| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon 97006
Address all correspondence and requests for reprints to: Henryk F. Urbanski, Division of Neuroscience, Oregon National Primate Research Center, 505 Northwest 185th Avenue, Beaverton, Oregon 97006. E-mail: urbanski{at}ohsu.edu.
| ABSTRACT |
|---|
|
|
|---|
were higher at 0100 h than at 1300 h (P < 0.05), and immunohistochemistry revealed a strong expression of this transcription factor specifically in chromaffin cells of the adrenal medulla. Taken together, the data indicate that the primate adrenal gland shows rhythmic expression of genes associated with cell biology and synthesis of steroids and catecholamines. Moreover, they strongly imply the existence of an intrinsic circadian clock. | INTRODUCTION |
|---|
|
|
|---|
At the intracellular level, the molecular clock mechanism appears to be highly conserved, involving coupled transcriptional/translational feedback loops that are driven by both positive and negative genetic components. In mammals, the positive components comprise the transcriptional activators CLOCK and BMAL1, which dimerize and bind to E boxes in the promoter regions of various genes, including the negative components. The negative components include the Period proteins (PER1, PER2, PER3) and Cryptochrome proteins (CRY1, CRY2), which in turn inhibit the synthesis of the Clock/Bmal1 complex, and then generate a circadian rhythm in their own transcription (15, 16, 17, 18).
Gene microarray data from mouse SCN, liver, and heart have shown that circadian transcriptional mechanisms temporally regulate biochemical pathways within each tissue, by driving the circadian expression of specific sets of genes (19, 20, 21, 22). Overall, these studies demonstrate that many genes involved in tissue-specific pathways, as well as general cellular pathways, accumulate in a circadian manner and in many cases appear to be controlled by a circadian clock. A deeper understanding of the circadian expression of genes associated with synthesis of hormones and neurotransmitter receptors, as well as genes involved in cell cycle and tumor suppression, has enormous biomedical potential (23, 24); however, this subject has only recently begun to be explored in primates (25, 26, 27). In view of the strong rhythmic profile of many of the adrenal functions and the circadian expression of Period genes in the adrenal gland of mice (28, 29), our goal was to test the hypothesis that circadian transcriptional mechanisms regulate specific pathways within the primate adrenal gland. We searched for rhythmic patterns of gene expression in the adrenal gland of the rhesus macaque by analyzing the transcriptome across a 24-h period. We found that key genes, including those involved in rate-limiting steps in the synthesis of catecholamines, cleavage of cholesterol, synthesis of DHEAS, and protein synthesis and turnover oscillated with a 24-h rhythm. Moreover, our results strongly imply the existence of an intrinsic molecular clock mechanism within this organ.
| RESULTS |
|---|
|
|
|---|
|
Phase Analysis of Microarray Data
The animals were killed at six time points across a 24-h period, with 4-h intervals: 0700 h (ZT0), 1100 h (ZT4), 1500 h (ZT8), 1900 h (ZT12), 2300 h (ZT16), and 0300 h (ZT20). Total RNA was isolated from the whole left adrenal gland and used to perform hybridizations on Affymetrix human HG_U133A gene microarray platforms and PCR experiments. The Affymetrix MAS 5.0 analysis software was used to analyze scanner image files and thereby generate raw data. After two consecutive filtering iterations, comprising a filter for significant amplitude and a filter for rhythmicity with a period of 24 h, both intended to identify robust oscillatory genes, 322 transcripts were identified. These transcripts were then organized by hierarchical clustering, using cosine correlation for distance measure, which yielded a temporal profile of rhythmic gene expression in the adrenal gland. The oscillation curves showed a variety of phases and amplitudes, with peaks of expression distributed throughout the 24-h cycle (Fig. 2A
; and supplemental Table 1 published on The Endocrine Societys Journals Online web site at http://mend.endojournals.org).
|
Functional Categories and Clusters
A gene annotation tool was used to obtain gene abbreviations and descriptions and to cluster the 322 transcripts into common biochemical pathways. This enabled us to work with a physiological view of the transcriptome and to determine at which stages each of those pathways was temporally regulated. Four main clusters emerged from the analysis, and included genes involved in: 1) catecholamine synthesis and reuptake; 2) cholesterol cleavage and DHEAS synthesis; 3) protein synthesis and turnover; and 4) the circadian clock mechanism.
Transcripts Involved in Catecholamine Synthesis and Reuptake.
Rhythmic expression of genes involved in catecholamine synthesis and reuptake included tyrosine hydroxylase (TH), phenylethanolamine N-methyl transferase (PNMT), and the norepinephrine transporter 2 (Slc6A2) (Fig. 3A
). TH and PNMT expression peaks occurred at approximately 0700 h (ZT0), whereas the expression peak of Slc6A2, detected by two different probe sets, occurred at approximately 1900 h (ZT12). The expression pattern of TH was validated by Taqman quantitative RT-PCR (Taqman qRT-PCR) (Fig. 3A
), whereas the expression patterns of PNMT and Slc6A2 were validated by semiquantitative RT-PCR (sqRT-PCR) (Fig. 3B
). As an internal control for all the clusters, ß-actin was assessed by sqRT-PCR (see Fig. 6B
).
|
|
-hydroxylase (Cyp17A), cytochrome b-5 (Cyb5), and dehydroepiandrosterone sulfotransferase (SULT2A1) (Fig. 4A
|
(Eif3S10), eukaryotic translation initiation factor 3, subunit 6 (Eif3S6), eukaryotic translation initiation factor 3, subunit 5
(Eif3S5), translation factor sui1 homolog (Gc20); 3) subset of proteins involved in folding: DnaJA1, tetratricopeptide repeat domain 2 (Ttc2), heat shock 70-kDa protein 8 (HspA8), heat shock 105 kDa/110 kDa protein B (Hsp105B) (Fig. 5B
-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (Galnt4), the O-linked N-acetylglucosamine (GlcNAc) transferase (Ogt), dolichyl-diphosphooligosaccharide-protein glycosyltransferase (Ddost); 5) subset of proteins involved in endoplasmic reticulum-Golgi transport: Golgi SNAP receptor complex member 2 (GosR2), coatomer protein complex, subunit
(Copa), vacuolar protein sorting 35 (Vps35), coated vesicle membrane protein (Rnp24), sorting nexin 4 (Snx4); 6) subset of proteins involved in ubiquitination: ubiquitin-specific protease 13 (Usp13), ubiquitin-specific protease 33 (Usp33), ubiquitin protein ligase E3A (Ube3A), tetratricopeptide repeat domain 3 (Ttc3) and proteasome components: proteasome 26S subunit 6 (Psmc6), proteasome activator subunit 2 (Psme2). Overall expression of this cluster was up-regulated between 0700 h (ZT0) and 1100 h (ZT4), and expression of the transcripts within each subset peaked with tight coordination with the exception of Usp13 and Galnt4 (Fig. 5A
|
. Expression of the transcriptional repressors Per1 and Per2 peaked at approximately 0700 h (ZT0), whereas Bmal1, a transcriptional activator, peaked at approximately 1900 h (ZT12). The peak of expression of Cry1 occurred at 1100 h (ZT8), 8 h after the peaks of Per1 and Per2 (Fig. 5A
occurred at approximately 0300 h (ZT20) (Fig. 6A
(Fig. 6A
Expression of Core-Clock Genes at 0100 h (ZT18) vs. 1300 h (ZT6)
In a separate experiment, involving a different group of six adult females, we used an alternative approach and measured in triplicate the expression of clock genes in the adrenal gland, at two time points 12 h apart. The animals were maintained in a 12-h light, 12-h dark lighting regimen with lights on at 0700 h (ZT0). Three of the animals were killed at 0100 h (ZT18) and three at 1300 h (ZT6). sqRT-PCR was used to assess the expression of Per1, Cry1, and Bmal1, in the adrenal glands. We found that Per1 mRNA was elevated at 0100 h (ZT18), whereas Bmal1 and Cry1 mRNA levels were elevated at 1300 h (ZT6) (Fig. 7A
). Taqman qRT-PCR analysis of Rev-erb
showed significantly higher levels of expression at 0100 h (ZT18), compared with 1300 h (ZT6) (Fig. 7B
).
|
Oscillation within Chromaffin Cells of the Primate Adrenal Gland
. The nuclear staining for REV-ERB
was highly localized in the adrenal medulla (Fig. 8A
and tyrosine hydroxylase (TH) was observed (Fig. 8B
|
| DISCUSSION |
|---|
|
|
|---|
Our microarray data revealed the existence of oscillatory patterns of gene expression in the monkey adrenal gland. However, there are some caveats. The adrenal gland is composed of two main regions, the cortex and the medulla, which lie in very close apposition. Moreover, chromaffin cells from the medulla frequently invaginate, or migrate, into the cortex, and conversely, small clusters of cortical cells are often found in the medulla (33, 34, 35). Therefore, gross dissection of the gland and region-specific gene expression analysis may result in erroneous conclusions. Consequently, we chose to use the entire adrenal gland for our microarray analysis, even though this may have led to some loss of sensitivity, due to normalization of each probe sets intensity to an average intensity value. Also, it is possible that some genes oscillate in one region, but not in the other, or the same genes may have different phases of expression in different regions of the gland, resulting in a net cancellation of the overall oscillation pattern. As a consequence, it is possible that in our analysis some rhythmically expressed genes fell below the detection threshold for rhythmic expression.
The analysis of phase distribution showed that the number of peaking transcripts began to increase after the lights were turned off and reached a maximum at the time when the light were turned back on in the morning, at 0700 h (ZT0). These results suggest that circadian transcriptional activating components in the rhesus macaque adrenal gland act mainly during the night phase of the 24-h day.
The analysis of gene clusters indicated that general cellular processes (e.g. protein synthesis), as well as pathways related to major organ-specific functions (e.g. catecholamines synthesis, DHEAS synthesis) are temporally coordinated at the transcriptional level. Secretion of one of the most important groups of adrenal hormones, the glucocorticoids, is regulated by humoral and neural inputs with circadian rhythms (36, 37). In the present study, the animals had strong diurnal profiles in plasma cortisol levels, with peaks early in the morning (Fig. 1
). At the transcriptional level, although the mRNAs coding for CYP21A and CYP11B, the cytochromes that convert 17-hydroxyprogesterone into 11-deoxycortisol and 11-deoxycortisol into cortisol, respectively, were detected in our microarrays at each of the six time points, these transcripts failed to reach our statistical criteria for rhythmic expression, suggesting that there is no major regulation of the pathway at this level.
The four genes involved in the synthesis of DHEAS had similar patterns of expression, gradually increasing across the day and peaking with temporal proximity at the beginning of the dark phase (Fig. 9
). This indicates that the pathway is transcriptionally synchronized, and differentially activated early in the night. Because we found the levels of DHEAS to peak around 0800 h (ZT1) (Fig. 1B
), the time window between the transcription of those genes and the secretion of the hormone may account for the translation of those mRNAs into functional cytochromes and enzymes for synthesis of the steroid. Expression of Cyp11A1, Cyp17A, and SULT2A1 is activated by ACTH (38, 39), which is secreted with a circadian pattern by the pituitary (40). ACTH up-regulates the expression of Cyp11A1 and Cyp17A, through cAMP-dependent mechanisms that ultimately lead to the activation of gene-specific transcription factors that bind to the promoters of Cyp11A1and Cyp17A, such as steroidogenic factor 1 and Sp1 (38, 41). Because it has been demonstrated that epinephrine activates the expression of Cyp11A1and Cyp17A (42), circadian secretion of epinephrine by chromaffin cells contacting the zona reticularis (34, 35) may also influence the rhythmic pattern of expression of these cytochromes within the cortex. Lastly, regulation of hepatic cytochrome P450s by D-site albumin promoter binding protein (DBP) and deleted in esophageal cancer 2 (DEC2), regulators of the mammalian circadian clock, has been reported (43); this suggests that Cyp11A1and Cyp17A may be regulated by a circadian clock mechanism, which is consistent with the finding that mice show a circadian expression pattern of Cyp17A and Cyb5 (18, 21).
|
We found that various genes involved in protein synthesis and turnover oscillate with a rhythmic pattern in the monkey adrenal, which is consistent with previous reports of protein concentrations having circadian rhythms in the rat adrenal (47, 48). Indeed, circadian expression of genes involved in protein synthesis and turnover has been consistently reported in previous circadian microarray studies of different organisms, including Drosophila (49), Arabidopsis (50), rat-1 fibroblasts (51), and mice (18, 19, 20, 21). Although additional studies will be necessary to elucidate the functional significance of this phenomenon, the findings suggest that, during the course of evolution, cells may have conserved a specific circadian program that organizes the pathway at different levels: ribosome, translation initiation, protein folding and sorting, glycosylation, and degradation. Moreover, they raise the question of what might happen in cells that lack functional circadian machinery (i.e. clock mutants), in terms of correct synthesis, gene processing and folding of new proteins, and triggering of the stress response when misfolding occurs.
Various approaches have been used to elucidate the circadian mechanisms that control diurnal adrenal function. From studies performed under free-running conditions, it is clear that adrenocortical physiology is driven by a circadian oscillator (30, 31, 32, 49, 53). For example, ablation of the SCN or destruction of its serotonergic afferents led to loss of circadian rhythm of corticosterone secretion in rats, implying a major role for the master clock in the regulation of adrenocortical function (54, 55). Moreover, a recent study showed that light, a major circadian cue, triggers the secretion of corticosterone in rats via the SCN (29). In addition to the classical pathway connecting the SCN with the adrenal through the HPA axis and the secretion of ACTH, it has also been demonstrated that the SCN drives the secretion of corticosterone through a neural pathway that involves the sympathetic innervation of the gland (29, 37). Early in vitro studies provided evidence that the adrenal gland might contain an intrinsic circadian oscillator (56, 57, 58). Because the adrenal is the target of multiple inputs with a circadian rhythm, the existence of a molecular clock mechanism able to organize gene expression across a 24-h day might be a way for the organ to balance its own homeostasis with the temporal demands of the body. Data from the present study demonstrate that a molecular circadian clock mechanism is likely to exist in the adrenal gland of primates. This mechanism comprises the expression of the core clock components Clock, Bmal1, Per1, Per2, Cry1, and Rev-erb
, as well as the circadian clock regulators Dec2 and Nfil3/E4bp4 (supplemental Table 1). The phase distribution of these transcripts was highly consistent with the mammalian clock model (59). Our 24-h transcriptome profiling experiment showed that the expression peak of the transcriptional activator Bmal1 was approximately 12 h out of phase with the repressors Per1 and Per2 (Fig. 6
), whereas expression of Cry1, similarly to what has been described in rodents (12, 21, 50), peaked approximately 8 h after Per1 and Per2. In addition, we found no significant oscillation for Clock (Fig. 6
). These results were corroborated in a second independent experiment, in which clock gene accumulation was compared between 0100 h (ZT18) and 1300 h (ZT6), two time points that were not assessed in the preceding gene microarray experiment. The results clearly confirmed the precise phase relationship for a circadian clock (Fig. 7
). Moreover, it has recently been found that light up-regulates the expression of Per1 in the adrenal gland of Per1-luc transgenic mice. Because a role for PER1 in resetting the molecular circadian clock has been proposed (60), it is plausible that light exerts a resetting effect on adrenal clock gene expression by activating PER1.
In keeping with the diurnal vs. nocturnal nature of monkeys and mice, respectively, a previous mouse adrenal study performed under similar photoperiodic conditions (i.e. 12-h light, 12-h dark conditions; lights on at 0700 h) reported that both Per1 and Per2 showed an expression peak at around 1630 h (ZT9.5), closer to the dark phase (28). Conversely, in the present monkey adrenal study we found that both Per1 and Per2 had an expression peak at the beginning of the light phase. In addition, the temporal profiles of adrenocortical secretory activity in both species are opposite: the peak of corticosterone occurs at the beginning of the dark phase in the case of mice, whereas the peak of cortisol occurs at the beginning of the light phase in the case of monkeys. Together, these results indicate that adrenal activity is temporally out of phase in diurnal mammals compared with nocturnal ones, and also that diurnal transcriptional mechanisms regulating gene expression within this endocrine organ have the same temporal relationship.
We found that the translated product of one of these transcripts, REV-ERB
, was expressed in the nuclei of the chromaffin cells in a circadian fashion, suggesting that this cell type harbors a molecular clock mechanism. Although we did not observe immunoreactivity for REV-ERB
in the adrenal cortex, results from mice adrenals, in which different levels of expression were found for Per1 and Per2 between the cortex and the medulla (28, 29), indicate that a more complete analysis of each clock component is necessary to arrive at definitive conclusions about the existence or absence of clock mechanisms in both regions. However, the in situ results of Bittman et al. (28), showing synchronous oscillation of both Per transcripts in the adrenal cortex and medulla of mice, suggest that if functional circadian oscillators are intrinsic to both regions they are likely to be synchronized under normal light-dark environmental conditions.
The adrenal gland plays multiple roles in human physiology, and, from a clinical perspective, abnormal functioning of specific regions of the gland may contribute to different pathologies, including obesity, diabetes, and cardiac diseases (61, 62, 63). The existence of temporal organization of gene expression, together with a circadian oscillator, within the primate adrenal introduces a new component that may help elucidate the circadian physiology of this organ.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Hormone Assays
Blood samples were collected hourly across 24 h, using a remote swivel/tether-based sampling system (5). The assay for cortisol was performed as previously described (5, 64), utilizing a 2010 Elecsys assay instrument (Roche Diagnostics, Alameda, CA). DHEAS was assayed as previously described (5, 65), using a competitive-binding RIA kit (Diagnostic Products Corp., Los Angeles, CA).
RNA Extraction
Animals were painlessly killed (in accordance with the NIH Guide for the Care and Use of Laboratory Animals) at different times across the 24-h day. During the nighttime necropsies, the animals eyes were covered to prevent illumination of the retina. Various tissues were collected and used in this and other unrelated studies. In all experiments, left adrenal glands were used for RNA extraction, whereas right adrenal glands were used for histology. In experiment 1 (the 24-h profile study) one adrenal gland per time point was collected. In experiment 2 (the 1-h vs. 13-h time point comparison study) three adrenal glands per time point were collected. The adrenals were quickly frozen in liquid N2 and subsequently homogenized using a PowerGen rotor-stator homogenizer (Fisher Scientific, Pittsburgh, PA). Total RNA was extracted using RNeasy columns (QIAGEN, Valencia, CA); the final concentration and purity were determined by spectrophotometry, and the integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technology, Palo Alto, CA).
Gene Microarray
Four factors dictated our use of the Affymetrix human HG_U133A gene microarray platform. First, there was no rhesus macaque gene microarray platform available at the time of this study. Second, the genetic homology between human and rhesus monkeys has been estimated to be between 92.5% and 95% (66). Third, the feasibility of using the Affymetrix human GeneChip in nonhuman primate studies has been previously demonstrated (67, 68). Fourth, application of the first filter in our microarray data analysis rigorously defined the presence of each transcript; we only selected transcripts that showed at least four Present calls of six, and this criterion ensured a reproducibility of at least 67% in the hybridization of each identified transcript.
cDNA synthesis, cRNA synthesis, hybridization, and array scanning were performed at the Affymetrix Microarray Core, Oregon Health and Science University West Campus, following the Affymetrix GeneChip Expression Analysis Technical Manual. The Matchminer software, obtained from the NCI/LMP Genomics and Bioinformatics group, was used to identify and annotate the genes represented on the microarray.
Data Analysis
Raw scanner image files were analyzed using Affymetrix MAS 5.0 absolute expression analysis software. The parameters
1 and
2, which set the point at which a probe set is called present (P), marginal (M), or undetectable (A), were set to 0.1 and 0.15, respectively. Comparisons were performed using global scaling, with the target intensity value set to an average intensity of 325; this allowed for the direct comparison of hybridization values from the different arrays. To extract those genes that have robust oscillatory patterns we used three statistical filters. The first filter was aimed at reducing the effect of interspecies hybridization by ensuring the reproducibility of the hybridization and the presence of that transcript; it included probe sets with at least four Present calls. To identify genes with rhythmic expression, we used an adaptation of a previously described statistical method (21, 52); we empirically tested for statistical significant cross-correlation between six time point courses of each probe set and cosine curves of defined period and phases. We used the cosine curve {ti,
Cos(2
(ti b)/24)} with a phase b (0
b < 24) to prepare 144 test cosine curves of 24-h periodicity, with a phase b from 024 h in increments of 10 min, and calculated the correlation value of the best-fitting cosine curve for each probe set. We selected the probe sets with correlation values above the cut off value of 0.8. To avoid noise and trivial oscillations, we extracted genes oscillating with high amplitude: we calculated the coefficient of variation of the six expression values, defined as its SD divided by the average expression value and selected the probe sets the coefficients of variations of which were above the cutoff value of 0.20. The peak-to-trough ratio was calculated for each probe set, and expressed as fold change (FC), in supplemental Table 1.
Expression data and other pertinent biological information have been deposited in the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) with accession number: GSE2703. (ID: lemosd_rev_1; password: 720865595).
Hierarchical Clustering and Peak Time Analysis
Hierarchical clustering was performed on the 322 rhythmically expressed genes. Using average-linked cluster analysis, distances were measured by the cosine correlation coefficient for similarity measurement. To estimate the peak time of each gene, we estimated the peak time of each cycling gene from the peak time of the most highly correlated cosine wave. The transcripts were then clustered according to their peaking times.
sqRT-PCR
For experiment 1 (the 24-h profile study) and experiment 2 (the 100-h vs. 1300-h time point comparison study), 2 µg of total RNA was used for sqRT-PCR. The cDNA was synthesized using the Omniscript kit (QIAGEN) and oligo d(T)15 primers (Promega Corp., Madison, WI). The reaction was performed following the manufacturers instructions, in a 20-µl volume and at 37 C for 1 h. PCR amplifications were performed using 1 µl of cDNA, 200 µM deoxynucleotide triphosphates (Promega), 0.5 µM of each primer, and 2.5 U of HotStarTaq polymerase (QIAGEN) in 25 µl reaction. The reactions were performed using the following program: 95 C, 15 min; 94 C, 1 min; specific annealing temperature for each primer set, 1 min and 72 C, 1 min. Potential primers sequences were chosen using regions conserved in humans and mice. Those sequences were then Blasted against the monkey sequences available at the Human Genome Sequencing Center at Baylor College of Medicine (http://www.hgsc.bcm.tmc.edu/projects/rmacaque/), to obtain, whenever available, the monkey sequences. The primers were purchased from Invitrogen (Carlsbad, CA). The sequences were: Per1-F (forward), GCCAGCATCACTCGCAGCAGC; Per1-R (reverse), GTGGGTCATCAGGGTGACCAGG; Bmal1-F, CACAGCATGGACAGCATGCTGC; Bma1-R, GCCACCCAGTCCAGCATCTGC; Per2-F, CATCCACTGGTGGACCTCGCG; Per2-R, GGCTCACTGGGCTGCGACGC; Cry1-F, GCCTGTCCTAAGAGGCTTCCCTG; Cry1-R, ACTGAGACCAGTGCCCATGGAGC; PNMT-F, GGAGCATGTACAGCCAACATGCC; PNMT-R, CAGGCATGATATAGGTGCGGAGG; Slc6A2-F, GGAGAGCTACCAACTCTTGCCAG; Slc6A2-R, ACCCAGCTAGTCAGCTGCAGAC; Cyp11A1-F, GCCATCTATGCTCTGGGCCGAG; Cyp11A1-R, CCATCCTCTCTGATCACTGCTGG; Cyp17A1-F, GAGTGGCACCAGCCGGATCAG; Cyp17A1-R, CTCCAGGCCTGGCGCACCTTG; Rnp24-F, CCGTCCTAATGGCAGAGCTCTC; Rnp24-R, AAGCCACCACTCACTGGGACAC; Rpl13a-F, GCAGTCCAGGTGCCACAGGCAG; Rpl13a-R, AGGTGAGGAGCATGGGCGAT GC; ß-actin-F, CATTGCTCCTCCTGAGCGCAAG; ß-actin-R, GGGCCGGACTCGTCATACTCC. The number of PCR cycles was established after testing a range of 2035 to ensure that the amount of DNA product remained in the logarithmic range of the amplification curve. Control reactions using the RNA samples were performed so as to rule out genomic contamination. PCR products (7 µl) were separated on 2% agarose gels, stained with ethidium bromide using electrophoresis, and were photographed under UV light.
Taqman Quantitative RT-PCR
The RNA was diluted to 0.1 µg/µl, and cDNA was prepared by random-primed reverse transcription using random hexamer primers (Promega), 200 ng of RNA, and the Omniscritp kit (QIAGEN). The reverse transcription reaction was diluted 1:100 for PCR analysis. The PCR mixtures contained 5 µl of Taqman Universal PCR Master Mix, 300 nM specific target gene primers, 50 nM human ß-actin primers (Applied Biosystems, Foster City, CA), 250 nM specific probes, and 2 µl cDNA. Reactions were conducted in triplicate for higher accuracy. The amplification was performed as follows: 2 min at 50 C, 10 min at 95 C, and then 40 cycles each at 95 C for 15 sec and 60 C for 60 sec in an ABI/ Prism 7700 Sequences Detector System (Applied Biosystems). After completion of the PCR, baseline and threshold values were set to optimize the amplification plot. Standard curves were drawn on the basis of the log of the input RNA vs. the critical threshold cycle, which is the cycle during which the fluorescence of the sample was greater than the threshold of baseline fluorescence. Standard curves were used to convert the critical threshold values into relative RNA concentrations for each sample. The primers and probes were designed using PrimerExpress software (Applied Biosystems) and were purchased from Invitrogen and Sigma Genosys (St. Louis, MO), respectively. For Rev-erb
, the primers and probe were designed using the rhesus macaque sequence available in the GenBank database (accession no. BV208705); for TH, the human sequence was used (accession no. NM_199292). The sequences were: Rev-erb
-F, ACCCTGAACAACATGCATTCC; Rev-erb
-R, GGAGAGAGAAGTGCAGAGTTCGA, Rev-erb
probe, 5'-6FAM-CTGCCGCTGCCCCCTTGTACA-TAMRA-3'; TH-F, TCATCACCTGGTCACCAAGTTC; TH-R, CGATCTCAGCAATCAGCTTCCT; TH probe, 5'-6FAM-CTCGGACCAGGTGTACCGCCA-TAMRA-3'.
Immunohistochemistry
Right adrenal glands from experiment 1 (the 24-h profile study) were fixed in 4% paraformaldehyde, and 25-µm sections were cut using a frozen-stage sliding microtome; they were immediately transferred to a cryoprotectant solution and stored at 20 C until use. Single-label immunohistochemistry for REV-ERB
was performed as follows: floating tissue sections were removed from the cryoprotectant and washed in 0.02 M potassium PBS (KPBS). Antigen retrieval was performed by heating the tissue in 20 mM sodium citrate buffer, pH 9.0, in a water bath at 90 C, for 30 min. The sections were incubated in blocking buffer (KPBS + 0.5% Triton X-100 + 2% normal donkey serum) for 30 min, to reduce background staining, and then incubated in rabbit polyclonal human REV-ERB
antibody (1:1000; Lifespan Biosciences, Seattle, WA) for 48 h at 4 C. After washing in KPBS, the sections were incubated for 1 h in biotinylated donkey antirabbit antibody (1:500; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), washed, and then incubated in avidin-biotin solution (Vectastain, Vector Laboratories, Burlingame, CA) for 1 h. REV-ERB
-immunoreactivity was visualized using the chromagen 3,3'-diaminobenzidine tetrachloride (DAB) enhanced with nickel chloride. Double-label immunohistochemistry for REV-ERB
and TH was performed using the mouse polyclonal TH antibody. Briefly, after staining for REV-ERB
, the sections were incubated in mouse TH antibody (1:2000; Roche Clinical Laboratories, Indianapolis, IN) 24 h at 4 C. After washes in KPBS, the sections were incubated for 1 h in biotinylated donkey antimouse antibody (1:500; Jackson ImmunoResearch Laboratories) and then washed and incubated in avidin-biotin solution for 1 h. TH immunoreactivity was visualized with DAB without nickel enhancement. Negative controls were performed in which the primary antibodies were omitted. Sections from all of the experiments were mounted onto glass microscope slides and coverslipped.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Author Disclosure Summary: D.R.L., H.F.U., and J.L.D. have nothing to declare.
First Published Online January 26, 2006
Abbreviations: DAB, 3,3'-Diaminobenzidine tetrachloride; DHEAS, dehydroepiandrosterone sulfate; F, forward; KPBS, potassium PBS; qRT-PCR, quantitative RT-PCR; R, reverse; SCN, suprachiasmatic nucleus; sqRT-PCR, semiquantitative RT-PCR; TH, tyrosine hydroxylase; ZT0, zeitgeber time zero.
Received for publication September 6, 2005. Accepted for publication January 19, 2006.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. W. Wilkinson Circadian Clocks: Showtime for the Adrenal Cortex Endocrinology, April 1, 2008; 149(4): 1451 - 1453. [Full Text] |