help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2005-0318
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.
Right arrow Articles by Garabedian, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.
Right arrow Articles by Garabedian, M. J.
Molecular Endocrinology 20 (3): 560-572
Copyright © 2006 by The Endocrine Society

MED14 and MED1 Differentially Regulate Target-Specific Gene Activation by the Glucocorticoid Receptor

Weiwei Chen, Inez Rogatsky and Michael J. Garabedian

Departments of Microbiology (M.J.G.), Urology (M.J.G.), and Pharmacology (W.C.) and New York University Cancer Institute, New York University School of Medicine, New York, New York 10016; and Hospital for Special Surgery, Cornell University School of Medicine (I.R.), New York, New York 10021

Address all correspondence and requests for reprints to: Dr. Michael J. Garabedian, Department of Microbiology, New York University Cancer Institute, New York University School of Medicine, 550 First Avenue, New York, New York 10016. E-mail: garabm01{at}med.nyu.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Mediator subunits MED14 and MED1 have been implicated in transcriptional regulation by the glucocorticoid receptor (GR) by acting through its activation functions 1 and 2. To understand the contribution of these Mediator subunits to GR gene-specific regulation, we reduced the levels of MED14 and MED1 using small interfering RNAs in U2OS-hGR osteosarcoma cells and examined the mRNA induction by dexamethasone of four primary GR target genes, interferon regulatory factor 8 (IRF8), ladinin 1, IGF-binding protein 1 (IGFBP1), and glucocorticoid-inducible leucine zipper (GILZ). We found that the GR target genes differed in their requirements for MED1 and MED14. GR-dependent mRNA expression of ladinin 1 and IRF8 required both MED1 and MED14, whereas induction of IGFBP1 mRNA by the receptor was dependent upon MED14, but not MED1. In contrast, GILZ induction by GR was largely independent of MED1 and MED14, but required the p160 cofactor transcriptional intermediary factor 2. Interestingly, we observed higher GR occupancy at GILZ than at the IGFBP1 or IRF8 glucocorticoid response element (GREs). In contrast, recruitment of MED14 compared with GR at IGFBP1 and IRF8 was higher than that observed at GILZ. At GILZ, GR and RNA polymerase II were recruited to both the GRE and the promoter, whereas at IGFBP1, RNA polymerase II occupied the promoter, but not the GRE. Thus, MED14 and MED1 are used by GR in a gene-specific manner, and the requirement for the Mediator at GILZ may be bypassed by increased GR and RNA polymerase II occupancy at the GREs. Our findings suggest that modulation of the Mediator subunit activities would provide a mechanism for promoter selectivity by GR.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A FUNDAMENTAL QUESTION that remains poorly understood is how DNA-binding regulatory proteins direct the specificity of transcription. Naturally, cell type-specific expression of sequence-specific DNA-binding proteins can account for tissue- and/or promoter-specific regulation (1). However, the vast majority of transcriptional regulators are not themselves cell type specific, yet display cell type- and/or promoter-specific regulatory properties. Thus, additional mechanisms must be employed by ubiquitous factors to confer specificity (2, 3). Recently, components that serve as a functional bridge between transcription factors and the RNA polymerase initiation complex, such as the Mediator coactivator complex, have been identified and shown to play an important role in activated transcription (4, 5). It has been suggested that combinatorial assembly of individual subunits of this complex might render promoters differentially responsive to a particular activator. For example, endogenous Mediator subcomplexes with and without MED1 have been described that allow promoter-selective functions depending on the activator (6, 7). The Mediator complex can also adopt distinct conformations depending upon the transcription factor with which it associates (8). However, evidence linking the Mediator to selective gene expression by a given transcription factor is scarce.

The glucocorticoid receptor (GR) is a ligand-activated and ubiquitously expressed transcription factor that controls numerous gene networks (9). Upon hormone binding, GR associates with specific genomic sites and assembles regulatory complexes to either activate or repress target genes in a cell- and promoter-specific manner. GR harbors two activation domains: an N-terminal activation function 1 (AF1) and a C-terminal AF2 (10, 11). Our laboratory has previously shown that vitamin D receptor-interacting protein 150/thyroid hormone receptor associated protein 170 (hereafter termed MED14) and vitamin D receptor-interacting protein 205/thyroid hormone receptor associated protein 220 (hereafter termed MED1) interact with GR through its AF1 and AF2 domains, respectively, and increase GR transcriptional activation in cell-based reporter assays (12). Recently, Rogatsky et al. (13) identified 10 GR-inducible target genes in U2OS osterosarcoma cells that differ in their requirements for AF1 and AF2. For example, GR induction of glucocorticoid-inducible leucine zipper (GILZ) and interferon regulatory factor 8 (IRF8) are largely AF1 independent, because a GR mutant with a disrupted AF1 core (14) is competent for activating these genes similarly to the wild type. Interestingly, this mutation also decreases the interaction of the receptor with MED14 (12). In contrast, ladinin 1 (LAD1) and IGF-binding protein 1 (IGFBP1) were sensitive to this AF1 mutation. The expressions of GILZ, LAD1, and IRF8 were compromised by the AF2 mutation E773R, which substitutes a key residue required for coactivator binding, whereas IGFBP1 was less sensitive to this alteration (13, 15). These findings suggest that GR AF1 and AF2 function in a gene-specific fashion, perhaps through differential recruitment of the Mediator complex.

In this study we test the hypothesis that distinct Mediator subunits direct gene-specific regulation by GR. We examined the dependence of GR primary target genes on MED1 and MED14 subunits by analyzing their recruitment to target promoters and their contribution to gene regulation.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Differential Induction Kinetics and Dose Response of Primary GR Target Genes
To understand the mechanism of Mediator-dependent gene regulation by GR, we analyzed a set of four GR-responsive genes, IRF8, LAD1, IGFBP1, and GILZ, in U2OS osteosarcoma cells stably expressing GR. We focused on these genes because they were previously shown to be strongly induced by glucocorticoids and displayed distinct requirements for AF1 and AF2 (13) (Table 1Go). We first sought to determine whether these genes exhibited differences in their time- and dexamethasone (Dex)-dependent mRNA accumulation as an indication of different cofactor requirements for receptor-dependent gene expression (Fig. 1Go).


View this table:
[in this window]
[in a new window]
  		Table 1. Target Gene Response to GR Mutations

 

Figure 1
View larger version (20K):
[in this window]
[in a new window]
  		Fig. 1. Temporal and Ligand-Dependent Induction of GR Target Genes

A, Kinetics of target gene induction by GR. U2OS-hGR cells were treated with 100 nM Dex for the indicated times. Total RNA was harvested, reverse transcribed, and subjected to real-time PCR with primer pairs to the indicated genes; Rpl19 RNA was used as an internal control for normalization. B, Dose response of target gene induction by Dex. Cells were treated with ethanol vehicle (0) or the indicated amount of Dex for 2 h, and total RNA was analyzed by real-time PCR as described above. Values given are the mean of three replicates within a single experiment that varied by less than 5%. Each experiment was repeated at least three times, and the same patterns were observed.

