| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pharmacology, University of Pennsylvania School of Medicine (T.M., J.B.P., D.C.), Philadelphia, Pennsylvania 19104; and Department of Infection Biology, Graduate School of Comprehensive Human Sciences and Institute of Basic Medical Sciences, University of Tsukuba (K.N.), Tsukuba 305-8575, Japan
Address all correspondence and requests for reprints to the present address: Dr. Debabrata Chakravarti, 4-119 Lurie Research Building, 303 East Superior Street, Division of Reproductive Biology Research, Department of Obstetrics and Gynecology, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611. E-mail: debu{at}northwestern.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
cAMP response element-binding protein (CREB)-binding protein (CBP)/p300 and p300/CBP-associated factor (PCAF) are members of a large and growing class of coactivators that are proposed to contribute to transcription via direct association with transcription factors, including nuclear hormone receptors, as part of coactivation complexes (6, 7). Recent reports demonstrate that these proteins depend at least in part on intrinsic acetyltransferase activity for their transcriptional regulatory activity in vitro and in intact cells (8, 9, 10). This implies that the HAT activity might be regulated. The HAT activity of transcriptional coactivation complexes has been targeted by several viral oncoproteins, including adenovirus E1A, simian virus 40 T antigen, human papillomavirus E6, Epstein-Barr virus Zta, and Kaposis sarcoma-associated herpesvirus protein viral interferon regulatory factor (11). PU.1, an Ets family oncoprotein, also targets CBP. PU.1 inhibits CBP-mediated acetylation of GATA binding protein-1, nuclear factor (erythroid derived 2), and erythroid Kruppel-like factor as well as histones and disrupts acetylation-dependent transcriptional events (12). Similarly, proliferating cell nuclear antigen binds to p300, inhibits its HAT activity in vitro, and blocks HAT-dependent transcription in vivo (13).
Recently, a new class of HAT regulatory proteins has been identified. These proteins block HAT activity via binding and masking of the coactivators substrate, histones. This class includes the subunits of the inhibitor of acetyltransferases (INHAT) complex, template-activating factor-I
(TAF-I
), TAF-Iß, and pp32, as well as ataxin 3, silencing mediator of retinoid and thyroid receptors (SMRT)/nuclear hormone receptor corepressor (NCoR), and PELP1 (proline-, glutamic acid-, and leucine-rich protein 1) (14, 15, 16, 17, 18, 19, 20). These proteins have all been demonstrated to function as transcriptional repressors when targeted to promoters, and each functions in part by keeping histone tails hypoacetylated.
The histone code hypothesis and chromatin signaling network model predict the existence of cellular proteins that may play a histone-binding role in establishing the acetylation (or other modification) status and transcriptional output of genes (21, 22, 23). We and others have recently shown that the INHAT subunits TAF-Iß and pp32 recognize hypoacetylated, but not hyperacetylated, histones (24, 25). We also demonstrated that TAF-Iß and pp32 may regulate transcription by binding to histone deacetylases (24). What is not clear is whether TAF-Iß and pp32 bind to chromatin throughout the genome or whether they are targeted to specific domains via association with DNA-binding factors. Both pp32 and TAF-Iß when overexpressed can individually inhibit activation by retinoic acid receptor in the presence of retinoic acid (15). TAF-Iß and pp32 have also been shown to interact with estrogen receptor
(ER
), inhibit ER
-mediated transcriptional activation, and inhibit ER
acetylation by p300 (19, 20), and these properties may extend to other nuclear receptors, because these proteins associated with other nuclear receptors in vitro (19, 20). Additionally, TAF-Iß also interacts with the DNA-binding domains of specificity factor-1 (SP1) and KLF5 where it negatively regulates DNA binding and activation by these factors (26, 27). Therefore, it appears that TAF-Iß and pp32 might also function independently of each other and have multiple targets to regulate transcription.
To identify novel targets of TAF-Iß, we used a yeast two-hybrid screen with TAF-Iß as the bait. More than half of the sequenced clones represented the hypothetical human protein thanatos-associated protein 7 (THAP7). This protein is a member of a large class of putative DNA-binding proteins containing the THAP domain, a C2-CH putative zinc finger domain sharing significant homology to the site-specific DNA-binding domain of the Drosophila p element transposase (28). Recently, it has been demonstrated that the human THAP protein, THAP1, has zinc-dependent, site-specific, in vitro DNA-binding activity (29). Although direct DNA binding by THAP7 has not yet been demonstrated, when targeted to promoters by fusions with the Gal4 DNA-binding domain, human THAP7 represses transcription in part by recruiting NCoR and HDAC3, while simultaneously causing the hypoacetylation of histone H3 (30). Consequently, knockdown of NCoR or treatment with trichostatin A (TSA) does not completely alleviate repression mediated by THAP7, indicating that THAP7 must also use additional, HDAC-independent mechanisms to repress transcription. Because THAP7 associated with TAF-Iß, we set out to determine whether TAF-Iß has a regulatory role in THAP7-mediated transcriptional repression. In this study we demonstrate that THAP7 associates with TAF-Iß in vitro and in transfected cells. We map the association domain to the C-terminal 77 amino acids of THAP7, which is a predicted coiled coil domain that has already been shown to be required for histone binding (30). Like TAF-Iß, THAP7 binds to histone tails and inhibits their acetylation by transcriptional coactivators/HATs p300 and PCAF. THAP7 has an additive effect with TAF-Iß with regard to its HAT inhibitory activity in vitro. More importantly, THAP7 can recruit TAF-Iß to targeted promoters and requires TAF-Iß for full repression. THAP7 may therefore provide an example of a novel putative transcription factor that recruits TAF-Iß to chromatin. Using its own histone-masking function along with its previously characterized NCoR/HDAC3 recruitment function can provide THAP7 with an additional mechanism to repress transcription.
| RESULTS |
|---|
|
|
|---|
|
To map the TAF-Iß-binding domain of THAP7, a series of THAP7 mutants was generated, in vitro translated with [35S]methionine, and incubated with GST-TAF-Iß1225. This deletion mutant of TAF-Iß was used because it bound more tightly than full-length TAF-Iß, although similar results were obtained with full-length TAF-Iß (data not shown). The schematic of THAP7 mutants tested and results of binding experiments are summarized in Fig. 2A
. All THAP7 mutants tested containing the C-terminal 77 amino acids of THAP7, which are predicted to form a coiled coil, including a mutant THAP7 containing only these 77 amino acids that could bind to GST-TAF-Iß, but not GST alone (Fig. 2B
, lanes 2, 5, 8, 11, 14, and 17). A mutant lacking these 77 amino acids could not bind to GST-TAF-Iß (Fig. 2B
, lane 20). These results indicate that amino acids 232309 of THAP7 are necessary and sufficient for TAF-Iß interaction in vitro (Fig. 2A
).
|
|
(heterochromatin protein 1
), which also forms nuclear foci (Fig. 3B
THAP7 Inhibits Histone Acetylation, But Not Deacetylation
TAF-Iß has been purified in multiple cellular complexes, with or without pp32, and has been demonstrated to possess numerous biochemical activities, including a protein phosphatase 2A (PP2A) inhibitory activity as well as a cyclin B-cyclin-dependent kinase-1 (CDK1) kinase inhibitory activity (33, 34, 35). We found, however, that overexpression of THAP7 had no effect on PP2A activity or cyclin B-CDK activity or on TAF-Iß protein levels (data not shown).
TAF-Iß has also been shown to bind to histone tails and consequently prevent the tails from serving as substrates for HATs in vitro, a process we termed histone masking (15, 16, 20). We therefore tested whether THAP7 could affect the ability of TAF-Iß to inhibit histone acetylation, and we first tested whether THAP7 possessed its own histone-masking activity. For this purpose we incubated GST-THAP7 with purified histone H3 or histone H4 (from calf thymus) or nucleosomes (purified from HeLa cells) at an increasing molar ratio (THAP7:histone) of 2:1, 4:1, or 8:1 in the presence of recombinant p300 or PCAF (Fig. 4
, A and B, respectively). Increasing amounts of GST-THAP7, but not GST, inhibited the acetylation of histone H3, histone H4, and nucleosomes by p300 (Fig. 4A
) and of histone H3 by PCAF (Fig. 4B
). We have recently demonstrated that, like TAF-Iß, THAP7 also possesses histone-binding properties and binds directly to histone H3 and histone H4 tails (30). To determine whether THAP7 inhibits the acetylation of histones via histone masking, we tested whether the addition of histone could rescue histone acetylation (15). The inhibition of histone acetylation by GST-THAP7 was completely relieved by increasing the molar ratio of histones to THAP7 (Fig. 4C
, panel I, lanes 712, and panel II, lanes 14, 9, and 10), whereas increasing the concentration of histone in the presence of high amounts of GST only slightly enhanced the acetylation of histone H4, providing a measure of acetylation recovery (Fig. 4C
, panel I, lanes 16). Additionally, the inhibition of histone acetylation by THAP7 (Fig. 4C
, panel II, lanes 14) was not significantly relieved by the addition of an equal molar amount of poly-L-lysine (Fig. 4C
, panel II, lanes 5 and 6) or poly-L-arginine (Fig. 4C
, panel II, lanes 7 and 8), indicating that THAP7 inhibits acetylation via histone masking. Consistent with in vitro binding studies and a mechanism involving histone masking, the GST-THAP7 histone-interacting domain (HID; amino acids 232309) was sufficient to inhibit histone acetylation in vitro (Fig. 4D
).
|
We have previously demonstrated that THAP7 can bind to both unacetylated and acetylated histone H3 tails and that THAP7 associates with HDAC3 and targets the deacetylation of histone H3 at promoters (30). In vitro, it has been shown that HDAC3 is not active unless it is bound to the SMRT/NCoR deacetylation activation domain (36). We therefore tested whether THAP7 also possessed any HDAC-enhancing or inhibitory function. For this purpose we generated Myc-tagged HDAC3 by in vitro transcription and translation and incubated it with in vitro-transcribed and translated NCoR, THAP7, or both. HDAC3 was then immunoprecipitated with anti-Myc antibodies, and the immunoprecipitates were used for in vitro HDAC activity assays with a fluorescently labeled HDAC substrate. Similar to published results, HDAC3 was not active on its own, but addition of NCoR stimulated its activity (Fig. 4F
) (36). The addition of THAP7 did not stimulate HDAC activity, and the addition of both NCoR and THAP7 resulted in similar activity to that after addition of NCoR alone. These data suggest that although THAP7 can bind to both unacetylated and acetylated histone H3 as well as HDAC3, it does not significantly inhibit or enhance the activity of HDAC3.
THAP7 Recruits TAF-Iß to Promoters and Requires TAF-Iß for Transcriptional Repression
Although the identities of putative THAP7 genomic targets are currently unknown, there is a strong indication that THAP7 might function as a transcriptional regulator. We have previously demonstrated that THAP7 represses transcription of a transfected Gal4 reporter gene when fused to the Gal4 DNA-binding domain. In addition, THAP7 recruited HDAC3 and NCoR to these promoters and caused the hypoacetylation of histone H3. However, treatment with the HDAC inhibitor TSA and knockdown of NCoR by small interfering RNA (siRNA) only partially relieved repression by THAP7, indicating that THAP7 must also possess HDAC independent mechanisms of transcriptional repression (30). Additionally, TAF-Iß has been shown to down-regulate the transcriptional activity of retinoic acid receptor and ER (15, 19, 20). We therefore tested whether TAF-Iß recruitment also contributes to THAP7-mediated transcriptional repression. For this purpose, we used an integrated reporter HeLa cell line containing a luciferase reporter under control of Gal4 DNA-binding sites. We transfected these cells with Gal4 DBD alone or with a Gal4 DBD-THAP7 fusion protein and analyzed promoter occupancy by chromatin immunoprecipitation (ChIP) assays (Fig. 5A
). Under conditions where equal amounts of promoter were pulled down by a Gal-4 antibody (lane 3), we observed a decrease in histone H3 acetylation in cells transfected with Gal4DBD-THAP7 compared with those transfected with Gal4 DBD alone (lane 4), with a concomitant increase in HDAC3 (lane 5) and NCoR (lane 6) occupancy, consistent with our previous results using a transfected Gal4 reporter (30). We also observed a significant increase in TAF-Iß at the promoter of the integrated reporter gene (lane 7), indicating that it can also be recruited by THAP7. We did not notice any observable recruitment of pp32 (lane 8), consistent with our binding data (Fig. 1
and data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
TAF-Iß has been demonstrated to block HAT-dependent transcription and be recruited to nuclear hormone-responsive genes via direct association with nuclear hormone receptors and/or histones (15, 19, 24). TAF-Iß also associates directly with the DNA-binding domains of the transcription factors, specificity factor-1 (SP1) and Kruppel like factor 5, although its binding disrupts DNA binding by these factors (26, 27). THAP7 may thus represent a novel class of transcription factors that recruits TAF-Iß to specific DNA elements to maintain histones in the deacetylated/transcriptionally repressed state. Although there has been no direct evidence that THAP7 binds to DNA, it has been shown by an in vitro selection assay that the THAP domain of THAP1 is a zinc-dependent, site-specific, DNA-binding domain (29); that the Drosophila p element transposase, site-specific DNA-binding domain contains all the invariant residues of the THAP domain; and that mutations in the conserved cysteines of THAP1 or p element transposase abrogate their DNA binding (29, 38).
THAP7 is a member of a large class of THAP domain-containing proteins that are found in diverse organisms, from flies to worms to humans. THAP7 has orthologues in mice, chicken, Xenopus, and zebrafish, indicating its potential importance in vertebrates (29). The THAP domain family in humans contains at least 12 distinct members, including death-associated protein-4 (DAP4)/p52rIPK, and the proapoptotic factor THAP1. The first THAP protein characterized was DAP4/p52rIPK (THAP0), which is a repressor of the protein kinase R (PKR) inhibitor P58IPK (39). Overexpression of P58IPK represses PKR-mediated eukaryotic translation initiation factor-2
phosphorylation, thus inhibiting the normally toxic and growth-suppressive effects associated with PKR function. Overexpression of DAP4/p52rIPK (THAP0) restores PKR activity and eukaryotic translation initiation factor-2
phosphorylation, thus suppressing the effects of p58IPK. Besides THAP7 and THAP0, the only other THAP protein characterized to date is THAP1. THAP1 is a nuclear proapoptotic factor that associates with PML nuclear bodies and potentiates both serum withdrawal and TNF-
-induced apoptosis (40). The proapoptotic function is dependent upon the THAP domain. THAP1 also interacts with prostate apoptosis response-4, a well-characterized proapoptotic factor linked to prostate cancer and neurodegenerative disease. The THAP domain of THAP1 has been shown to bind directly to a specific DNA sequence using an in vitro DNA site selection strategy; however, no endogenous targets of THAP1 have yet been identified (29). Very little is known about the remaining THAP family members and their functions.
THAP7 was isolated in a yeast two-hybrid screen as a protein that interacts with the INHAT subunit TAF-Iß. The binding domain was mapped to the C-terminal, 77-amino acids of THAP7, which is predominantly positively charged. This domain has also been demonstrated to be necessary and sufficient for histone binding (30). Deletion of the C-terminal, histone-binding domain and the INHAT domain of TAF-Iß did not prevent the association with THAP7. THAP7 and TAF-Iß can inhibit histone acetylation in an additive manner based on their own abilities to associate with histones. This inhibition is observed at a ratio of THAP7:histone of 1:1 or greater, consistent with a mechanism of histone masking. However, it is unlikely that the ratio of endogenous THAP7:histone in living cells will be very high. Indeed, overexpression of THAP7 did not have any affect on bulk histone acetylation (data not shown), indicating that THAP7 is likely to work on a limited number of target genes where the local concentration of these factors is high, perhaps due to recruitment via its own DNA-binding domain. Consistent with this idea, GFP-THAP7 fusions are found in discrete nuclear domains in cells, where the concentration may be locally high enough to change the status of histone acetylation. This is exactly what was observed when THAP7 was targeted to a specific promoter using fusions to the DNA-binding domain of the yeast Gal4 protein.
In a stably integrated, inducible 293 cell line, endogenous TAF-Iß coimmunoprecipitated with THAP7. Even under low expression conditions, Flag-tagged THAP7 effectively immunoprecipitated endogenous TAF-Iß. Additionally, the amount of TAF-Iß immunoprecipitated was proportional to the amount of expressed THAP7, suggesting that these two proteins interact in living cells. Consequently, GFP-THAP7 sequestered endogenous TAF-Iß in discrete nuclear subdomains in HeLa cells that did not contain pp32, PML, the splicing factor SC-35, or HP1
. These nuclear foci also did not contain the 20S proteasome, indicating that they are probably not aggregated proteins destined for disposal. It has recently been shown that GFP fusions of THAP1 also form nuclear foci (40), but these foci contain PML, unlike THAP7. GFP-THAP7 domains did contain the corepressors SMRT/NCoR and the INHAT subunit TAF-Iß, but not the INHAT subunit pp32, indicating that there is some specificity to the proteins that accumulate in GFP-THAP7 domains. It is currently unclear whether THAP protein nuclear foci are critical for their function.
Because TAF-Iß, but not pp32, coimmunoprecipitated with THAP7 and accumulated in THAP7 nuclear domains, it appears that TAF-Iß and pp32 can also function independently in cellular complexes that are distinct from the INHAT complex. This is consistent with the finding that pp32 and TAF-Iß have been purified in different cellular complexes with distinct, physiologically relevant activities (41). The future availability of an anti-THAP7 antibody will be crucial and should also facilitate interaction studies between endogenous THAP7 and its interactors.
THAP7 is likely to repress transcription by multiple mechanisms. Using the Gal4 reporter system, we have been able to demonstrate that THAP7 functions by both HDAC-dependent and HDAC-independent mechanisms. We have demonstrated that THAP7 recruits NCoR and HDAC3 to the promoter, which could provide a mechanism to deacetylate histone H3, as we have also observed for a Gal4-containing promoter (30). Importantly, TSA treatment or knockdown of NCoR by siRNA only partially relieves repression by THAP7, suggesting that HDAC-independent mechanisms must exist to repress transcription. In this study we show that THAP7 recruits the INHAT subunit TAF-Iß to the promoter and possesses its own histone-masking activity, which is likely to contribute to transcriptional repression. It is important to note that even with reduced TAF-Iß levels (this work) or reduced NCoR levels (30), THAP7 still represses transcription, indicating a cumulative contribution of NCoR, HDAC, and TAF-Iß in the repression process. It is also possible that other mechanisms independent of NCoR and TAF-Iß recruitment may contribute to THAP7-mediated repression, and it is likely that the histone-masking domain of THAP7 can function in the absence of corepressors to repress transcription by keeping histones hypoacetylated.
To date, no transcriptional target genes of THAP7 or other THAP proteins have been identified, and this will thus be of critical importance to understanding the physiological function of THAP domain proteins. It does not appear in transient transfection assays that THAP7 decreases transcription overall, because it did not affect the levels of a number of tested reporter genes (data not shown). Evidence clearly supports the idea that the THAP domains of THAP1 and the Drosophila p element transposase are site-specific, DNA-binding domains, although the p element transposase also possesses a high nonspecific DNA-binding activity (29, 42), and THAP7 also possesses a HID that is critical for transcriptional repression and chromatin targeting. TAF-Iß, in contrast, does not possess any known DNA-binding activity and is therefore likely to be targeted to chromatin via association with a DNA-binding protein such as nuclear hormone receptors or THAP7. Although we are actively searching for THAP7 endogenous target genes, the use of the Gal4 reporter system has nonetheless been an important tool to study the repressive mechanism of THAP7, as it has been instrumental in study of the mechanism of repression by several transcription factors, including nuclear receptors (43). It will be critical in the future to identify genomic targets of THAP7 as well as a THAP7 response element. Once these targets are identified, it will also be important to demonstrate that THAP7 represses these genes and that HDAC3, NCoR, and TAF-Iß are targeted to these THAP7-responsive promoters.
TAF-Iß has been implicated in numerous cellular pathways. It regulates adenoviral DNA replication (44, 45), inhibits the phosphatase activity of PP2A (33), possesses chromatin-remodeling activity (46), is a substrate of granzyme A and an inhibitor of the granzyme A-induced deoxyribonuclease NM23-H1 (32, 41), inhibits the acetylation of histone tails via histone masking (15), inhibits demethylation of DNA (47), activates transcription from chromatin templates in vitro (48), and regulates G2/M transition by inhibiting cyclin B-CDK1 activity (34). THAP7 expression did not affect PP2A activity or cyclin B-CDK activity in cell lysates, and it also had no affect on TAF-Iß expression levels. It remains to be determined whether THAP7 regulates the other activities of the multifunctional protein TAF-Iß.
In summary we show that human THAP7 associates with TAF-Iß in vitro and in cultured cells, and that, like TAF-Iß, THAP7 inhibits histone acetylation via histone masking. THAP7 is able to target histone hypoacetylation at targeted chromatin integrated promoters and is able to directly recruit TAF-Iß to these promoters. THAP7 is thus able to repress transcription by multiple mechanisms, both HDAC dependent and independent. Based on our results, we predict that other THAP domain proteins will be involved in regulating transcription and other chromatin-based processes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In Vitro Interaction Assays
GST fusion proteins were generated in BL21 E. coli cells induced for 90 min with 0.5 mM isopropyl-ß-D-thiogalactopyranoside. Cells were lysed by sonication in NET buffer [150 mM KCl, 20 mM Tris-HCl (pH 7.5), and 0.5 mM EDTA] containing 2% Triton and 0.7% sarkosyl. Proteins were then bound to glutathione-Sepharose and washed extensively with NET buffer containing 0.1% Nonidet P-40 (NP40). In vitro translated radiolabeled proteins were generated using the TNT in vitro translation system with [35S]methionine (Promega Corp., Madison, WI). Five microliters of in vitro translated, radiolabeled protein was incubated with equivalent amounts (
500 ng) of GST protein in 200 µl buffer containing 150 mM KCl, 20 mM Tris-HCl (pH 7.4), 5 mM MgCl2, 1 mM dithiothreitol (DTT), 10 µg/ml BSA, protease inhibitor cocktail, and 0.5% NP40 for 30 min and washed extensively with the same buffer; bound proteins were collected on glutathione-Sepharose beads and resolved by SDS-PAGE. Gels were fixed, dried, and analyzed using a phosphorimaging device.
Cell Culture and Transfections
293T cells were maintained in DMEM with 10% fetal bovine serum (FBS) containing 100 U/ml penicillin G sodium and 100 µg/ml streptomycin sulfate (Invitrogen Life Technologies, Inc., Carlsbad, CA). Before transfections with the indicated plasmids, cells were split so as to be at 5070% confluence the following day and transfected with Lipofectamine 2000 according to the manufacturers instructions (Invitrogen Life Technologies, Inc.). For coimmunoprecipitations, cells were harvested 2448 h after transfection.
Generation of THAP7-Inducible Stable Cell Line
THAP7 containing a 3x Flag carboxyl-terminal tag was cloned into the pTRE hygro vector and linearized by digestion with Xmn1. Two hundred and fifty nanograms of this pTRE 3x Flag THAP7 vector was transfected along with 750 ng pTet-tTS ts vector (predigested with PvuI), using FuGene, into the HEK 293 Tet on cell line. This cell line was grown in DMEM with 10% FBS in the presence of 50 µg/ml Geneticin (Invitrogen Life Technologies, Inc.) and 100 µg/ml hygromycin B (Roche, Indianapolis, IN) for selection of integrated plasmid. After 7 d of selection, colonies were selected, and the expression of 3x Flag THAP7 was monitored by immunoblot with anti-Flag antibodies after induction with doxycycline (0.12 µg/ml). Positive clones were maintained in the same medium, except with 50 µg/ml hygromycin for maintenance of the integrated plasmid.
Coimmunoprecipitations
Approximately 106 293 Tet on cells or 293 Tet on cells containing the integrated 3x Flag THAP7 construct were washed and pelleted in PBS. The cell pellets were lysed in 500 µl RIPA buffer [50 mM Tris-HCl (pH 7.4), 1% NP40, 150 mM NaCl, 0.25% sodium deoxycholate, 1 mM EDTA, 1 mM phenylmethylsulfonylfluoride (PMSF), and protease inhibitor cocktail (Roche)] for 10 min on ice. The lysates were cleared by centrifugation at 14,000 rpm in a microfuge for 10 min. The cleared lysates were then incubated overnight at 4 C with 50 µl anti-Flag agarose beads (Sigma-Aldrich Corp., St. Louis, MO). After extensive washing with RIPA buffer, 3x sodium dodecyl sulfate loading buffer was added to the agarose beads and boiled. Released proteins were subjected to SDS-PAGE. After transferring of proteins to nitrocellulose membranes, the membranes were blocked in Tris-buffered saline with 0.05% Tween 20 containing 5% nonfat milk (blocking buffer) for 10 min and incubated with anti-Flag polyclonal antibodies (1:1000; Sigma-Aldrich Corp.) or a monoclonal anti-TAF-Iß antibody in the blocking buffer, and immunoblots were visualized using ECL detection (Amersham Biosciences, Arlington Heights, IL).
Immunofluorescence
HeLa cells or NIH-3T3 cells were seeded onto coverslips so as to be approximately 50% confluent the next day. These cells were transfected with plasmid EGFP-THAP7 with Lipofectamine 2000 (Invitrogen Life Technologies, Inc.) according to the manufacturers instructions. Twenty-four hours after transfection, cells were fixed with 4% paraformaldehyde for 5 min, solubilized with 0.2% Triton X-100 for 30 min, washed with PBS with 2% BSA, and incubated with anti-TAF-Iß, anti-pp32, anti-PML, anti-NCoR (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-SMRT (Affinity Bioreagents, Golden, CO), anti-HP1
(Upstate Biotechnology, Inc., Lake Placid, NY), anti-SC-35 (Sigma-Aldrich Corp.), or anti-20S proteasome (Sigma-Aldrich Corp.) antibodies. Cells were washed three times in PBS, then incubated with the appropriate tetramethylrhodamine isothiocyanate-labeled secondary antibodies (Sigma-Aldrich) for 45 min and washed three times in PBS before mounting on glass slides. Images were captured with an Olympus AX70 epifluorescence microscope (New Hyde Park, NY) using a x40 lens.
HAT Assays
HAT assays were performed as described previously (15). Briefly, 1 pmol recombinant PCAF or p300 was incubated for 30 min at room temperature with 0.252 µg purified histone H3 or H4 (Roche) or purified nucleosomes in the presence of GST, GST-TAF-Iß, or GST-THAP7 in 25 µl buffer containing 50 mM Tris-HCl (pH 7.5), 10% glycerol, 0.1 mM EDTA, 0.1 mM PMSF, 200 mM KCl, 10 mM sodium butyrate, 0.6 mM DTT, and 0.15 µl [14C]acetyl-coenzyme A (50 µCi/ml; 1000 pmol/µl). For rescue experiments, an approximately equal molar amount of poly-L-lysine (average molecular weight, 10,000; Sigma-Aldrich Corp.), poly-L-arginine (average molecular weight, 10,000; Sigma-Aldrich Corp.), or histone H4 was added to the incubation mixture. Reaction products were subjected to SDS-PAGE, Coomassie stained, and analyzed by a phosphorimaging device.
HDAC Assay
Myc-tagged HDAC3 was in vitro transcribed and translated using the Promega TNT-translation system and was incubated with in vitro transcribed and translated THAP7, NCoR, or both in 200 µl coimmuoprecipitation buffer [150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1 mM PMSF, protease inhibitors, plus 1% NP40]. HDAC3 and bound proteins were immunoprecipitated with anti-Myc antibodies (1:1000) overnight and pulled down with protein G-agarose beads . Bound proteins were washed four times in coimmunoprecipitation buffer. Immunoprecipitates were then used in HDAC assays using the HDAC assay kit with fluorometric detection system (Upstate Biotechnology, Inc.) according to the manufacturers instructions. Experiments were repeated three times and were plotted with error bars representing SD of the data.
ChIP Assay
HeLa cells containing an integrated Gal4 reporter luciferase (HeLa DLR, BD Clontech) were transfected with Gal4 DBD or Gal4 DBD-THAP7 using Lipofectamine 2000. Twenty-four hours after transfection, approximately 106 cells were fixed with 1% formaldehyde for 15 min at room temperature, followed by the addition of 0.125 M glycine for 5 min at room temperature. Cells were then washed in PBS, spun down at 1,000 rpm, and resuspended in 200 µl ChIP lysis buffer [1% sodium dodecyl sulfate, 1 mM EDTA, and 50 mM Tris-HCl (pH 8.0)]. Cells were then sonicated for a total of 30 sec at level 3 on a Misonix Sonicator 3000 (Misonix Corp., Farmingdale, NY). After a 14,000 rpm spin, the supernatant was diluted 10-fold in ChIP dilution buffer [0.1% sodium dodecyl sulfate, 1.1% Triton X-100, 1 mM EDTA, 150 mM NaCl, and 20 mM Tris-HCl (pH 8.0)] and blocked with protein G-Sepharose beads and 20 µg sonicated salmon sperm DNA. After spinning down the beads at 3,000 rpm for 1 min, the supernatant was incubated overnight with antiacetylated histone H3 (Upstate Biotechnology, Inc.), anti-Gal4, anti-NCoR, anti-HDAC3, anti-TAF-Iß (Santa Cruz Biotechnology, Inc.), or anti-pp32 antibodies. The immunoprecipitated material was pulled down by incubation with protein G-Sepharose for 3 h, and beads were washed once with wash buffer 1 [0.1% sodium dodecyl sulfate, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, and 20 mM Tris-HCl (pH 8.0)], again with wash buffer 1 plus 350 mM NaCl, once with wash buffer 3 [0.25 M LiCl, 1% NP40, 1% sodium deoxycholate, 1 mM EDTA, and 10 mM Tris-HCl (pH 8.0)], and twice with Tris-EDTA (pH 8.0). Immune complexes were eluted in 200 µl elution buffer (1% sodium dodecyl sulfate and 0.1 M sodium bicarbonate). Cross-links were reversed after the addition of 200 mM NaCl by incubation overnight at 65 C. DNA from immunoprecipitates or from 0.1% of input were then isolated using Qiagen spin columns and analyzed by PCR using the following primers corresponding to the reporter luciferase promoter: forward primer, CCTGCAGGTCGGAGTACTGT; and reverse primer, GGTACCCGGGGATCCATTAT.
siRNA and Reporter Gene Studies
TAF-Iß specific siRNA or a control siRNA (Dharmacon, Lafayette, CO; 100 nM) were transfected into 293T cultured in DMEM and 10% FBS cells using Dharmafect transfection reagent 1 (Dharmacon) according to the manufacturers instructions. Forty-eight hours after transfection, cells were seeded into 96-well dishes and subsequently transfected with 100 ng Gal4 MH100 thymidine kinase-luciferase reporter construct, 10 ng Renilla luciferase, and 100 ng of either Gal4 DBD alone or Gal4 DBD-THAP7 (per six wells) using Lipofectamine 2000. Cells were harvested in lysis buffer, and dual luciferase assays were performed according to the manufacturers instructions (Promega Corp.).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
First Published Online September 29, 2005
Abbreviations: CBP, cAMP response element-binding protein (CREB)-binding protein; CDK1, cyclin-dependent kinase-1; ChIP, chromatin immunoprecipitation; DAP, death-associated protein; DTT, dithiothreitol; ER
, estrogen receptor
; FBS, fetal bovine serum; GFP, green fluorescence protein; GST, glutathione-S-transferase; HAT, histone acetyltransferase; HID, histone-interacting domain; HP1
, heterochromatin protein 1
; INHAT, inhibitor of acetyltransferase; NP40, Nonidet P-40; PCAF, p300/CBP-associated factor; PKR, protein kinase R; PML, promyelocytic leukemia; PMSF, phenylmethylsulfonylfluoride; PP2A, protein phosphatase 2A; SC-35, splicing component 35; siRNA, small interfering RNA; SMRT, silencing mediator of retinoid and thyroid receptors; TAF-Iß, template-activating factor-Iß; THAP7, thanatos-associated protein-7; TSA, trichostatin A.
Received for publication June 23, 2005. Accepted for publication September 20, 2005.
| REFERENCES |
|---|
|
|
|---|
-associated protein, template-activating factor Iß, inhibits acetylation and transactivation. Mol Endocrinol 17:6778
-associated protein alters receptor-deoxyribonucleic acid interactions and represses receptor-mediated transcription. Mol Endocrinol 18:26492645
in a death regulatory pathway. Science 299:223226NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
A. K. Ewing, M. Attner, and D. Chakravarti Novel Regulatory Role for Human Acf1 in Transcriptional Repression of Vitamin D3 Receptor-Regulated Genes Mol. Endocrinol., August 1, 2007; 21(8): 1791 - 1806. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kato, M. Miyaji-Yamaguchi, M. Okuwaki, and K. Nagata Histone acetylation-independent transcription stimulation by a histone chaperone Nucleic Acids Res., February 16, 2007; 35(3): 705 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cayrol, C. Lacroix, C. Mathe, V. Ecochard, M. Ceribelli, E. Loreau, V. Lazar, P. Dessen, R. Mantovani, L. Aguilar, et al. The THAP-zinc finger protein THAP1 regulates endothelial cell proliferation through modulation of pRB/E2F cell-cycle target genes Blood, January 15, 2007; 109(2): 584 - 594. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |