| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Cellular Biology (J.L., J.F., C.T., J.W.), Baylor College of Medicine, Houston, Texas 77030; and Department of Biochemistry and Molecular Biology (H.Y.), Yonsei University College of Medicine, Soedaemoon-gu, Seoul 120-752, Korea
Address all correspondence and requests for reprints to: Jiemin Wong, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: jwong{at}bcm.tmc.edu.
| ABSTRACT |
|---|
|
|
|---|
F) and one with a Gly 21 to Glu mutation (ARG21E), were surprisingly inactive in activating transcription from various reporters assembled into chromatin. Further study using chromatin immunoprecipitation assay revealed that these mutants failed to bind both mouse mammary tumor virus-long terminal repeat and prostate-specific antigen enhancer assembled into chromatin. This defect is specific to chromatin because both mutants could bind to a consensus AR response element in vitro and activate transcription driven by mouse mammary tumor virus-long terminal repeat in transient transfection as effective as the wild-type AR. To further substantiate this novel finding, we established 293 cell lines that stably expressed either AR or AR
F mutant in an inducible manner. Using these cell lines, we confirmed by using chromatin immunoprecipitation assay that AR but not AR
F could bind to the endogenous prostate-specific antigen enhancer. Furthermore, we found that the AR
F mutant interacts poorly with Brg1, the ATPase subunit of the chromatin-remodeling factor SWI/SNF. Taken together, our study reveals a novel role of AR N/C interaction in control of AR chromatin binding and suggests a working model that the proper N/C interaction is required for AR to recruit SWI/SNF complex, which in turn remodels chromatin to allow AR to bind to AR response elements in chromatin. | INTRODUCTION |
|---|
|
|
|---|
The actions of AR are subject to modulation, either positively or negatively, by an increasing number of coregulatory proteins, termed coactivators or corepressors (7, 8, 9). Coactivators are believed to function either as bridging factors between receptors and basal transcription machinery to enhance recruitment of the basal transcription machinery and/or as factors that have capacity to actively remodel repressive chromatin (10, 11). A large number of proteins have been reported to function as AR coactivators, including the generic coactivators such as steroid receptor coactivator (SRC) family members and cAMP response element binding protein-binding protein (CBP)/p300, the ATP-dependent chromatin remodeling complex SWI/SNF, and the relatively AR-specific coactivators such as ARA54 and ARA70 (8, 12). SRC family members interact with both the AF1 and AF2 of AR (13, 14, 15, 16). The interaction with AF1 is mediated through a glutamine-rich region in the SRC family members, whereas the interaction with the AF2 requires the signature LxxLL motifs that are widely involved in interaction with other NRs (16, 17). In this regard, the AF2 domain of AR has been shown to bind with a higher affinity toward the FxxLF motif than to the LxxLL motif (16, 18). The FxxLF was a AR-LBD interacting signature motif initially identified in the NTD of AR and later also found in the several AR coactivators, including ARA70 and ARA 54 (19). Several studies show that the activity of SWI/SNF is required for transcriptional activation by AR (20, 21). Although the exact mechanism remains to be determined, previous studies indicate that SWI/SNF can be recruited either indirectly through CBP/p300 and/or directly through an interaction between AR and BAF57 (20, 21).
The NTD of AR is known to strongly interact with the LBD in a hormone-dependent manner (22, 23, 24). This interdomain interaction, also known as the N/C interaction, involves the 23FxxLF27 motif and its flanking sequence in the NTD and a hydrophobic cleft created by helices 3, 4, 5, and 12 in the LBD (25, 26). Such a strong N/C interaction has many implications on the transcriptional regulation by AR because the same hydrophobic cleft in the AR-LBD is likely required for hormone-dependent interaction with the LxxLL motif-containing coactivators such as SRC-1 and the FxxLF motif-containing coactivators such as ARA70. By transient transfection assays, several groups have investigated the roles of the N/C interaction using AR mutants defective in the N/C interaction. These studies have collectively shown that the N/C interaction is required for the optimal transcriptional activation by AR for some [e.g. prostate-specific antigen (PSA)] but not the other reporters [mouse mammary tumor virus-long terminal repeat (MMTV-LTR)] (27, 28), although the underlying mechanism is not entirely clear. On one hand, the N/C interaction has been reported to inhibit the binding and coactivator activity of SRC-1 toward AR (29). On the other hand, the N/C interaction has been shown to reduce the rate of hormone dissociation from AR (24), thus providing an explanation why the N/C interaction may facilitate the transcriptional activation by AR.
We have previously established Xenopus oocytes as a model system for study of transcriptional regulation by AR in the context of chromatin (21, 31). Xenopus oocytes contain a large storage of factors required for transcription and both histones and nonhistone proteins required for chromatin assembly. Introduction of DNA into the nucleus of Xenopus oocytes through microinjection allows the assembly of injected DNA into chromatin through a replication-independent (injection of double stranded DNA) or a replication-coupled pathway (injection of single-stranded reporter DNA) (31, 32, 33). We have shown previously that expression of AR in Xenopus oocytes activates transcription from several AR reporters assembled into chromatin in a hormone-stimulated manner, and this transcriptional activation involves histone acetylation by CBP/p300 and chromatin remodeling by SWI/SNF (21, 31). Using this model system, we have investigated the role for the N/C interaction in transcriptional regulation by AR. To our surprise, we find that the N/C interaction is required for transcriptional activation by AR from both PSA and MMTV-LTR driven reporters. We show that the N/C interaction-defective mutants are defective in binding to chromatin template but not to the DNA in vitro or transient transfected. We confirm in mammalian cells that the N/C interaction is required for binding of AR to the endogenous PSA enhancer. Taken together, our study uncovers a novel, chromatin-specific function for AR N/C interaction.
| RESULTS |
|---|
|
|
|---|
F) and one with G21 mutated to E (ARG21E) (Fig. 1A
|
|
F. After incubation overnight to allow expression of AR and AR
F, the oocytes were treated with 50 nM R1881 for 1 h. The nuclei of oocytes were then manually isolated away from the cytoplasm and the distribution of AR or AR
F in cytoplasm and nucleus was determined by Western analysis. As shown in Fig. 2A
F translocated into the nucleus upon R1881 treatment. This result indicates that AR
F does respond to R1881, suggesting that there is no gross defect in hormone binding activity for AR
F.
|
F translocated into the nucleus, we next investigated whether the AR mutants are able to bind to the MMTV-LTR in chromatin. For this purpose, we used the same experimental scheme as illustrated in Fig. 1A
The previous study using the same AR mutants expressed in mammalian cells showed that both AR mutants bind to several AR response elements (AREs) in vitro indistinguishable from the wild-type AR (28). To test whether both mutants expressed in Xenopus oocytes were able to bind to ARE in vitro, we performed gel mobility shift assay using a 32P-labeled consensus ARE probe essentially following the experimental conditions used in the previous study (28). The result in Fig. 3
showed that both mutants were able to bind to the ARE probe as effectively as the wild-type AR. Thus, like the case in mammalian cells (27), the AR mutants expressed in Xenopus oocytes possess the ability to bind an ARE probe in vitro. This result suggests that the N/C interaction mutants are specifically crippled in their ability to bind to chromatin template.
|
Interestingly, ChIP result from the reporter containing four AREs showed that both AR mutants could bind to this reporter (Fig. 4C
). Thus, the presence of multiple AREs seems to rescue the chromatin binding defect of the AR N/C interaction mutants. Transcriptional analysis showed that both AR mutants were able to stimulate transcription from this reporter, albeit lesser efficient in comparison to the wild-type AR (Fig. 4C
, lower panel). Together, these results suggest that the N/C interaction mutants are not completely inactive in binding to chromatin. The presence of multiple AREs presumably allows the AR mutants to bind chromatin synergistically and therefore rescues their crippled chromatin binding activity.
The N/C Interaction Is also Required for Binding of AR to Chromatin in Mammalian Cells
Given our novel finding that the N/C interaction is required for binding of AR to chromatin in Xenopus oocytes, we next wished to test whether the AR N/C interaction is also required for binding of AR to chromatin in mammalian cells. Toward this direction, we established stable inducible cell lines expressing either AR or AR
F mutant using the Flp-In T-Rex 293 system from Invitrogen (Carlsbad, CA). One advantage of this system is that the expression plasmid is selectively integrated into a single Flp recombinase target (FRT) site located in the transcriptionally active genomic locus through the coexpression of Flp recombinase. Thus, the resulting stable cell lines are identical in genetic background except the expression of the genes of interest. The other advantage of this system is inducible expression of the gene of interest. As shown in Fig. 5A
, we first established the condition that the expression of AR and AR
F were readily induced by treatment with doxycycline (0.5 µg/ml) overnight. Because there is no detectable level of endogenous AR in the parental 293 cell line (see Fig. 5A
), these stable cell lines permitted us to compare the binding of AR and AR
F mutant to the chromosomal AR target genes such as PSA. To do this, we first induced the expression of AR and AR
F overnight, added R1881 (50 nM) for 1 h, and then examined the binding of AR and AR
F to the endogenous PSA enhancer using ChIP assays as described in Materials and Methods. To our delight, the ChIP result (Fig. 5B
) showed that, although AR did bind to the PSA enhancer, no binding of AR
F was detected under the exact same condition. This result is in agreement with our data from Xenopus oocytes and further demonstrates that the AR N/C interaction is required for AR to bind chromatin template. We also attempted to analyze whether AR
F was able to activate PSA gene expression by RT-PCR. Although no activation of PSA was detected upon induction of AR
F and R1881 treatment, we also failed to detect transcriptional activation by the wild-type AR under the same condition (data not shown). Interestingly we found that PSA gene was abundantly transcribed in the 293 Flp-In cells (data not shown), which at least in part explain why we did not see any significant induction of PSA gene by AR.
|
F mutant is defective in binding to the endogenous PSA enhancer. We next tested whether the AR
F and ARG21E mutants were able to bind to transiently transfected AR reporter. For this purpose, we cotransfected a MMTV-LTR luc reporter with AR, AR
F or ARG21E into 293 cells. Twenty-four hours after transfection, the cells were either treated with 50 nM R1881 for 12 h for luciferase assay or 1 h for ChIP assay. A representative result in Fig. 5C
F and ARG21E mutants were able to bind to transiently transfected MMTV-LTR luc reporter, which presumably was not assembled into canonical chromatin structure.
The N/C Interaction Is Likely Required for AR to Interact with SWI/SNF
The above results indicate that the N/C interaction mutants are selectively defective in binding to chromatin in vivo. It is well documented that assembly of DNA into chromatin can severely inhibit the binding of transcriptional factors to their cognate recognition sequences (34, 35). Two key mechanisms that facilitate binding of transcriptional factors to chromatin are the posttranslational modifications of histones such as acetylation and chromatin remodeling by ATPase machineries such as SWI/SNF complex (11, 36). Thus, we reasoned that the N/C interaction mutants might be impaired in hormone-dependent recruitment of histone acetyltransferase-containing coactivators such as SRC family coactivators and CBP/p300 and/or ATP-dependent chromatin remodeling complex SWI/SNF. To test this idea, we made use of the 293 stable cell lines we have generated. The expression of AR and AR
F mutant was induced by doxycycline (0.5 µg/ml) overnight and followed by treatment with R1881 for 1 h. To preserve the hormone-dependent interaction with coactivators, we treated cells after hormone treatment with a reversible short arm cross-linking reagent dithiobis[succinimidylprooionate] (DSP) (Pierce, Rockford, IL). The whole-cell extracts were then prepared and used for immunoprecipitation (IP) using the AR N20 antibody. After extensive washing, the beads were boiled in 2x sodium dodecyl sulfate loading buffer containing 10 mM dithiothreitol (DTT) to reverse the cross-linking. Although we did not observe significant difference in association of p300, SRC-1 and SRC-3 with both AR and AR
F (Fig. 6B
), we found that the R1881-dependent interaction with Brg1, the ATPase subunit of the SWI/SNF complex, was significantly reduced for the AR
F mutant (Fig. 6A
). The control Western analysis showed that a similar level of Brg1 was present in each sample (Input). In addition, a similar level of AR protein was immunoprecipiated from the AR and AR
F samples, thus excluding the inefficient IP of AR
F as a potential explanation for the reduced co-IP of Brg1. Thus, this experiment provides evidence that the AR N/C interaction is likely required for the efficient interaction of AR with SWI/SNF complex.
|
| DISCUSSION |
|---|
|
|
|---|
The two AR mutants used in this study were previously shown to exhibit reduced transcriptional activity toward reporters driven by nonspecific HREs (hormone response element) but not by the specific HREs (28). We confirmed that these AR mutants were able to activate transcription from a reporter driven by MMTV-LTR and further showed that both mutants bound to the transfected MMTV-LTR as effectively as the wild-type AR (Fig. 5D
). These AR mutants were shown to bind to various HREs in in vitro gel mobility shift assay indistinguishable from the wild-type AR (28), a result that is also confirmed by our study (Fig. 3
). An independent study using similar N/C interaction mutants showed that the N/C interaction affects transcription driven by the promoters such as PSA but not by MMTV-LTR (27). Interestingly, several AR mutants identified in patients suffering from androgen-insensitive syndrome were found to contain single-point mutations in the AR LBD that also attenuate the AR N/C interaction (40). Together, the current data suggest that the N/C interaction maybe critically important for physiological function of AR but lesser important for transient transfection-based transcription assay. Before this study, mechanistically the N/C interaction of AR has been shown to affect only the rate of hormone dissociation (24, 41). Although the N/C interaction has also been shown to inhibit the recruitment of SRC family coactivator by AR-LBD (29), this effect is unlikely to explain the role of N/C interaction in transcriptional activation by AR. In this study, we find that in Xenopus oocytes both AR
F and ARG21E mutants are essentially inactive in activating transcription from a chromatin reporter driven by the MMTV-LTR. This result is in sharp contrast with the previous study using transient transfection assays in which the N/C interaction did not appear to be essential for activation from a MMTV-LTR reporter (41). This difference can be readily explained by the selective defect of both AR
F and ARG21E mutants in binding to chromatin templates as we have observed (Figs. 2
and 4
). We show that both AR mutants failed to bind not only the MMTV-LTR but also the PSA enhancer and the reporter with a single consensus ARE in chromatin. Importantly, by using inducible stable cell lines expressing AR or AR
F mutant, we further show that the AR
F mutant is also defective in binding of the chromosomal PSA enhancer in mammalian cells (Fig. 5
). Thus, the requirement for N/C interaction in binding of chromatin is not a unique phenomenon for Xenopus oocytes but is likely a general property of AR. The requirement for the N/C interaction in binding of chromatin by AR also provides a new explanation as to why the N/C interaction mutants are associated with the androgen-insensitive syndrome (40). Thus, it is tempting to propose that the AR N/C interaction is required for AR to bind to chromatin to exert its transcriptional function. However, because our study focused only on two AR mutants, it remains to be demonstrated whether the N/C interaction is generally required for the binding of AR to chromatin templates.
Currently we do not know exactly why the N/C interaction mutants are defective in binding to chromatin. Both mutants responded to R1881 in Xenopus oocytes (Fig. 2A
) as well as in mammalian cells (Fig. 5
, C and D), thus ruling out defect in hormone binding as a potential explanation for the defect in chromatin binding. As shown in Fig. 6B
, the AR
F mutant interacts with SRC-1, SRC-3, and p300 as efficiently as the wild-type AR. Thus, the N-C interaction seems not essential for interaction of AR with these coactivators. Interestingly, we found that the AR
F mutant exhibits a significantly reduced interaction with Brg1, the ATPase subunit of the SWI/SNF complex. Strong evidence indicates that the SWI/SNF complex plays a critical role in transcriptional activation by AR (20, 21, 42). Our finding that the AR
F mutant is significantly impaired in interaction with Brg1suggests a model in which the SWI/SNF is required for binding of AR to chromatin. In this model, AR by itself could not bind efficiently to the ARE in chromatin. The hormone-dependent recruitment of SWI/SNF by AR remodels the chromatin structure, which in turn allows AR to bind more effectively to the AREs. This working model could also explain why in the presence of multiple AREs (four AREs) both AR N/C interaction mutants are able to bind to chromatin (Fig. 4C
). It is well documented that transcriptional factors can bind synergistically to their multiple cognate binding sites in nucleosomes both in vitro and in vivo (43). In this case, the synergistical binding by AR to four AREs may bypass the requirement for chromatin remodeling by SWI/SNF. Alternatively, the weak interaction between SWI/SNF and the AR mutants may recruit sufficient amount of SWI/SNF to the reporter containing multiple AREs, which in turn allows the AR mutants to bind more efficiently. However, we like to emphasize here that, although the defect in interaction with SWI/SNF fits well with the chromatin binding defect, we could not exclude the possibility that the AR mutants may be crippled in interaction with additional cofactor(s) that maybe also essential for efficient binding of AR to chromatin.
Previous studies indicate that chromatin structure constrains the function of transient expressed progesterone receptor (44). Although the transiently expressed PR is able to activate transcription from a transient transfected reporter, it cannot efficiently activate a stably integrated reporter. Furthermore, a differential effect of chromatin on transcriptional activation by estrogen receptor (ER)
and ERß has also been reported (45). In this case, although ER
and ERß have a similar activity toward nonchromatin DNA templates, ERß is a much weaker transcriptional activator toward the chromatin template in comparison to ER
. In this study, we show that the N/C interaction of AR is required specifically for its transcriptional function in the context of chromatin. Thus, chromatin can impose various constraints on transcription regulation. It further emphasizes the need to study the transcriptional regulation in the context of chromatin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
F and pSG5-ARG21E plasmids were kindly provided by Dr. Frank Claessens (University of Leuven, Leuven, Belgium) (28). To generate the constructs for in vitro synthesis of mRNA encoding AR
F and ARG21E, we first amplified by PCR the region from the N-terminal to an internal unique Afl II site (amino acids 1113) using the pSG5-ARF or pSG5-ARG21E as template. These PCR products were then used to replace the corresponding region of AR cloned into a modified pSP64(polyA) vector (MS2-Flag-AR) to generate MS2-Flag-AR
F and MS2-Flag-ARG21E. To generate doxycycline-inducible stable cell line expressing AR or AR
F, we first amplified by AR the whole coding region of AR or AR
F using the corresponding MS2 construct described above. The PCR products were then cloned into the pcDNA5/FRT/TO vector from Invitrogen. All plasmids were verified by DNA sequencing. The AR antibodies N-20 and C-19 were purchased from Santa Cruz Biotechnology. Gal4 (DBD) antibodies were purchased from Upstate Biotechnology (Lake Placid, NY). Brg1 antibody was kindly provided by Dr. Weidong Wang (National Institute on Aging). Flag tag antibody was purchased from Sigma (St. Louis, MO). Antibodies against SRC-1, SRC-3, and p300 were as described (46).
Microinjection of Xenopus Oocytes
Preparation and microinjection of mRNA and reporter DNA into stage VI Xenopus oocytes were performed as previously described (32). All capped polyadenylated mRNAs used for injection were synthesized using a SP6 Message Machine kit (Ambion, Austin, TX). The preparation of single-stranded reporter DNA was previously described (32). mRNA was injected at a concentration of 100 ng/µl (18.4 nl/oocyte) and reporter plasmid in ssDNA form was injected at a concentration of 50 ng/µl (18.4 nl/oocyte) according to the experimental scheme described in each figure.
Primer Extension
Primer extension was used to analyze the quantity of RNA transcripts produced form reporter genes in Xenopus oocytes. The procedure used for primer extension has been previously described (32). The Xenopus oocyte storage histone H4 mRNA was used as an internal control in all primer extension assays (47).
Western Blotting
For Xenopus oocyte whole-cell extracts, five to 10 oocytes were homogenized in 100 mM Tris/10 mM EDTA (pH 8.0) (10 µl/oocyte) and centrifuged to remove insoluble material. An equal volume of 2x SDS-PAGE loading buffer was added to each sample and either used immediately for Western analysis or stored at 20 C. Xenopus oocyte nuclear extracts were prepared by manually dissecting the germinal vesicle from 10 oocytes and dissolving them in 40 µl of 2x SDS-PAGE loading buffer. Ten microliters were used for Western blotting.
ChIP
ChIP assays using injected Xenopus oocytes were performed exactly as previously described (48). Ten to 20 oocytes were used per treatment group. The final volume of the sonicated chromatin solution was 1.4 ml. Twenty microliters of chromatin solution were saved for the input control. The volume of sonicated chromatin solution equivalent to one oocyte was used for IP with 1 µg of AR N20 or C19 antibody, 5 µl of protein A agarose (Sigma) and ChIP I buffer to a final volume of 200 µl. Immunoprecipitated DNA was resuspended in 20 µl of 10 mM Tris (pH 8.0) (80 µl for input samples). Four microliters were used for each PCR. The PCR primers for ChIP assay of MMTV-LTR reporter are 5'CCAATCTTGGTTCCCAAGGTTT 3'(forward) and 5'GTTAGGACTGTTGCAAGTTTACT3' (reverse). The primers for ChIP assay of PSA-CAT reporter are 5'GATCCAGGCTTGCTTACTGTCCTA3' (forward) and 5'AATCTTGTAGGGTGACCAGAGCAG3' (reverse). The primers for ChIP assay of 1xARE- and 4xARE-pTRßA reporters are 5'TGCCAGGGCCTATTTTGAATC3' (forward) and 5'AGAGCCTGAGTGAAGACCCATAAG3' (reverse).
ChIP assay using Flp-In T-REx 293 stable cell lines was essentially as described (49). The stable cell lines were first treated with doxycycline (0.5 µg/ml) for 12 h to induce expression of AR or ARF mutant. The cells were further treated with R1881 (50 nM) for 1 h before processed for ChIP assay. The same PSA primers were used here.
Standard PCR was performed in 20-µl volumes with the inclusion of 1 µCi of [32P]deoxy-CTP. The products were visualized by autoradiography. The PCR (94 C for 45 sec, 63 C for 45 sec, 72 C for 45 sec) consisted of 20 cycles for DNA from oocytes and 25 cycles for DNA from mammalian cells.
Gel Mobility Shift Assay
Gel shift experiment was performed essentially as described previously (28) with minor modifications. The wild-type AR and mutants were expressed in Xenopus oocytes via injection of their corresponding mRNAs. After overnight incubation, the oocytes were treated with R1881 (50 nM) for 1 h before were homogenized with lysis buffer [20 mM HEPES (pH 7.8), 450 mM NaCl, 0.4 mM EDTA, 1 mM DTT and 25% glycerol] (10 µl/oocyte). After a centrifugation at 13,000 rpm for 10 min at 4 C, the clean supernatants were collected and used immediately for gel mobility shift assay or stored in a 80 C freezer.
Protein-Protein Cross-Linking Using DSP
To facilitate the analysis of AR-coactivator interaction, we made use of protein-protein cross-linking reagent DSP from Pierce (no. 22585). The cross-linking with DSP (20 mM) was carried out in PBS buffer at room temperature for 30 min essentially according to manufacturers instruction. The cells were lysed with high-salt EBC buffer [20 mM Tris (pH 8.0), 500 mM NaCl, 1% Nonidet P-40, 2 mM EDTA and 20% glycerol plus a cocktail of proteinase inhibitors (Roche, Indianapolis, IN)]. The lysates were sonicated three times for 15 sec each time on ice at 40% output (Branson Sonifier 250). After centrifugation at top speed for 15 min, the clean extracts were diluted 3-fold with IP buffer [20 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA] before used for IP and Western analysis using antibodies as indicated in the figure legend.
| ACKNOWLEDGMENTS |
|---|
F and pSG5-ARG21E constructs. We also thank Dr. Weidong Wang for providing Brg1 antibody. We are grateful to David Stewart for critical reading of the manuscript. | FOOTNOTES |
|---|
First Published Online December 22, 2005
Abbreviations: AF, Activation domain; AR, androgen receptor; ARE, AR response element; C, carboxyl terminal; CAT, chloramphenicol acetyl transferase; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; DBD, DNA binding domain; DSP, dithiobis[succinimidylprooionate]; DTT, dithiothreitol; ER, estrogen receptor; HRE, hormone response element; IP, immunoprecipitation; LBD, ligand binding domain; LTR, long terminal repeat; MMTV, mouse mammary tumor virus; N, amino terminal; N/C interaction, N-terminal and C-terminal interaction; NR, nuclear receptor; NTD, N-terminal domain; PSA, prostate-specific antigen; SRC, steroid receptor coactivator; ssDNA, single-stranded DNA.
Received for publication July 18, 2005. Accepted for publication December 13, 2005.
| REFERENCES |
|---|
|
|
|---|
and ß. EMBO J 22:600611[CrossRef][Medline]NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
J. Yang and M. J Young The mineralocorticoid receptor and its coregulators J. Mol. Endocrinol., August 1, 2009; 43(2): 53 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. Need, H. I. Scher, A. A. Peters, N. L. Moore, A. Cheong, C. J. Ryan, G. A. Wittert, V. R. Marshall, W. D. Tilley, and G. Buchanan A Novel Androgen Receptor Amino Terminal Region Reveals Two Classes of Amino/Carboxyl Interaction-Deficient Variants with Divergent Capacity to Activate Responsive Sites in Chromatin Endocrinology, June 1, 2009; 150(6): 2674 - 2682. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fu, J. Jiang, J. Li, S. Wang, G. Shi, Q. Feng, E. White, J. Qin, and J. Wong Deleted in Breast Cancer 1, a Novel Androgen Receptor (AR) Coactivator That Promotes AR DNA-binding Activity J. Biol. Chem., March 13, 2009; 284(11): 6832 - 6840. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Rosenblatt and K. L. Burnstein Inhibition of Androgen Receptor Transcriptional Activity as a Novel Mechanism of Action of Arsenic Mol. Endocrinol., March 1, 2009; 23(3): 412 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J Kojetin, T. P Burris, E. V Jensen, and S. A Khan Implications of the binding of tamoxifen to the coactivator recognition site of the estrogen receptor Endocr. Relat. Cancer, December 1, 2008; 15(4): 851 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Centenera, J. M. Harris, W. D. Tilley, and L. M. Butler Minireview: The Contribution of Different Androgen Receptor Domains to Receptor Dimerization and Signaling Mol. Endocrinol., November 1, 2008; 22(11): 2373 - 2382. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bai and E. M. Wilson Epidermal Growth Factor-Dependent Phosphorylation and Ubiquitinylation of MAGE-11 Regulates Its Interaction with the Androgen Receptor Mol. Cell. Biol., March 15, 2008; 28(6): 1947 - 1963. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Dehm and D. J. Tindall Androgen Receptor Structural and Functional Elements: Role and Regulation in Prostate Cancer Mol. Endocrinol., December 1, 2007; 21(12): 2855 - 2863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Hodgson, I. Astapova, A. N. Hollenberg, and S. P. Balk Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors Cancer Res., September 1, 2007; 67(17): 8388 - 8395. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Askew, R. T. Gampe Jr., T. B. Stanley, J. L. Faggart, and E. M. Wilson Modulation of Androgen Receptor Activation Function 2 by Testosterone and Dihydrotestosterone J. Biol. Chem., August 31, 2007; 282(35): 25801 - 25816. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haelens, T. Tanner, S. Denayer, L. Callewaert, and F. Claessens The Hinge Region Regulates DNA Binding, Nuclear Translocation, and Transactivation of the Androgen Receptor Cancer Res., May 1, 2007; 67(9): 4514 - 4523. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, H. Kawate, K. Ohnaka, H. Nawata, and R. Takayanagi Nuclear Compartmentalization of N-CoR and Its Interactions with Steroid Receptors. Mol. Cell. Biol., September 1, 2006; 26(17): 6633 - 6655. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |