help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0298
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Wong, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Wong, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Molecular Endocrinology 20 (4): 776-785
Copyright © 2006 by The Endocrine Society

A Role of the Amino-Terminal (N) and Carboxyl-Terminal (C) Interaction in Binding of Androgen Receptor to Chromatin

Jiwen Li, Junjiang Fu, Charalambos Toumazou, Ho-Geun Yoon and Jiemin Wong

Department of Molecular and Cellular Biology (J.L., J.F., C.T., J.W.), Baylor College of Medicine, Houston, Texas 77030; and Department of Biochemistry and Molecular Biology (H.Y.), Yonsei University College of Medicine, Soedaemoon-gu, Seoul 120-752, Korea

Address all correspondence and requests for reprints to: Jiemin Wong, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: jwong{at}bcm.tmc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The N-terminal domain of AR is known to engage a hormone-dependent interaction with its C-terminal ligand-binding domain, and this N/C interaction is known to modulate AR transcriptional activity. Using Xenopus oocytes as a model system to study transcriptional regulation in chromatin, we found that two previously reported N/C interaction-defective AR mutants, one with deletion of 23FQNLF27(AR{Delta}F) and one with a Gly 21 to Glu mutation (ARG21E), were surprisingly inactive in activating transcription from various reporters assembled into chromatin. Further study using chromatin immunoprecipitation assay revealed that these mutants failed to bind both mouse mammary tumor virus-long terminal repeat and prostate-specific antigen enhancer assembled into chromatin. This defect is specific to chromatin because both mutants could bind to a consensus AR response element in vitro and activate transcription driven by mouse mammary tumor virus-long terminal repeat in transient transfection as effective as the wild-type AR. To further substantiate this novel finding, we established 293 cell lines that stably expressed either AR or AR{Delta}F mutant in an inducible manner. Using these cell lines, we confirmed by using chromatin immunoprecipitation assay that AR but not AR{Delta}F could bind to the endogenous prostate-specific antigen enhancer. Furthermore, we found that the AR{Delta}F mutant interacts poorly with Brg1, the ATPase subunit of the chromatin-remodeling factor SWI/SNF. Taken together, our study reveals a novel role of AR N/C interaction in control of AR chromatin binding and suggests a working model that the proper N/C interaction is required for AR to recruit SWI/SNF complex, which in turn remodels chromatin to allow AR to bind to AR response elements in chromatin.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ANDROGENS PLAY critical roles in the differentiation, development and maintenance of male reproductive functions, as well as in the etiology of prostate cancer (1, 2). The biological actions of androgens are believed to be mediated through the intracellular androgen receptor (AR), which belongs to the nuclear receptor (NR) superfamily of ligand-regulated transcription factors (3, 4). AR shares with other members of the NR superfamily a signature structural and functional organization that includes an amino-terminal variable domain (NTD), a highly conserved central DNA binding domain (DBD) and a multifunctional carboxyl-terminal ligand binding domain (LBD) that is involved in dimerization of the receptors, binding of specific ligands, and contains a ligand-dependent activation function (AF) 2 (3, 4, 5, 6). Unlike many NRs, the NTD of AR harbors one or more transcriptional AF1 and exhibits strong hormone-independent activity in isolation. On the other hand, although the LBD is critically important for hormone-regulated transcriptional activity of AR, the AR-LBD in isolation exhibits only a weak hormone-dependent activity.

The actions of AR are subject to modulation, either positively or negatively, by an increasing number of coregulatory proteins, termed coactivators or corepressors (7, 8, 9). Coactivators are believed to function either as bridging factors between receptors and basal transcription machinery to enhance recruitment of the basal transcription machinery and/or as factors that have capacity to actively remodel repressive chromatin (10, 11). A large number of proteins have been reported to function as AR coactivators, including the generic coactivators such as steroid receptor coactivator (SRC) family members and cAMP response element binding protein-binding protein (CBP)/p300, the ATP-dependent chromatin remodeling complex SWI/SNF, and the relatively AR-specific coactivators such as ARA54 and ARA70 (8, 12). SRC family members interact with both the AF1 and AF2 of AR (13, 14, 15, 16). The interaction with AF1 is mediated through a glutamine-rich region in the SRC family members, whereas the interaction with the AF2 requires the signature LxxLL motifs that are widely involved in interaction with other NRs (16, 17). In this regard, the AF2 domain of AR has been shown to bind with a higher affinity toward the FxxLF motif than to the LxxLL motif (16, 18). The FxxLF was a AR-LBD interacting signature motif initially identified in the NTD of AR and later also found in the several AR coactivators, including ARA70 and ARA 54 (19). Several studies show that the activity of SWI/SNF is required for transcriptional activation by AR (20, 21). Although the exact mechanism remains to be determined, previous studies indicate that SWI/SNF can be recruited either indirectly through CBP/p300 and/or directly through an interaction between AR and BAF57 (20, 21).

The NTD of AR is known to strongly interact with the LBD in a hormone-dependent manner (22, 23, 24). This interdomain interaction, also known as the N/C interaction, involves the 23FxxLF27 motif and its flanking sequence in the NTD and a hydrophobic cleft created by helices 3, 4, 5, and 12 in the LBD (25, 26). Such a strong N/C interaction has many implications on the transcriptional regulation by AR because the same hydrophobic cleft in the AR-LBD is likely required for hormone-dependent interaction with the LxxLL motif-containing coactivators such as SRC-1 and the FxxLF motif-containing coactivators such as ARA70. By transient transfection assays, several groups have investigated the roles of the N/C interaction using AR mutants defective in the N/C interaction. These studies have collectively shown that the N/C interaction is required for the optimal transcriptional activation by AR for some [e.g. prostate-specific antigen (PSA)] but not the other reporters [mouse mammary tumor virus-long terminal repeat (MMTV-LTR)] (27, 28), although the underlying mechanism is not entirely clear. On one hand, the N/C interaction has been reported to inhibit the binding and coactivator activity of SRC-1 toward AR (29). On the other hand, the N/C interaction has been shown to reduce the rate of hormone dissociation from AR (24), thus providing an explanation why the N/C interaction may facilitate the transcriptional activation by AR.

We have previously established Xenopus oocytes as a model system for study of transcriptional regulation by AR in the context of chromatin (21, 31). Xenopus oocytes contain a large storage of factors required for transcription and both histones and nonhistone proteins required for chromatin assembly. Introduction of DNA into the nucleus of Xenopus oocytes through microinjection allows the assembly of injected DNA into chromatin through a replication-independent (injection of double stranded DNA) or a replication-coupled pathway (injection of single-stranded reporter DNA) (31, 32, 33). We have shown previously that expression of AR in Xenopus oocytes activates transcription from several AR reporters assembled into chromatin in a hormone-stimulated manner, and this transcriptional activation involves histone acetylation by CBP/p300 and chromatin remodeling by SWI/SNF (21, 31). Using this model system, we have investigated the role for the N/C interaction in transcriptional regulation by AR. To our surprise, we find that the N/C interaction is required for transcriptional activation by AR from both PSA and MMTV-LTR driven reporters. We show that the N/C interaction-defective mutants are defective in binding to chromatin template but not to the DNA in vitro or transient transfected. We confirm in mammalian cells that the N/C interaction is required for binding of AR to the endogenous PSA enhancer. Taken together, our study uncovers a novel, chromatin-specific function for AR N/C interaction.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The N/C Interaction Is Required for Transcriptional Activation by AR in Xenopus Oocytes
A previous study by Claessens and his colleagues (28) showed that two AR mutants, one with deletion of the 23FxxLF27 motif (AR{Delta}F) and one with G21 mutated to E (ARG21E) (Fig. 1AGo), were defective in N/C interaction as determined using mammalian two-hybrid assay. To assess the role of AR N/C interaction in the context of chromatin, we first cloned these two AR mutants into a vector that allows us to synthesize their corresponding mRNA in vitro. As illustrated in Fig. 1BGo, we first injected the mRNA encoding AR or AR mutants into the cytoplasm of Xenopus oocytes, and approximately 2–3 h later, the single-stranded (ss) MMTV-LTR-chloramphenicol acetyl transferase (CAT) reporter was injected into the nucleus of the Xenopus oocytes to allow the assembly of the reporter DNA into chromatin via the replication-coupled pathway. After overnight incubation with or without R1881 (50 nM), a synthetic AR agonist, the oocytes were collected, and the expression of AR and mutants was analyzed using Western blotting and the transcription from the MMTV-LTR reporter was determined using primer extension assay. A representative result is shown in Fig. 1DGo. Consistent with our previous result (30), AR activated transcription slightly in the absence of R1881. Addition of R1881 led to a strong transcriptional activation from the MMTV-LTR reporter. Surprisingly, both AR mutants failed to stimulate transcriptional activation from the MMTV-LTR reporter under the exact the same condition (Fig. 1DGo). Western analysis (the bottom panel) showed that both mutants and the wild-type AR were expressed to a very similar level, thus excluding the difference in protein expression as the explanation for lack of transcriptional activation. This result is very reproducible (observed in more than five independent experiments). Furthermore, the same result was also observed when a PSA enhancer-driven reporter was used (see Fig. 4AGo). Thus, although the N/C interaction did not appear to affect transcriptional activation from the MMTV-LTR driven reporter by AR in transient transfection assay (27), we found that both N/C interaction defective mutants are inactive in the context of chromatin.


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. The N/C Interaction Is Required for Transcriptional Activation by AR in the Context of Chromatin

A, The diagram illustrating the structure of AR and AR mutants used in this study. B, The experimental scheme showing injection of mRNA into the cytoplasm and reporter DNA into the nucleus of Xenopus oocytes. The same groups of oocytes can be used for Western analysis (WB) to examine the expression of the injected mRNAs, primer extension to analyze the levels of transcription from the injected reporter DNA, and ChIP assay to determine the binding of AR and mutants to chromatin. C, The diagram showing the MMTV-LTR-CAT reporter. Also indicated is the relative position of the PCR product generated in ChIP assay. D, A representative primer extension results showing that both AR mutants were defective in R1881-stimulated transcriptional activation from the MMTV-LTR-CAT reporter. Expt, the primer extension product from the MMTV-LTR reporter; Ctrl, primer extension product from the endogenous storage histone H4 mRNA, which serves as a loading control. Also shown at the bottom panel is the expression of both AR and AR mutants revealed by Western blot using AR N20 antibody. *, A nonspecific band that serves as a loading control.

 

Figure 4
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4. The Binding of AR Mutants to Single vs. Multiple AREs in Chromatin

A, Both AR N/C interaction mutants failed to bind to the PSA enhancer. ChIP assay was performed essentially as in Fig. 2Go except the PSA enhancer-CAT reporter was used. Input, 5%; IgG, rabbit antimouse IgG. The effect on transcription was determined by primer extension analysis and shown at the bottom panel. B and C, ChIP assays revealed that both AR mutants could bind to the pTRßA reporter containing 4XAREs but not a single ARE. Also shown at the bottom panels are the transcriptional data from these two reporters. Both ChIP and transcription were confirmed by at least three independent experiments.

 
The N/C Interaction Is Specifically Required for Binding of AR to Chromatin But Not DNA
We next wished to determine why the N/C interaction mutants are defective in transcriptional activation from the chromatin. One explanation is that, under our experimental conditions, the mutants did not bind R1881. Although a previous study indicates that the N/C interaction helps to stabilize the binding of hormone to AR (24), this relatively minor difference in hormone binding is unlikely to explain the severe defect in transcriptional activation we have observed. Furthermore, if the subtle difference in hormone-dissociation does contribute to the difference in transcriptional activity, we expect that the defect in transcription would be rescued by using a higher concentration of R1881. However, we did not observe any significant activation by the AR mutants within a wide range concentration of R1881 (up to 100 nM) (data not shown). On the other hand, as we have shown previously (30), the wild-type of AR can effectively activate transcription by R1881 at a concentration as low as 0.1 nM (data not shown). To ascertain that the mutant AR indeed could bind to R1881, we analyzed the R1881-induced translocation of AR from the cytoplasm to the nucleus as we have shown previously (30). For this purpose, the oocytes were injected with mRNA encoding either AR or AR{Delta}F. After incubation overnight to allow expression of AR and AR{Delta}F, the oocytes were treated with 50 nM R1881 for 1 h. The nuclei of oocytes were then manually isolated away from the cytoplasm and the distribution of AR or AR{Delta}F in cytoplasm and nucleus was determined by Western analysis. As shown in Fig. 2AGo, both AR and AR{Delta}F translocated into the nucleus upon R1881 treatment. This result indicates that AR{Delta}F does respond to R1881, suggesting that there is no gross defect in hormone binding activity for AR{Delta}F.


Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2. The AR N/C Interaction Mutants Exhibit Impaired Chromatin Binding Activity

A, The AR{Delta}F translocated from the cytoplasm into nucleus in response to R1881. The oocytes were injected with mRNA encoding either AR or AR{Delta}F, incubated overnight and then treated with 50 nM R1881 for 1 h. The nucleus of the oocytes were manually isolated away from cytoplasm, and the extracts from total oocytes (T), nucleus (N), and cytoplasm (C) were prepared and analyzed for the levels of AR by Western blot. The extracts used for T and C were equivalent to half a oocyte, whereas the extracts used for N were equivalent to four oocytes. B, ChIP assay showing that both AR mutants failed to bind to the MMTV-LTR. Each input is 5% of the extract used for ChIP. IgG, rabbit antimouse IgG used as negative control for ChIP assays. Also shown at the bottom of the panel is the result of Western blot for AR (AR N-20 antibody). The ChIP data were confirmed by three independent experiments.

 
Because the above result indicated that in response to R1881 both AR and AR{Delta}F translocated into the nucleus, we next investigated whether the AR mutants are able to bind to the MMTV-LTR in chromatin. For this purpose, we used the same experimental scheme as illustrated in Fig. 1AGo and chromatin immunoprecipitation assay (ChIP). A representative result was shown in Fig. 2BGo. Consistent with our previous result (20), the ChIP data revealed that AR weakly bound to the MMTV-LTR in the absence of R1881 and R1881 treatment strongly enhanced the binding of AR (5–6-fold). Surprisingly, no significant binding was detected for both N/C interaction mutants both in the absence or presence of R1881. In fact, the ChIP signals for both AR mutants were at the range of background (compare to lane 1 as well as signals for control IgG). The failure to detect the binding of AR mutants in ChIP cannot be explained by the inability of the antibody (AR-N20; Santa Cruz Biotechnology, Santa Cruz, CA) used for ChIP to recognize both mutants because Western analysis using the same antibody detected the equal level expression of AR and AR mutants. Furthermore, the same result was obtained when the ChIP assay was performed using an antibody against the C terminus of AR (AR-C19; Santa Cruz Biotechnology). Taken together, we conclude that the AR N/C interaction mutants are defective in binding to the MMTV-LTR assembled into chromatin.

The previous study using the same AR mutants expressed in mammalian cells showed that both AR mutants bind to several AR response elements (AREs) in vitro indistinguishable from the wild-type AR (28). To test whether both mutants expressed in Xenopus oocytes were able to bind to ARE in vitro, we performed gel mobility shift assay using a 32P-labeled consensus ARE probe essentially following the experimental conditions used in the previous study (28). The result in Fig. 3Go showed that both mutants were able to bind to the ARE probe as effectively as the wild-type AR. Thus, like the case in mammalian cells (27), the AR mutants expressed in Xenopus oocytes possess the ability to bind an ARE probe in vitro. This result suggests that the N/C interaction mutants are specifically crippled in their ability to bind to chromatin template.


Figure 3
View larger version (71K):
[in this window]
[in a new window]
 
Fig. 3. Both AR N/C Interaction Mutants Bind to an ARE Probe in Vitro as Effectively as the Wild-Type AR

The extracts (10 µl/oocyte) were prepared from the R1881-treated control oocytes (lanes 2 and 3) or oocytes expressing AR or AR mutants. The amounts of extracts used were 1 µl for even lanes 2 µl for odd lanes. The position of the AR/DNA complexes is as indicated. The ARE probe used was as described.

 
The N/C Interaction Mutants Can Bind to the Multiple AREs But Not Single ARE in Chromatin
To further characterize the role of the N/C interaction in binding of AR to chromatin, we next compared the binding of AR and the AR mutants to the PSA enhancer as well as to the reporter containing a single or multiple AREs (4XARE). Again, oocytes were first injected with the mRNA encoding AR or AR mutants. The oocytes were then injected with the reporter containing either the PSA enhancer, 1xARE or 4xARE in the ssDNA form to allow them assemble into chromatin via the replication-coupled assembly pathway. The oocytes were incubated with R1881 (50 nM) overnight and then processed for ChIP assays using the AR-N20 antibody and transcriptional analyses by primer extension. As shown in Fig. 4Go, A and B, although binding of the wild-type AR is readily detected, no binding of both AR N/C interaction mutants was detected for the PSA enhancer and the reporter with a single ARE. Consistent with the ChIP results, no transcriptional activation from these reporters was observed for both AR mutants, whereas activation by AR was readily detected (Fig. 4Go, A and B, lower panel). Thus, the defect in binding to chromatin is not specific to the MMTV-LTR but appears to be a general feature of these N-C interaction mutants.

Interestingly, ChIP result from the reporter containing four AREs showed that both AR mutants could bind to this reporter (Fig. 4CGo). Thus, the presence of multiple AREs seems to rescue the chromatin binding defect of the AR N/C interaction mutants. Transcriptional analysis showed that both AR mutants were able to stimulate transcription from this reporter, albeit lesser efficient in comparison to the wild-type AR (Fig. 4CGo, lower panel). Together, these results suggest that the N/C interaction mutants are not completely inactive in binding to chromatin. The presence of multiple AREs presumably allows the AR mutants to bind chromatin synergistically and therefore rescues their crippled chromatin binding activity.

The N/C Interaction Is also Required for Binding of AR to Chromatin in Mammalian Cells
Given our novel finding that the N/C interaction is required for binding of AR to chromatin in Xenopus oocytes, we next wished to test whether the AR N/C interaction is also required for binding of AR to chromatin in mammalian cells. Toward this direction, we established stable inducible cell lines expressing either AR or AR{Delta}F mutant using the Flp-In T-Rex 293 system from Invitrogen (Carlsbad, CA). One advantage of this system is that the expression plasmid is selectively integrated into a single Flp recombinase target (FRT) site located in the transcriptionally active genomic locus through the coexpression of Flp recombinase. Thus, the resulting stable cell lines are identical in genetic background except the expression of the genes of interest. The other advantage of this system is inducible expression of the gene of interest. As shown in Fig. 5AGo, we first established the condition that the expression of AR and AR{Delta}F were readily induced by treatment with doxycycline (0.5 µg/ml) overnight. Because there is no detectable level of endogenous AR in the parental 293 cell line (see Fig. 5AGo), these stable cell lines permitted us to compare the binding of AR and AR{Delta}F mutant to the chromosomal AR target genes such as PSA. To do this, we first induced the expression of AR and AR{Delta}F overnight, added R1881 (50 nM) for 1 h, and then examined the binding of AR and AR{Delta}F to the endogenous PSA enhancer using ChIP assays as described in Materials and Methods. To our delight, the ChIP result (Fig. 5BGo) showed that, although AR did bind to the PSA enhancer, no binding of AR{Delta}F was detected under the exact same condition. This result is in agreement with our data from Xenopus oocytes and further demonstrates that the AR N/C interaction is required for AR to bind chromatin template. We also attempted to analyze whether AR{Delta}F was able to activate PSA gene expression by RT-PCR. Although no activation of PSA was detected upon induction of AR{Delta}F and R1881 treatment, we also failed to detect transcriptional activation by the wild-type AR under the same condition (data not shown). Interestingly we found that PSA gene was abundantly transcribed in the 293 Flp-In cells (data not shown), which at least in part explain why we did not see any significant induction of PSA gene by AR.


Figure 5
View larger version (40K):
[in this window]
[in a new window]
 
Fig. 5. The N/C Interaction Is Required for AR to Bind to the Chromosomal PSA Enhancer But Not a Transiently Transfected Reporter in Mammalian Cells

A, Establishing inducible stable cell lines expressing AR or AR{Delta}F using the Flp-In T-REx system. The parental cell line (293), stable AR and AR{Delta}F cell lines were induced with doxycycline (0.5 µg/ml) overnight and the whole-cell extracts were prepared and analyzed for the expression of AR by Western blot using the AR N-20 antibody. B, ChIP assay was carried out to examine the binding of AR and ARF to the endogenous PSA enhancer. The cells were first induced for expression of AR or ARF overnight and then treated with R1881 (50 nM) for 1 h before used for ChIP assays. The result showed that AR but not AR{Delta}F is able to the endogenous PSA enhancer. This result is confirmed by three independent experiments. C, Both AR mutants were able to activate transcription from a luciferase reporter driven by MMTV-LTR in transient transfection. The data are average results from two independent experiments. D, ChIP assay on transiently transfected reporter showed that both AR mutants bound to the MMTV-LTR in a R1881-dependent manner. The ChIP results were verified by two independent experiments.

 
The above ChIP result showed that AR{Delta}F mutant is defective in binding to the endogenous PSA enhancer. We next tested whether the AR{Delta}F and ARG21E mutants were able to bind to transiently transfected AR reporter. For this purpose, we cotransfected a MMTV-LTR luc reporter with AR, AR{Delta}F or ARG21E into 293 cells. Twenty-four hours after transfection, the cells were either treated with 50 nM R1881 for 12 h for luciferase assay or 1 h for ChIP assay. A representative result in Fig. 5CGo showed that both mutants were able to activate transcription from the transfected MMTV-LTR luc reporter. Furthermore, the ChIP result in Fig. 5DGo showed that both mutants bound to the transfected MMTV-LTR luc reporter in a R1881-dependent manner. Thus, in agreement with the previous data (28), both AR{Delta}F and ARG21E mutants were able to bind to transiently transfected MMTV-LTR luc reporter, which presumably was not assembled into canonical chromatin structure.

The N/C Interaction Is Likely Required for AR to Interact with SWI/SNF
The above results indicate that the N/C interaction mutants are selectively defective in binding to chromatin in vivo. It is well documented that assembly of DNA into chromatin can severely inhibit the binding of transcriptional factors to their cognate recognition sequences (34, 35). Two key mechanisms that facilitate binding of transcriptional factors to chromatin are the posttranslational modifications of histones such as acetylation and chromatin remodeling by ATPase machineries such as SWI/SNF complex (11, 36). Thus, we reasoned that the N/C interaction mutants might be impaired in hormone-dependent recruitment of histone acetyltransferase-containing coactivators such as SRC family coactivators and CBP/p300 and/or ATP-dependent chromatin remodeling complex SWI/SNF. To test this idea, we made use of the 293 stable cell lines we have generated. The expression of AR and AR{Delta}F mutant was induced by doxycycline (0.5 µg/ml) overnight and followed by treatment with R1881 for 1 h. To preserve the hormone-dependent interaction with coactivators, we treated cells after hormone treatment with a reversible short arm cross-linking reagent dithiobis[succinimidylprooionate] (DSP) (Pierce, Rockford, IL). The whole-cell extracts were then prepared and used for immunoprecipitation (IP) using the AR N20 antibody. After extensive washing, the beads were boiled in 2x sodium dodecyl sulfate loading buffer containing 10 mM dithiothreitol (DTT) to reverse the cross-linking. Although we did not observe significant difference in association of p300, SRC-1 and SRC-3 with both AR and AR{Delta}F (Fig. 6BGo), we found that the R1881-dependent interaction with Brg1, the ATPase subunit of the SWI/SNF complex, was significantly reduced for the AR{Delta}F mutant (Fig. 6AGo). The control Western analysis showed that a similar level of Brg1 was present in each sample (Input). In addition, a similar level of AR protein was immunoprecipiated from the AR and AR{Delta}F samples, thus excluding the inefficient IP of AR{Delta}F as a potential explanation for the reduced co-IP of Brg1. Thus, this experiment provides evidence that the AR N/C interaction is likely required for the efficient interaction of AR with SWI/SNF complex.


Figure 6
View larger version (45K):
[in this window]
[in a new window]
 
Fig. 6. The AR{Delta}F Mutant Exhibited Impaired Interaction with SWI/SNF

A, The parental cell line, AR and AR{Delta}F cell lines were induced overnight with doxycycline (1 µg/ml), treated with R1881 (50 nM) for 1 h and then treated with cross-linking reagent DSP. The cell extracts were prepared as described and used for IP using AR N-20 antibody. After reverse cross-linking by boiling in sodium dodecyl sulfate loading buffer containing 10 mM DTT, the samples were resolved with a SDS-PAGE. The presence of AR and Brg1 was detected by Western blot using their corresponding specific antibody. B, The experiments were the same as in A except the coimmunoprecipitations of SRC-1, SRC-3, and p300 were analyzed.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chromatin is an integral component of transcriptional regulation in eukaryotic cells (37, 38, 39). Chromatin in general serves to repress transcription by limiting the access of transcriptional factors and/or basal transcriptional machinery to their recognition sequences (34). Thus, it is not surprising that cells have evolved various mechanisms to facilitate transcription in the context of chromatin (36). In this study, we have analyzed the role of AR N/C interaction in transcriptional regulation in the context of chromatin using Xenopus oocytes as a model system. We find to our surprise that two AR mutants defective in N/C interaction are unable to activate transcription from a MMTV-LTR driven reporter assembled into chromatin. In an effort to understand the underlying mechanism, we find that these mutants are specifically impaired in their ability to bind to chromatin. We present evidence that this defect in binding chromatin may be ascribed to the impaired hormone-dependent interaction between AR and chromatin remodeling factor SWI/SNF.

The two AR mutants used in this study were previously shown to exhibit reduced transcriptional activity toward reporters driven by nonspecific HREs (hormone response element) but not by the specific HREs (28). We confirmed that these AR mutants were able to activate transcription from a reporter driven by MMTV-LTR and further showed that both mutants bound to the transfected MMTV-LTR as effectively as the wild-type AR (Fig. 5DGo). These AR mutants were shown to bind to various HREs in in vitro gel mobility shift assay indistinguishable from the wild-type AR (28), a result that is also confirmed by our study (Fig. 3Go). An independent study using similar N/C interaction mutants showed that the N/C interaction affects transcription driven by the promoters such as PSA but not by MMTV-LTR (27). Interestingly, several AR mutants identified in patients suffering from androgen-insensitive syndrome were found to contain single-point mutations in the AR LBD that also attenuate the AR N/C interaction (40). Together, the current data suggest that the N/C interaction maybe critically important for physiological function of AR but lesser important for transient transfection-based transcription assay. Before this study, mechanistically the N/C interaction of AR has been shown to affect only the rate of hormone dissociation (24, 41). Although the N/C interaction has also been shown to inhibit the recruitment of SRC family coactivator by AR-LBD (29), this effect is unlikely to explain the role of N/C interaction in transcriptional activation by AR. In this study, we find that in Xenopus oocytes both AR{Delta}F and ARG21E mutants are essentially inactive in activating transcription from a chromatin reporter driven by the MMTV-LTR. This result is in sharp contrast with the previous study using transient transfection assays in which the N/C interaction did not appear to be essential for activation from a MMTV-LTR reporter (41). This difference can be readily explained by the selective defect of both AR{Delta}F and ARG21E mutants in binding to chromatin templates as we have observed (Figs. 2Go and 4Go). We show that both AR mutants failed to bind not only the MMTV-LTR but also the PSA enhancer and the reporter with a single consensus ARE in chromatin. Importantly, by using inducible stable cell lines expressing AR or AR{Delta}F mutant, we further show that the AR{Delta}F mutant is also defective in binding of the chromosomal PSA enhancer in mammalian cells (Fig. 5Go). Thus, the requirement for N/C interaction in binding of chromatin is not a unique phenomenon for Xenopus oocytes but is likely a general property of AR. The requirement for the N/C interaction in binding of chromatin by AR also provides a new explanation as to why the N/C interaction mutants are associated with the androgen-insensitive syndrome (40). Thus, it is tempting to propose that the AR N/C interaction is required for AR to bind to chromatin to exert its transcriptional function. However, because our study focused only on two AR mutants, it remains to be demonstrated whether the N/C interaction is generally required for the binding of AR to chromatin templates.

Currently we do not know exactly why the N/C interaction mutants are defective in binding to chromatin. Both mutants responded to R1881 in Xenopus oocytes (Fig. 2AGo) as well as in mammalian cells (Fig. 5Go, C and D), thus ruling out defect in hormone binding as a potential explanation for the defect in chromatin binding. As shown in Fig. 6BGo, the AR{Delta}F mutant interacts with SRC-1, SRC-3, and p300 as efficiently as the wild-type AR. Thus, the N-C interaction seems not essential for interaction of AR with these coactivators. Interestingly, we found that the AR{Delta}F mutant exhibits a significantly reduced interaction with Brg1, the ATPase subunit of the SWI/SNF complex. Strong evidence indicates that the SWI/SNF complex plays a critical role in transcriptional activation by AR (20, 21, 42). Our finding that the AR{Delta}F mutant is significantly impaired in interaction with Brg1suggests a model in which the SWI/SNF is required for binding of AR to chromatin. In this model, AR by itself could not bind efficiently to the ARE in chromatin. The hormone-dependent recruitment of SWI/SNF by AR remodels the chromatin structure, which in turn allows AR to bind more effectively to the AREs. This working model could also explain why in the presence of multiple AREs (four AREs) both AR N/C interaction mutants are able to bind to chromatin (Fig. 4CGo). It is well documented that transcriptional factors can bind synergistically to their multiple cognate binding sites in nucleosomes both in vitro and in vivo (43). In this case, the synergistical binding by AR to four AREs may bypass the requirement for chromatin remodeling by SWI/SNF. Alternatively, the weak interaction between SWI/SNF and the AR mutants may recruit sufficient amount of SWI/SNF to the reporter containing multiple AREs, which in turn allows the AR mutants to bind more efficiently. However, we like to emphasize here that, although the defect in interaction with SWI/SNF fits well with the chromatin binding defect, we could not exclude the possibility that the AR mutants may be crippled in interaction with additional cofactor(s) that maybe also essential for efficient binding of AR to chromatin.

Previous studies indicate that chromatin structure constrains the function of transient expressed progesterone receptor (44). Although the transiently expressed PR is able to activate transcription from a transient transfected reporter, it cannot efficiently activate a stably integrated reporter. Furthermore, a differential effect of chromatin on transcriptional activation by estrogen receptor (ER) {alpha} and ERß has also been reported (45). In this case, although ER{alpha} and ERß have a similar activity toward nonchromatin DNA templates, ERß is a much weaker transcriptional activator toward the chromatin template in comparison to ER{alpha}. In this study, we show that the N/C interaction of AR is required specifically for its transcriptional function in the context of chromatin. Thus, chromatin can impose various constraints on transcription regulation. It further emphasizes the need to study the transcriptional regulation in the context of chromatin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Constructs and Antibodies
The reporter plasmids MMTV-LTR-CAT, PSA-CAT, 1xARE-TRßA-CAT and 4xARE-TRßA-CAT were previously described (20, 30). The preparation of ssDNA for each reporter from phagemids was essentially as described (32). The original pSG5-AR{Delta}F and pSG5-ARG21E plasmids were kindly provided by Dr. Frank Claessens (University of Leuven, Leuven, Belgium) (28). To generate the constructs for in vitro synthesis of mRNA encoding AR{Delta}F and ARG21E, we first amplified by PCR the region from the N-terminal to an internal unique Afl II site (amino acids 1–113) using the pSG5-ARF or pSG5-ARG21E as template. These PCR products were then used to replace the corresponding region of AR cloned into a modified pSP64(polyA) vector (MS2-Flag-AR) to generate MS2-Flag-AR{Delta}F and MS2-Flag-ARG21E. To generate doxycycline-inducible stable cell line expressing AR or AR{Delta}F, we first amplified by AR the whole coding region of AR or AR{Delta}F using the corresponding MS2 construct described above. The PCR products were then cloned into the pcDNA5/FRT/TO vector from Invitrogen. All plasmids were verified by DNA sequencing.

The AR antibodies N-20 and C-19 were purchased from Santa Cruz Biotechnology. Gal4 (DBD) antibodies were purchased from Upstate Biotechnology (Lake Placid, NY). Brg1 antibody was kindly provided by Dr. Weidong Wang (National Institute on Aging). Flag tag antibody was purchased from Sigma (St. Louis, MO). Antibodies against SRC-1, SRC-3, and p300 were as described (46).

Microinjection of Xenopus Oocytes
Preparation and microinjection of mRNA and reporter DNA into stage VI Xenopus oocytes were performed as previously described (32). All capped polyadenylated mRNAs used for injection were synthesized using a SP6 Message Machine kit (Ambion, Austin, TX). The preparation of single-stranded reporter DNA was previously described (32). mRNA was injected at a concentration of 100 ng/µl (18.4 nl/oocyte) and reporter plasmid in ssDNA form was injected at a concentration of 50 ng/µl (18.4 nl/oocyte) according to the experimental scheme described in each figure.

Primer Extension
Primer extension was used to analyze the quantity of RNA transcripts produced form reporter genes in Xenopus oocytes. The procedure used for primer extension has been previously described (32). The Xenopus oocyte storage histone H4 mRNA was used as an internal control in all primer extension assays (47).

Western Blotting
For Xenopus oocyte whole-cell extracts, five to 10 oocytes were homogenized in 100 mM Tris/10 mM EDTA (pH 8.0) (10 µl/oocyte) and centrifuged to remove insoluble material. An equal volume of 2x SDS-PAGE loading buffer was added to each sample and either used immediately for Western analysis or stored at –20 C. Xenopus oocyte nuclear extracts were prepared by manually dissecting the germinal vesicle from 10 oocytes and dissolving them in 40 µl of 2x SDS-PAGE loading buffer. Ten microliters were used for Western blotting.

ChIP
ChIP assays using injected Xenopus oocytes were performed exactly as previously described (48). Ten to 20 oocytes were used per treatment group. The final volume of the sonicated chromatin solution was 1.4 ml. Twenty microliters of chromatin solution were saved for the input control. The volume of sonicated chromatin solution equivalent to one oocyte was used for IP with 1 µg of AR N20 or C19 antibody, 5 µl of protein A agarose (Sigma) and ChIP I buffer to a final volume of 200 µl. Immunoprecipitated DNA was resuspended in 20 µl of 10 mM Tris (pH 8.0) (80 µl for input samples). Four microliters were used for each PCR. The PCR primers for ChIP assay of MMTV-LTR reporter are 5'CCAATCTTGGTTCCCAAGGTTT 3'(forward) and 5'GTTAGGACTGTTGCAAGTTTACT3' (reverse). The primers for ChIP assay of PSA-CAT reporter are 5'GATCCAGGCTTGCTTACTGTCCTA3' (forward) and 5'AATCTTGTAGGGTGACCAGAGCAG3' (reverse). The primers for ChIP assay of 1xARE- and 4xARE-pTRßA reporters are 5'TGCCAGGGCCTATTTTGAATC3' (forward) and 5'AGAGCCTGAGTGAAGACCCATAAG3' (reverse).

ChIP assay using Flp-In T-REx 293 stable cell lines was essentially as described (49). The stable cell lines were first treated with doxycycline (0.5 µg/ml) for 12 h to induce expression of AR or ARF mutant. The cells were further treated with R1881 (50 nM) for 1 h before processed for ChIP assay. The same PSA primers were used here.

Standard PCR was performed in 20-µl volumes with the inclusion of 1 µCi of [32P]deoxy-CTP. The products were visualized by autoradiography. The PCR (94 C for 45 sec, 63 C for 45 sec, 72 C for 45 sec) consisted of 20 cycles for DNA from oocytes and 25 cycles for DNA from mammalian cells.

Gel Mobility Shift Assay
Gel shift experiment was performed essentially as described previously (28) with minor modifications. The wild-type AR and mutants were expressed in Xenopus oocytes via injection of their corresponding mRNAs. After overnight incubation, the oocytes were treated with R1881 (50 nM) for 1 h before were homogenized with lysis buffer [20 mM HEPES (pH 7.8), 450 mM NaCl, 0.4 mM EDTA, 1 mM DTT and 25% glycerol] (10 µl/oocyte). After a centrifugation at 13,000 rpm for 10 min at 4 C, the clean supernatants were collected and used immediately for gel mobility shift assay or stored in a –80 C freezer.

Protein-Protein Cross-Linking Using DSP
To facilitate the analysis of AR-coactivator interaction, we made use of protein-protein cross-linking reagent DSP from Pierce (no. 22585). The cross-linking with DSP (20 mM) was carried out in PBS buffer at room temperature for 30 min essentially according to manufacturer’s instruction. The cells were lysed with high-salt EBC buffer [20 mM Tris (pH 8.0), 500 mM NaCl, 1% Nonidet P-40, 2 mM EDTA and 20% glycerol plus a cocktail of proteinase inhibitors (Roche, Indianapolis, IN)]. The lysates were sonicated three times for 15 sec each time on ice at 40% output (Branson Sonifier 250). After centrifugation at top speed for 15 min, the clean extracts were diluted 3-fold with IP buffer [20 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA] before used for IP and Western analysis using antibodies as indicated in the figure legend.


    ACKNOWLEDGMENTS
 
We thank Dr. Frank Claessens for providing pSG5-AR{Delta}F and pSG5-ARG21E constructs. We also thank Dr. Weidong Wang for providing Brg1 antibody. We are grateful to David Stewart for critical reading of the manuscript.


    FOOTNOTES
 
This work is supported by National Institutes of Health Grants DK065264 and Department of Defense Prostate Cancer Research Program DAMD 17-03-0165 (to J.W).

First Published Online December 22, 2005

Abbreviations: AF, Activation domain; AR, androgen receptor; ARE, AR response element; C, carboxyl terminal; CAT, chloramphenicol acetyl transferase; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; DBD, DNA binding domain; DSP, dithiobis[succinimidylprooionate]; DTT, dithiothreitol; ER, estrogen receptor; HRE, hormone response element; IP, immunoprecipitation; LBD, ligand binding domain; LTR, long terminal repeat; MMTV, mouse mammary tumor virus; N, amino terminal; N/C interaction, N-terminal and C-terminal interaction; NR, nuclear receptor; NTD, N-terminal domain; PSA, prostate-specific antigen; SRC, steroid receptor coactivator; ssDNA, single-stranded DNA.

Received for publication July 18, 2005. Accepted for publication December 13, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Lee HJ, Chang C 2003 Recent advances in androgen receptor action. Cell Mol Life Sci 60:1613–1622[CrossRef][Medline]
  2. Culig Z 2003 Role of the androgen receptor axis in prostate cancer. Urology 62:21–26[CrossRef][Medline]
  3. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  4. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  5. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  6. Chang C, Saltzman A, Yeh S, Young W, Keller E, Lee HJ, Wang C, Mizokami A 1995 Androgen receptor: an overview. Crit Rev Eukaryot Gene Expr 5:97–125[Medline]
  7. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  8. Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocr Rev 23:175–200[Abstract/Free Full Text]
  9. Wang L, Hsu CL, Chang C 2005 Androgen receptor corepressors: an overview. Prostate 63:117–130[CrossRef][Medline]
  10. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121–141[Free Full Text]
  11. Kraus WL, Wong J 2002 Nuclear receptor-dependent transcription with chromatin. Is it all about enzymes? Eur J Biochem 269:2275–2283[Medline]
  12. Culig Z, Comuzzi B, Steiner H, Bartsch G, Hobisch A 2004 Expression and function of androgen receptor coactivators in prostate cancer. J Steroid Biochem Mol Biol 92:265–271[CrossRef][Medline]
  13. Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee GA, Stallcup MR 1999 Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 19:6164–6173[Abstract/Free Full Text]
  14. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 19:6085–6097[Abstract/Free Full Text]
  15. Bevan CL, Hoare S, Claessens F, Heery DM, Parker MG 1999 The AF1 and AF2 domains of the androgen receptor interact with distinct regions of SRC1. Mol Cell Biol 19:8383–8392[Abstract/Free Full Text]
  16. Estebanez-Perpina E, Moore JM, Mar E, Delgado-Rodrigues E, Nguyen P, Baxter JD, Buehrer BM, Webb P, Fletterick RJ, Guy RK 2005 The molecular mechanisms of coactivator utilization in ligand-dependent transactivation by the androgen receptor. J Biol Chem 280:8060–8068[Abstract/Free Full Text]
  17. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  18. He B, Gampe Jr RT, Kole AJ, Hnat AT, Stanley TB, An G, Stewart EL, Kalman RI, Minges JT, Wilson EM 2004 Structural basis for androgen receptor interdomain and coactivator interactions suggests a transition in nuclear receptor activation function dominance. Mol Cell 16:425–438[CrossRef][Medline]
  19. He B, Minges JT, Lee LW, Wilson EM 2002 The FXXLF motif mediates androgen receptor-specific interactions with coregulators. J Biol Chem 277:10226–10235[Abstract/Free Full Text]
  20. Huang ZQ, Li J, Sachs LM, Cole PA, Wong J 2003 A role for cofactor-cofactor and cofactor-histone interactions in targeting p300, SWI/SNF and Mediator for transcription. EMBO J 22:2146–2155[CrossRef][Medline]
  21. Link KA, Burd CJ, Williams E, Marshall T, Rosson G, Henry E, Weissman B, Knudsen KE 2005 BAF57 governs androgen receptor action and androgen-dependent proliferation through SWI/SNF. Mol Cell Biol 25:2200–2215[Abstract/Free Full Text]
  22. Langley E, Zhou ZX, Wilson EM 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:29983–29990[Abstract/Free Full Text]
  23. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  24. Langley E, Kemppainen JA, Wilson EM 1998 Intermolecular NH2-/carboxyl-terminal interactions in androgen receptor dimerization revealed by mutations that cause androgen insensitivity. J Biol Chem 273:92–101[Abstract/Free Full Text]
  25. He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986–22994[Abstract/Free Full Text]
  26. He B, Wilson EM 2003 Electrostatic modulation in steroid receptor recruitment of LXXLL and FXXLF motifs. Mol Cell Biol 23:2135–2150[Abstract/Free Full Text]
  27. He B, Lee LW, Minges JT, Wilson EM 2002 Dependence of selective gene activation on the androgen receptor NH2- and COOH-terminal interaction. J Biol Chem 277:25631–25639[Abstract/Free Full Text]
  28. Callewaert L, Verrijdt G, Christiaens V, Haelens A, Claessens F 2003 Dual function of an amino-terminal amphipatic helix in androgen receptor-mediated transactivation through specific and nonspecific response elements. J Biol Chem 278:8212–8218[Abstract/Free Full Text]
  29. He B, Bowen NT, Minges JT, Wilson EM 2001 Androgen-induced NH2- and COOH-terminal interaction inhibits p160 coactivator recruitment by activation function 2. J Biol Chem 276:42293–42301[Abstract/Free Full Text]
  30. Huang Z, Li J, Wong J 2002 AR possesses an intrinsic hormone-independent transcriptional activity. Mol Endocrinol 16:924–937[Abstract/Free Full Text]
  31. Almouzni G, Wolffe AP 1993 Replication-coupled chromatin assembly is required for the repression of basal transcription in vivo. Genes Dev 7:2033–2047[Abstract/Free Full Text]
  32. Wong J, Shi YB, Wolffe AP 1995 A role for nucleosome assembly in both silencing and activation of the Xenopus TRßA gene by the thyroid hormone receptor. Genes Dev 9:2696–2711[Abstract/Free Full Text]
  33. Wong J, Shi YB, Wolffe AP 1997 Determinants of chromatin disruption and transcriptional regulation instigated by the thyroid hormone receptor: hormone-regulated chromatin disruption is not sufficient for transcriptional activation. EMBO J 16:3158–3171[CrossRef][Medline]
  34. Wolffe AP, Guschin D 2000 Review: chromatin structural features and targets that regulate transcription. J Struct Biol 129:102–122[CrossRef][Medline]
  35. Wolffe AP 2001 Transcriptional regulation in the context of chromatin structure. Essays Biochem 37:45–57[Medline]
  36. Kingston RE, Narlikar GJ 1999 ATP-dependent remodeling and acetylation as regulators of chromatin fluidity. Genes Dev 13:2339–2352[Free Full Text]
  37. Struhl K 1998 Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12:599–606[Free Full Text]
  38. Jenuwein T, Allis CD 2001 Translating the histone code. Science 293:1074–1080[Abstract/Free Full Text]
  39. Zhang Y, Reinberg D 2001 Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev 15:2343–2360[Free Full Text]
  40. Thompson J, Saatcioglu F, Janne OA, Palvimo JJ 2001 Disrupted amino- and carboxyl-terminal interactions of the androgen receptor are linked to androgen insensitivity. Mol Endocrinol 15:923–935[Abstract/Free Full Text]
  41. He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. J Biol Chem 274:37219–37225[Abstract/Free Full Text]
  42. Marshall TW, Link KA, Petre-Draviam CE, Knudsen KE 2003 Differential requirement of SWI/SNF for androgen receptor activity. J Biol Chem 278:30605–30613[Abstract/Free Full Text]
  43. Workman JL, Kingston RE 1998 Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67:545–579[CrossRef][Medline]
  44. Smith CL, Htun H, Wolford RG, Hager GL 1997 Differential activity of progesterone and glucocorticoid receptors on mouse mammary tumor virus templates differing in chromatin structure. J Biol Chem 272:14227–14235[Abstract/Free Full Text]
  45. Cheung E, Schwabish MA, Kraus WL 2003 Chromatin exposes intrinsic differences in the transcriptional activities of estrogen receptors {alpha} and ß. EMBO J 22:600–611[CrossRef][Medline]
  46. Li J, O’Malley BW, Wong J 2000 p300 Requires its histone acetyltransferase activity and SRC-1 interaction domain to facilitate thyroid hormone receptor activation in chromatin. Mol Cell Biol 20:2031–2042[Abstract/Free Full Text]
  47. Wong J, Patterton D, Imhof A, Guschin D, Shi YB, Wolffe AP 1998 Distinct requirements for chromatin assembly in transcriptional repression by thyroid hormone receptor and histone deacetylase. EMBO J 17:520–534[CrossRef][Medline]
  48. Stewart MD, Li J, Wong J 2005 Relationship between histone H3 lysine 9 methylation, transcription repression, and heterochromatin protein 1 recruitment. Mol Cell Biol 25:2525–2538[Abstract/Free Full Text]
  49. Yoon HG, Choi Y, Cole PA, Wong J 2005 Reading and function of a histone code involved in targeting corepressor complexes for repression. Mol Cell Biol 25:324–335[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   AR
Coregulators:   p300  |  SRC-1  |  AIB1
Ligands:   R1881



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
J. Yang and M. J Young
The mineralocorticoid receptor and its coregulators
J. Mol. Endocrinol., August 1, 2009; 43(2): 53 - 64.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. F. Need, H. I. Scher, A. A. Peters, N. L. Moore, A. Cheong, C. J. Ryan, G. A. Wittert, V. R. Marshall, W. D. Tilley, and G. Buchanan
A Novel Androgen Receptor Amino Terminal Region Reveals Two Classes of Amino/Carboxyl Interaction-Deficient Variants with Divergent Capacity to Activate Responsive Sites in Chromatin
Endocrinology, June 1, 2009; 150(6): 2674 - 2682.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Fu, J. Jiang, J. Li, S. Wang, G. Shi, Q. Feng, E. White, J. Qin, and J. Wong
Deleted in Breast Cancer 1, a Novel Androgen Receptor (AR) Coactivator That Promotes AR DNA-binding Activity
J. Biol. Chem., March 13, 2009; 284(11): 6832 - 6840.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. E. Rosenblatt and K. L. Burnstein
Inhibition of Androgen Receptor Transcriptional Activity as a Novel Mechanism of Action of Arsenic
Mol. Endocrinol., March 1, 2009; 23(3): 412 - 421.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. J Kojetin, T. P Burris, E. V Jensen, and S. A Khan
Implications of the binding of tamoxifen to the coactivator recognition site of the estrogen receptor
Endocr. Relat. Cancer, December 1, 2008; 15(4): 851 - 870.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. M. Centenera, J. M. Harris, W. D. Tilley, and L. M. Butler
Minireview: The Contribution of Different Androgen Receptor Domains to Receptor Dimerization and Signaling
Mol. Endocrinol., November 1, 2008; 22(11): 2373 - 2382.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Bai and E. M. Wilson
Epidermal Growth Factor-Dependent Phosphorylation and Ubiquitinylation of MAGE-11 Regulates Its Interaction with the Androgen Receptor
Mol. Cell. Biol., March 15, 2008; 28(6): 1947 - 1963.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. M. Dehm and D. J. Tindall
Androgen Receptor Structural and Functional Elements: Role and Regulation in Prostate Cancer
Mol. Endocrinol., December 1, 2007; 21(12): 2855 - 2863.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. C. Hodgson, I. Astapova, A. N. Hollenberg, and S. P. Balk
Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors
Cancer Res., September 1, 2007; 67(17): 8388 - 8395.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. B. Askew, R. T. Gampe Jr., T. B. Stanley, J. L. Faggart, and E. M. Wilson
Modulation of Androgen Receptor Activation Function 2 by Testosterone and Dihydrotestosterone
J. Biol. Chem., August 31, 2007; 282(35): 25801 - 25816.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Haelens, T. Tanner, S. Denayer, L. Callewaert, and F. Claessens
The Hinge Region Regulates DNA Binding, Nuclear Translocation, and Transactivation of the Androgen Receptor
Cancer Res., May 1, 2007; 67(9): 4514 - 4523.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Wu, H. Kawate, K. Ohnaka, H. Nawata, and R. Takayanagi
Nuclear Compartmentalization of N-CoR and Its Interactions with Steroid Receptors.
Mol. Cell. Biol., September 1, 2006; 26(17): 6633 - 6655.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Wong, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Wong, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals