic animals that were either free-fed (n = 5) or fasted for 48 h (n = 5).

 
To test whether there was a difference in the level of reporter expression observed between control Stat transgenic lines and those carrying the mutated construct, we used a semiquantitative assay for transgene expression, in which the intensity of X-gal staining in the arcuate nucleus of fasted animals was assigned a score of 0–5 (Fig. 2CGo). Because each line represents a different integration site, and because some integration sites are subject to position effects associated with transgene silencing, an accurate comparison of the control and mutated constructs required that multiple animals be examined from each of several different lines. Figure 2Go, D and E, depicts results for every animal we analyzed, with individual transgenic lines organized in columns. Although there were some animals in every transgenic line in which no staining was detectable, the overall level is clearly greater in lines carrying the control construct, with five of the nine control lines exhibiting mean levels of staining that were higher than each of the lines carrying the mutated construct, and an overall difference across all animals carrying the control vs. the mutated construct that is highly significant (P < 0.0001) (Fig. 2FGo).

Because the comparison between transgenic lines carrying the control or the mutated construct was carried out on animals that had been fasted for 48 h, and because transgenic lines generated with the control construct exhibit increased expression upon fasting that mimics normal Agrp regulation, we suspected that the putative Stat sites (or at least the five nucleotides that we altered) might be required for increased Agrp expression normally provoked by fasting. We tested this idea by comparing levels of X-gal staining between animals that were free-feeding or fasted for 48 h. For each of the five transgenic lines generated from the mutated construct that exhibited any staining at all (Fig. 2EGo), there was no difference between animals that were free-fed or those that were fasted (Fig. 2GGo). As an alternative approach, we also counted the number of X-gal-positive neurons on the surface of a coronal brain slice for one transgenic line that produced very consistent low-level X-gal staining, and observed no difference between slices from fasted vs. free-fed animals (Fig. 2HGo). In contrast, all six of the control transgenic lines tested showed increased levels of X-gal staining in fasted compared with free-fed animals (26) (data not shown). Thus, evolutionarily conserved Stat binding sites are required for fasting-induced up-regulation of Agrp, but the mutated BAC transgene behaves opposite to what would be predicted were pStat3 acting as a transcriptional repressor.

Agrp Neuron-Specific Disruption of Stat3
To investigate whether the unexpected finding described above can be explained by loss of activatable Stat3, we used the Cre-loxP system to conditionally disrupt the Stat3 gene specifically in Agrp neurons. Animals carrying a Cre transgene controlled by Agrp regulatory elements, Tg.AgrpCre, were crossed with animals carrying Stat3flox (35), a gene-targeted Stat3 allele with loxP sites that flank exon 22, which encodes a tyrosine residue whose phosphorylation is critical for Stat3 dimerization and nuclear translocation (Fig. 3AGo). Among backcross progeny, we generated both Tg.AgrpCre/+; Stat3flox/flox and Tg.AgrpCre/+; Stat3flox/– animals (hereafter referred to as Agrp-Stat3 mutant mice) and littermate controls,+/+; Stat3flox/flox, or +/+; Stat3flox/– (these genotypes did not exhibit any intergroup differences and are considered as a single control group in what follows).


Figure 3
View larger version (64K):
[in this window]
[in a new window]
 
Fig. 3. Generation and Characterization of Agrp-Stat3 Mutant Mice

A, Mice carrying a Cre recombinase transgene generated by BAC recombineering were crossed with mice carrying a loxP-flanked Stat3 allele generated by Takeda et al. (35 ) to generate Agrp-Stat3 mutant mice. B, Double labeling for Npy mRNA and Cre or Stat3 in control and mutant animals. Sections from the arcuate nucleus of control and mutant mice were prepared as described in Materials and Methods; genotypes and probes are indicated on the figure. Cre immunostaining colocalizes with the in situ hybridization signal for Npy mRNA (upper panel). Immunostaining for activatable Stat3 in control mice (middle panel) reveals expression in both Npy and non-Npy neurons (arrows); whereas in Agrp-Stat3 mutant mice, immunostaining for activatable Stat3 is selectively missing from neurons that express Npy mRNA (lower panel). C, Immunostaining for pStat3 45 min after ip administration of leptin to control (left) and Agrp-Stat3 mutant (right) mice.

 
To evaluate the efficacy of our approach for removing activatable Stat3 from Agrp/Npy neurons, we first carried out double-labeling experiments in control (Tg.AgrpCre/+) mice to examine the pattern of immunostaining for Cre protein, and its relationship to that of Npy mRNA. We observed no immunostaining for Cre outside the hypothalamus (data not shown). Within the hypothalamus, Cre was expressed in a population of neurons in the medial aspect of the arcuate nucleus that overlapped almost perfectly with those that expressed Npy mRNA (Fig. 3BGo, upper panel).

We then carried out similar double-labeling experiments in control and Agrp-Stat3 mutant mice to examine the pattern of total Stat3 immunostaining and Npy mRNA hybridization signal. In control mice, Stat3 immunostaining appears in both Npy-expressing neurons and a surrounding, mostly lateral, population of neurons in the arcuate nucleus (Fig. 3BGo, middle panel). In Agrp-Stat3 mutant mice, Stat3 immunostaining persisted in this latter population but was completely eliminated from Npy-expressing neurons (Fig. 3BGo, lower panel). Finally, we examined the pattern of hypothalamic pStat3 immunostaining 45 min after ip injection of leptin. Control animals exhibited robust immunostaining in response to leptin in several regions of the hypothalamus, similar to what has been reported previously by Munzberg et al. (36, 37) (Fig. 3CGo). In Agrp-Stat3 mutant mice, leptin-induced pStat3 immunostaining was unaffected in most regions of the hypothalamus but was eliminated from the medial region of the arcuate nucleus (Fig. 3CGo). Taken together, these observations indicate that mutant animals specifically lack the ability to activate Stat3 in Agrp neurons.

Agrp-Stat3 mutant mice exhibited a mild obesity phenotype, which will be presented in detail elsewhere (Gong, L., and R. G. MacKenzie, manuscript in preparation). With regard to the focus of the current paper—the effect of Stat3 on expression of orexigenic neuropeptides in Agrp/Npy neurons—we measured hypothalamic Agrp and Npy mRNA levels in control and Agrp-Stat3 mutant mice under both free-feeding conditions and after food deprivation. A 48-h fast caused a significant elevation of Agrp and Npy mRNA in both Agrp-Stat3 mutant mice and nontransgenic littermate control mice (Fig. 4AGo). Notably, Agrp mRNA levels in mutant mice were no different from those in control mice (Fig. 4Go, A and B). In one experiment, Npy mRNA levels during free feeding were slightly elevated in Agrp-Stat3 mutant mice, but this result was not confirmed in a subsequent experiment (Fig. 4BGo).


Figure 4
View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. Effects and Mechanism of Action of Stat3 in the Regulation of Neuropeptide mRNA

Agrp (A), Npy (B), and Pomc (C) mRNA levels were measured using quantitative RT-PCR of hypothalamic RNA as described in Materials and Methods. Two different experiments were carried out, one under free-feeding and fasting (48 h) conditions on older mice (21–25 wk of age; Expt I) and a second under only free-feeding conditions on younger mice (6–13 wk of age; Expt II); results are presented together relative to fed control values. For Expt I, n = 4 males for each of four groups, with a significant effect (by two-way ANOVA) observed only for fasting vs. fed: Agrp (P = 0.0001), Npy (P = 0.0009), and Pomc (P = 0.0132). (By two-tailed t test, there was a significant difference, P = 0.025, between fed mutant and fed control animals for Npy mRNA levels). For Expt II, n = 8 controls and n = 5 mutants, with no significant difference by two-way ANOVA (P > 0.05) between groups for any neuropeptide mRNA. D, The previously existing model for transcriptional regulation of Agrp mRNA between the fed and fasted states (left) posited that in the fed state, leptin-induced pStat3 actively represses Agrp transcription from a high basal or default level. Our results suggest a new model (right), in which a low level of Agrp mRNA represents basal activity during the fed state, which is then activated by factors in addition to Stat3 during the fasted state. As described in Discussion, candidates for these additional factors include Foxo1 and/or the glucocorticoid receptor.

 
We also measured mRNA levels of Pomc. Several lines of evidence suggest that Pomc expression is positively regulated by leptin-Stat3 signaling; however, Pomc is expressed in a set of neurons in the arcuate nucleus distinct from those that express Agrp and Npy, and therefore should not be directly affected by an Agrp neuron-specific disruption of Stat3. Indeed, we observed that free-fed Pomc mRNA levels in Agrp-Stat3 mutant mice were no different from those of control mice, and that fasting caused a 2-fold reduction in mRNA levels in both mutants and controls (Fig. 4Go).

Interpretation of energy homeostasis circuitry based on neuropeptide mRNA levels can be complicated by secondary effects; for example, hyperleptinemia in diet-induced obesity is expected to cause decreased levels of Agrp mRNA and therefore counteract inputs that would otherwise result in more elevated Agrp mRNA levels. However, this explanation is unlikely to apply to the results depicted in Fig. 4Go, because the mild obesity that develops in Agrp-Stat3 mutant mice is not apparent until several months of age, and there is no difference between mutant and control Agrp mRNA levels in both old (Expt I, Fig. 4AGo) and young (Expt II, Fig. 4AGo) animals.

In summary, our findings indicate that transcriptional regulation of Agrp mRNA between the fed and fasted states cannot be explained by a high basal level in the fasted state with repression mediated by pStat3 in the fed state (Fig. 4DGo, left panel). Instead, our results suggest a new model (Fig. 4DGo, right panel), in which a low level of Agrp mRNA represents basal activity during the fed state, which is then activated by factors in addition to Stat3 during the fasted state.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interest in Stat3 as a mediator of CNS leptin signaling stems originally from the observation of Vaisse et al. (38) that pStat3 (but not other Stat proteins) can be detected by Western blotting of hypothalamic extracts shortly after leptin treatment. Although accumulation of pStat3 can be detected in several regions of the hypothalamus (36, 39), work from several different groups, including our own (18, 37, 40, 41), has emphasized that Pomc and Agrp neurons in the arcuate nucleus are primary sites of direct leptin action.

Of course, Stat3 is only one of several downstream mediators of leptin signaling in the CNS; additional tyrosine phosphorylation sites in the leptin receptor activate the MAPK cascade, and leptin has a rapid effect on cell membrane potential (42) and phosphatidylinositol 3-kinase activity (43), events that are probably independent of Stat3 phosphorylation. Nonetheless, most attempts to study regulation of gene expression downstream of leptin signaling have focused on Stat3, in which relatively small (1–2 kb) regions of 5' flanking sequence from the Pomc (37), Npy (44, 45), or the TRH gene (46, 47) have been fused to a reporter gene and tested for enhancer activity in cultured cells.

The BAC-based lacZ reporter strategy applied here is similar in concept to these approaches but less efficient, because it depends on the construction and analysis of multiple transgenic lines for each data point. On the other hand, the BAC-based transgenic approach allows potential regulatory regions to be investigated in vivo, and in the context of a genomic DNA fragment sufficiently large to recapitulate the normal pattern of endogenous gene expression. This is especially important in the case of Agrp neurons, where Stat3 has been postulated to inhibit, rather than stimulate Agrp and Npy expression. For example, previous studies of Agrp transcription identified an approximately 500-bp minimal promoter that directs expression of a reporter gene in GT1–7 cells (which are derived from a gonadotrophic releasing hormone-expressing cell line), but deletion of the putative Stat sites had little effect on reporter gene expression (21). In the case of Npy, reporter gene studies identified leptin-responsive Stat binding sites in an approximately 500-bp promoter region, but the effect of leptin on reporter gene expression in PC12 or neuroblastoma cells was opposite to that which occurs in hypothalamic neurons in the arcuate nucleus (44, 45).

Within the approximately 42.5 kb of DNA upstream of Agrp required for normal reporter gene expression in the arcuate nucleus of the hypothalamus, our results demonstrate that five evolutionarily conserved nucleotides are required for transcriptional activation induced by fasting. Although the mutations we engineered were chosen because they disrupt Stat protein-DNA interactions, the underlying mechanism must involve an additional transcription factor or transcription factor complex, because removal of activatable Stat3 from Agrp neurons did not alter basal or fasting-induced Agrp mRNA levels (Fig. 4Go, A and B). Likely candidates for members of this complex in addition to Stat3 include members of the Foxo transcription factor family and/or the glucocorticoid receptor. Consensus binding sites for Foxo proteins lie 7–13 nucleotides away from each of the putative Stat sites in the Agrp promoter, and recent studies from Kitamura et al. (48) suggest that Foxo1 interacts with Stat3 to regulate Agrp expression. In addition, a previous study by Makimura et al. (49) has shown that transcriptional activation of Agrp induced by fasting depends on the presence of glucocorticoids. Thus, a plausible explanation for the observation that Stat binding elements but not activatable Stat3 are required for fasting-induced stimulation of Agrp mRNA posits that one or more proteins in addition to, or instead of, Stat3, form a transcriptional activation complex at the Stat binding site under conditions of energy deficit (Fig. 4DGo, right). Although molecular characteristics of this complex remain to be fully characterized, our results suggest that protein-DNA interactions at this site have been conserved for more than 200 million years of evolution.

Bates et al. (20) have shown that Agrp mRNA levels are elevated in mice carrying a leptin receptor mutation that specifically prevents leptin activation of Stat3 (Leprs/s). Apparent discordance between our results and those of Bates et al. (20) suggests that the elevated Agrp mRNA levels in Leprs/s mice are not due to impaired leptin-Stat3 signaling in Agrp neurons but, instead, are a consequence of impaired leptin-Stat3 signaling in other cell types. Nonetheless, our results do not preclude the possibility that pStat3 might function as a transcriptional repressor of Agrp under certain circumstances. For example, in the transition from a fasted to a fed state as leptin levels rise, the putative transcriptional activation complex referred to in Fig. 4DGo may dissociate from the Stat binding site at the same time that new pStat3 dimers enter the nucleus. Both events would likely contribute to decreased transcription of Agrp, and the loss of one or the other might affect the kinetics of the process, such that in the absence of pStat3, the rate of Agrp transcriptional initiation declines more slowly than normal. Thus, a snapshot of Agrp mRNA levels provided by quantitative RT-PCR in fed and fasted animals might not capture a change in total amount of Agrp mRNA integrated over many weeks. Such a role may be uncovered by evaluating neuropeptide gene expression in control and Agrp-Stat3 mutant mice after leptin injection or in more complex paradigms.

The Stat group of transcription factors were initially recognized as transcriptional activators whose nuclear migration and DNA binding is triggered by phosphorylation and dimerization, but it has gradually become apparent that there are a number of molecular variations on this theme (14), and the action of a particular Stat protein will depend on both the target gene and the cellular context. As shown here, the ability to test how specific modifications to DNA target sites or members of DNA binding protein complexes affect transcriptional regulation in vivo will be helpful in integrating molecular models for Stat action with their effects in whole animals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sequence Analysis
Genomic sequences surrounding the Agrp locus for chimpanzee, human, dog, mouse, and rat were obtained from publicly available genome assemblies (chimpanzee assembly CHIMP1, human assembly 35, dog assembly CanFam1.0, mouse assembly m33, and rat assembly RGSC 3.4, respectively). Genomic sequences for other species, including chicken, cat, cow, tenrec, platypus, and opossum, were obtained by a cross-species BLAST search of the NCBI trace archive followed by assembly of the overlapping trace sequence using SeqMan (DNAStar, Madison, WI). In addition to sequence assembled from trace data, chicken genomic sequence was also obtained from direct sequencing of subcloned fragments from a chicken Agrp BAC clone isolated by screening a BAC library (UCD001 Jungle Fowl BAC library), kindly provided by Dr. Jerry Dodgson at Michigan State University (East Lansing, MI). Comparative sequence analysis was performed using the PipMaker (50) and VISTA (51) software tools. MatInspector (Genomatix Software, München, Germany) and rVISTA (52) were used to identify potential transcription factor binding sites within conserved regions.

BAC Transgene Mutagenesis
Five base pairs located within two putative Stat binding sites upstream of Agrp on BAC172ßgeo (26) were mutated using homologous recombination in bacteria (53). BAC172ßgeoMUT was generated by a two-step recombination strategy. First, a 224-bp region containing the Stat binding sites was replaced with a tetracycline resistance (TetR) cassette. The TetR cassette was then replaced with a mutated version of the original 224-bp region through a second round of recombination and selection against the TetR marker. This strategy specifically alters 5 bp without the net insertion or deletion of any sequence.

The TetR cassette was amplified from pFRT-Tet-17 by PCR using primers HATetRF1 (AGCTGTATGCCCACCGGGGGAACAGTGTTTTCTGCTCCCTTGGTTTCCAGAGATCTATGATTCCCTTTGTCAACAG) and HATetRR1 (GTCCCCACAGATGTTCACTTAGTCTCCCTAGGACATGTTGTTTCCTTTGCAAGCTTATGATGATGATGTGCTTAAAAAC). Each primer has 50 nucleotides identical with the targeting sites of BAC172ßgeo, providing homology arms for recombination; the remaining 3' sequence serves as an annealing primer for amplification of the TetR cassette. Recombination between the amplified TetR fragment and BAC172ßgeo, resulting in BAC172ßgeoStatTet, was carried out as described previously (53), and correctly recombined BACs were verified by PCR using primers that flank the targeting site and thus generate a larger PCR product upon the insertion of the TetR cassette.

A 230-bp fragment of the Agrp promoter in which the two Stat sites were mutated as described in Results was constructed by PCR-directed mutagenesis using primers StatStuI (TTCCAGAGGCCTTAGGTAGAAAGGGGG) and StatXhoI (CTTTGCCTCGAGGAACTTTGTCAAGGGC); this fragment was cloned and then used as the template for PCR amplification with primers HAStatDelFor (AGCTGTATGCCCACCGGGGGAACAGTGTTTTCTGCTCCCTTGGTTTCCAGAGG) and HAStatDelRev (GTCCCCACAGATGTTCACTTAGTCTCCCTAGGACATGTTGTTTCCTTTGCCTCG). Recombination between the mutated targeting cassette and BAC172ßgeoStatTet gave rise to BAC172ßgeoMUT; correctly targeted BAC molecules were identified by restriction digestion after PCR amplification of the targeted region and direct sequencing of PCR products across the targeting site. We also compared the restriction digest patterns of BAC172ßgeo and BAC172ßgeoMUT to insure that no rearrangement of the BAC occurred during the recombineering process.

Mouse Genetics
We have previously described the construction and applications of an AgrpCre transgene engineered by BAC recombineering. For the work described here, a different AgrpCre transgene was constructed at Wayne State University (R. G. MacKenzie) using the same strategy, but with a cDNA of codon-improved Cre (iCre) recombinase (54). The Cre cDNA was inserted at the initiator ATG of the Agrp coding sequence located in exon 2. The modified BAC was then linearized and transgenic animals constructed by the University of Michigan Transgenic Core Facility. Eutopic expression of functional iCre was determined by immunostaining for Cre and expression of EGFP using the reporter strain Gt(ROSA)26Sortm2Sho (55). Crossing Tg.AgrpCre mice with mice in which exon 22 of the Stat3 gene was flanked by loxP sites (35) yielded Tg.AgrpCre/Stat3flox/flox and allowed for the deletion of activatable Stat3 specifically from Agrp neurons. Occasionally, spurious germline recombination in Tg.AgrpCre/Stat3flox/flox background resulted in offspring carrying a single recombined allele of the Stat3 gene (Stat3flox/–) and these animals were included as indicated (see Results). As described by Takeda et al. (35), small amounts of an abnormal Stat3 protein, Stat3{delta}, are produced by the recombined Stat3 allele; Stat3{delta} cannot be phosphorylated and therefore cannot be activated by Jak-Stat receptors. All animal work was carried out under Association for Assessment and Accreditation of Laboratory Animal Care-approved institutional guidelines.

Histology, in Situ Hybridization, and Immunohistochemistry
For studies of Agrp reporter gene expression using the modified BAC, BAC transgenic mice were either free-fed on standard mouse chow or fasted for approximately 36 h before reporter expression analysis (food was removed from cage setups between 1600 and 1800 h). After CO2 euthanasia, the brain was immediately dissected and 1-mm coronal brain slices were cut through the hypothalamic region using a mouse brain matrix (ASI instruments, Warren, MI). Brain slices were fixed in PBS containing 4% paraformaldehyde (PFA), washed three times for 30 min in PBS containing 0.1% Triton X-100, and incubated for 24 h at 37 C in X-gal staining solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mg/ml X-gal, and 2 mM MgCl2 in PBS). Brain slices were viewed under a dissecting microscope, assigned a semiquantitative score from 0–5 (Fig. 4CGo), and captured with Axiocam imaging software.

For studies of combined mRNA in situ hybridization and immunohistochemistry, free-feeding Tg.AgrpCre/Stat3flox/flox and Stat3flox/flox animals were euthanized and transcardially perfused with saline followed by 4% PFA. Brains were excised and placed in ice-cold 4% PFA for 4 h, and then in 20% sucrose at 4 C overnight. Brains were embedded, frozen in OCT; 8-µm cryostat sections were stored at –80 C. For hybridization, sections were dried for 1 h at room temperature, rinsed three times (5 min each) with PBS, treated with proteinase K (0.25 µg/ml PBS) for 10 min, and then rinsed briefly with (2 mg/ml) glycine before being placed into 4% PFA. After three more PBS rinses (5 min each), sections were treated with 0.1 M triethanolamine and 0.25% acetic anhydride for 10 min, washed with 2x standard saline citrate (SSC) three times (2 min each), and then dehydrated through an alcohol series. Hybridization was carried out with 50–100 ng of digoxigenin-labeled cRNA probe overnight at 55 C, after which sections were washed two times with 2x SSC (1 min each), and then incubated with RNase (0.2 mg/ml) for 1 h at 37 C before being washed again in progressively decreasing concentrations of SSC (2x, 1x, 0.5x, 0.1x; 5 min each), followed by a final 1-h wash in 0.1x SSC at 67 C. After cooling to room temperature, sections were transferred to Tris-buffered saline, treated with 0.25% Triton X-100 and 1% hydrogen peroxide for 1 h, followed by 1% blocking reagent. Sections were incubated overnight at 4 C with rabbit anti-Cre (1:8000) or rabbit anti-Stat3 (1:1000) together with sheep anti-digoxigenin (1:200) coupled to alkaline phosphatase. Sections were then incubated for 1 h with a goat antirabbit antibody (1:100) coupled to horseradish peroxidase. After washing, Cre or Stat3 was visualized by Alexa 488-tyramide amplification, followed by detection of Npy cRNA with alkaline phosphatase histochemistry.

A similar approach was used to examine pStat3, except control and mutant mice were fasted overnight, euthanized 45 min after ip injection of 5 mg/kg mouse leptin (R&D Systems, Minneapolis, MN), and 30-µm floating sections prepared. pStat3 was detected using a rabbit anti-pStat3 primary antibody (Cell Signaling Technology, Beverly, MA) at 1:2000 dilution and an Alexa 568-coupled goat antirabbit secondary antibody (Molecular Probes, Eugene, OR). Fluorophores were visualized using an IX70 inverted Olympus microscope (Melville, NY) with mercury arc illumination and a standard filter cube. Images were captured using a high-sensitivity, variable integration time, color charge-coupled device video camera (Hitachi, Tokyo, Japan).

Measurement of Neuropeptide mRNA Levels
Tg.AgrpCre/Stat3flox/flox and Stat3flox/flox littermate controls were euthanized by cervical dislocation, and RNA was extracted from hypothalamic wedges using RNAeasy columns (Qiagen, Valencia, CA). Relative mRNA expression was determined by quantitative RT-PCR using the 2{Delta}{Delta}CT method (56) for which ß-actin served as the reference gene. Oligonucleotide primers were as follows: Npy, CTGACCCTCGCTCTATCTCTG and AGTATCTGGCCATGTCCTCTG; Pomc, CCCAAGGACAAGCGTTACGG and GTGCGCGTTCTTGATGATGG; Agrp, TTGTGTTCTGCTGTTGGCACT and AGCAAAAGGCATTGAAGAAGC; Actb, CAACGAGCGGTTCCGATG and CACTGTGTTGGCATAGAGG.


    ACKNOWLEDGMENTS
 
We thank Dr. Yanru Chen and the Stanford Transgenic Facility for microinjection.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grants DK-48506 (to G.S.B.) and DK-68384 (to M.W.S.).

The authors have nothing to declare.

First Published Online May 18, 2006

Abbreviations: Agrp, Agouti-related protein; CNS, central nervous system; Npy, neuropeptide Y; PFA, paraformaldehyde; POMC, pro-opiomelanocortin; pStat, phosphorylated signal transducer and activator of transcription; SSC, standard saline citrate; Stat, signal transducer and activator of transcription; TetR, tetracycline resistance.

Received for publication March 6, 2006. Accepted for publication May 12, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661–671[Medline]
  2. Lu XY, Shieh KR, Kabbaj M, Barsh GS, Akil H, Watson SJ 2002 Diurnal rhythm of agouti-related protein and its relation to corticosterone and food intake. Endocrinology 143:3905–3915[Abstract/Free Full Text]
  3. Shutter JR, Graham M, Kinsey AC, Scully S, Luthy R, Stark KL 1997 Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice. Genes Dev 11:593–602[Abstract/Free Full Text]
  4. Hagan MM, Rushing PA, Pritchard LM, Schwartz MW, Strack AM, Van Der Ploeg LH, Woods SC, Seeley RJ 2000 Long-term orexigenic effects of AgRP-(83–132) involve mechanisms other than melanocortin receptor blockade. Am J Physiol 279:R47–R52
  5. Ollmann MM, Wilson BD, Yang YK, Kerns JA, Chen Y, Gantz I, Barsh GS 1997 Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278:135–138[Abstract/Free Full Text]
  6. Graham M, Shutter JR, Sarmiento U, Sarosi I, Stark KL 1997 Overexpression of Agrt leads to obesity in transgenic mice. Nat Genet 17:273–274[CrossRef][Medline]
  7. Barsh GS, Schwartz MW 2002 Genetic approaches to studying energy balance: perception and integration. Nat Rev Genet 3:589–600[CrossRef][Medline]
  8. Elmquist JK 2001 Hypothalamic pathways underlying the endocrine, autonomic, and behavioral effects of leptin. Physiol Behav 74:703–708[CrossRef][Medline]
  9. Mizuno TM, Mobbs CV 1999 Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140:814–817[Abstract/Free Full Text]
  10. Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn P, Baskin DG 1997 Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46:2119–2123[Abstract]
  11. Schwartz MW, Woods SC, Seeley RJ, Barsh GS, Baskin DG, Leibel RL 2003 Is the energy homeostasis system inherently biased toward weight gain? Diabetes 52:232–238[Abstract/Free Full Text]
  12. Myers Jr MG 2004 Leptin receptor signaling and the regulation of mammalian physiology. Recent Prog Horm Res 59:287–304[Abstract/Free Full Text]
  13. Aaronson DS, Horvath CM 2002 A road map for those who don’t know JAK-STAT. Science 296:1653–1655[Abstract/Free Full Text]
  14. Levy DE, Darnell Jr JE 2002 Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651–662[CrossRef][Medline]
  15. Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S 1997 Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci USA 94:3801–3804[Abstract/Free Full Text]
  16. Gao Q, Wolfgang MJ, Neschen S, Morino K, Horvath TL, Shulman GI, Fu XY 2004 Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. Proc Natl Acad Sci USA 101:4661–4666[Abstract/Free Full Text]
  17. Cui Y, Huang L, Elefteriou F, Yang G, Shelton JM, Giles JE, Oz OK, Pourbahrami T, Lu CY, Richardson JA, Karsenty G, Li C 2004 Essential role of STAT3 in body weight and glucose homeostasis. Mol Cell Biol 24:258–269[Abstract/Free Full Text]
  18. Wilson BD, Bagnol D, Kaelin CB, Ollmann MM, Gantz I, Watson SJ, Barsh GS 1999 Physiological and anatomical circuitry between Agouti-related protein and leptin signaling. Endocrinology 140:2387–2397[Abstract/Free Full Text]
  19. Hakansson ML, Meister B 1998 Transcription factor STAT3 in leptin target neurons of the rat hypothalamus. Neuroendocrinology 68:420–427[CrossRef][Medline]
  20. Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers Jr MG 2003 STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856–859[CrossRef][Medline]
  21. Brown AM, Mayfield DK, Volaufova J, Argyropoulos G 2001 The gene structure and minimal promoter of the human agouti related protein. Gene 277:231–238[CrossRef][Medline]
  22. Hahn TM, Breininger JF, Baskin DG, Schwartz MW 1998 Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci 1:271–272[CrossRef][Medline]
  23. Carvalheira JB, Torsoni MA, Ueno M, Amaral ME, Araujo EP, Velloso LA, Gontijo JA, Saad MJ 2005 Cross-talk between the insulin and leptin signaling systems in rat hypothalamus. Obes Res 13:48–57[Medline]
  24. Niswender KD, Morton GJ, Stearns WH, Rhodes CJ, Myers Jr MG, Schwartz MW 2001 Key enzyme in leptin-induced anorexia. Nature 413:794–795[Medline]
  25. Zhao AZ, Huan JN, Gupta S, Pal R, Sahu A 2002 A phosphatidylinositol 3-kinase phosphodiesterase 3B-cyclic AMP pathway in hypothalamic action of leptin on feeding. Nat Neurosci 5:727–728[Medline]
  26. Kaelin CB, Xu AW, Lu XY, Barsh GS 2004 Transcriptional regulation of agouti-related protein (Agrp) in transgenic mice. Endocrinology 145:5798–5806[Abstract/Free Full Text]
  27. Boffelli D, Nobrega MA, Rubin EM 2004 Comparative genomics at the vertebrate extremes. Nat Rev Genet 5:456–465[CrossRef][Medline]
  28. Cerda-Reverter JM, Peter RE 2003 Endogenous melanocortin antagonist in fish: structure, brain mapping, and regulation by fasting of the goldfish agouti-related protein gene. Endocrinology 144:4552–4561[Abstract/Free Full Text]
  29. Tachibana T, Sugahara K, Ohgushi A, Ando R, Kawakami S, Yoshimatsu T, Furuse M 2001 Intracerebroventricular injection of agouti-related protein attenuates the anorexigenic effect of alpha-melanocyte stimulating hormone in neonatal chicks. Neurosci Lett 305:131–134[CrossRef][Medline]
  30. Song Y, Golling G, Thacker TL, Cone RD 2003 Agouti-related protein (AGRP) is conserved and regulated by metabolic state in the zebrafish, Danio rerio. Endocrine 22:257–265[CrossRef][Medline]
  31. Dridi S, Swennen Q, Decuypere E, Buyse J 2005 Mode of leptin action in chicken hypothalamus. Brain Res 1047:214–223[CrossRef][Medline]
  32. Takeuchi S, Teshigawara K, Takahashi S 2000 Widespread expression of Agouti-related protein (AGRP) in the chicken: a possible involvement of AGRP in regulating peripheral melanocortin systems in the chicken. Biochim Biophys Acta 1496:261–269[Medline]
  33. Ehret GB, Reichenbach P, Schindler U, Horvath CM, Fritz S, Nabholz M, Bucher P 2001 DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites. J Biol Chem 276:6675–6688[Abstract/Free Full Text]
  34. Horvath CM, Wen Z, Darnell Jr JE 1995 A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev 9:984–994[Abstract/Free Full Text]
  35. Takeda K, Kaisho T, Yoshida N, Takeda J, Kishimoto T, Akira S 1998 Stat3 activation is responsible for IL-6-dependent T cell proliferation through preventing apoptosis: generation and characterization of T cell-specific Stat3-deficient mice. J Immunol 161:4652–4660[Abstract/Free Full Text]
  36. Munzberg H, Flier JS, Bjorbaek C 2004 Region-specific leptin resistance within the hypothalamus of diet-induced obese mice. Endocrinology 145:4880–4889[Abstract/Free Full Text]
  37. Munzberg H, Huo L, Nillni EA, Hollenberg AN, Bjorbaek C 2003 Role of signal transducer and activator of transcription 3 in regulation of hypothalamic proopiomelanocortin gene expression by leptin. Endocrinology 144:2121–2131[Abstract/Free Full Text]
  38. Vaisse C, Halaas JL, Horvath CM, Darnell Jr JE, Stoffel M, Friedman JM 1996 Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet 14:95–97[CrossRef][Medline]
  39. Hubschle T, Thom E, Watson A, Roth J, Klaus S, Meyerhof W 2001 Leptin-induced nuclear translocation of STAT3 immunoreactivity in hypothalamic nuclei involved in body weight regulation. J Neurosci 21:2413–2424[Abstract/Free Full Text]
  40. Elias CF, Aschkenasi C, Lee C, Kelly J, Ahima RS, Bjorbaek C, Flier JS, Saper CB, Elmquist JK 1999 Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic area. Neuron 23:775–786[CrossRef][Medline]
  41. Balthasar N, Coppari R, McMinn J, Liu SM, Lee CE, Tang V, Kenny CD, McGovern RA, Chua Jr SC, Elmquist JK, Lowell BB 2004 Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis. Neuron 42:983–991[CrossRef][Medline]
  42. Spanswick D, Smith MA, Groppi VE, Logan SD, Ashford ML 1997 Leptin inhibits hypothalamic neurons by activation of ATP-sensitive potassium channels. Nature 390:521–525[CrossRef][Medline]
  43. Xu AW, Kaelin CB, Takeda K, Akira S, Schwartz MW, Barsh GS 2005 PI3K integrates the action of insulin and leptin on hypothalamic neurons. J Clin Invest 115:951–958[CrossRef][Medline]
  44. Muraoka O, Xu B, Tsurumaki T, Akira S, Yamaguchi T, Higuchi H 2003 Leptin-induced transactivation of NPY gene promoter mediated by JAK1, JAK2 and STAT3 in the neural cell lines. Neurochem Int 42:591–601[CrossRef][Medline]
  45. Higuchi H, Hasegawa A, Yamaguchi T 2005 Transcriptional regulation of neuronal genes and its effect on neural functions: transcriptional regulation of neuropeptide Y gene by leptin and its effect on feeding. J Pharmacol Sci 98:225–231[CrossRef][Medline]
  46. Nillni EA, Vaslet C, Harris M, Hollenberg A, Bjorbak C, Flier JS 2000 Leptin regulates prothyrotropin-releasing hormone biosynthesis. Evidence for direct and indirect pathways. J Biol Chem 275:36124–36133[Abstract/Free Full Text]
  47. Harris M, Aschkenasi C, Elias CF, Chandrankunnel A, Nillni EA, Bjoorbaek C, Elmquist JK, Flier JS, Hollenberg AN 2001 Transcriptional regulation of the thyrotropin-releasing hormone gene by leptin and melanocortin signaling. J Clin Invest 107:111–120[Medline]
  48. Kitamura T, Feng Y, Kitamura YI, Chua SC, Xu AW, Barsh GS, Rossetti L, Accili D 2006 Forkhead protein FoxO1 mediates Agrp-dependent effects of leptin on food intake. Nat Med 12:534–540[CrossRef][Medline]
  49. Makimura H, Mizuno TM, Isoda F, Beasley J, Silverstein JH, Mobbs CV 2003 Role of glucocorticoids in mediating effects of fasting and diabetes on hypothalamic gene expression. BMC Physiol 3:5[CrossRef][Medline]
  50. Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, Gibbs R, Hardison R, Miller W 2000 PipMaker—a web server for aligning two genomic DNA sequences. Genome Res 10:577–586[Abstract/Free Full Text]
  51. Mayor C, Brudno M, Schwartz JR, Poliakov A, Rubin EM, Frazer KA, Pachter LS, Dubchak I 2000 VISTA: visualizing global DNA sequence alignments of arbitrary length. Bioinformatics 16:1046–1047[Abstract/Free Full Text]
  52. Loots GG, Ovcharenko I, Pachter L, Dubchak I, Rubin EM 2002 rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res 12:832–839[Abstract/Free Full Text]
  53. Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, Court DL, Jenkins NA, Copeland NG 2001 A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73:56–65[CrossRef][Medline]
  54. Shimshek DR, Kim J, Hubner MR, Spergel DJ, Buchholz F, Casanova E, Stewart AF, Seeburg PH, Sprengel R 2002 Codon-improved Cre recombinase (iCre) expression in the mouse. Genesis 32:19–26[CrossRef][Medline]
  55. Mao X, Fujiwara Y, Chapdelaine A, Yang H, Orkin SH 2001 Activation of EGFP expression by Cre-mediated excision in a new ROSA26 reporter mouse strain. Blood 97:324–326[Abstract/Free Full Text]
  56. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2{Delta}{Delta}C(T) method. Methods 25:402–408[CrossRef][Medline]
  57. Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I 2004 VISTA: computational tools for comparative genomics. Nucleic Acids Res 32:W273–W279



This article has been cited by other articles:


Home page
EndocrinologyHome page
L. Gong, F. Yao, K. Hockman, H. H. Heng, G. J. Morton, K. Takeda, S. Akira, M. J. Low, M. Rubinstein, and R. G. MacKenzie
Signal Transducer and Activator of Transcription-3 Is Required in Hypothalamic Agouti-Related Protein/Neuropeptide Y Neurons for Normal Energy Homeostasis
Endocrinology, July 1, 2008; 149(7): 3346 - 3354.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. van de Wall, R. Leshan, A. W. Xu, N. Balthasar, R. Coppari, S. M. Liu, Y. H. Jo, R. G. MacKenzie, D. B. Allison, N. J. Dun, et al.
Collective and Individual Functions of Leptin Receptor Modulated Neurons Controlling Metabolism and Ingestion
Endocrinology, April 1, 2008; 149(4): 1773 - 1785.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. L. Piper, E. K. Unger, M. G. Myers Jr., and A. W. Xu
Specific Physiological Roles for Signal Transducer and Activator of Transcription 3 in Leptin Receptor-Expressing Neurons
Mol. Endocrinol., March 1, 2008; 22(3): 751 - 759.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. W. Xu, L. Ste-Marie, C. B. Kaelin, and G. S. Barsh
Inactivation of Signal Transducer and Activator of Transcription 3 in Proopiomelanocortin (Pomc) Neurons Causes Decreased Pomc Expression, Mild Obesity, and Defects in Compensatory Refeeding
Endocrinology, January 1, 2007; 148(1): 72 - 80.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaelin, C. B.
Right arrow Articles by MacKenzie, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaelin, C. B.
Right arrow Articles by MacKenzie, R. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals