Molecular Endocrinology, doi:10.1210/me.2006-0128
Molecular Endocrinology 20 (11): 2747-2760
Copyright © 2006 by The Endocrine Society
Inhibition of Growth Hormone Receptor Gene Expression by Saturated Fatty Acids: Role of Krüppel-Like Zinc Finger Factor, ZBP-89
Jamuna Thimmarayappa,
Jinhong Sun,
Laura E. Schultz,
Prapai Dejkhamron,
Chunxia Lu,
Agata Giallongo,
Juanita L. Merchant and
Ram K. Menon
Departments of Pediatrics (J.T., J.S., L.E.S., P.D., C.L., R.K.M.), Internal Medicine (J.L.M.), and Molecular and Integrative Physiology (J.L.M., R.K.M.), University of Michigan, Ann Arbor, Michigan; and Istituto di Biomedicina e Immunologia Molecolare del Consiglio Nazionale delle Ricerche (A.G.), 90146 Palermo, Palermo, Italy
Address all correspondence and requests for reprints to: Ram K. Menon, M.D., University of Michigan Medical School, 1205 Medical Professional Building, Box 0718, 1500 East Medical Center Drive, Ann Arbor, Michigan 48109-0718. E-mail: rammenon{at}umich.edu.
 |
ABSTRACT
|
|---|
The expression and function of the GH receptor is critical for the actions of pituitary GH in the intact animal. The role of systemic factors in the reduced expression of the GH receptor and consequent GH insensitivity in pathological states such as sepsis, malnutrition, and poorly controlled diabetes mellitus is unclear. In the current study, we demonstrate that saturated (palmitic and myristic; 50 µM) fatty acids (FA) inhibit activity of the promoter of the major (L2) transcript of the GH receptor gene; unsaturated (oleic and linoleic) FA (200 µM) do not alter activity of the promoter. Comparable effects with palmitic acid and the nonmetabolizable analog bromo-palmitic acid, and failure of triacsin C to abrogate palmitic acids effects on GH receptor expression indicate that this effect is due to direct action(s) of FA. Palmitic acid, but not the unsaturated FA linoleic acid, decreased steady-state levels of endogenous L2 mRNA and GHR protein in 3T3-L1 preadipocytes. The effect of FA was localized to two cis elements located approximately 600 bp apart on the L2 promoter. EMSA and chromatin immunoprecipitation assays established that both these cis elements bind the Krüppel-type zinc finger transcription factor, ZBP-89. Ectopic expression of ZBP-89 amplified the inhibitory effect of FA on L2 promoter activity and on steady-state levels of endogenous L2 mRNA in 3T3-L1 preadipocytes. Mutational analyses of the two ZBP-89 binding sites revealed that both the sites are essential for palmitic acids inhibitory effect on the L2 promoter and for the enhancing effect of ZBP-89 on palmitic acid-induced inhibition of the L2 promoter. Our results establish a molecular basis for FA-induced inhibition of GH receptor gene expression in the pathogenesis of acquired GH insensitivity in pathological states such as poorly controlled diabetes mellitus and small for gestational age.
 |
INTRODUCTION
|
|---|
PITUITARY GH is essential for postnatal linear growth and regulation of metabolism of fat, carbohydrate, and protein in animals. At the tissue level, these pleiotropic actions of GH result from the interaction of GH with the GH receptor and expression and function of the GH receptor is critical for the action of GH (1). Dysregulation of the GH/GH receptor axis has been implicated in some forms of short stature, the pathogenesis of certain types of tumors, in the initiation and progression of chronic complications of diabetes mellitus (DM) such as nephropathy and retinopathy, and in determining morbidity associated with catabolic states such as malnutrition, trauma, sepsis, or surgery. A feature that is common to the GH receptor transcripts from different species is the heterogeneity in the 5'-untranslated region (UTR) (2). This heterogeneity in the 5'-UTR results from splicing of the various exon 1 fragments to a common splice site located 11 bp upstream of the initiating ATG. Although the number of 5'-untranslated exons varies among species, in all examples the location of the splice site from the initiating ATG is constant. Disparate 5'-untranslated exons are under the control of individual promoters. In the mouse, three 5'-UTRs (termed L1, L2, and L5) have been identified and their regulatory elements characterized in some detail (3, 4, 5, 6, 7, 8, 9). The L2 transcript is the dominant transcript expressed in postnatal life, constituting 5080% of the hepatic GHR transcripts in the nonpregnant adult animal (2, 7).
The GH/GH receptor axis plays a critical permissive role in the pathogenesis of diabetic nephropathy and retinopathy (10). Poorly controlled DM is a state of GH insensitivity associated with decreased expression of hepatic GH receptor (8, 11, 12, 13). Whereas previous studies have elucidated aspects of the molecular basis for modulation of GH receptor gene expression in DM (9, 14), the systemic/circulatory factors that play a role in the reduced expression of the GH receptor in DM and consequent GH insensitivity are as yet unknown. Similarly, the pathogenesis of acquired GH insensitivity in children born small for gestational age (SGA) or very low birth children (VLBW) remains unclear (15). The present study was undertaken to identify and characterize the molecular basis for the regulatory control of the GH receptor gene by metabolic signals. Our results reveal that fatty acids (FA) directly inhibit expression of the GH receptor gene. Our studies also support a role for the Krüppel-type zinc finger transcription factor, ZBP-89, in this action of FA on GH receptor expression.
 |
RESULTS
|
|---|
Saturated But Not Unsaturated Fatty Acids Modulate Activity of the Promoter of the L2 Transcript
Acquired states of GH insensitivity such as poorly controlled DM and SGA are associated with decreased expression of the GH receptor. These pathological states are also characterized by dysregulation of FA metabolism (16). To identify the metabolic/hormonal signals that transduce the effect of DM on the GH receptor gene, we investigated the effect of FA on promoter activity of the dominant GH receptor transcript, the L2 transcript. Exposure of the L2 promoter-luciferase stable cell line to palmitic acid (50 µM), the major saturated FA in plasma, for 24 h resulted in an approximately 50% decrease in luciferase activity (Fig. 1A
). Experiments measuring cell viability verified that this abrogation of activity of the L2 promoter was not secondary to increase in cell death (data not shown). Myristic acid (50 µM) also resulted in a similar decrease in L2 promoter activity. In contrast, other saturated FAs such as stearic (200 µM) and arachidic acid (200 µM), and unsaturated FAs such as oleic (200 µM) and linoleic (200 µM), did not alter the activity of the L2 promoter (Fig. 1A
). The effects of saturated FAs could either be due to a direct action or due to products generated by its metabolism. Thus, palmitate has been linked to the activation of several signaling pathways, e.g. by its metabolism to diacylyglycerol and subsequent activation of protein kinase C (17, 18), by palmitoylation of proteins (19), or via synthesis of ceramide (20, 21). All of these events require conversion of palmitate to palmitoyl-coenzyme A (CoA) by acyl-CoA synthetase. To distinguish between direct and indirect effects of FA, we tested the effects of a nonmetabolizable analog of palmitic acid, 2-bromoplamitate, on L2 promoter activity. These experiments established that the bromopalmitate analog mimicked the effects of palmitic acid on L2 promoter activity suggesting that the effect of palmitate was not dependent on the metabolism of palmitate (Fig. 1B
). Furthermore, triacsin C, an inhibitor of the enzyme acyl-CoA synthetase, failed to abrogate the effect of palmitic acid on the L2 promoter (Fig. 1B
). Hence, these results support the conclusion that the effects of palmitic acid on L2 promoter activity are not dependent on the intracellular metabolism of palmitate.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1. Effect of Saturated Fatty Acids on GH Receptor Gene Expression
A, Saturated fatty acids inhibit promoter activity of the L2 transcript of the murine GH receptor. BNL CL.2 (mouse liver) cells stably expressing the full-length (2 kb) L2 promoter-luciferase fusion gene were exposed for 24 h to BSA-conjugated FAs (50 µM myristic, 50 µM palmitic, 200 µM stearic, 200 µM arachidic, 200 µM oleic, 200 µM linoleic), and luciferase activity measured. Luciferase activity normalized for protein content (mean ± SE; n = 810) is depicted relative to activity with exposure to BSA alone (diagonally hatched bar). *, P < 0.01 compared with BSA alone. B, Inhibition of GH receptor promoter activity by palmitic does not require metabolism of palmitic acid. BNL CL.2 (mouse liver) cells stably expressing the full-length (2 kb) L2 promoter-luciferase fusion gene were exposed for 24 h to either 50 µM BSA-conjugated palmitic or 50 µM bromo-palmitic acid, and luciferase activity measured (open bars; n = 35). In another set of experiments (solid bars; n = 35), BNL CL.2 cells stably expressing the full-length (2 kb) L2 promoter-luciferase fusion gene were exposed to 1 µM triacsin C in the presence or absence of 50 µM BSA-conjugated palmitic acid. Luciferase activity (mean ± SE; normalized for protein content) is depicted relative to activity with exposure to BSA alone (diagonally hatched bar). * and #, P < 0.01 compared with BSA or triacsin C, respectively. C, Saturated FAs inhibit expression of endogenous GH receptor mRNA. 3T3-L1 preadipocytes were exposed for 24 h in serum-free conditions to the indicated concentrations of palmitic acid (open bars) or linoleic acid (solid bars) or vehicle (BSA; diagonally hatched bar), followed by harvesting of the cells for extraction of RNA. The abundance of the L2 mRNA transcript of the GH receptor was measured by real-time RT-PCR using methods previously described (8 ). The results (mean ± SE; n = 34) are depicted relative to mRNA abundance with exposure to BSA alone (diagonally hatched bar). *, P < 0.01 compared with BSA alone. D, Palmitic acid inhibits expression of endogenous GH receptor. 3T3-L1 preadipocytes were exposed for 24 h in serum-free conditions to BSA (lane A) or the indicated concentrations of palmitic acid (lanes B and C) and whole cell lysates prepared. Aliquots of equal amounts of protein were size-fractionated by electrophoresis, transferred on to nitrocellulose membrane by Western blotting, and the membrane sequentially probed with antibodies specific for the GH receptor (AL-47) or actin. The specific signal was detected using the chemiluminescence system as described in Materials and Methods. The positions of the molecular weight marker, the GH receptor, and actin are indicated. Results depicted are representative of two such experiments.
|
|
To verify the biological significance of the observed effect of palmitic acid on the GH receptor promoter, we investigated the effect of FAs on the expression of endogenous GH receptor in 3T3-L1 preadipocytes. 3T3-L1 cells are an established model system for the study of GH receptor expression and function. 3T3-L1 preadipocytes were exposed for 24 h to either vehicle (BSA) or FAs at the indicated concentrations, and the abundance of endogenous GH receptor mRNA and protein in these cells quantitated by real-time RT-PCR and Western blot assays, respectively. These results demonstrate that exposure of the cells to palmitic acid (50400 µM) decreased the steady state levels of the major GH receptor transcript, L2, by 5060% (Fig. 1C
). In concordance with the effects observed on the L2 promoter (Fig. 1A
), the inhibition of GH receptor mRNA by FA was specific to palmitic acid and was not observed with similar concentrations of the unsaturated FA, linoleic acid (Fig. 1C
). Western blot analysis revealed that the abundance of GH receptor protein, but not that of a control protein actin, was also decreased in 3T3-L1 cells exposed to palmitic acid (Fig. 1D
).
Identification and Characterization of a FA-Response Element in the GH Receptor Promoter
To investigate the molecular basis for the observed effect of FA on GH receptor gene expression, we used conventional deletional analysis in transient transfection experiments to localize the effect of FA to a region (
200 bp) of the L2 promoter (Fig. 2
, A and B). This 200-bp segment was analyzed by EMSA for protein binding activity using three overlapping oligonucleotides (D1, D2, and D3) that spanned this region of the L2 promoter (Fig. 2B
). Exploiting this strategy, we identified a 61-bp region (we term L2-D1) of the distal L2 GH receptor promoter, located 647587 bp 5' to the transcription start site that displayed protein-binding activity; D2 and D3 did not exhibit protein-binding activity (data not shown). Addition of nuclear extract from female mouse liver to an aliquot of 32P-labeled L2-D1 resulted in the formation of a protein-DNA complex (complex A, Fig. 3A
). The sequence specificity of this protein-DNA complex was established by demonstrating that, whereas a 10-fold molar excess of unlabeled L2-D1 eliminated the formation of protein-DNA complex A, an oligonucleotide with an unrelated sequence [random sequence (RS)] did not affect the binding even at a 40-fold molar excess (Fig. 3A
). Analysis of the nucleotide sequence of this region using MatInspector (22) and TFSearch (23) algorithms revealed the presence of putative binding sites for a restricted (10, 11, 12) number of DNA-binding proteins. Using EMSA with liver nuclear extracts, we systematically screened for factor(s) interacting with L2-D1 element and narrowed the identity of the candidate protein(s) to ZBP-89/BERF-1/BFCOL1, a Krüppel-like zinc finger transcription factor that binds to a GC-rich sequence motif in a sequence-specific manner (24). To confirm the identity of the proteins(s) participating in the formation of protein-DNA complex A, we performed competition experiments with oligonucleotides containing consensus binding sites for ZBP-89 (25) and related Krüppel-family protein Sp1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) respectively. Although the addition of molar excess of ZBP oligonucleotide abrogated the formation of protein-complex A, addition of the Sp1 oligonucleotide did not alter the formation of this complex (Fig. 3B
). The addition of antibody specific for ZBP-89 in an EMSA reaction with 32P-labeled L2-D1 and mouse liver nuclear extracts retarded the mobility of complex A and the appearance of a supershifted (SS) complex (Fig. 3C
). In parallel experiments, addition of antibodies specific for Sp1, Sp2, and Sp3 did not result in alteration of the mobility of complex A (data not shown). These results indicate the presence of ZBP-89 in the protein-DNA complex formed with mouse liver nuclear proteins and the L2-D1 sequence.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2. Identification of a FA-responsive Element in the GH Receptor Promoter
A, Localization of the cis element(s) transducing the effects of FA on the L2 transcript of the murine GH receptor (GHR). BNL CL.2 (mouse liver) cells were transiently transfected with pGL3-basic luciferase vector (horizontally hatched bar), fos-Luc enhancer-promoter construct (diagonally hatched bar) or pGL3-L2 promoter constructs containing either the full-length 2.0-kb fragment or sequential deletions (0.7, 0.608, 0.459, and 0.344 kb). One day after transfection, the cells were exposed for 24 h to either vehicle (BSA) or BSA-conjugated palmitic acid and the luciferase activity measured. Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 57) for each individual construct exposed to palmitic acid (shaded bars) is depicted as relative to activity of the respective construct exposed to BSA alone (open bar), designated as 100%. *, P < 0.01 compared with BSA alone. B, Schematic representation of the location and nucleotide sequence of the L2-D1 FA-response element. The relative locations of the 200-bp region (stippled box) of the L2 promoter identified to encompass a putative FA-response element and the three overlapping oligonucleotide probes (D1, D2, and D3) used in EMSA to screen for protein-binding activity of this region are indicated. The distance from the transcription start site of the 200-bp region and the D1 probe is indicated. The nucleotide sequence of the D1 probe is specified.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 3. ZBP-89 Binds to a Putative FA-Response Element (D1) in the Promoter of the L2 Transcript of the Murine GH Receptor Gene
Panel A, 32P-labeled L2-D1 was incubated with nuclear extracts prepared from liver of adult female mice, electrophoresed, and subjected to autoradiography as described in Materials and Methods. Competition between 32P-labeled L2-D1 and unlabeled specific (L2-D1, lanes 2 and 3) or an unrelated sequence (RS, lanes 4 and 5) oligonucleotides at molar excess of 10 (lanes 2 and 4) or 40 (lanes 3 and 5) is shown. The band representing specific (A) and nonspecific (NS) DNA-protein complexes, and the unbound 32P-labeled L2-D1 (FP) are indicated. Panel B, Competition between 32P-labeled L2-D1 and unlabeled ZBP consensus (lanes 24) or Sp1 consensus (lanes 57) oligonucleotides at molar excess of 10 (lanes 2 and 5), 20 (lanes 3 and 6) and 40 (lanes 4 and 7) is shown. The band representing the specific (A) DNA-protein complex is indicated. Panel C, 32P-labeled L2-D1 was incubated with nuclear extracts from adult mouse liver in the absence (lane 1) or presence of ZBP antibody (lane 2) or preimmune sera (lane 3), electrophoresed, and subjected to autoradiography as described in Materials and Methods. The bands representing the specific (A) and the supershifted protein-DNA complexes (SS) are indicated. Panel D, ChIP assays with chromatin fractions from 3T3-L1 preadipocytes either not infected (top lanes) or infected with adenovirus expressing ZBP-89 (bottom lanes). ChIP was performed using anti-ZBP-89 (3 µg), anti-RNA polymerase II (1 µg), or, anti-Ac-H4 (2 µg) antibody; normal rabbit (R) and mouse (M) IgG served as controls. Input DNA and DNA from each of the immunoprecipitated fractions were amplified for the D1 site by PCR (3436 cycles each) as described in Materials and Methods. One percent of the input is shown. PCR products (20 µl aliquots from each reaction) were resolved on a 2% agarose gel and viewed by staining with ethidium bromide. Inset, Input DNA and DNA from the anti-ZBP-89 immunoprecipitated chromatin fraction of 3T3-L1 preadipocytes infected with adenovirus expressing ZBP-89 were amplified for D1 (upper panel) and L1 (lower panel) sites by PCR as described in Materials and Methods. One percent of the input is shown. PCR products (20 µl aliquots from each reaction) were resolved on a 2% agarose gel and viewed by staining with ethidium bromide.
|
|
The in vivo interaction of ZBP-89 with the L2-D1 sequence was verified by the chromatin immunoprecipitation (ChIP) assay. For this purpose 3T3-L1 cells, naive or infected with an adenovirus directing the expression of ZBP-89, were used in ChIP assays to demonstrate in vivo occupancy of the L2-D1 site by ZBP-89 (Fig. 3D
). The specificity of the ChIP assay was verified by demonstrating absence of interaction of ZBP-89 with the L1 GH receptor promoter (Fig. 3D
, inset).
ZBP-89 is a bifunctional transcription factor displaying a transcription activation domain at C terminus and a repressor domain at N terminus (26). To investigate the functional significance of ZBP-89 binding to the L2-D1 element, we engineered a L2 promoter-luciferase construct (pGL3B-L2[2kb
D1]) with deletion of the ZBP-89 binding site and tested its activity in transient transfection assays in BNL CL.2 cells. Whereas loss of the L2-D1 site did not alter basal L2 promoter activity (Fig. 4A
), absence of the ZBP-89 binding site L2-D1 resulted in abrogation of the palmitic acids effect on the L2 promoter (Fig. 4B
). Possible explanations for this lack of effect on basal promoter activity could be low levels of expression of endogenous ZBP-89 in BNL CL.2 cells or the presence of additional ZBP-89 sites within the L2 promoter (vide infra). We further investigated the functional role of ZBP-89 in controlling GH receptor gene expression by overexpressing ZBP-89 in BNL CL.2 cells. These results demonstrate that ectopic expression of ZBP-89 significantly augments the activity of the L2 promoter (Fig. 4C
). The specificity of this effect was verified by demonstrating that deletion of ZBP-89 binding site (pGL3B-L2[2kb
D1] resulted in abrogation of this effect of ZBP-89 on the L2 promoter (Fig. 4C
). To further confirm this effect of ZBP-89 on L2 promoter activity, we tested this effect in Schneiders Drosophila Line 2 (SL2) cells. SL2 cells have been shown to be devoid of many of the Krüppel-like factors and hence use of this model system decreases the possibility of overlapping and potentially confounding effects from other members of the Krüppel-like family. These data indicate that, similar to the results obtained in BNL CL.2 cells, ZBP-89 increased the activity of the L2 promoter (Fig. 4C
; inset).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4. Functional Analysis of Distal ZBP-Binding Site (D1) on the L2 Promoter
A, Deletion of Distal ZBP-89 binding site (D1) does not decrease basal activity of the L2 promoter. Luciferase expression plasmids containing either the empty vector (pGL3B), full-length promoter (L2[2kb]), or internal deletion of ZBP-89 DNA-binding site L2-D1 (L2[2kb D1]) were transiently transfected in BNL CL.2 (mouse liver) cells and assayed for luciferase activity [luciferase values ranged from 3762 relative light units (RLU)]. Cotransfection of Renilla luciferase was used to normalize transfection efficiency. Results represent mean ± SE; n = 35, P < 0.05 compared with the following: *, vs. pGL3B. B, Deletion of distal ZBP-binding site (D1) abrogates effect of palmitic acid on L2 promoter activity. BNL CL.2 cells were transiently transfected with pGL3-basic luciferase vector or pGL3-L2 promoter constructs containing either the full-length promoter (L2[2kb]) or internal deletion of ZBP-89 DNA-binding site L2-D1 (L2 [2kb D1]). One day after transfection, the cells were exposed for 24 h to either BSA or BSA-conjugated palmitic acid (50 µM) and the luciferase activity measured (luciferase values ranged from 1778 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) is depicted (shaded bars) as relative to activity of the respective construct vector in the presence of BSA alone (diagonally hatched bar) designated as 100%. *, P < 0.01 compared with BSA. C, Deletion of distal ZBP-89 binding site (D1) abrogates effects of ZBP-89 on L2 promoter activity. BNL CL.2 cells were transiently transfected with pGL3-L2 promoter constructs containing either the full-length promoter (L2[2kb]) or internal deletion of ZBP-89 DNA-binding site L2-D1 (L2[2kb D1]). The cells were also cotransfected with a plasmid directing expression of ZBP-89 or empty plasmid (control). At 24 h after transfection, the cells were harvested and the luciferase activity measured (luciferase values ranged from 37472 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) in the presence of ZBP-89 overexpression (shaded bars) is depicted as relative to activity of the respective construct in the presence of the empty vector (open bars) designated as 1; *, P < 0.01 compared with transfection with empty vector [() ZBP]. Upper inset, Schneiders Drosophila Line 2 (SL2) were transiently cotransfected with pGL3-L2[2kb] promoter construct and a plasmid directing expression of ZBP-89 or empty plasmid (control). Cotransfection of plasmid RSV/ß-gal was included in each transfection mixture to enable monitoring of transfection efficiency. Forty-eight hours after transfection, the cells were harvested and the luciferase and ß-galactosidase activity measured. The normalized luciferase activity (mean ± SE; n = 35) in the presence of ZBP-89 overexpression (shaded bar) is depicted as relative to activity of the respective construct in the presence of the empty vector (open bar) designated as 1; *, P < 0.01 compared with transfection with empty vector (control). Lower inset, Western blot analysis demonstrating ectopic expression of ZBP-89 in BNL CL.2 cells. Whole cell lysates of BNL CL.2 cells either nontransfected (C) or transiently transfected with plasmid expressing flag-tagged ZBP-89 (Z) were size-fractionated by electrophoresis, transferred on to nitrocellulose membrane by western blotting, and the membrane probed with anti-Flag antibody. The specific signal was detected using the chemiluminescence system as described in Materials and Methods. The positions of the molecular weight marker and ZBP-89 protein are indicated. D, The distal ZBP-89 binding site D1 mediates ZBP-mediated augmentation of FA effects on the L2 promoter. BNL CL.2 (mouse liver) cells with (shaded bars) or without (open bars) ectopic expression of ZBP-89 were transiently transfected with pGL3-basic luciferase vector or pGL3-L2 promoter constructs containing the full-length 2.0-kb fragment or internal deletion of ZBP-89 DNA-binding site L2-D1 (L2[2kb D1]). One day after transfection, the cells were exposed for 24 h to either vehicle (BSA) or BSA-conjugated palmitic acid (50 µM) and the luciferase activity measured (luciferase values ranged from 37371 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) for each individual construct exposed to palmitic acid in the absence or presence of ectopically expressed ZBP-89 is depicted as relative to activity of the respective construct exposed to BSA alone (diagonally hatched bar), designated as 100%. *, P < 0.01 compared with absence of ectopically expressed ZBP-89 (open bars).
|
|
ZBP-89 Augments FA Effects on the L2 Promoter
Our results established that the ZBP-89 binding site overlapped with the putative FA-response element. To ascertain the role of ZBP-89 in the effect of FA on GH receptor gene expression, we tested the effect of ZBP-89 overexpression on FA-induced inhibition of L2 promoter activity. These results indicate that in BNL CL.2 cells, ectopic expression of ZBP-89 amplifies the inhibitory effect of FA on L2 promoter activity (Fig. 4D
). The specificity of this effect was verified by demonstrating that the deletion of the L2-D1 ZBP-binding site resulted in abrogation of the FA-sensitizing effect of ZBP-89 (Fig. 4D
).
Identification of a Second (Proximal) ZBP-89 Binding Site in the L2 Promoter
Our aforementioned studies with the native L2 promoter suggested the possibility of additional ZBP-89 sites within the L2 promoter. Upon verifying the role of the L2-D1 element in ZBP-mediated FA effect on the L2 promoter, we conducted a systematic survey of the L2 promoter for evidence of other ZBP-89 binding sites by testing L2-promoter deletion constructs for the FA-sensitizing effect of ZBP-89. These results established that L2-promoter constructs with progressively restricted lengths (0.7, 0.344, and 0.075 kb) of the L2 promoter retained the FA-sensitizing effect of ZBP-89 (Fig. 5A
). In contrast, the shortest fragment (0.043 kb) did not display such an effect (Fig. 5A
), suggesting the presence of additional ZBP-89 binding site(s) between 75 and 43 bp of the L2 promoter. Bioinformatic analysis of the primary sequence of this region using the MatInspector (22) and TFSearch (23) algorithms revealed a putative ZBP-89 binding site (we termed L2-A2) located 3679 bp 5' to the transcription start site (Fig. 5B
). Addition of nuclear extract from female mouse liver to an aliquot of 32P-labeled L2-A2 resulted in the formation of two protein-DNA complexes (complexes A and B; Fig. 5C
). To confirm the identity of the proteins(s) participating in the formation of the protein-DNA complexes, we performed competition experiments with oligonucleotides containing consensus binding sites for ZBP-89 and related Krüppel-family protein Sp1, respectively. Whereas the addition of molar excess of ZBP oligonucleotide abrogated the formation of protein-complexes A and B, addition of the Sp1 oligonucleotide failed to abrogate the formation of these complexes (Fig. 5C
). The addition of antibody specific for ZBP-89 in an EMSA reaction with 32P-labeled L2-A2 and mouse liver nuclear extracts resulted in the appearance of SS with attenuation of complexes A and B (Fig. 5D
). In parallel experiments addition of antibodies specific for Sp1, Sp2, and Sp3 did not result in alteration of the mobility of complex A and B (data not shown). We next used the ChIP assay to confirm the in vivo occupancy of the L2-A2 site by ZBP-89 in 3T3-L1 preadipocytes (Fig. 5E
). These results support the conclusion that ZBP-89 participates in the formation of the DNA-protein complexes at the L2-A2 site.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5. ZBP-89 Binds to a Second (Proximal) FA-Response Element (A2) in the Promoter of the L2 Transcript of the Murine GH Receptor Gene
Panel A, Localization of ZBP-binding site A2 on the L2 promoter. BNL CL.2 (mouse liver) cells with (shaded bars) or without (open bars) ectopic expression of ZBP-89 were transiently transfected with pGL3-basic luciferase vector or pGL3-L2 promoter constructs containing the full-length 2.0-kb fragment or sequential deletions [0.7, 0.344, 0.075, and 0.043 kb]. One day after transfection, the cells were exposed for 24 h to either vehicle (BSA) or BSA-conjugated palmitic acid (50 µM) and the luciferase activity measured (luciferase values ranged from 8436 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) for each individual construct exposed to palmitic acid in the absence or presence of ectopically expressed ZBP-89 is depicted as relative to activity of the respective construct exposed to BSA alone (diagonally hatched bar), designated as 100%. *, P < 0.01 compared with absence of ectopically expressed ZBP-89 (open bars). Panel B, Schematic representation of the location and nucleotide sequence of the L2-A2 FA-response element. The relative locations (vis-a-vis the transcription start site) of the L2-D1 (stippled box) and L2-A2 (solid box) putative FA-response elements of the L2 promoter are indicated. The nucleotide sequence of the L2-A2 EMSA probe is specified. Panel C, ZBP-89 binds to a proximal FA-response element L2-A2. 32P-labeled L2-A2 was incubated with nuclear extracts prepared from liver of adult female mice, electrophoresed, and subjected to autoradiography. Competition between 32P-labeled L2-A2 and unlabeled specific (L2-A2, lanes 24), ZBP-89 consensus (lanes 57), or Sp1 consensus sequence (lanes 8 and 9) oligonucleotides at molar excess of 10 (lanes 2 and 5), 20 (lanes 3, 6, and 8), or 40 (lanes 4, 7, and 9) is shown. The bands representing specific DNA-protein complexes (A and B) are indicated. Panel D, 32P-labeled L2-A2 was incubated with nuclear extracts from adult mouse liver in the absence (lane 1) or presence of ZBP-89 antibody (lane 2) or preimmune sera (lane 3), electrophoresed, and subjected to autoradiography. The bands representing specific DNA-protein complexes (A and B) and the SS are indicated. Panel E, ChIP assays with chromatin fractions from 3T3-L1 preadipocytes. ChIP was performed using anti-ZBP-89 (3 µg), anti-RNA polymerase II (1 µg), or, anti-Ac-H4 (2 µg) antibody; normal rabbit (R) and mouse (M) IgG served as controls. Input DNA and DNA from each of the immunoprecipitated fractions were amplified by PCR (35 cycles) as described in Materials and Methods; 1% of the input is shown. PCR products (20 µl aliquots from each reaction) were resolved on a 2% agarose gel and viewed by staining with ethidium bromide.
|
|
To investigate the functional significance of the L2-A2 ZBP-89 binding site, promoter-reporter constructs were engineered with deletion of the L2-A2 ZBP-89 binding site either in isolation (pGL3B-L2[2kb
A2]) or in combination with deletion of the D1 ZBP-89 binding site (pGL3B-L2[2kb
D1/A2]). Transient transfection of these constructs into BNL CL.2 cells revealed that absence of the L2-A2 site, either in isolation or in combination with the L2-D1 site, resulted in significant abrogation of the basal activity of the L2 promoter (Fig. 6A
). Furthermore, in the absence of the L2-A2 site, palmitic acid was devoid of effect on the L2 promoter (Fig. 6B
). In contrast, the effect of ectopic expression of ZBP-89 on the L2 promoter was retained in the absence of the L2-A2 site (Fig. 6C
). However, the ability of ZBP-89 to amplify the inhibitory actions of palmitic acid on L2 promoter activity required the presence of the L2-A2 site (Fig. 6D
). These results suggest a model wherein the two ZBP-89 binding sites, L2-D1 and L2-A2, are essential for palmitic acids inhibitory effect on the L2 promoter. Similarly, the two sites are not individually sufficient for the enhancing effect of ZBP-89 on palmitic acid-induced inhibition of L2 promoter activity with both the sites being essential for this effect, thereby implying cooperativity between these two ZBP-89 binding sites.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 6. Functional Analysis of a Second (Proximal) ZBP-Binding Site (A2) on the L2 Promoter
A, Deletion of ZBP-89 binding site A2 decreases basal activity of the L2 promoter. Luciferase expression plasmids containing either the empty vector (pGL3B), full-length promoter (L2[2kb]), or internal deletion of ZBP-89 DNA-binding sites L2-A2 individually (L2[2kb A2]) or in combination with the D1 site (L2[2kb D1/A2]) were transiently transfected in BNL CL.2 (mouse liver) cells and assayed for luciferase activity (luciferase values ranged from 1078 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. Results represent mean ± SE; n = 35, P < 0.05 compared with the following: *, vs. pGL3B; #, vs. pGL3B-L2[2kb]. B, Deletion of ZBP-binding site A2 abrogates effect of palmitic acid on L2 promoter activity. BNL CL.2 cells were transiently transfected with pGL3-basic luciferase vector or pGL3-L2 promoter constructs containing either the full-length promoter (L2[2kb]) or internal deletion of ZBP-89 DNA-binding site L2-A2 individually (L2 [2kb A2]) or in combination with the D1 site (L2 [2kb D1/A2]). One day after transfection, the cells were exposed for 24 h to either BSA or BSA-conjugated palmitic acid (50 µM) and the luciferase activity measured (luciferase values ranged from 978 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) is depicted (shaded bars) as relative to activity of the respective construct vector in the presence of BSA alone (diagonally hatched bar) designated as 100%. *, P < 0.01 compared with BSA. C, Deletion of ZBP-89 binding site A2 does not abrogate effects of ZBP-89 on L2 promoter activity. BNL CL.2 cells were transiently transfected with pGL3-L2 promoter constructs containing either the full-length promoter (L2[2kb]) or internal deletion of ZBP-89 DNA-binding site L2-A2 individually (L2[2kb A2]) or in combination with D1 site (L2[2kb D1/A2]). The cells were also cotransfected with a plasmid directing expression of ZBP-89 or empty plasmid (control). Twenty-four hours after transfection, the cells were harvested and the luciferase activity measured (luciferase values ranged from 102472 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) in the presence of ZBP-89 overexpression (shaded bars) is depicted as relative to activity of the respective construct in the presence of the empty vector (open bars) designated as 1; *, P < 0.01 compared with transfection with empty vector [() ZBP]. D, The proximal ZBP-89 binding site A2 mediates ZBP-mediated augmentation of FA effects on the L2 promoter. BNL CL.2 (mouse liver) cells with (shaded bars) or without (open bars) ectopic expression of ZBP-89 were transiently transfected with pGL3-basic luciferase vector or pGL3-L2 promoter constructs containing the full-length 2.0-kb fragment or internal deletion of ZBP-89 DNA-binding site L2-A2 individually (L2[2kb A2]) or in combination with D1 site (L2[2kb D1/A2])L2-D1 (L2[2kb D1]). One day after transfection, the cells were exposed for 24 h to either vehicle (BSA) or BSA-conjugated palmitic acid (50 µM) and the luciferase activity measured (luciferase values ranged from 862 RLU). Cotransfection of Renilla luciferase was used to normalize transfection efficiency. The normalized luciferase activity (mean ± SE; n = 35) for each individual construct exposed to palmitic acid in the absence or presence of ectopically expressed ZBP-89 is depicted as relative to activity of the respective construct exposed to BSA alone (diagonally hatched bar), designated as 100%. *, P < 0.01 compared with absence of ectopically expressed ZBP-89 (open bars).
|
|
ZBP-89 Augments FA Effects on Endogenous GH Receptor Gene Expression
To verify the biological relevance of the results obtained with in vitro promoter studies, we investigated the effect of ectopic expression of ZBP-89 on PA-induced inhibition of endogenous GH receptor gene expression. 3T3-L1 preadipocytes were infected with ZBP-89 overexpressing adenovirus and after exposure of the cells to PA, the steady state abundance of the L2 transcript was quantitated by real-time RT-PCR. These results established that consistent with the results obtained with the GH receptor promoter-luciferase construct, overexpression of ZBP-89 increased the steady state levels of endogenous GH receptor mRNA (Fig. 7A
) and the PA-induced decrement in L2 mRNA levels was significantly greater in cells expressing the ZBP-89 adenovirus as compared with cells infected with a control (ß-galactosidase expressing) adenovirus (Fig. 7B
).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7. Effects of ZBP-89 on Endogenous GH Receptor Expression
A, ZBP-89 increases expression of endogenous GH receptor mRNA. 3T3-L1 preadipocytes were infected with recombinant adenovirus expressing either ß-galactosidase (open bar) or ZBP-89 (solid bar). Forty-eight hours after infection, the cells were harvested for extraction of RNA. The abundance of the L2 mRNA transcript of the GH receptor was measured by real-time RT-PCR using methods previously described (8 ). The results (mean ± SE; n = 2) are depicted relative to mRNA abundance with infection with ß-galactosidase expressing adenovirus. Inset, Western blot analysis demonstrating adenovirally mediated expression of ZBP-89 in 3T3-L1 preadipocytes. Whole cell lysates of 3T3-L1 preadipocytes either naïve (C) or infected with 100 or 300 multiplicity of infection of recombinant Ad-ZBP-89 adenovirus expressing myc-flag-tagged ZBP-89 were size-fractionated by electrophoresis, transferred on to nitrocellulose membrane by Western blotting, and the membrane probed with anti-myc antibody. The specific signal was detected using the chemiluminescence system as described in Materials and Methods. The positions of the molecular weight marker, the ZBP-89 protein, and a nonspecific (NS) band are indicated. B, ZBP-89 augments FA effects on endogenous GH receptor gene expression. 3T3-L1 preadipocytes were infected with recombinant adenovirus expressing either ß-galactosidase or ZBP-89. Forty-eight hours after infection, the cells were transferred to serum-free conditions and then exposed to palmitic acid (200 µM; solid bars) or vehicle (BSA; open bar) for 24 h, followed by harvesting of the cells for extraction of RNA. The abundance of the L2 mRNA transcript of the GH receptor was measured by real-time RT-PCR using methods previously described (8 ). The results (mean ± SE; n = 3) are depicted relative to mRNA abundance with exposure to BSA alone (open bar). *, P < 0.01 compared with ß-galactosidase infected cells.
|
|
 |
DISCUSSION
|
|---|
The main findings of this study are that saturated FAs directly inhibit GH receptor gene expression, this effect is mediated by direct action of FA and not secondary to metabolites generated by intracellular metabolism of FA, and that the Krüppel-type zinc finger transcription factor ZBP-89 plays a role in this action of FA on GH receptor gene expression.
Studies conducted during the past few years have highlighted the importance of FAs in the regulation of gene expression including those genes related to nutrition and growth (27). To the best of our knowledge, the current study is the first to demonstrate that FAs alter the expression of the GH receptor gene. Our studies indicate that saturated, but not unsaturated, FAs inhibit expression of the GH receptor gene. Furthermore, our results demonstrating comparable effects with palmitic acid and a nonmetabolizable analog of palmitic acid (bromo-palmitic acid), and the failure of inhibition of palmitic acid metabolism to abrogate palmitic acids effects on GH receptor expression, support the conclusion that this effect of palmitic acid is due to direct actions of palmitic acid. FA-mediated inhibition of GH receptor promoter activity and expression occurred at a relatively low concentration of FA (50200 µM FA) and thus was unlikely to be secondary to a nonspecific detergent-like effect. Furthermore, similar concentrations of palmitic acid failed to alter the activity of either the pGL3-Basic vector or that of an unrelated promoter (c-fos promoter enhancer) (Fig. 2A
), supporting the specificity of the observed effect of palmitic acid on the L2-GHR promoter. There are multiple ways in which FA can directly interact with the cell. One of the mechanisms postulated for the biological effects of FA is via their ability to act as ligands for PPAR. The lack of effect (data not shown) of fenofibrate (500 µM) and rosiglitazone (10 µM), ligands for PPAR
and PPAR
respectively, on GH receptor L2 promoter activity argues against a role for PPAR in the observed effect of FA on GH receptor expression. Similarly, the effect of FA is unlikely to be solely mediated by the newly discovered family of G protein-coupled receptors for FA (e.g. GPR40 family and GPR120) because the profile of fatty acid ligands for these receptors is at variance with that observed for the effect of FA on GH receptor. Whereas the observed effects of FA on GH receptor gene expression are restricted to medium-chain saturated FAs, GPR40 is activated by medium and long chain saturated and unsaturated FAs (28, 29), GPR41 and GPR43 by short chain carboxylic acids (30, 31, 32), and GPR120 by long chain saturated and unsaturated FAs (33). It is noteworthy that previous studies (34) have established that saturated FA can interact with Toll-family of receptors (e.g. TLR2 and TLR4) to induce nuclear factor-
B expression and this effect was observed at molar concentrations (75 µM) similar to that observed in the current studies. We have obtained preliminary data (data not shown) to suggest that the effect of saturated FA on GH receptor is mediated via the Toll-family of receptors.
ZBP-89 (BFCOLI1, BERF-1, ZNF148, Zfp148) is a ubiquitously expressed Krüppel-type zinc finger protein with pleiotropic actions including regulation of transcription, cell growth arrest, and cell death (24). A recent study demonstrated that ZBP-89 acts as a transcriptional activator of the bovine GH receptor gene (35). Our results confirm that ZBP-89 increases GH receptor promoter activity. Furthermore, our studies extend this observation by establishing that ZBP-89 plays a role in FAs effect on the GH receptor gene and that these actions of ZBP-89 on the GH receptor promoter are mediated by two ZBP-binding sites approximately 600 bp apart. Cooperativity between these two ZBP-89 binding sites is evident by the finding that the integrity of these two sites is essential for the effect of ZBP-89 effect of enhancing palmitic acids inhibition of GH receptor promoter activity. The exact mechanism by which ZBP-89 enhances the effect of FA on the GH receptor promoter is not clear at this time. Our studies indicate that the binding of ZBP-89 to the GH receptor element is not altered by FA (data not shown). However, the possibility that posttranslational modifications of ZBP-89 play a role in the action of ZBP-89 cannot be excluded. Overlapping of the ZBP-89-binding site and the FA-response element in the L2 promoter raises the possibility that ZBP-89 is solely responsible for transducing the effects of FA on GH receptor gene expression. However, the finding that ectopic expression of ZBP-89 increases, whereas FA inhibits, L2 promoter activity suggests a role for either posttranslational modifications of ZBP-89 by FA or for other proteins interacting with ZBP-89. It is noteworthy that ZBP-89 has been shown to interact with other proteins, such as SP1 (36), signal transducers and activators of transcription 3 (37), p53 (38), and polymerase I and transcript-release factor (39).
The GH/GH receptor axis plays a critical role in statural growth and regulation of metabolism. The findings of the current study impact on our understanding of the pathophysiology of three disease states; short stature, type 1 DM, and obesity-linked type 2 DM. Children who are born SGA including those born with extreme reductions in birth weight, VLBW, are exposed to abnormalities in circulating lipid concentrations both in the short-term as a consequence of artificial nutritional support regimens including total parenteral nutrition, and in the long-term due to persistent lipid abnormalities in postnatal life (40, 41). Approximately 1520% of SGA and VLBW children fail to exhibit catch-up growth with detrimental effects on their final adult height (42). Abnormalities in the GH/GH receptor axis are implicated in the pathogenesis of growth retardation in SGA and VLBW children (15, 43). Results from the present study indicating effects of FA on GHR expression provide a molecular basis for the state of GH insensitivity observed in these cohorts. Resistance to actions of GH due to down-regulation of the GH receptor is also a hallmark of poorly controlled type 1 DM. Whereas many of the molecular mechanisms that play a role in regulation of the GH/GH receptor axis in DM have been elucidated (9), the metabolic signals that transduce these changes have not been identified. Results from the present study suggest that alterations in the concentration of circulating levels of FA could play a role in the decrease in expression of GH receptor in poorly controlled type 1 DM. Failure of pancreatic ß-cell mass to compensate for insulin resistance is a critical event in the pathogenesis of type II diabetes. GH receptors are expressed on pancreatic ß cells and the GH/IGF-I axis is believed to play a stimulatory role in ß cell mitogenesis and growth (44). Results from the current study suggest that FA-induced down-regulation of GH receptors on pancreatic ß cells could contribute to the failure of ß cell mass to compensate for insulin resistance in obesity-linked type 2 DM.
In summary, the current report establishes a role for saturated FAs in the regulation of expression of the GH receptor gene. Our studies have identified cis elements in the GH receptor promoter that play a role in the FA-induced inhibition of GH receptor expression. We have elucidated a role for the Krüppel-like zinc finger binding protein ZBP-89 in the molecular mechanism underlying this phenomenon. Our studies suggest a molecular basis for the alterations in GH receptor expression in DM and SGA.
 |
MATERIALS AND METHODS
|
|---|
Oligonucleotides
The following synthetic oligonucleotides were used in these experiments:
L2-F4: CTCCCTTCCCAGTTTCAC
L2-F5: CTCCCCAAGCCTGACAAC
L2-F7: TGGGGGACTTTTGGGATAGC
L2-F8: GGTCACTGCTCTCTTTGAACTTAC
L2-F9: TCTAGGAGGAGCCCC
L2-D1[F]: ATGAGAATGGGTGGGTAGGGAAGTGGGGGGGAAGGGTATGGGG
GACTTTTGGGATAGCAT
ZBP-F-Consensus: GGCCGATGCGCCCCTCCCCCGCGCCGATC (25)
L2-A2: TCCTCCCTTCCCAGTTTCACCCCGCCCCCTTCCTGCTCCCCAAG
RS: CCCATGTTAGAATCCCAGCTTATACCCGCAGGC
ACAACATT
Fluorescent 5'-Nuclease RT-PCR Primers and Probe
Forward: GTCCACGCGGCCTGAG
Reverse: TCGCCTCGGGAGACAGAAC
Probe: CAGCCCCCAAGCGGACACGA
ChIP Primers
L1-F: AACAGCCAGGGCTACAAAGA (4)
L1-R: GCTTCCAGCTGAAGTGAAGG
L2-D1[F]: CCACCCCTCCCCTCTCTT
L2-D1: CAGCTCGTGGGTTGTCAG
L2-A2[F]: CCACCCCTCCCCTCTCTT
L2-A2: CAGCTCGTGGGTTGTCAG
Where necessary double-stranded oligonucleotides were generated by annealing of synthetic oligonucleotides with the respective complementary sequences.
Fatty Acid Solution Preparations
Stock FA solutions were prepared by conjugating FA with fatty acid-free BSA (Sigma, St. Louis, MO) as previously described (45). In brief, sufficient FAs were dissolved in preheated 0.1 N NaOH and diluted 1:10 in prewarmed (4550 C) DMEM containing 12% (wt/vol) BSA, to give a final FA concentration of 2.0 mM. This gave a final molar ratio of FA/BSA of 1.5:1.0, and predicted to give an unbound FA concentration of
8 nM (46, 47, 48). Stock FA solutions were filter sterilized and diluted with cell culture media for use in experiments. Control media contained 0.1 N NaOH and BSA but was devoid of lipid. Where required, the pH of preparations was adjusted to 7.4.
Reporter Gene Constructs
Luciferase reporter gene constructs were engineered to contain various portions of the GH receptor 5'-flanking region. pGL3B-L2[-2.0] and pGL3B-L2[-0.7] have been described previously (7). pGL3B-L2[-608], pGL3B-L2[-459], pGL3B-L2[-344], pGL3B-L2[-75], and pGL3B-L2[-43] were engineered by using PCR; the 5'-end of these constructs was defined by the oligonucleotides L2-F7, L2-F8, L2-F9, L2F4, and L2F5, respectively. pGL3B-L2[2kb
D1] and pGL3B-L2[2kb
A2] were created by deletion of the L2-D1 and L2-A2 binding sites respectively from pGL3B-L2[-2.0] using QuikChange (Stratagene, La Jolla, CA); the double mutant pGL3B-L2[2kb
D1/A2] was created using a similar strategy. All constructs were sequenced through the vector-insert junctions to ensure nucleotide fidelity and verify directionality. The reporter plasmid fos-Luc containing the mouse c-fos enhancer (379 to +1) upstream of the luciferase gene (49) was provided by J. Schwartz.
Cell Culture
The culture media used for cell culture experiments were obtained from Invitrogen (Carlsbad, CA) unless otherwise stated. BNL CL.2 cells [mouse embryonic liver, hepatocyte-like cells; American Type Culture Collection (Manassas, VA): TIB-73] were maintained at 37 C in Eagles DMEM (with nonessential amino acids, sodium pyruvate, and Earles balanced salt solution), 10% fetal serum, with penicillin G (100 U/ml) and streptomycin (100 µg/ml) in an atmosphere of 5% CO2/95% air. BNL CL.2 cells stably transfected with the L2[-2.0]-GH receptor promoter luciferase construct were maintained as described previously (50). 3T3 preadipocytes were grown at 37 C in DMEM supplemented with 4.5 g/liter glucose, 10% calf serum, penicillin G (100 U/ml), and streptomycin (100 µg/ml) in an atmosphere of 10% CO2/90% air.
Transient Expression of Reporter Gene
BNL CL.2 cells (0.20 x 106 cells/35-mm plate) were plated 24 h before transfection. Three micrograms of plasmid DNA (comprising 1 µg of reporter plasmid, 0.2 µg of the internal Renilla luciferase control, and 1.8 µg salmon sperm DNA) were transfected per plate using the LipofectAMINE method (Invitrogen). The following day, the cells were serum deprived for 1012 h and then exposed in serum-free medium to either FAs or vehicle for 24 h and cells harvested for luciferase assay. For estimation of luciferase activity, the plates were rinsed twice with PBS and the cells harvested by the addition of 200 µl lysis buffer (Dual Luciferase Assay System; Promega, Madison, WI). After a brief freeze-thaw cycle the insoluble debris was removed by centrifugation at 4 C for 23 min at 14,000 x g. Twenty-microliter aliquots of the supernatant were then immediately processed for sequential quantitation of both firefly and Renilla luciferase activity (Dual Luciferase Assay System; Promega) using a Monolight TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA). All transfections were performed in triplicates. Where indicated transfection efficiency was monitored by cotransfection of 0.2 µg of the plasmid pRL-TK (Promega) expressing the Renilla luciferase. The results of the luciferase assay are expressed in relative light units equalized for transfection efficiency or protein concentration as indicated. Protein concentration of the supernatant was determined using the Bradford protein assay (Bio-Rad Laboratories, Hercules, CA). In certain experiments to achieve ectopic expression of ZBP-89, 0.2 µg of plasmid expressing full-length Flag-tagged rat ZBP-89 cDNA (24) was also cotransfected.
Schneiders Drosophila Line 2 (SL2) cells were grown in 60-mm dishes in Schneiders medium (Invitrogen) supplemented with 10% fetal calf serum. The cells were allowed to grow to a confluency of 5060% before commencement of transient transfection experiments. Eleven micrograms of plasmid DNA were transfected per plate using the calcium phosphate transfection method (Invitrogen). To investigate the role of ZBP-89 in regulating the activity of the GH receptor promoter, 4 µg of the GH receptor promoter reporter plasmid (pGL3-L2) was cotransfected with and without 1 µg of plasmid expressing ZBP. Plasmid RSV/ß-gal (1 µg) was included in each transfection mixture to enable monitoring of transfection efficiency. The cells were exposed to the DNA precipitate for 48 h before being harvested and processed for chemiluminescent assays for measurement of luciferase (Promega) and ß-galactosidase activity (CLONTECH, Palo Alto, CA).
EMSA
Nuclear extracts from mouse liver were prepared as previously described (7). Protease inhibitors (leupeptin 2 µg/ml, pepstatin 1 µg/ml, and aprotinin 1%) were included in the buffers used to prepare the nuclear extracts. Double-stranded DNA fragments used as probes were obtained by annealing complementary custom synthesized single stranded oligonucleotides. The DNA was end-labeled with [
32P]ATP and T4 polynucleotide kinase. Approximately 14 fmol of DNA were added to 3 µg of nuclear extract in a final volume of 50 µl containing 1.5 µg of poly(deoxyinosine-deoxycytosine), 20 mM Tris-HCl (pH 8.0), 50 mM NaCl, BSA (50 µg/ml), 1% Nonidet P-40, 1 mM EDTA, 10% glycerol, and 1 mM dithiothreitol. After incubation at room temperature for 30 min, DNA-protein complexes were resolved by electrophoresis at room temperature through an 8% nondenaturing polyacrylamide gel [acrylamide, N,N-methylene-bis-acrylamine (BIS) 80:1] with 90 mM Tris-borate (pH 8.5), 2 mM EDTA buffer. The gels were dried and subjected to autoradiography with intensifying screens (NEN Life Sciences, Boston, MA) at 80 C. Competition experiments included the addition of excess unlabeled DNA fragments to the reaction mix. In some experiments, nuclear extracts were incubated with the indicated amounts of polyclonal antibody against ZBP-89 (Ref. 25 or Santa Cruz Biotechnology, Inc.) for 30 min at room temperature before addition to the binding reactions.
Adenovirally Mediated Overexpression of ZBP-89
Replication-deficient recombinant Ad-ZBP-89 expressing full-length Flag-tagged rat ZBP-89 cDNA has been previously described (51). The adenovirus was plaque purified, and a cesium chloride preparation was used for the experiments. Infection of 3T3-L1 preadipocytes was carried out at a multiplicity of infection of 100 pfu/cell in the presence of poly-L-lysine hydrobromide (Sigma) as previously described (52). Cells were harvested for analysis 48 h after infection.
Western Blot Analysis
Fifteen microgram aliquots of total cell lysate were heated for 5 min at 100 C in 62.5 mM Tris HCl, 10% (vol/vol) glycerol, 5% (vol/vol) 2-mercaptoethanol, 1.05% sodium dodecyl sulfate (SDS), and 0.004% bromophenol blue. The protein samples were then electrophoresed through a 4% stacking, 8% resolving, discontinuous SDS-polyacrylamide gel in 25 mM Tris HCl, 192 mM glycine, and 0.1% SDS buffer. BenchMark prestained protein ladder (Invitrogen) was also concurrently electrophoresed. After electrophoresis, the proteins were transferred to nitrocellulose membrane by electroblotting (Bio-Rad Laboratories) in transfer buffer [10 mM N-cyclohexyl-3-aminopropanesulfonic acid, 3 mM dithiothreitol, 15% methanol (pH 10.5)] for 1.5 h. The nitrocellulose membrane were then soaked overnight at 4 C in 5% nonfat dry milk, 1x TBS, and 0.1% Tween 20 and subsequently probed with the AL-47 antibody (1:1000 dilution) against the GH receptor (courtesy of Stuart Frank, Internal Medicine, University of Alabama, Birmingham, AL) using the ECL enhanced chemiluminescence system (Amersham, Piscataway, NJ) according to the manufacturers instructions.
ChIP
ChIP experiments were conducted on 3T3-L1 cells, either naive or ectopically expressing ZBP-89 via adenovirally mediated expression. These cells were subjected to ChIP using the EZ-ChIP kit (Upstate Biotechnology, Lake Placid, NY) with minor modifications. Briefly, 3T3-L1 preadipocytes were cross-linked by exposure to 1% formaldehyde in PBS for 10 min, followed by addition of 1 ml 10x glycine to quench unreacted formaldehyde. The cells were then scraped in ice-cold PBS containing a protease inhibitor cocktail, centrifuged, and the cell pellet resuspended in SDS lysis buffer. The cell lysate was subjected to shearing to generate DNA fragments of
500 bp [7 x 15 sec, at 4.5 output of an ultrasonic sonicator (Heat Systems-Ultrasonics)]. Samples were diluted 1:10 with ChIP dilution buffer [16.7 mM Tris-HCl (pH 8.0), 167 mM NaCl, 1.2 mM EDTA, 0.01% SDS, 1.1% Triton X-100, and protease inhibitor cocktail] and precleared with 10 µg of salmon sperm DNA and 60 µl packed Protein G-agarose beads/ml ChIP dilution buffer. For immunoprecipitation, samples containing 100 µg of nuclear protein were incubated overnight at 4 C with the following antibodies individually: anti-ZBP (26), anti-acetyl H4 and RNA Pol 2 (Upstate Biotechnology). Normal rabbit and mouse IgG served as negative controls. After incubation of individual immunoprecipitate for 1 h with 10 µg of salmon sperm DNA and 60 µl of protein G agarose beads, the beads were washed, eluted, reverse cross-linked, and free DNA purified with a PCR purification kit. The L2-D1 (60 bp) and the L2A2 (100 bp) sites were amplified with 3436 cycles of PCR (94 C for 20 sec, 60 C for 20 sec, and 72 C for 30 sec) using the respective primers. The promoter of the L1 transcript of the GH receptor (4) was used as a control with primers L1-F and L1-R amplifying a 182-bp region of the L1 promoter (38 cycles of PCR; 94 C for 30 sec, 52 C for 30 sec, and 72 C for 30 sec). Samples were separated on 2% agarose gels and stained with ethidium bromide.
Fluorescent 5'-Nuclease RT-PCR
Total RNA was extracted using TRI-reagent (Molecular Research Center). Real-time quantitative reverse-transcription PCR (QT-PCR) using the ABI Prism 7000 sequence detection system (PE Applied Biosystems, Foster City, CA) was performed and analyzed following protocols described previously (8).
Data Analysis
Data are presented as mean ± SE unless otherwise indicated. The Mann-Whitney and Kruskal-Wallis nonparametric tests were performed to analyze statistical significance of the difference between the distribution of two and multiple independent samples, respectively. P values equal to or less than 0.05 were considered significant.
 |
ACKNOWLEDGMENTS
|
|---|
The authors acknowledge the assistance and the generous provision of reagents by Drs. Christin Carter-Su and Jessica Schwartz (Molecular and Integrative Physiology, University of Michigan, Ann Arbor, MI), Robert ODoherty (Internal Medicine, University of Pittsburgh, Pittsburgh, PA), Stuart Frank (Internal Medicine, University of Alabama, Birmingham, AL), and members of their respective laboratories.
 |
FOOTNOTES
|
|---|
This work was supported in part by grants from the National Institutes of Health [DK49845 (to R.K.M.), DK55732 (to J.L.M.), and P60DK-20572 (Michigan Diabetes Research and Training Center)].
Disclosure Statement: The authors have nothing to disclose.
First Published Online July 6, 2006
Abbreviations: ChIP, Chromatin immunoprecipitation; CoA, coenzyme A; DM, diabetes mellitus; FA, fatty acid; PPAR, peroxisome proliferator-activated receptor; RLU, relative light units; RS, random sequence; SDS, sodium dodecyl sulfate; SGA, small for gestational age; SS, supershifted complex; TLR, Toll-like receptor; UTR, untranslated region; VLBW, very low birth weight; ZBP, Krüppel-type zinc finger transcription factor.
Received for publication March 21, 2006.
Accepted for publication June 26, 2006.
 |
REFERENCES
|
|---|
- Herrington J, Carter-Su C 2001 Signaling pathways activated by the growth hormone receptor. Trends Endocrinol Metab 12:252257[CrossRef][Medline]
- Edens A, Talamantes F 1998 Alternative processing of growth hormone receptor transcripts. Endocr Rev 19:559582[Abstract/Free Full Text]
- Zou L, Menon RK 1995 A member of the CTF/NF-1 transcription factor family regulates murine growth hormone receptor gene promoter activity. Endocrinology 136:52365239[Abstract]
- Menon RK, Stephan DA, Singh M, Morris SM, Zou L 1995 Cloning of the promoter-regulatory region of the murine growth hormone receptor gene. J Biol Chem 270:88518859[Abstract/Free Full Text]
- Menon RK, Cheng H, Singh M 1997 Identification and characterization of single strand DNA-binding protein that represses growth hormone receptor gene expression. Mol Endocrinol 11:12911304[Abstract/Free Full Text]
- Schwartzbauer G, Yu JH, H C, Menon RK 1998 Transcription factor MSY-1 regulates expression of the murine growth hormone receptor gene. J Biol Chem 273:2476024769[Abstract/Free Full Text]
- Yu JH, Schwartzbauer G, Kazlman A, Menon RK 1999 Role of the Sp family of transcription factors in the ontogeny of GH receptor gene expression. J Biol Chem 274:3432734336[Abstract/Free Full Text]
- Menon RK, Shaufl A, Yu JH, Stephan DA, Friday RP 2001 Identification and characterization of a novel transcript of the murine growth hormone receptor gene exhibiting development- and tissue-specific expression. Mol Cell Endocrinol 172:135146[CrossRef][Medline]
- Gowri PM, Yu JH, Shaufl A, Sperling MA, Menon RK 2003 Recruitment of a repressosome complex at the GHR promoter and its potential role in diabetic nephropathy. Mol Cell Biol 23:815825[Abstract/Free Full Text]
- Sonksen PH, Russell-Jones D, Jones RH 1993 Growth hormone and diabetes mellitus. Horm Res 40:6879[Medline]
- Mercado M, Molitch ME, Baumann G 1992 Low plasma growth hormone binding protein in IDDM. Diabetes 41:605609[Abstract]
- Menon RK, Arslanian S, May B, Cutfield WS, Sperling MA 1992 Diminished growth hormone-binding protein in children with insulin-dependent diabetes mellitus. J Clin Endocrinol Metab 74:934938[Abstract]
- Menon RK, Stephan DA, Rao RH, Shen-orr Z, Down Jr LS, Roberts CT, LeRoith D, Sperling MA 1994 Tissue-specific regulation of the growth hormone receptor gene in streptozotocin-induced diabetes in the rat. J Endocrinol 142:453462[Abstract/Free Full Text]
- Baxter RC, Bryson JM, Turtle JR 1980 Somatogenic receptors of rat liver: regulation by insulin. Endocrinology 107:11761181[Abstract/Free Full Text]
- Ali O, Cohen P 2003 Insulin-like growth factors and their binding proteins in children born small for gestational age: implication for growth hormone therapy. Horm Res 60:115123[CrossRef][Medline]
- Unger RH, Foster DW 1998 Diabetes mellitus. In: Wilson JD, Foster DW, Kronenberg HM, Larsen PR, eds. Williams textbook of endocrinology. 9th ed. Philadelphia: W. B. Saunders; 939972
- Montell E, Turini M, Marotta M, Roberts M, Noe V, Ciudad CJ, Mace K, Gomez-Foix AM 2001 DAG accumulation from saturated fatty acids desensitizes insulin stimulation of glucose uptake in muscle cells. Am J Physiol Endocrinol Metab 280:E229E237
- Eitel K, Staiger H, Rieger J, Mischak H, Brandhorst H, Brendel MD, Bretzel RG, Haring H-U, Kellerer M 2003 Protein kinase C (
) activation and translocation to the nucleus are required for fatty acid-induced apoptosis of insulin-secreting cells. Diabetes 52:991997[Abstract/Free Full Text] - Webb Y, Hermida-Matsumoto L, Resh MD 2000 Inhibition of protein palmitoylation, raft localization, and T cell signaling by 2-bromopalmitate and polyunsaturated fatty acids. J Biol Chem 275:261270[Abstract/Free Full Text]
- Kelpe CL, Moore PC, Parazzoli SD, Wicksteed B, Rhodes CJ, Poitout V 2003 Palmitate inhibition of insulin gene expression is mediated at the transcriptional level via ceramide synthesis. J Biol Chem 278:3001530021[Abstract/Free Full Text]
- Chavez JA, Knotts TA, Wang L-P, Li G, Dobrowsky RT, Florant GL, Summers SA 2003 A role for ceramide, but not diacylglycerol, in the antagonism of insulin signal transduction by saturated fatty acids. J Biol Chem 278:1029710303[Abstract/Free Full Text]
- Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:48784884[Abstract/Free Full Text]
- Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel A, Kel O, Ignatieva E, Ananko E, Podkolodnaya O, Kolpakov F, Podkolodny N, Kolchanov N 1998 Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26:362367[Abstract/Free Full Text]
- Merchant J, Iyer G, Taylor B, Kitchen J, Mortensen E, Wang Z, Flintoft R, Michel J, Bassel-Duby R 1996 ZBP-89, a Kruppel-like zinc finger protein, inhibits epidermal growth factor induction of the gastrin promoter. Mol Cell Biol 16:66446653[Abstract]
- Law GL, Itoh H, Law DJ, Mize GJ, Merchant JL, Morris DR 1998 Transcription factor ZBP-89 regulates the activity of the ornithine decarboxylase promoter. J Biol Chem 273:1995519964[Abstract/Free Full Text]
- Passantino R, Antona V, Barbieri G, Rubino P, Melchionna R, Cossu G, Feo S, Giallongo A 1998 Negative regulation of ß enolase gene transcription in embryonic muscle is dependent upon a zinc finger factor that binds to the G-rich box within the muscle-specific enhancer. J Biol Chem 273:484494[Abstract/Free Full Text]
- Pegorier J-P, May CL, Girard J 2004 Control of gene expression by fatty acids. J Nutr 134:2444S2449S
- Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, Eilert MM, Ellis C, Elshourbagy NA, Goetz AS, Minnick DT, Murdock PR, Sauls Jr HR, Shabon U, Spinage LD, Strum JC, Szekeres PG, Tan KB, Way JM, Ignar DM, Wilson S, Muir AI 2003 The orphan G protein-coupled receptor GPR40 is activated by medium and long chain fatty acids. J Biol Chem 278:1130311311[Abstract/Free Full Text]
- Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S, Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S, Fujisawa Y, Fujino M 2003 Free fatty acids regulate insulin secretion from pancreatic ß-cells through GPR40. Nature 422:173176[CrossRef][Medline]
- Le Poul E, Loison C, Struyf S, Springael J-Y, Lannoy V, Decobecq M-E, Brezillon S, Dupriez V, Vassart G, Van Damme J, Parmentier M, Detheux M 2003 Functional characterization of human receptors for short chain fatty acids and their role in polymorphonuclear cell activation. J Biol Chem 278:2548125489[Abstract/Free Full Text]
- Xiong Y, Miyamoto N, Shibata K, Valasek MA, Motoike T, Kedzierski RM, Yanagisawa M 2004 Short-chain fatty acids stimulate leptin production in adipocytes through the G protein-coupled receptor GPR41. Proc Natl Acad Sci USA 101:10451050[Abstract/Free Full Text]
- Brown AJ, Goldsworthy SM, Barnes AA, Eilert MM, Tcheang L, Daniels D, Muir AI, Wigglesworth MJ, Kinghorn I, Fraser NJ, Pike NB, Strum JC, Steplewski KM, Murdock PR, Holder JC, Marshall FH, Szekeres PG, Wilson S, Ignar DM, Foord SM, Wise A, Dowell SJ 2003 The orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J Biol Chem 278:1131211319[Abstract/Free Full Text]
- Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki S, Tsujimoto G 2005 Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nat Med 11:9094[CrossRef][Medline]
- Lee JY, Sohn KH, Rhee SH, Hwang D 2001 Saturated fatty acids, but not unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through toll-like receptor 4. J Biol Chem 276:1668316689[Abstract/Free Full Text]
- Xu Q, Springer L, Merchant J, Jiang H 2006 Identification of zinc finger binding protein 89 (ZBP-89) as a transcriptional activator for a major bovine growth hormone receptor promoter. Mol Cell Endocrinol 251:8895[CrossRef][Medline]
- Zhang X, Diab I, Zehner Z 2003 ZBP-89 represses vimentin gene transcription by interacting with the transcriptional activator, Sp1. Nucleic Acids Res 31:29002914[Abstract/Free Full Text]
- Wu Y, Diab I, Zhang X, Izmailova E, Zehner Z 2004 Stat3 enhances vimentin gene expression by binding to the antisilencer element and interacting with the repressor protein, ZBP-89. Oncogene 8:168178
- Bai L, Merchant JL 2001 ZBP-89 promotes growth arrest through stabilization of p53. Mol Cell Biol 21:46704683[Abstract/Free Full Text]
- Hasegawa T, Takeuchi A, Miyaishi O, Xiao H, Mao J, Isobe K 2000 PTRF (polymerase I and transcript-release factor) is tissue-specific and interacts with the BFCOL1 (binding factor of a type-I collagen promoter) zinc-finger transcription factor which binds to the two mouse type-I collagen gene promoters. Biochem J 347:5559[CrossRef][Medline]
- Bazaes R, Salazar T, Pittaluga E, Pena V, Alegria A, Iniguez G, Ong K, Dunger D, MV M 2003 Glucose and lipid metabolism in small for gestational age infants at 48 hours of age. Pediatrics 111:804809[Abstract/Free Full Text]
- Boiko J, Jaquet D, Chevenne D, Rigal O, Czernichow P, Levy-Marchal C 2005 In situ lipolytic regulation in subjects born small for gestational age. Int J Obes (Lond) 29:565570[CrossRef][Medline]
- Cutfield W, Regan F, Jackson W, Jefferies C, Robinson E, Harris M, Hofman P 2004 The endocrine consequences for very low birth weight premature infants. Growth Horm IGF Res 14:S130S135
- Leger J, Oury J, Noe lM, Baron S, Benali K, Blot P, Czernichow P 1996 Growth factors and intrauterine growth retardation. I. Serum growth hormone, insulin-like growth factor (IGF)-I, IGF-II, and IGF binding protein 3 levels in normally grown and growth-retarded human fetuses during the second half of gestation. Pediatr Res 40:94100[Medline]
- Lingohr MK, Buettner R, Rhodes CJ 2002 Pancreatic ß-cell growth and survivala role in obesity-linked type 2 diabetes? Trends Mol Med 8:375384[CrossRef][Medline]
- Sinha S, Perdomo G, Brown NF, ODoherty RM 2004 Fatty acid-induced insulin resistance in L6 myotubes is prevented by inhibition of activation and nuclear localization of nuclear factor
B. J Biol Chem 279:4129441301[Abstract/Free Full Text] - Spector AA, Fletcher JE 1978 Disturbances in lipid and lipoprotein metabolism. Bethesda, MD: American Physiological Society
- Spector A 1975 Fatty acid binding to plasma albumin. J Lipid Res 16:165179[Abstract]
- Richieri G, Kleinfeld A 1995 Unbound free fatty acid levels in human serum. J Lipid Res 36:229240[Abstract]
- Harvat B, Wharton W 1995 Serum response element and flanking sequences mediate the synergistic transcriptional activation of c-fos by 12-O-tetradecanoylphorbol-13-acetate and cholera toxin in AKR-2B cells. Cell Growth Diff 6:955964[Abstract]
- Denson LA, Shaufl A, Karpen SJ, Menon RK 2001 Tumor necrosis factor
down regulates murine hepatic growth hormone receptor gene expression via inhibition of Sp1 and Sp3 binding. J Clin Invest 107:14511458[CrossRef][Medline] - Bai L, Merchant J 2000 Transcription factor ZBP-89 cooperates with histone acetyltransferase p300 during butyrate activation of p21waf1 transcription in human cells. J Biol Chem 275:3072530733[Abstract/Free Full Text]
- Orlicky D, Schaack J 2001 Adenovirus transduction of 3T3-L1 cells. J Lipid Res 42:460466[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Wei, S. Puzhko, M. Wabitsch, and C. G. Goodyer
Structure and Activity of the Human Growth Hormone Receptor (hGHR) Gene V2 Promoter
Mol. Endocrinol.,
March 1, 2009;
23(3):
360 - 372.
[Abstract]
[Full Text]
[PDF]
|
 |
|