 
The kinetic analysis revealed that IGFBP1 and GILZ mRNAs were induced by 15 min of hormone treatment, whereas the induction of LAD1 and IRF8 mRNA by Dex occurred later, after 30 and 60 min of Dex treatment, respectively (Fig. 1AGo). The LAD1, IGFBP1, and IRF8 mRNAs continued to increase exponentially throughout the 90-min time course, whereas GILZ mRNA, despite being induced by Dex within 15 min, did not accumulate significantly over the next 75 min (Fig. 1AGo). We can readily detect the basal level of activity of the target genes using real-time PCR (rank order of basal mRNA expression: GILZ>IRF8>IGFBP1>LAD1). Therefore, the differential kinetics of induction of the GR target genes reflect true temporal differences in induction patterns, rather than the lack of sensitivity of the assay at early time points. Thus, distinct patterns of hormone-dependent mRNA accumulation are evident at endogenous GR target genes.

Next, we measured the mRNA accumulation of GILZ, LAD1, IGFBP1, and IRF8 as a function of the Dex concentration. The concentration of Dex required for the induction of GILZ, LAD1, and IGFBP1 ranged between 0.1 and 1 nM, whereas the dose needed for activation of the IRF8 gene was higher (1–10 nM; Fig. 1BGo). This suggests that at low ligand concentrations, GR is more efficient at engaging in the functional interactions that are necessary for transcriptional activation at the GILZ, LAD1, and IGFBP1 promoters compared with IRF8. The gene-specific kinetics and dose response to Dex suggest that different mechanisms may underlie the induction of GILZ, IGFBP1, LAD1, and IRF8 by GR in U2OS cells.

MED14 and MED1 Are Differentially Required for Dex-Dependent Activation of GR Target Genes
The Mediator complex has been shown to link transcription factors to the RNA polymerase transcription initiation complex (5). Our laboratory has previously shown that MED14 and MED1 interact with GR through AF1 and AF2, respectively, and increase GR-dependent transcriptional activation in transient transfection assays (12). To assess whether MED14 and MED1 are used differentially at GR target genes, we silenced the expression of MED14 and MED1 using small interfering RNA (siRNA) and measured LAD1, IGFBP1, GILZ and IRF8 mRNAs in the absence and presence of Dex by real-time PCR. The siRNAs specifically reduced MED14 and MED1 in cells at both the mRNA and protein levels, whereas the expression of GR and the control steroid receptor coactivator 1 (SRC-1) cofactor were unaffected (Fig. 2Go, A and B).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2. Distinct Requirements of MED14 and MED1 for Basal and Dex-Dependent Activation of Endogenous GR Target Genes

Reduction in the levels of MED14 and MED1 by siRNA. A, U2OS-hGR cells were transfected with siRNA against MED1 (siMED1), MED14 (siMED14), or a control luciferase siRNA (siCTRL), and total RNA was analyzed by real-time PCR as described in Fig. 1Go. Reduction of each gene by siRNA relative to the control is shown. Data were averaged from three independent experiments, and the error bar represents the SD. B, U2OS-hGR cells were transfected with siMED1, siMED14, or siCTRL where indicated. After 48 h, proteins were extracted, and an immunoblot was performed using antibodies against MED14, MED1, SRC-1, GR, and tubulin. C and D, Response of GR target genes to the silencing of MED14 or MED1. U2OS-hGR cells were transfected with siRNA targeting MED14 (siMED14), MED1 (siMED1), a luciferase control (siCTRL1), or a pool of nonspecific siRNAs (siCTRL2), then treated with 100 nM Dex (C; induced) or ethanol vehicle (D; basal) for 2 h, and total RNA was analyzed by real-time PCR. For each gene, mRNA levels in cells transfected with siMED14 and siMED1 were plotted relative to the expression levels in the siCTRL-transfected cells, which were set at 1. Data were averaged from three independent experiments, and the error bar represents the SD.

 
Quantitative analysis of Dex-inducible mRNAs revealed that the reduction in MED14 significantly decreased induction of IGFBP1, LAD1, and IRF8 compared with control siRNA-treated cells (Fig. 2CGo). In contrast, the hormone-dependent expression of GILZ was only slightly affected by the down-regulation of MED14. Basal expression of IGFBP1 and IRF8 decreased slightly, whereas LAD1 was dramatically reduced (80%) compared with control cells (Fig. 2DGo). The same gene-specific requirement for MED14 was observed using an siRNA targeting a different region of MED14 (supplemental Fig. 1, which is published on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). In addition, defects in the glucocorticoid responsiveness of IGFBP1, GILZ, and IRF8 could be rescued by transient overexpression of a MED 14 derivative that is resistant to siRNA silencing (supplemental Fig. 2). These results suggest that the observed changes were MED14 specific and not the result of off-target effects of siRNA.

Interestingly, silencing of MED1 dramatically reduced the Dex-dependent activation of LAD1 (55% reduction relative to control), but only modestly affected IRF8 (30% reduction) and had little effect on the expression of IGFBP1 and GILZ (<10% reduction). Similar trends were observed when basal expression was assessed, with the exception of GILZ, where the basal RNA level was reduced by siMED1 by 40% (Fig. 2DGo). Simultaneous silencing of MED1 and MED14 did not result in any further reduction in the Dex-dependent expression of the four genes tested (supplemental Fig. 3).

Because MED1 and MED14 are components of the large Mediator complex, it is possible that the reduction in MED1 or MED14 may disrupt the integrity of the entire Mediator complex, thereby altering GR-dependent gene expression. It has previously been demonstrated that the loss of MED1 does not substantially alter the subunit composition of the residual Mediator complex (16). However, this has not been established for MED14. Therefore, we asked whether MED14 is required for the integrity of the Mediator complex. We used VP16 activity, which is known to be dependent upon MED25 (17, 18), as an indicator of the integrity of the Mediator complex. As shown in Fig. 3Go, the transcriptional activity of VP16 was not compromised when MED14 was reduced, whereas GR-dependent transcription was decreased. Therefore, the loss of MED14 does not substantially alter the functional integrity of the Mediator complex and suggests that GR uses specific Mediator components to control gene-specific transcription. Based on these findings, the GR-regulated genes examined can be grouped into distinct classes: IGFBP1 depends on MED14 function, rather than MED1 (class I); LAD1 and IRF8 transcriptional activation requires both MED14 and MED1 (class II); finally, GILZ is largely independent of either MED14 or MED1 (class III).


Figure 3
View larger version (14K):
[in this window]
[in a new window]
  		Fig. 3. Mediator Complex Lacking MED14 Supports VP16-Dependent Transactivation

A, U2OS-hGR cells were transfected with a plasmid containing the Gal4-fused VP16 activation domain, a luciferase reporter gene driven by five Gal4-binding sites upstream of E1b promoter along with siMED14 or control siRNA (siCTRL), and assayed for luciferase activity. Values are the mean of triplicate samples, with the error bars representing the SD. B, U2OS-hGR cells were transfected with a luciferase reporter gene driven by the mouse mammary tumor virus promoter together with siMED14 or siCTRL, treated with ethanol vehicle or Dex (100 nM), and assayed for luciferase activity. RLU, Relative light units.

 
MED1 and MED14 Are Recruited to the Promoters of GR Target Genes
As a step toward understanding the gene-specific requirements for the Mediator subunits, we employed a chromatin immunoprecipitation (ChIP) assay to identify the genomic segments in the regulatory regions of the IGFBP1, GILZ, IRF8, and LAD1 genes occupied by GR, MED14 ,and MED1 in U2OS cells. The glucocorticoid response element (GRE) at the IGFBP1 promoter has previously been identified (19). Recently, the GREs in the GILZ (20, 21, 22) and IRF8 upstream regulatory regions were identified and validated in functional assays (Rogatsky, I., unpublished observation). The LAD1 regulatory region has not been characterized.

For the ChIP assay, U2OS-hGR cells were treated with either ethanol vehicle or Dex for 2 h, then cross-linked with formaldehyde. The chromatin was sheared, and the cross-linked protein-DNA complexes were precipitated with antibodies against GR, MED14, MED1, or control IgG. PCR was then performed on the precipitated DNA fragments to amplify the GR-binding sites within the regulatory regions (Fig. 4AGo). Regions 2–4 kb upstream of the same promoter were amplified as a control for ChIP specificity. We found that GR, MED1, and MED14 associate with the GRE in the regulatory regions of IGFBP1, GILZ, and IRF8 genes in a Dex-dependent manner (Fig. 4BGo). We also have examined MED14 recruitment to the LAD1 gene. Recall that a reduction in MED14 had a substantial effect on the basal level of LAD1 expression (Fig. 2DGo). Our results show that MED14 is recruited to the LAD1 gene in a constitutive manner to a region approximately 1000 bp upstream from the start site of transcription (supplemental Fig. 4). This region contains numerous potential binding sites for transcription factors, such as specificity protein 1 (Sp1), that use the Mediator as a coactivator and could account for the change in basal activity when MED14 levels are reduced by siRNA. No Dex-dependent recruitment of GR was observed within a region 4 kb upstream of the LAD1 gene; therefore, analysis of this gene was not pursued.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		Fig. 4. GR, MED14, and MED1 Are Recruited to the GR Target Genes in a Dex-Dependent Manner

A, Schematic depiction of GILZ, IGFBP1, and IRF8 regulatory regions. GR-binding sites are shown as black boxes, whereas the hatched boxes upstream represent regions that do not contain GREs and serve as a negative control for the ChIP assay. The arrows represent the transcription start site. B, GR, MED14, and MED1 recruitment to GILZ, IGFBP1, and IRF8. U2OS-hGR cells were treated with vehicle or Dex for 2 h, and ChIP assays were performed with antibodies against GR, MED14, MED1, and rabbit IgG as a negative control. GR-binding sites were amplified by PCR using gene-specific primer pairs, and the PCR products were resolved on agarose gels, visualized by ethidium bromide staining, and quantified using National Institutes of Health Image 1.63 software. C, Recruitment relative to input. The signal of the PCR product representing 1% input was arbitrarily set at 1. D, Recruitment relative to GR. Data were averaged from three independent ChIP assays. Data were averaged from three independent experiments. The error bar represents the SD. Student’s t test was applied to assess significance. P < 0.1 was considered significant. Asterisks show statistically significant changes.

 
Quantification of Dex-dependent GR occupancy relative to the input revealed that more GR was recruited to GILZ (0.94 ± 0.35%) than to IGFBP1 (0.46 ± 0.3%) or IRF8 (0.15 ± 0.06%; Fig. 4Go, B and C). A similar result was obtained using a GR antibody that targets a different domain of the receptor (supplemental Fig. 5). The Dex-dependent recruitment of MED14 relative to the input showed a similar signal between GILZ (0.32 ± 0.17%) and IGFBP1 (0.37 ± 0.20%), but somewhat less at IRF8 (0.16 ± 0.07%). The Dex-dependent recruitment of MED1 was significantly more at GILZ (0.23 ± 0.14%) and IGFBP1 (0.22 ± 0.04%) than at IRF8 (0.10 ± 0.05%) regulatory regions.

We also examined whether the relative ratio of GR to selective Mediator components is an important determinant in the gene-specific effects observed on silencing MED14. Using the recruitment of GR as a baseline, the amount of MED1 or MED14 in relation to GR was determined among the genes (Fig. 4DGo). The occupancy of MED14 at IGFBP1 and IRF8 compared with GR was significantly higher than that observed at the GILZ regulatory region (rank order: IGFBP1>IRF8>>GILZ), and this pattern held true at earlier time points (supplemental Fig. 6). This parallels the sensitivity of these genes to MED14 silencing (rank order: IGFBP1~IRF8>GILZ). In contrast, the recruitment of MED1 compared with that of GR is similar among the genes (Fig. 4DGo). Therefore, the greater the MED14 recruitment relative to GR, the larger the effect of silencing MED14 has on transcriptional activation of a given gene. Thus, MED14 is an important determinant for GR hormone-dependent transcription of IGFBP1 and IRF8, but not GILZ.

GR-Mediated Induction of GILZ Requires Transcriptional Intermediary Factor (TIF)
In addition to the Mediator complex, a well-established family of cofactors that confer transcriptional activation by GR and other steroid hormone receptors are the p160 proteins [SRC1, TIF2/GR-interacting protein (GRIP)1, and steroid/nuclear receptor-associated coactivator 3/activator of thyroid hormone], which are recruited to the GR AF2 domain in an agonist-dependent manner (23, 24, 25, 26, 27). The p160 proteins modify chromatin structure through histone acetylation and methylation via associations with cAMP response element binding protein-binding protein and coactivator-associated arginine methyltransferase 1 (28). Based on kinetic studies, a cyclic recruitment of the Mediator vs. the p160 complexes to target promoters was proposed (29, 30); however, the relative contributions of these complexes to transcriptional activation of specific GR target genes are unknown. Given that siMED14 and siMED1 had distinct effects on the induction of IGFBP1, IRF8, LAD1, and GILZ, we examined the consequences of knocking down the expression of TIF2 on these genes. TIF2 appears to be the most abundant p160 in U2OS cells (31). Introducing siTIF2 into U2OS-GR cells specifically reduced the expression of TIF2 mRNA by 75% compared with cells transfected with control siRNA (Fig. 5AGo). Analysis of Dex-dependent induction of GR targets revealed that IRF8 and IGFBP1 were unaffected by TIF2 down-regulation, LAD1 was slightly reduced, whereas the induction of GILZ was dramatically impaired by siTIF2 (Fig. 5BGo). Basal activity was largely unaffected by TIF2 knockdown (not shown). These results implicate p160 TIF2 in conferring GR-dependent transcriptional activation of the GILZ gene.


Figure 5
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 5. GR-Mediated Induction of GILZ Requires TIF2/GRIP1

Dex-dependent induction of GILZ expression is mediated by TIF2. U2OS-hGR cells were transfected with an siRNA targeting TIF2 (siTIF2) or a nonspecific siRNA (siCTRL), then treated with 100 nM Dex (induced) for 2 h, and total RNA was analyzed by real-time PCR. The mRNA abundance of TIF2 (A) and IRF8, GILZ, IGFBP1, and LAD1 (B) was assessed by qPCR using Rpl19 as a normalization control. The mRNA levels in cells transfected with siTIF2 were plotted relative to the expression levels in the siCTRL-transfected cells, which were set at 1. Data are averaged from duplicate samples, with the error bars representing the range of the mean. The experiment was repeated and produced similar results.

 
Glucocorticoid-Dependent Recruitment of RNA Polymerase II to the Promoter and Enhancer of GILZ
Considering that the induction of GILZ by GR appears to be independent of MED14 and MED1, we asked whether GR bound to the enhancer region GREs could recruit RNA polymerase II. To test this, we assayed the occupancy of RNA polymerase II at the promoters and GRE-containing enhancers of GILZ and IGFBP1 by ChIP. The GILZ regulatory region contains multiple clustered GREs that reside approximately 1.7 kb upstream from the core promoter, whereas the IGFBP1 regulatory region harbors two GREs in close proximity to the promoter (Fig. 6AGo and supplemental Fig. 7). We found that RNA polymerase II was recruited to the promoters of GILZ and IGFBP1 in a Dex-dependent manner. However, RNA polymerase II was not detected at the IGFBP1 GRE (Fig. 6BGo). Interestingly, RNA polymerase II was recruited to the GRE enhancer of GILZ in a Dex-dependent manner (Fig. 6Go, B and C). The recruitment of RNA polymerase II to the promoter and enhancer of GILZ, but not to the intervening region (Fig. 6Go, C and D), supports the idea that GR bound at the GRE can bring RNA polymerase II to the GILZ promoter through DNA looping, a mechanism recently described for the regulation of the prostate-specific antigen promoter by the androgen receptor (32, 33). Our findings strongly suggest that GR at GILZ circumvents the requirement for the Mediator and recruits, either directly or indirectly, RNA polymerase II, whereas at IGFBP1, GR requires the Mediator to engage RNA polymerase II.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 6. Glucocorticoid-Dependent Recruitment of RNA Polymerase II to the Promoter and Enhancer of GILZ

A, Schematic representation of GILZ and IGFBP1 regulatory regions showing the locations of the primer pairs used in the ChIP assays. The black boxes indicate GR-binding sites, and the hatched boxes upstream represent regions that served as a negative control for the ChIP assay. The open boxes designate the promoter region. The transcription start site (TSS) is denoted by an arrow. B, Polymerase II (Pol II) occupancy at the GILZ and IGFBP1 regulatory regions. U2OS-hGR cells were treated with vehicle or Dex for 2 h, and a ChIP assay was performed as described above using gene-specific primer pairs (Table 3Go). The PCR products were resolved on an agarose gel and visualized by ethidium bromide staining. C, Pol II occupancy along the GILZ regulatory region was determined by ChIP as described above. D, PCR products from C were quantified as described in Fig. 4Go. The PCR signal with 1% input was arbitrarily set at 1. Fold enrichment was determined by normalizing to the input intensity.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Previous studies have revealed that coactivators enable GR to regulate transcription via RNA polymerase II (2). However, these studies have largely focused on artificial reporter genes rather than natural targets of the transcription machinery (12). Although informative, such an approach cannot address the potential diversity that coactivators contribute to GR transcriptional activation at endogenous target genes. In this study we compared the requirement for two GR coactivators, MED14 and MED1, at multiple GR-regulated genes with distinct regulatory element composition and promoter architecture. Our findings suggest that elimination of MED14 affects GR responsiveness at some promoters (LAD1, IGBP1, and IRF8), but not others (GILZ). Thus, GR uses distinct Mediator components to control gene-specific transcription.

The precise mechanism underlying GR-dependent gene-specific regulation by the Mediator is not fully understood. Context effects introduced by differences in GREs, core promoters, chromatin packaging, or other transcription factors could influence the activities of the Mediator and may contribute to promoter-specific expression of GR target genes. For example, the binding of GR to MED14 may induce a specific Mediator conformation, which facilitates transcriptional activation at certain promoters. An alternate conformation, induced upon binding of GR to MED1, may regulate transcription at a different promoter. Elegant structural analysis of the Mediator complex bound to distinct activators supports this idea (6, 8, 34).

Although GR induction of IRF8 and IGFBP1 are Mediator dependent, GR activation of GILZ does not rely upon either MED14 or MED1. One possibility we considered was that MED1 and MED14 are simultaneously required at GILZ. This appears unlikely, however, because the concomitant reduction of MED1 and MED14 had little effect on GR regulation of GILZ. Another possibility is that the gene-specific requirement for MED1 and MED14 depends on specific sequences or number of GREs. For example, GR bound at the GILZ GRE, through allosteric changes imparted by the DNA (35), might adopt a conformation with a low affinity for Mediator subunits, but a high affinity for other coactivators (e.g. p160) or general transcription factors (e.g. transcription factor II D) that recruit RNA polymerase II, thus bypassing the requirement for the Mediator. Consistent with this idea is a comparatively low occupancy of MED1 and MED14 to GR at GILZ compared with IGFBP1 and IRF8 and the finding that GILZ is sensitive to knockdown of the p160 TIF2/GRIP1, whereas the Med14-sensitive genes, IRF8 and IGFBP1, are largely unaffected by a reduction in TIF2 levels. Although there is a small effect of MED14 reduction on GILZ induction by GR, and this is probably due to the interaction of Mediator with the GILZ regulatory region through a cooperating factor.

The total number of GREs in a given regulatory region might also influence the requirement for the Mediator. Interestingly, GILZ harbors four consensus GREs within the GR-binding fragment, and three of the four sites contribute to GILZ GRE activity (20). In contrast, IGFBP1 (19) and IRF8 (Rogatsky, I., unpublished observation) have noncanonical GREs, and GR occupancy at IGFBP1 and IRF8, compared with GILZ, is low. Such weak GR binding to DNA may prejudice genes toward Mediator-dependent RNA polymerase II recruitment.

The GR target genes analyzed were previously shown to differ in their requirements for AF1 and AF2 (13). For example, GR induction of GILZ and IRF8 is largely AF1 independent, as defined by the GR mutant 30IIB that disrupts the AF1 core and reduces AF1 activity (14). We have also previously shown that this receptor mutation decreases interaction with MED14 (12). This apparent discrepancy between the resistance of IRF8 activation to an AF1 mutation and its sensitivity to siMED14 may reflect the ability of GR to engage MED14 through a non-AF1 domain. Alternatively, another transcription factor that cooperates with GR could recruit MED14 to the IRF8 regulatory region, thus contributing to Mediator-dependent regulation. Consistent with this latter idea is the finding that MED14 and MED1 occupy a site approximately 1200 bp upstream of the IRF8 GRE in a Dex-dependent manner. This DNA regulatory region is predicted to contain Sp1- and p65- (nuclear factor-{kappa}B) binding sites, which recruit transcription factors that have been shown to be Mediator dependent (36, 37) and, in the case of Sp1, have been shown to cooperate synergistically with GR to enhance transcription (38).

The lack of sensitivity of GILZ to siMED14 and to a mutation in AF1 is consistent with Mediator-independent phenotype of GILZ activation by GR. Consistent with the lack of a strict requirement for GR AF1 in the activation of GILZ is the finding that thymocytes from mice expressing a ligand-binding GR fragment devoid of the N-terminus still induced GILZ, albeit to a lesser degree than the wild-type GR (39). The expression of GILZ is, however, compromised by the AF2 mutation E773R, which substitutes a key residue required for coactivator binding, including MED1 (13, 15). Yet, siMED1 does not affect GILZ induction by GR, suggesting that an interaction between GR and a different AF2 cofactor, such as a p160 family member, is probably important for GILZ induction by GR.

Indeed, we show that TIF2/GRIP1 is indispensable in mediating GR transcriptional activation at GILZ. Such differential regulatory mechanisms may contribute to the distinct kinetic and hormonal induction profiles of the target genes examined. For example, the array of GREs at GILZ may facilitate GR recruitment at low hormone concentrations and result in rapid activation of the promoter over time.

The MED1 dependence of the GR target genes tested does not appear to be associated with the requirement for AF2, with the exception of the LAD1 gene. The LAD1 gene appears to be regulated by GR in a way that is distinct from the other genes tested. We were unable to identify a GR-binding site by ChIP within a region 4 kb upstream of the LAD1 transcription start site despite potential GREs detected by computer analysis. Fusion of the upstream regulatory region of LAD1 to a luciferase reporter did not support GR-mediated enhancement (Chen, W., and M. J. Garabedian, unpublished observation), unlike GILZ (20) and IRF8 (Rogatsky, I., unpublished observation). Both basal and Dex-induced LAD1 mRNA expressions were sensitive to a reduction in either MED1 or MED14. Although it is tempting to speculate that the induction of LAD1 by GR may reflect a distinct mode of regulation that relies on the nonnuclear action of GR (40), two pieces of evidence argue against this. First, previous results reported by Rogatsky et al. (13) demonstrate that LAD1 induction by GR is sensitive to a mutation that disrupts receptor dimerization, which suggests that cooperative DNA binding by GR is important for the induction of LAD1. Second, we examined the activation of LAD1 by GR with a single point mutation in the DNA-binding domain (K422E) that largely eliminates DNA binding to GRE (41). This derivative fails to activate the expression of the LAD1 gene (supplemental Fig. 9). In light of these findings, our data suggest that LAD1 is most likely being regulated by GR through direct DNA binding, and that GR is being recruited to a region(s) other than those we analyzed by ChIP. LAD1 may represent yet another type of GR regulatory mechanism that we have yet to fully elucidate.

Based on these findings, we present models describing the role of Mediator in GR transcriptional activation of the IGFBP1, IRF8, and GILZ genes. For IGFBP1, the MED14-dependent induction by GR reflects a direct interaction of AF1 with MED14 (Fig. 7AGo). This complex, in turn, recruits RNA polymerase II to the IGFBP1 promoter to initiate transcription. Interestingly, although the RNA polymerase II occupancy at the IGFBP1 promoter is Dex dependent, the enrichment is less dramatic than that of GILZ and IRF8 (not shown). Given the strong and rapid IGFBP1 mRNA induction after Dex treatment, the apparent low RNA polymerase II occupancy may indicate a role for the Mediator in enhancing the rate of reinitiation by RNA polymerase II and thus increasing the transcription efficiency of this gene.


Figure 7
View larger version (25K):
[in this window]
[in a new window]
  		Fig. 7. Models for GR Activation of Target Genes

A, For IGFBP1, GR binds and recruits the Mediator complex via MED14 through GR AF1, which, in turn, recruits the RNA polymerase II transcription machinery (RNAP II). B, GR binds to the IRF8 regulatory region and recruits MED14 via an alternative non-AF1 domain (a) or indirectly through another transcription factor (b). C, At GILZ, we speculate that GR uses TIF2 to facilitate chromatin remodeling at the GREs and recruits RNAP II independently of the Mediator, most likely through another cofactor (hatched).

 
IRF8 induction appears to be MED14 dependent, but AF1 independent, perhaps suggesting that a GR domain different from the AF1 core recruits MED14 (Fig. 7BaGo) or that MED14 is recruited through another transcription factor that cooperates with GR to facilitate the assembly of the RNA polymerase II initiation complex (Fig. 7BbGo).

The GILZ gene is regulated through multiple GREs at the enhancer region, which may supplant its requirement for the Mediator complex (Fig. 7CGo). We propose that after binding to the GREs and chromatin remodeling by TIF2, GR can recruit RNA polymerase II independently of the Mediator. This rather simple mode of regulation is reminiscent of bacterial systems where activators bind DNA and exert effects on RNA polymerase. It is interesting to note that GILZ is induced by GR in a wide variety of cell types, including T cells (42), B cell-derived lymphoma Raji and IM-9 cells (Rogatsky, I., unpublished observations), erythroid progenitor cells (43), macrophages (44), A549 human lung adenocarcinoma (20), U2OS (13), and mouse embryonic fibroblasts (Wang, J. C., and M. J. Garabedian, unpublished observations), whereas IRF8 (45) and IGFBP1 (19) are more restricted in their expression to cells of hemopoietic and hepatic lineages, respectively.

The Mediator is important in GR promoter selectivity and activity. In addition, some genes, such as GILZ, appear to functionally bypass the requirement for specific Mediator components. Such a pathway may have evolved to enable the pan activation of genes by GR across multiple cell types, whereas the Mediator-dependent pathway could potentially confer cell type- and/or promoter-specific regulation depending on the concentration of, for example, MED14 within a given cell type. It is interesting to note that MED14 is X-linked and fails to undergo X-chromosome inactivation (46, 47). This suggests that MED14 levels are higher in females than in males, which, in light of our findings, may represent a mechanism underlying gender-specific differences in the expression of GR target genes, a hypothesis we are currently testing.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Cell Culture and Treatments
U2OS human osteosarcoma cells stably expressing wild-type human GR (U2OS-hGR) (48) were cultured in DMEM supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT), 10 U/ml penicillin and streptomycin, 2 mM L-glutamine, and 500 µg/ml geneticin (G418, Invitrogen Life Technologies, Inc., Carlsbad, CA). Dex (Sigma-Aldrich Corp., St. Louis, MO) was diluted in 100% ethanol (vehicle).

RNA Interference
Two siRNA duplexes specific for human MED14 (siMED14) were designed using the siRNA designer software at siDESIGN Center at Dharmacon (Lafayette, CO) (http://design.dharmacon.com/rnadesign/default.aspx) and were synthesized with UU overhangs and a 5'-phosphate on the antisense strand (Dharmacon). The targeted 21-mer oligonucleotide sequences were AAGGAAATCTGATGTGGAAAG [266–286 nucleotides (nt) on cDNA sequence; accession no. NM_006084, p1-siMED14] and AACAATGCCAACAACAGGCC (3500–3518 nt; p2-siMED14). A pool of four siRNA duplexes specific for human MED1 (siMED1) was designed and synthesized (Dharmacon) using the SMART selection and pooling technologies. An siRNA specific for luciferase (D-001400-01; siCTRL1) or a pool of nonspecific siRNA (D-001206-13; siCTRL2) was used as a control (Dharmacon). The TIF2 siRNA (Qiagen, Valencia, CA) oligonucleotide was generated against the sequence AAGTCAGATGTATCCTCTACA (457–477 nt on cDNA sequence; accession no. NM_006540).

siRNA-Resistant MED14 Variant (MED14v)
The siRNA-resistant MED14v was generated from pRK5-HA-MED14 using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) following the manufacturer’s instruction. The primer pair contained two point mutations (lower case) within the siMED14 targeting region and the sequences were 5'-CCTATGCCAAGGAAgTCcGATGTGGAAGG (forward primer) and 5'-CCTTTCCACATCgGAcTTCCTTGGCAGTAGG (reverse primer). The change was confirmed by DNA sequencing.

Transient Transfections
Cells were seeded into 6-cm plates at a density of 105 cells and transfected in serum-free medium using 10 µl Lipofectamine and 10 µl Plus reagent (Invitrogen Life Technologies, Inc.) following the manufacturer’s instructions. After 3 h, the medium was replaced with phenol red-free DMEM supplemented with 10% charcoal-dextran-stripped FBS. For luciferase assays, U2OS-hGR cells were seeded into six-well plates at a density of 105 cells/plate and transfected with pRK5-HA-MED14 or pRK5-HA-MED14v or with mouse mammary tumor virus promoter-luciferase, pGal4-luciferase, and Gal4-VP16 together with cytomegalovirus promoter-LacZ and siRNAs using Lipofectamine and Plus reagent. Three hours after the transfection, the cells were allowed to recover in phenol red-free DMEM-10% charcoal-dextran-stripped FBS medium for 40 h and then were treated with ethanol vehicle or Dex (100 nM) for an additional 8 h. Cells were harvested in lysis buffer, and luciferase activity was measured.

Antibodies and Immunoblotting
Cells were washed with PBS, and whole cell extracts were prepared by lysing cells in 50 µl 10 mM HEPES (pH 7.5), 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 1% Triton X-100, 10 mM sodium fluoride, 25 mM ZnCl2, and 1x protease inhibitor cocktail (Calbiochem, La Jolla, CA) for 30 min on ice with vortexing at 10-min intervals. After centrifugation for 10 min at 4 C, the protein concentration was measured (protein assay; Bio-Rad Laboratories, Hercules, CA) and boiled in sodium dodecyl sulfate sample buffer. Protein lysates (typically 35 µg) were separated by 7% SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Immobilon, Millipore Corp., Burlington, MA), probed with the indicated antibodies, and detected using enhanced chemiluminescence (GE Healthcare, Piscataway, NJ). The rabbit polyclonal antibody against MED14 was raised against a glutathione-S-transferase-MED141146–1454 and affinity purified using a MED14 peptide column prepared with MED14 residues 1146–1454 (Covance, Berkeley, CA). A mouse monoclonal antibody against MED1 used in the immunoblot analysis was a gift from Dr. L. Freedman. An affinity-purified rabbit polyclonal antibody against MED1 used in the ChIP assay was provided by Dr. K. Oda. The antibody for GR (218) used in the ChIP assay was generated against the peptide 194LQDLEFSSGSPGKE207. The polyclonal antibody against the N-terminal 499 amino acids of human GR (N499) was a gift from Dr. K. Yamamoto. The following antibodies were also used: hemagglutinin mouse monoclonal antibody (12-CA5; Roche, Indianapolis, IN); tubulin mouse monoclonal (Covance), and rabbit polyclonal anti-SRC1 (SC-6096; Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

Real-time PCR
Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen). cDNA was synthesized using enhanced avian reverse transcriptase (Sigma-Aldrich Corp.) and random hexamers (GE Healthcare) following the manufacturers’ instructions. Gene-specific cDNA was amplified in a 20-µl reaction containing SYBR Green Taq ReadyMix for Quantitative PCR (Sigma-Aldrich Corp.) and 300 nM of each primer. Real-time PCR was performed in a LightCycler (Roche). Rpl19 was used as an internal control for data normalization. The sequences of the primers used for real-time PCR are given in Table 2Go.


View this table:
[in this window]
[in a new window]
  		Table 2. Real-Time PCR Primer Pairs

 
ChIP Assays
ChIP assays were performed as described by Rogatsky et al. (31). U2OS-hGR cells were fixed using cross-linking buffer [50 mM HEPES (pH 8.0), 1% formaldehyde, 1 mM EDTA, 0.5 mM EGTA, and 100 mM NaCl] for 10 min at room temperature. The cross-link was quenched using 0.125 M glycine, and cells were rinsed twice with cold PBS, collected by centrifugation, and rocked on a Nutator (Becton-Dickinson, Franklin Lakes, NJ) in buffer I [50 mM HEPES (pH 8.0), 1 mM EDTA, 10% glycerol, 5% Nonidet P-40, and 0.25% Triton X-100] for 10 min at 4 C. Nuclei were pelleted by centrifugation, then washed in buffer II [10 mM Tris (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, and 200 mM NaCl] for 10 min at room temperature. Nuclei were pelleted by centrifugation and resuspended in RIPA buffer [10 mM Tris (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 5% glycerol, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, and 1% Triton X-100]. Samples were sonicated on ice 18 times for 10 sec each time at 30-sec intervals. Cell debris was removed by centrifugation at 12,000 x g for 10 min. The sheared chromatin was then incubated with specific antibodies or control antibody (IgG) on a rocker at 4 C overnight. Protein A-Sepharose beads (35 µl; Sigma-Aldrich Corp.) were added to the samples, and the incubation was continued for 2 h. The beads were washed three times using RIPA buffer and incubated in 100 µl sodium dodecyl sulfate-proteinase K-TE buffer [10 mM Tris (pH 8.0), 1 mM EDTA, 0.5% sodium dodecyl sulfate, and 0.2 mg/ml protease K] for 2 h at 55 C and then at 65 C overnight. The DNA was then purified using a PCR purification kit (Qiagen) and eluted in Tris (pH 8.0). One percent of the input chromatin was processed in parallel. The primers used for ChIP are listed in Table 3Go. Dilutions of input DNA were amplified, and the PCR products were quantitated to determine the linear range of amplification for each gene (supplemental Fig. 5). PCRs were carried out for 35 cycles, and products were resolved on 2% agarose gels and visualized by ethidium bromide staining. The intensities of the bands were quantitated using National Institutes of Health Image 1.63 software (Bethesda, MD).


View this table:
[in this window]
[in a new window]
  		Table 3. ChIP Assay Primer Pairs

 
Transcription Factor-Binding Site Analysis
The 5'-flanking regions of GR target genes were retrieved from the UCSC human genome database (http://genome.cse.ucsc.edu/). The transcription start site was confirmed using the DBTSS database (http://dbtss.hgc.jp). The putative GREs and other transcription factor binding sites were determined using Alibaba2.1 (www.gene-regulation.com).

Statistics
Results are expressed as the mean ± SD. Data were analyzed by Student’s t test. P < 0.1 was considered significant.


   ACKNOWLEDGMENTS
 
We thank K. Yamamoto (UCSF, San Francisco, CA) for the GR antiserum, and L. Freedman (Wyeth, Collegeville, PA) and K. Oda (UCSF) for MED1 antibodies. We also thank N. Tanese, A. Wilson, I. Pineda Torra, E. Oxelmark, and N. Ismaili for critically reading the manuscript.


   FOOTNOTES
 
This work was supported by grants from the National Institutes of Health and the American Cancer Society (to M.J.G.).

First Published Online October 20, 2005

Abbreviations: AF1, Activation function 1; ChIP, chromatin immunoprecipitation; Dex, dexamethasone; FBS, fetal bovine serum; GILZ, glucocorticoid-inducible leucine zipper; GR, glucocorticoid receptor; GRE, glucocorticoid response element; GRIP, GR-interacting protein; IGFBP1, IGF-binding protein 1; IRF8, interferon regulatory factor 8; LAD1, ladinin 1; MED14v, MED14 variant; siRNA, small interfering RNA; Sp1, specificity protein 1; SRC-1, steroid receptor coactivator 1; TIF2, transcriptional intermediary factor 2.

Received for publication August 3, 2005. Accepted for publication October 12, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Taatjes DJ, Marr MT, Tjian R 2004 Regulatory diversity among metazoan co-activator complexes. Nat Rev Mol Cell Biol 5:403–410[CrossRef][Medline]
  2. Yamamoto KR, Darimont BD, Wagner RL, Iniguez-Lluhi JA 1998 Building transcriptional regulatory complexes: signals and surfaces. Cold Spring Harbor Symp Quant Biol 63:587–598[CrossRef][Medline]
  3. McKenna NJ, O’Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474[CrossRef][Medline]
  4. Malik S, Roeder RG 2005 Dynamic regulation of pol II transcription by the mammalian Mediator complex. Trends Biochem Sci 30:256–263[CrossRef][Medline]
  5. Kornberg RD 2005 Mediator and the mechanism of transcriptional activation. Trends Biochem Sci 30:235–239[CrossRef][Medline]
  6. Taatjes DJ, Tjian R 2004 Structure and function of CRSP/Med2: a promoter-selective transcriptional coactivator complex. Mol Cell 14:675–683[CrossRef][Medline]
  7. Zhang X, Krutchinsky A, Fukuda A, Chen W, Yamamura S, Chait BT, Roeder RG 2005 MED1/TRAP220 exists predominantly in a TRAP/Mediator subpopulation enriched in RNA polymerase II and is required for ER-mediated transcription. Mol Cell 19:89–100[CrossRef][Medline]
  8. Taatjes DJ, Schneider-Poetsch T, Tjian R 2004 Distinct conformational states of nuclear receptor-bound CRSP-Med complexes. Nat Struct Mol Biol 11:664–671[CrossRef][Medline]
  9. Yamamoto KR 1995 Multilayered control of intracellular receptor function. Harvey Lect 91:1–19[Medline]
  10. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  11. Godowski PJ, Rusconi S, Miesfeld R, Yamamoto KR 1987 Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature 325:365–368[CrossRef][Medline]
  12. Hittelman AB, Burakov D, Iniguez-Lluhi JA, Freedman LP, Garabedian MJ 1999 Differential regulation of glucocorticoid receptor transcriptional activation via AF-1-associated proteins. EMBO J 18:5380–5388[CrossRef][Medline]
  13. Rogatsky I, Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq CM, Darimont BD, Garabedian MJ, Yamamoto KR 2003 Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor. Proc Natl Acad Sci USA 100:13845–13850[Abstract/Free Full Text]
  14. Iniguez-Lluhi JA, Lou DY, Yamamoto KR 1997 Three amino acid substitutions selectively disrupt the activation but not the repression function of the glucocorticoid receptor N terminus. J Biol Chem 272:4149–4156[Abstract/Free Full Text]
  15. Burakov D, Wong CW, Rachez C, Cheskis BJ, Freedman LP 2000 Functional interactions between the estrogen receptor and DRIP205, a subunit of the heteromeric DRIP coactivator complex. J Biol Chem 275:20928–20934[Abstract/Free Full Text]
  16. Malik S, Guermah M, Yuan CX, Wu W, Yamamura S, Roeder RG 2004 Structural and functional organization of TRAP220, the TRAP/Mediator subunit that is targeted by nuclear receptors. Mol Cell Biol 24:8244–8254[Abstract/Free Full Text]
  17. Ito M, Yuan CX, Malik S, Gu W, Fondell JD, Yamamura S, Fu ZY, Zhang X, Qin J, Roeder RG 1999 Identity between TRAP and SMCC complexes indicates novel pathways for the function of nuclear receptors and diverse mammalian activators. Mol Cell 3:361–370[CrossRef][Medline]
  18. Ito M, Okano HJ, Darnell RB, Roeder RG 2002 The TRAP100 component of the TRAP/Mediator complex is essential in broad transcriptional events and development. EMBO J 21:3464–3475[CrossRef][Medline]
  19. Suwanichkul A, Allander SV, Morris SL, Powell DR 1994 Glucocorticoids and insulin regulate expression of the human gene for insulin-like growth factor-binding protein-1 through proximal promoter elements. J Biol Chem 269:30835–30841[Abstract/Free Full Text]
  20. Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq C, Yamamoto KR 2004 Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes. Proc Natl Acad Sci USA 101:15603–15608[Abstract/Free Full Text]
  21. Asselin-Labat ML, Biola-Vidamment A, Kerbrat S, Lombes M, Bertoglio J, Pallardy M 2005 FoxO3 mediates antagonistic effects of glucocorticoids and interleukin-2 on glucocorticoid-induced leucine zipper expression. Mol Endocrinol 19:1752–1764[Abstract/Free Full Text]
  22. Smit P, Russcher H, de Jong FH, Brinkmann AO, Lamberts SW, Koper JW 2005 Differential regulation of synthetic glucocorticoids on gene expression levels of glucocorticoid-induced leucine zipper and interleukin-2. J Clin Endocrinol Metab 90:2994–3000[Abstract/Free Full Text]
  23. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  24. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  25. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  26. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract/Free Full Text]
  27. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  28. Stallcup MR, Chen D, Koh SS, Ma H, Lee YH, Li H, Schurter BT, Aswad DW 2000 Co-operation between protein-acetylating and protein-methylating co-activators in transcriptional activation. Biochem Soc Trans 28:415–418[Medline]
  29. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  30. Burakov D, Crofts LA, Chang CP, Freedman LP 2002 Reciprocal recruitment of DRIP/Mediator and p160 coactivator complexes in vivo by estrogen receptor. J Biol Chem 277:14359–14362[Abstract/Free Full Text]
  31. Rogatsky I, Zarember KA, Yamamoto KR 2001 Factor recruitment and TIF2/GRIP1 corepressor activity at a collagenase-3 response element that mediates regulation by phorbol esters and hormones. EMBO J 20:6071–6083[CrossRef][Medline]
  32. Shang Y, Myers M, Brown M 2002 Formation of the androgen receptor transcription complex. Mol Cell 9:601–610[CrossRef][Medline]
  33. Wang Q, Carroll JS, Brown M 2005 Spatial and temporal recruitment of androgen receptor and its coactivators involves chromosomal looping and polymerase tracking. Mol Cell 19:631–642[CrossRef][Medline]
  34. Chadick JZ, Asturias FJ 2005 Structure of eukaryotic Mediator complexes. Trends Biochem Sci 30:264–271[CrossRef][Medline]
  35. Lefstin JA, Yamamoto KR 1998 Allosteric effects of DNA on transcriptional regulators. Nature 392:885–888[CrossRef][Medline]
  36. Ryu S, Zhou S, Ladurner AG, Tjian R 1999 The transcriptional cofactor complex CRSP is required for activity of the enhancer-binding protein Sp1. Nature 397:446–450[CrossRef][Medline]
  37. Naar AM, Beaurang PA, Zhou S, Abraham S, Solomon W, Tjian R 1999 Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature 398:828–832[CrossRef][Medline]
  38. Strahle U, Schmid W, Schutz G 1988 Synergistic action of the glucocorticoid receptor with transcription factors. EMBO J 7:3389–3395[Medline]
  39. Mittelstadt PR, Ashwell JD 2003 Disruption of glucocorticoid receptor exon 2 yields a ligand-responsive C-terminal fragment that regulates gene expression. Mol Endocrinol 17:1534–1542[Abstract/Free Full Text]
  40. Hafezi-Moghadam A, Simoncini T, Yang Z, Limbourg FP, Plumier JC, Rebsamen MC, Hsieh CM, Chui DS, Thomas KL, Prorock AJ, Laubach VE, Moskowitz MA, French BA, Ley K, Liao JK 2002 Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat Med 8:473–479[CrossRef][Medline]
  41. Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular receptors use a common mechanism to interpret signaling information at response elements. Genes Dev 10:1271–1283[Abstract/Free Full Text]
  42. Riccardi C, Cifone MG, Migliorati G 1999 Glucocorticoid hormone-induced modulation of gene expression and regulation of T-cell death: role of GITR and GILZ, two dexamethasone-induced genes. Cell Death Differ 6:1182–1189[CrossRef][Medline]
  43. Kolbus A, Blazquez-Domingo M, Carotta S, Bakker W, Luedemann S, von Lindern M, Steinlein P, Beug H 2003 Cooperative signaling between cytokine receptors and the glucocorticoid receptor in the expansion of erythroid progenitors: molecular analysis by expression profiling. Blood 102:3136–3146[Abstract/Free Full Text]
  44. Berrebi D, Bruscoli S, Cohen N, Foussat A, Migliorati G, Bouchet-Delbos L, Maillot MC, Portier A, Couderc J, Galanaud P, Peuchmaur M, Riccardi C, Emilie D 2003 Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an anti-inflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10. Blood 101:729–738[Abstract/Free Full Text]
  45. Busslinger M 2004 Transcriptional control of early B cell development. Annu Rev Immunol 22:55–79[CrossRef][Medline]
  46. Yoshikawa H, Fujiyama A, Nakai K, Inazawa J, Matsubara K 1998 Detection and isolation of a novel human gene located on Xp11.2-p11.4 that escapes X-inactivation using a two-dimensional DNA mapping method. Genomics 49:237–246[CrossRef][Medline]
  47. Carrel L, Willard HF 2005 X-Inactivation profile reveals extensive variability in X-linked gene expression in females. Nature 434:400–404[CrossRef][Medline]
  48. Wang Z, Frederick J, Garabedian MJ 2002 Deciphering the phosphorylation "code" of the glucocorticoid receptor in vivo. J Biol Chem 277:26573–26580[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   GR
Coregulators:   TRAP220  |  DRIP150  |  SRC-1  |  GRIP1
Ligands:   Dexamethasone



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
I. M. E. Beck, W. Vanden Berghe, L. Vermeulen, K. R. Yamamoto, G. Haegeman, and K. De Bosscher
Crosstalk in Inflammation: The Interplay of Glucocorticoid Receptor-Based Mechanisms and Kinases and Phosphatases
Endocr. Rev., December 1, 2009; 30(7): 830 - 882.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
E. Ayroldi and C. Riccardi
Glucocorticoid-induced leucine zipper (GILZ): a new important mediator of glucocorticoid action
FASEB J, November 1, 2009; 23(11): 3649 - 3658.
[Abstract] [Full Text] [PDF]

Home page
 Sci SignalHome page
M. A. Balamotis, M. A. Pennella, J. L. Stevens, B. Wasylyk, A. S. Belmont, and A. J. Berk
Complexity in Transcription Control at the Activation Domain-Mediator Interface
Sci. Signal., May 5, 2009; 2(69): ra20 - ra20.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
L. E Ellestad, S. A Malkiewicz, H D. Guthrie, G. R Welch, and T. E Porter
Expression and regulation of glucocorticoid-induced leucine zipper in the developing anterior pituitary gland
J. Mol. Endocrinol., February 1, 2009; 42(2): 171 - 183.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Ding, C. Tomomori-Sato, S. Sato, R. C. Conaway, J. W. Conaway, and T. G. Boyer
MED19 and MED26 Are Synergistic Functional Targets of the RE1 Silencing Transcription Factor in Epigenetic Silencing of Neuronal Gene Expression
J. Biol. Chem., January 30, 2009; 284(5): 2648 - 2656.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
W. Chen, T. Dang, R. D. Blind, Z. Wang, C. N. Cavasotto, A. B. Hittelman, I. Rogatsky, S. K. Logan, and M. J. Garabedian
Glucocorticoid Receptor Phosphorylation Differentially Affects Target Gene Expression
Mol. Endocrinol., August 1, 2008; 22(8): 1754 - 1766.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Jeanneteau, M. J. Garabedian, and M. V. Chao
Activation of Trk neurotrophin receptors by glucocorticoids provides a neuroprotective effect
PNAS, March 25, 2008; 105(12): 4862 - 4867.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
K. Ge, Y.-W. Cho, H. Guo, T. B. Hong, M. Guermah, M. Ito, H. Yu, M. Kalkum, and R. G. Roeder
Alternative Mechanisms by Which Mediator Subunit MED1/TRAP220 Regulates Peroxisome Proliferator-Activated Receptor {gamma}-Stimulated Adipogenesis and Target Gene Expression
Mol. Cell. Biol., February 1, 2008; 28(3): 1081 - 1091.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Aoyagi and T. K. Archer
Nicotinamide Uncouples Hormone-Dependent Chromatin Remodeling from Transcription Complex Assembly
Mol. Cell. Biol., January 1, 2008; 28(1): 30 - 39.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. K. Mathew, S. Sengupta, A. Kawakami, E. A. Andreasen, C. V. Lohr, C. A. Loynes, S. A. Renshaw, R. T. Peterson, and R. L. Tanguay
Unraveling Tissue Regeneration Pathways Using Chemical Genetics
J. Biol. Chem., November 30, 2007; 282(48): 35202 - 35210.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
W. Chen and R. G. Roeder
The Mediator subunit MED1/TRAP220 is required for optimal glucocorticoid receptor-mediated transcription activation
Nucleic Acids Res., September 25, 2007; 35(18): 6161 - 6169.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. B. Hebbar and T. K. Archer
Chromatin-dependent Cooperativity between Site-specific Transcription Factors in Vivo
J. Biol. Chem., March 16, 2007; 282(11): 8284 - 8291.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Z. Wang, W. Chen, E. Kono, T. Dang, and M. J. Garabedian
Modulation of Glucocorticoid Receptor Phosphorylation and Transcriptional Activity by a C-Terminal-Associated Protein Phosphatase
Mol. Endocrinol., March 1, 2007; 21(3): 625 - 634.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. He and S. S. Simons Jr.
STAMP, a Novel Predicted Factor Assisting TIF2 Actions in Glucocorticoid Receptor-Mediated Induction and Repression
Mol. Cell. Biol., February 15, 2007; 27(4): 1467 - 1485.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
K. C. M. C. Koeijvoets, E. F. C. van Rossum, G. M. Dallinga-Thie, E. W. Steyerberg, J. C. Defesche, J. J. P. Kastelein, S. W. J. Lamberts, and E. J. G. Sijbrands
A Functional Polymorphism in the Glucocorticoid Receptor Gene and Its Relation to Cardiovascular Disease Risk in Familial Hypercholesterolemia
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4131 - 4136.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.
Right arrow Articles by Garabedian, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.
Right arrow Articles by Garabedian, M. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals