help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0015
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zella, L. A.
Right arrow Articles by Pike, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zella, L. A.
Right arrow Articles by Pike, J. W.
Molecular Endocrinology 20 (6): 1231-1247
Copyright © 2006 by The Endocrine Society

Enhancers Located within Two Introns of the Vitamin D Receptor Gene Mediate Transcriptional Autoregulation by 1,25-Dihydroxyvitamin D3

Lee A. Zella, Sungtae Kim, Nirupama K. Shevde and J. Wesley Pike

Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin 53706

Address all correspondence and requests for reprints to: J. Wesley Pike, Department of Biochemistry, University of Wisconsin-Madison, 433 Babcock Drive, Madison, Wisconsin 53706. E-mail: pike{at}biochem.wisc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The biological actions of 1,25-(OH)2D3 are mediated by the vitamin D receptor (VDR), a protein that binds to target genes and alters their expression. 1,25-(OH)2D3 is also capable of inducing transcription of the VDR gene itself. In the present study, we explored both the capacity of 1,25-(OH)2D3 to induce VDR gene expression in bone cells and the mechanism instrumental to this up-regulation. After establishing the ability of 1,25-(OH)2D3 to stimulate VDR mRNA up-regulation both in bone in vivo and in osteoblastic cells, we screened the mouse VDR gene locus from 20 kb upstream of the gene’s transcriptional start site (TSS) to 10 kb downstream of the final exon to identify VDR binding sites using chromatin immunoprecipitation-DNA microarray (ChIP-chip) analysis. Three conserved regions were identified 20, 27, and 29 kb downstream of the TSS. VDR binding to these sites in response to 1,25-(OH)2D3 was confirmed by ChIP analysis and was accompanied by differential localization of retinoid X receptor, histone acetylation, and RNA polymerase II recruitment. One of these regions was able to confer 1,25-(OH)2D3 regulation to downstream promoters, thereby permitting identification and characterization of the regulatory element located within. Importantly, a highly conserved region within the human VDR gene analogous to that discovered in the mouse was also capable of mediating 1,25-(OH)2D3 response. Our results demonstrate that 1,25-(OH)2D3 and its receptor autoregulate the expression of the VDR gene. The location of these regulatory regions and their apparent distances from the TSS are consistent with new findings suggesting the emerging relevance of distant enhancers.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE VITAMIN D RECEPTOR (VDR) is a member of a large superfamily of genes whose transcription factor products function to regulate the expression of target genes involved in development, metabolism, homeostasis, and reproduction. Many of these receptors are regulated by small endocrine ligands that include the steroid hormones, vitamin D3, and the thyroid and retinoid hormones (1, 2, 3). The VDR in particular mediates the transcriptional actions of 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], the hormonally active form of vitamin D3. These actions at the level of target genes in the intestine, kidney, and bone function to regulate vertebrate calcium and phosphorus homeostasis and also to ensure proper mineralization and remodeling of the adult skeleton (4, 5). During 1,25-(OH)2D3-mediated transcription, the VDR forms a heterodimer with a retinoid X receptor (RXR) isoform and binds to vitamin D3 response elements (VDREs) located in the promoter regions of target genes. This binding leads to the recruitment of additional coregulatory proteins necessary for chromatin modification and transcriptional activation (3). The successful formation of these multiprotein complexes containing VDR and RXR, histone-modifying enzymes, and regulatory components of the basal transcriptional apparatus are instrumental to changes in 1,25-(OH)2D3-mediated gene transcription (6, 7).

Interestingly, one of the genomic targets for 1,25-(OH)2D3 is the VDR gene itself, a process originally termed homologous up-regulation. This type of regulation has been observed in a variety of cell culture models including mouse 3T6 fibroblasts (8), human HL-60 cells (9), and MG-63 osteosarcoma cells (10) and has also been identified in certain vitamin D3 target tissues in vivo (11, 12, 13, 14). Although considerable evidence exists to support the up-regulation of the VDR gene by 1,25-(OH)2D3, delineation of the mechanism by which this occurs has not been forthcoming. This is largely due to the complexity of VDR genes, but additionally because 1,25-(OH)2D3 also modulates VDR protein levels via a posttranslational mechanism. Indeed, several studies have shown that 1,25-(OH)2D3 can stabilize the VDR protein in cultured cells and increase the protein’s half-life independently of any transcriptional component (15, 16, 17).

In animal tissues in vivo, an additional component of increased VDR gene expression is the tissue-selective character of this regulation. In the kidney, for example, 1,25-(OH)2D3 stimulates a dramatic increase in VDR mRNA levels. This increase, however, is entirely dependent upon levels of dietary calcium that are sufficient to maintain a normal serum calcium concentration (13, 14). In the intestine, up-regulation of the VDR mRNA does not appear to occur. Although Strom et al. showed a 10-fold increase in VDR mRNA in the duodenum of vitamin D-deficient rats after treatment with a single physiologic dose of 1,25-(OH)2D3 (11), a follow-up study failed to demonstrate any change in VDR mRNA levels in the duodenum under similar dietary conditions (15). More recently, a similar study in rats also concluded that, although a decrease in basal VDR mRNA levels was observed in the intestine as a result of vitamin D deficiency, daily vitamin D supplementation was unable to restore these levels to normal (18). Separate from this apparent complexity in the kidney and intestine, however, 1,25-(OH)2D3 is fully capable of up-regulating VDR mRNA in tissues such as the parathyroid gland (12) and skin (18). Interestingly, the in vivo effects of 1,25-(OH)2D3 on VDR mRNA expression in bone, another primary vitamin D target tissue, have not been investigated despite the fact that up-regulation of this gene is most strikingly evident in bone osteoblasts in culture (10, 16). Taken together, these studies support the idea that 1,25-(OH)2D3 up-regulates the expression of the VDR gene in vivo, although this up-regulation is clearly tissue specific and almost certainly influenced by additional, unidentified factors.

As indicated earlier, the mechanism underlying the ability of 1,25-(OH)2D3 to up-regulate VDR mRNA expression remains unclear due both to the complexity of the promoter region(s) within the VDR gene and to a failure to identify functional VDREs. The mouse VDR gene is characterized by a TATA-less GC-rich region upstream of exon 1 that includes four tandem Sp1 sites and two putative CCAAT box elements (19, 20). Studies of the human VDR gene have suggested that at least two and perhaps three differentially used promoters may exist (21, 22, 23), only one of which corresponds to that found in the mouse. The second promoter in the human gene is located downstream of the first and contains both a TATA box as well as multiple Sp1 sites (GC rich) (23). This promoter is not conserved in the mouse gene, although an adjacent exon (exon 2) is present (19). With regard to regulation, the upstream promoter common to both the mouse and human genes is sensitive to protein kinase A stimulators (19, 24), whereas the downstream human promoter is responsive to 17ß-estradiol, glucocorticoids, and retinoic acid (23), all known regulators of VDR gene expression. Perhaps most importantly, however, none of the promoters in either the mouse or the human gene have been demonstrated to contain identifiable VDREs or to respond to 1,25-(OH)2D3.

In the present study, we explored the capacity of 1,25-(OH)2D3 to induce VDR gene expression in bone cells in vivo. We then used several cultured osteoblastic cell models to delineate the mechanism by which 1,25-(OH)2D3 promotes an up-regulation of the VDR gene. Three conserved VDR binding regions were identified within two large introns located substantial distances downstream of the gene’s transcriptional start site (TSS) using high-resolution chromatin immunoprecipitation analysis method combined with DNA microarray analysis (ChIP-chip). This binding was accompanied by differential localization of RXR, histone acetylation and RNA polymerase II (RNA pol II) recruitment. One of these regions was able to confer 1,25-(OH)2D3 regulation to a minimal VDR gene promoter, thus allowing us to identify and characterize the regulatory element located within. Finally, a region located within the human VDR gene with high sequence homology to that in the mouse also exhibited transcriptional activity when transfected into cultured bone cells. Our results identify a direct autoregulatory mechanism whereby 1,25-(OH)2D3 is able to induce the synthesis of VDR mRNA.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Organization of the Mouse and Human VDR Genes
The relative organization of the human and mouse VDR genes, located on chromosomes 12 and 15, respectively, is illustrated in Fig. 1Go. Both the human and mouse genes have eight coding exons, with unequivocal start codons located in exon 2 of the human gene and exon 3 of the mouse gene. Proteins of 423 amino acid in the mouse and 427 amino acids in the human are produced (25). Despite this similarity, the number of noncoding exons located 5' of the bone fide translational start sites differ significantly between the two species. Thus, whereas two noncoding exons are found in the mouse gene (exons 1 and 2), at least six are found in the human gene (exons 1a-1f). An additional difference is the presence in the human gene of at least two promoters, as documented in Fig. 1Go.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Organization of the Mouse and Human VDR Genes

A, Location (March 2005 assembly) and size of the VDR gene in both the mouse and human genome. B, Linear depiction of the structure of the mouse and human VDR (hVDR) gene where the arrows indicate exons containing either an initiation or a termination codon. Functional promoters are present upstream of exon 1 in the mouse and exons 1c and 1a in the human. Dotted lines encompass exons 3–10 in the mouse gene and exons 2–9 in the human gene that encode the mouse or human VDR protein (shown). DBD, DNA binding domain; LBD, ligand binding domain.

 
1,25-(OH)2D3 Induces VDR mRNA Induction in Bone in Vivo and in Osteoblast-Like Cells in Vitro
VDR up-regulation is most strikingly observed in cultured osteoblastic cell lines. We therefore began our studies by first assessing whether 1,25-(OH)2D3 could induce VDR mRNA in mouse bone in vivo. Groups of wild-type C57BL6 mice were treated with increasing concentrations of a single dose of 1,25-(OH)2D3. Calvarial tissue was then isolated from each mouse 6 h later, and the isolated RNA was subjected to qRT-PCR using primers capable of amplifying VDR and Cyp24a1 as well ß-actin mRNA. The results in Fig. 2Go, A and C, document the dose response curves generated for both VDR and Cyp24a1. As can be seen, VDR mRNA levels were dose-dependently stimulated in response to 1,25-(OH)2D3, increasing approximately 4-fold above base line at the 10 ng/g body weight (bw) dose. As expected, Cyp24a1 levels were also dramatically increased. Interestingly, as seen in Fig. 2Go, B and D, the EC50 values for VDR and Cyp24a1 induction differed (VDR, 0.174 ng/g bw; Cyp24a1, 3.3 ng/g bw). Although the physiological relevance of this difference remains unclear at present, the data strongly support the idea that 1,25-(OH)2D3 can indeed up-regulate VDR mRNA levels in bone in a fashion similar to that observed in cultured osteoblasts.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Regulation of VDR mRNA by 1,25-(OH)2D3 in Vivo in Bone

A, VDR mRNA expression levels in calvarial tissue of 1,25-(OH)2D3-treated mice. Calvarial tissue was isolated 6 h after a single injection of 1,25-(OH)2D3 (0–100 ng/g bw) and total RNA subjected to qRT-PCR using primers identified in Materials and Methods. VDR mRNA levels were normalized to ß-actin expression. Each point represents the mean ± SEM (n = 5). B, Nonlinear regression analysis of VDR mRNA expression presented in panel A. C, Cyp24a1 mRNA expression levels in calvarial tissue of mice as described in panel A. qRT-PCR was performed using primers specific to mouse Cyp24a1. Cyp24a1 mRNA levels were normalized to ß-actin expression. D, Nonlinear regression analysis of Cyp24a1 mRNA expression presented in panel C. Statistical analyses in panels A and C were carried out using one way ANOVA with Dunnett’s posttest (*, P < 0.01 in comparison to vehicle).

 
1,25-(OH)2D3 also up-regulated VDR mRNA in a dose-dependent fashion in both cultured osteoblast-like MC3T3-E1 cells (Fig. 3AGo) and in ST2 cells (data not shown, but see also Fig. 3BGo). These results establish two comparable bone cell models for subsequent delineation of the mechanism by which 1,25-(OH)2D3 promotes VDR mRNA up-regulation.


Figure 3
View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3. Autoregulation of VDR mRNA by 1,25-(OH)2D3 and Its Receptor in Vitro

A, Induction of VDR expression levels by 1,25-(OH)2D3 in vitro. MC3T3-E1 cells were treated for 6 h with either vehicle (NT, no treatment) or 1,25-(OH)2D3 (10–10 to 10–7 M). Total RNA was isolated and subjected to RT-PCR analysis using primers specific to mouse Cyp24a1 (30 cycles), VDR (25 cycles), or ß-actin (25 cycles). These results are typical of several similar experiments. B, Effects of VDR siRNA on 1,25-(OH)2D3-induced VDR mRNA expression levels in ST2 cells. ST2 cells were transfected with 20 nM nontargeting siRNA, cyclophilin B siRNA, or mVDR siRNA. After 48 h, the cells were treated for an additional 6 h with either vehicle or 1,25-(OH)2D3 (10–7 M). Total RNA was isolated and subjected to standard RT-PCR analysis using primers identified in Materials and Methods. The cycle number for amplification of each individual transcript is as follows: VDR (20 cycles), Cyp24a1 (25 cycles), OPN (15 cycles), and ß-actin (15 cycles). These results are typical of several independent experiments.

 
Induction of VDR Gene Expression Is Dependent upon the VDR
We initiated mechanistic studies by first establishing that the increase in VDR mRNA levels detected in response to 1,25-(OH)2D3 was mediated by the VDR itself using small interfering RNA (siRNA). ST2 cells were exposed for 48 h to either control siRNAs (nontargeted and cyclophilin B siRNAs) or to a siRNA pool directed toward the mouse VDR and then treated for an additional 6 h with either vehicle or 1,25-(OH)2D3. Cells were also mock transfected in the absence of siRNA and then treated without or with 1,25-(OH)2D3 as an additional control. Total RNA was isolated, reverse transcribed, and subjected to PCR analysis using primers to mouse (m) VDR (mVDR), mCyp24a1, mOPN [mouse osteopontin (OPN)], and mß-actin transcripts. As seen in Fig. 3BGo, both Cyp24a1 and OPN as well as the VDR were significantly up-regulated by 1,25-(OH)2D3 in the mock-transfected cells as well as in cells treated with either the nontargeted or cyclophilin B siRNA pool. The 1,25-(OH)2D3 mediated up-regulation of these three genes in the cells pretreated with the VDR siRNA pool, however, was substantially reduced. Although VDR protein levels are also down-regulated in the presence of the VDR siRNA (data not shown), the reduced capacity of Cyp24a1 and OPN to respond to 1,25-(OH)2D3 confirms this functional reduction as well. Although unlikely, it is possible that residual VDR siRNA existing beyond 48 h might also be responsible for degrading the VDR mRNA rapidly up-regulated over the 6-h period by 1,25-(OH)2D3. With this caveat, however, these results suggest that the increase in VDR mRNA expression seen after 1,25-(OH)2D3 treatment is mediated by the VDR through a classic autoregulatory mechanism.

ChIP-chip Analysis of the VDR Locus Identifies VDR Binding Sites
As discussed earlier, previous attempts to define a vitamin D regulatory region in either the mouse or human VDR genes have been uniformly unsuccessful. Based upon this failure, we elected to use ChIP-chip analysis (26) to scan the entire mouse VDR gene locus as documented in Fig. 4AGo (the VDR gene is transcribed on the reverse strand). ST2 cells were treated in the absence or presence of 1,25-(OH)2D3 for 6 h and then subjected to a standard ChIP using antibodies to VDR, RXR, or a nonspecific IgG. The precipitated DNA was isolated, amplified, and the individual samples were then labeled with either Cy3 or Cy5 (see Materials and Methods). Samples to be compared were cohybridized to a high-density oligonucleotide DNA microarray that contained the tiled region from 20 kb upstream of the TSS to 10 kb downstream of the final exon at a resolution of 50 bp. A comparison of hybridization signals generated from precipitations using 1) IgG in the presence and absence of hormone, 2) VDR in the absence or presence of hormone, 3) VDR in the presence of hormone vs. input DNA and 4) RXR in the presence of hormone vs. input DNA is seen in Fig. 4BGo and an expansion of the peak data is seen in Fig. 4CGo. As highlighted in this figure, although no activity was observed outside the gene, three regions of increased VDR and RXR binding designated S1, S2, and S3 were evident within two of the VDR gene’s introns. A fourth peak of activity located proximal to the TSS was also observed, but this peak was not reproducible under each of the conditions tested. Peak finding analysis of these data indicated that binding of the VDR and RXR to the S1 region was considerably more robust than that observed at either S2 or S3. Interestingly, signals comparing RXR in the absence and presence of 1,25-(OH)2D3 (data not shown) were routinely weak, suggesting the possibility that a residual level of RXR might be bound to one or more of the three regions in both the absence and presence of the hormone. Regardless, these screening data suggest the location of at least three potential intronic VDR/RXR binding sites.


Figure 4
View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4. ChIP-chip Analysis of VDR Locus Identifies VDR-Binding Regions

A, Schematic diagram of the mouse VDR gene and its 10 exons. The nucleotide base pairs indicate nucleotide location on chromosome 15 (May 2004 Assembly). The reverse arrow indicates the direction of transcription on the reverse strand. B, Individual data tracks representing the enrichment ratios of Cy5 to Cy3 hybridization intensity [log (2 )] for IgG plus or minus hormone, VDR plus or minus hormone, VDR plus hormone vs. input DNA, and RXR plus hormone vs. input DNA. The nucleotide base pairs on the x-axis indicate chromosome 15 position. C, An expanded view of the S1, S2, and S3 regions for each of the four comparisons. The highlighted areas indicate the peaks of interest.

 
ChIP Analysis Confirms VDR Binding in Regions S1, S2, and S3
To confirm VDR binding to the above identified regions, we designed five sets of oligonucleotide primers capable of amplifying S1, S2, and S3, the TSS and an intervening control region I as seen in Fig. 5AGo and then conducted a direct ChIP analysis. The results seen in Fig. 5BGo confirm the data obtained in the ChIP-chip analysis; strong VDR binding to the S1 region, and weaker but detectable binding at both the S2 and S3 regions as well. VDR binding was not detected at either the TSS (the location of the nonreproducible peak observed in the ChIP-chip analysis) or at the intervening control region designated I. Of significance, ChIP-assessed binding of the VDR to these three sites as well as to the control Cyp24a1 promoter was dramatically reduced when VDR siRNA (but not a nontargeted siRNA pool) was transfected into the cells before treatment with 1,25-(OH)2D3 (Fig. 5CGo). These data confirm that VDR binds to the S1, S2, and S3 regions of the VDR gene in osteoblast-like cells and further supports a potential autoregulatory mode of VDR mRNA up-regulation.


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. ChIP Analysis Confirms VDR Binding to the Mouse VDR S1, S2, and S3 Regions

A, A schematic diagram of the mouse VDR gene extending from exon 1–4. The vertical bars represent the exons that are separated by three introns whose sizes are indicated. The location of the S1-S3 regions as well as the TSS and I regions are boxed. Horizontal pairs of arrows indicate the general location and nucleotide position (relative to the TSS) of the primer pairs used in the ChIP analysis. B, ChIP analysis of 1,25-(OH)2D3-induced VDR binding to the mouse VDR gene. MC3T3-E1 cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 3 h and then subjected to ChIP analysis using antibodies to either the VDR or nonspecific IgG. The DNA precipitates were recovered and subjected to 30 cycles of PCR using the primers depicted in panel A. The amplification of input DNA (0.2% of sample) is also included. VDR binding to the Cyp24a1 gene promoter was used as a positive control. C, VDR siRNA reduces VDR binding to the mouse VDR gene. MC3T3-E1 cells were transfected with 50 nM nontargeting siRNA or VDR siRNA as described in Materials and Methods. After 72 h, cells were treated for an additional 6 h with either vehicle or 1,25-(OH)2D3 (10–7 M) and then subjected to ChIP analysis as described in panel B.

 
Conservation of S1, S2, and S3 Regions and Identification of Potential VDREs
A 10-way vertebrate alignment and conservation analysis was carried out on the S1, S2, and S3 regions using the UCSC genome browser on the mouse March 2005 assembly. As seen in Fig. 6AGo, the entire S1 region in the VDR gene is broadly conserved across multiple species, including rat and human. Although S2 and S3 are also conserved across species, this conservation is limited to more localized segments. In addition, Fig. 6BGo outlines the results of an in silico analysis that reveals at least four potential VDREs in these regions of the mouse gene, two in S1 and one each in S2 and S3. These elements showed moderate to strong sequence conservation across the human, rat, and mouse genes. Given the structure and degeneracy of response elements for nuclear receptors, however, it is entirely possible that putative sites in addition to those documented here may also exist.


Figure 6
View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6. Sequence Homology and Location of Putative VDREs in Mouse S1, S2, and S3 Regions

A, Sequence alignment and conservation analysis of mouse VDR S1, S2, and S3 regions. The UCSC genome browser was used to generate a 10-way vertebrate alignment (600–700 bp) of the mouse S1, S2, and S3 regions (March 2005 assembly). The first track corresponds to the conservation of the VDR regions across multiple species, whereas the second and third tracks depict conservation between the mouse and rat or mouse and human genes, respectively. Signal intensity corresponds to the degree of conservation. B, Identification of putative VDREs by in silico analysis of mouse VDR gene S1, S2, and S3 regions. Putative VDREs were identified using the web-based program ConSite (http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite). Asterisk indicates full conservation.

 
The S1 Region of the Mouse VDR Gene Exhibits 1,25-(OH)2D3-Dependent Transcriptional Activity in a Heterologous Promoter
To assess the transcriptional activity of each of the three VDR binding regions, we cloned S1, S2, and S3, whose coordinates are identified in Fig. 7AGo, into a thymidine kinase (TK) promoter-based vector, transfected these constructs into MC3T3-E1 cells, and evaluated their ability to enhance transcription in the presence of 1,25-(OH)2D3. As can be seen in Fig. 7Go, B and C, the S1 region was fully capable of mediating a dose-dependent response to 1,25-(OH)2D3, which was enhanced when increased amounts of VDR expression vector were simultaneously cotransfected. Interestingly, neither the S2 or S3 regions nor subfragments of these regions displayed any sensitivity to 1,25-(OH)2D3, regardless of whether VDR was cotransfected or not (Fig. 7BGo and data not shown). Taken together with the ChIP analyses, these data suggest that, although binding sites for the VDR exist in all three regions in the context of native chromatin, the transcriptional capability of these sites as assessed within artificial reporter plasmids may be influenced by additional, undefined factors.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. The Mouse VDR S1 Region Mediates Transcriptional Response to Both 1,25-(OH)2D3 and VDR

A, Location and size of the mouse VDR S1, S2, and S3 regions whose activities were investigated in the context of the TK promoter. Numbers represent the 5' and 3' ends of the regions relative to the VDR gene TSS. B, Transcriptional activity of the mouse VDR gene S1, S2, and S3 regions in the presence of 1,25-(OH)2D3. ST2 cells were cotransfected with pCH110-ßgal (50 ng), pcDNA-hVDR (50 ng), and either ptk-mVDR S1-luc, ptk-mVDR S2-luc, ptk-mVDR S3-luc, or ptk-luc control vector (250 ng), treated for 24 h with either vehicle or increasing concentrations of 1,25-(OH)2D3 (10–10 M to 10–7 M) and then evaluated for both luciferase and ß-gal activity as described in Materials and Methods. Each point represents the normalized RLU (relative light unit) average ± SEM for a triplicate set of transfections. Statistical analyses were carried out using one way ANOVA with Dunnett’s posttest (*, P < 0.01 in comparison to vehicle). C, Transcriptional activity of mouse VDR gene S1 region as a function of VDR levels. MC3T3-E1 cells were cotransfected with pCH110-ßgal, increasing amounts of pcDNA-hVDR, and either ptk-mVDR S1-luc or ptk-luc control vector. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity as described in Materials and Methods. Each point represents fold induction over vehicle (calculated from the normalized RLU average ± SEM of a triplicate set of transfections).

 
The S1 Region Confers a VDR-Dependent, 1,25-(OH)2D3-Inducible Response to a Mouse VDR Minimal Promoter
In view of the above findings, we next assessed whether S1 was capable of mediating hormonal responsiveness in the context of its own homologous promoter. As illustrated in Fig. 8AGo, two VDR promoter constructs were prepared, the first with coordinates –100/+50 and the second with coordinates –1400 /+50. A third construct was then prepared that contained the S1 fragment cloned directly upstream of the VDR minimal promoter (–100 /+50). As can be seen in Fig. 8BGo, although neither of the VDR gene promoter fragments alone were sensitive to treatment with 1,25-(OH)2D3 in MC3T3-E1 cells, the S1 region itself was capable of conferring a dose-dependent sensitivity to 1,25-(OH)2D3. To confirm VDR dependency, we cotransfected control siRNAs or VDR siRNA together with the VDR minimal promoter containing the S1 region and evaluated subsequent response to 1,25-(OH)2D3. As seen in Fig. 8CGo, the presence of VDR siRNA but not that of control siRNA completely abrogated the ability of the S1 region to mediate response to 1,25-(OH)2D3. These observations indicate that the S1 region is indeed capable of conferring VDR-dependent, 1,25-(OH)2D3 sensitivity on its own promoter as well as on a promoter of viral origin.


Figure 8
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. The Mouse VDR S1 Region Confers a VDR-Dependent 1,25-(OH)2D3-Inducible Response to a Mouse VDR Minimal Promoter

A, Schematic diagram of pGL3 –100/+50 mVDR-luc, pGL3 –1400/+50 mVDR-luc, and pGL3 –100/+50 mVDR S1-luc reporter constructs. B, Transcriptional activity of the mouse VDR S1 region in the context of pGL3 –100/+50 mVDR. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either pGL3 –100/+50 mVDR-luc, pGL3 –1400/+50 mVDR-luc, pGL3 –100/+50 mVDR S1-luc, or pGL3-luc control vector as described in Materials and Methods. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized relative light unit (RLU) average ± SEM for a triplicate set of transfections. C, Transcriptional activity of S1 region cotransfected with VDR siRNA. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pGL3 –100/+50 mVDR-luc or pGL3 –100/+50 mVDR S1-luc reporter vector, and 50 nM of the indicated siRNA pool as described in Materials and Methods. Cells were treated and processed as in panel B. Each point represents fold induction over vehicle (calculated from the normalized RLU average ± SEM of a triplicate set of transfections).

 
The S1 Region Contains a VDRE Capable of Binding the VDR/RXR Heterodimer and Independently Activating Transcription
The transcriptional activity inherent to the S1 region allowed us to map the VDREs located within. Because two potential elements were identified through in silico analysis (Fig. 6BGo), we carried out site-directed mutagenesis to alter the sequence of each of the half-sites in the two potential VDREs in the context of S1 (see Fig. 9AGo). Then we examined the effects of these mutations in response to 1,25-(OH)2D3 in MC3T3-E1 cells. As can be seen in Fig. 9BGo, although mutations in each of the two half-sites of putative VDRE2 had no effect on the transcriptional activity of S1, a similar mutagenesis of the half-sites located in VDRE1 fully compromised hormonal response. This functional activity was also supported by the results documented in Fig. 9CGo, wherein we show that purified VDR and RXR were fully capable of binding directly to VDRE1 via bandshift analysis. Perhaps as important, the VDRE1 DNA sequence itself retained 1,25-(OH)2D3 responsiveness when cloned into the mouse VDR promoter (–100/+50) as either a single or multiple copy enhancer (Fig. 10Go). The modest activity of a single copy of VDRE1 compared with that observed in the context of S1 itself provides further evidence for the contribution of additional factors capable of associating with and enhancing the activity of the VDRE. The ability of the VDR to bind to VDRE1 and to confer transcriptional response combined with the loss of hormone responsiveness when mutagenized in the context of the S1 DNA fragment all provide compelling evidence that VDRE1 mediates the activity of 1,25-(OH)2D3 in this region.


Figure 9
View larger version (66K):
[in this window]
[in a new window]
 
Fig. 9. The Mouse VDR S1 Region Contains a Functional VDRE

A, Diagram showing the sequence of the wild-type and two mutant versions of VDRE 1 or VDRE 2 prepared in the context of ptk-mVDR-S1-luc. Site-directed mutagenesis of each of the half-sites located in VDRE 1 or VDRE 2 was performed as described in the Materials and Methods. B, Transcriptional activity of wild-type and mutant ptk-mVDR S1-luc reporter vectors. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either wild-type ptk-mVDR S1-luc vectors, mutant ptk-mVDR S1-luc vectors, or the ptk-luc control vector. Cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized RLU average ± SEM for a triplicate set of transfections. C, Bandshift analysis of VDR/RXR heterodimer binding to the specific DNA sequence derived from VDRE 1 of the mouse VDR S1 region. Labeled duplex DNA probes from the mouse osteopontin VDRE (mOPN DR3) or the sequence corresponding to S1 VDRE 1 were incubated with purified VDR and RXR{alpha} in 50 mM KCl (–) or in 150 mM KCl (+) with or without 1,25-(OH)2D3 (see left panel). Unlabeled probe (1-, 10-, or 100-fold excess) was added to the incubations in a competition bandshift assay (see right panel). Complexes were resolved on 6% nondenaturing polyacrylamide gels, dried and visualized using autoradiography.

 

Figure 10
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10. The Mouse VDR S1 VDRE 1 Activates Transcription Independently in the Context of the Mouse Minimal VDR Promoter

A, Diagram of pGL3 –100/+50 mVDR VDRE x1-luc and pGL3 –100/+50 mVDR VDRE x3-luc reporter constructs. B, mVDR S1 VDRE 1 mediates transcriptional response to 1,25-(OH)2D3 in either a single or multiple copy orientation. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either pGL3 –100/+50 mVDR-luc, pGL3 –100/+50 mVDR S1-luc, pGL3 –100/+50 mVDR VDRE x1-luc, pGL3 –100/+50 mVDR VDRE x3-luc, or pGL3-luc control vector as described in Materials and Methods. Cells were treated with vehicle or 1,25-(OH)2D3 (10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized relative light unit (RLU) average ± SEM of a triplicate set of transfections. Statistical analyses were carried out using unpaired t tests (*, P < 0.05 in comparison to vehicle).

 
VDR Binding to the S1 and S3 Regions Results in Broad Histone Acetylation and RNA Pol II Recruitment
Despite the lack of functional 1,25-(OH)2D3 sensitivity observed with S2 and S3, all three regions in the mouse VDR gene appear to contain interactive sites for the VDR based upon ChIP-chip and ChIP analyses. We therefore asked in a final set of ChIP analyses whether the binding of VDR to these sites was accompanied uniformly by RXR localization and was associated with coactivator recruitment and functional changes in histone modification. Because recent studies also suggest that RNA pol II can be recruited into distant regulatory sites (27, 28), we assayed similarly for the presence of this protein as well. Accordingly, MC3T3-E1 cells were treated with either vehicle or 1,25-(OH)2D3 for 3 h and then subjected to ChIP analysis using antibodies specific to VDR, pan-RXR, SRC-1, cAMP response element binding protein-binding protein (CBP), tetra-acetylated histone 4, and RNA pol II. As seen in Fig. 11AGo, both RXR as well as VDR were found bound to the S1 and S3 regions of the VDR gene in response to 1,25-(OH)2D3; binding at S2, however, was extremely low. As seen in Fig. 11BGo, the time course of binding was rapid and comparable at both S1 and S3. The presence of RXR at S3 in the absence of ligand and its limited induction in the presence of 1,25-(OH)2D3 suggests that RXR might be capable of binding to some regulatory sites in the absence of the VDR and perhaps can serve as a regulatory marker (7). Both SRC-1 and CBP appeared to be present at the S1 and S3 regions as well as at the intervening control region I and in some cases CBP appeared to be enhanced by 1,25-(OH)2D3, although none of this binding activity is particularly robust. An investigation of SRC-1 binding on the VDR gene, as seen in Fig. 11BGo, confirmed the generally weak appearance of this coactivator even at early time points and a lack of induction by 1,25-(OH)2D3. This finding suggests that neither of these histone acetyltransferases play dominant roles in VDR gene expression. Despite this, histone 4 acetylation was extensive across a broad region of the gene from the TSS downstream (Fig. 11AGo). The level of this acetylation was modestly enhanced at S1 and S3 and significantly enhanced at S2 but remained constitutive at the I and the TSS regions. An early time course of acetylation in these regions confirmed this result and did not reveal noticeable differences in the temporal process of acetylation (Fig. 11BGo). The existing levels of acetylation across the VDR gene likely reflect the fact that basal levels of VDR gene expression are significant in the absence of 1,25-(OH)2D3. Perhaps most interesting is the observation made in Fig. 11AGo that the association of RNA pol II, although not substantially increased by hormone treatment at the TSS, is strikingly and reproducibly recruited to both S1 and S3. Taken together, these results suggest that transcriptionally active complexes can be recruited to the S1 and S3 regions, and that these regions may represent potential recruitment centers for increasing the level of RNA pol II necessary for enhanced transcription (27).


Figure 11
View larger version (72K):
[in this window]
[in a new window]
 
Fig. 11. VDR/RXR Heterodimer Binding to the S1 and S3 Regions Results in CBP Coactivator Recruitment, Time-Dependent Histone 4 Acetylation and RNA pol II Enhancement

A, ChIP analysis of VDR and RXR binding, coactivator levels, histone acetylation, and RNA pol II levels in the VDR gene in the absence or presence of 1,25-(OH)2D3. MC3T3-E1 cells were treated with either vehicle or 1,25-(OH)2D3 (10–7 M) for 3 h and then subjected to ChIP analysis using antibodies specific to VDR, RXR, SRC-1, CBP, tetra-acetylated histone 4, RNA pol II, or an irrelevant IgG antibody. DNA precipitates were isolated and then subjected to PCR (30 cycles) using the primers depicted in Fig. 5AGo. Activity at the mouse Cyp24a1 promoter was included for comparison. B, ChIP analysis of time-dependent VDR binding, SRC-1 recruitment, and histone acetylation in the VDR gene after 1,25-(OH)2D3 treatment. MC3T3-E1 cells were treated with 1,25-(OH)2D3 (10–7 M) for 0, 15, 30, or 60 min and then subjected to ChIP as in panel A using antibodies to VDR, SRC-1, tetra-acetylated histone 4, and IgG. PCR analysis was carried out as described in panel A.

 
A Region Located in the Human Gene with High Sequence Homology to Mouse S1 Regulates Transcription in Response to 1,25-(OH)2D3
In a final experiment, we cloned the region located in the human VDR gene that displayed high sequence homology to the mouse S1 (Fig. 12Go, A and B) and examined its capacity to regulate transcription in the presence of 1,25-(OH)2D3. As can be seen in Fig. 12CGo, the human VDR equivalent S1 region does indeed mediate a level of sensitivity to 1,25-(OH)2D3 that is equal to or perhaps better that that seen with the comparable mouse S1 region. This result provides considerable support for the identification of a relevant regulatory region in both the mouse and human genes that mediates the actions of 1,25-(OH)2D3.


Figure 12
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 12. The Human S1 Region Activates Transcription of a ptk-hVDR S1-luc Reporter in the Presence of 1,25-(OH)2D3

A, Diagram of the cloned human S1 region located in the intronic sequence between exons 2 and 3 of the human VDR gene. B, Size and nucleotide location of the human VDR S1 region. Numbers represent the 5' and 3' ends of the region relative to the human VDR gene TSS. C, Transcriptional activity of the mouse and human S1 regions in the context of the tk promoter. MC3T3-E1 cells were cotransfected with pCH110-ßgal, pcDNA-hVDR, and either ptk-mVDR S1-luc, ptk-hVDR S1-luc, or ptk-luc control vector as described in Materials and Methods. Cells were treated with either vehicle or increasing concentrations of 1,25-(OH)2D3 (10–9–10–7 M) for 24 h and then evaluated for both luciferase and ß-gal activity. Each point represents the normalized relative light unit (RLU) average ± SEM of a triplicate set of transfections. Statistical analyses were carried out using one way ANOVA with Dunnett’s posttest (*, P < 0.05; **, P < 0.01 in comparison to vehicle).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A mechanistic target of 1,25-(OH)2D3 action both in vivo and in vitro is the VDR gene itself (8). Indeed, we show that 1,25-(OH)2D3 promotes an up-regulation of VDR expression both in mouse bone in vivo as well as in two cultured mouse osteoblast cell lines in vitro. We therefore used these bone cell models to explore the molecular mechanism by which 1,25-(OH)2D3 promotes up-regulation of its own receptor’s gene. An siRNA knock-down approach first established an autoregulatory role for the VDR in this regulation. ChIP-chip analysis was then used to screen the entire mouse VDR gene locus as well as extended flanking sequence for potential VDR and RXR binding sites. Three regions within introns of the mouse VDR gene were identified by this method, and although they each displayed different levels of VDR binding, all were confirmed through a direct analysis using traditional ChIP. The role of the VDR in this autoregulation was verified using VDR siRNA coupled to ChIP. Interestingly, only one of the three regions was capable of transcriptional activation by 1,25-(OH)2D3 when cloned upstream of a TK promoter. In addition, this region was also active when placed upstream of a minimal promoter derived from the mouse VDR gene itself. Mapping studies of this region by traditional molecular approaches revealed the identity of the VDRE located within. This element was comprised of two hexanucleotide half-sites separated by 3 bp, thus manifesting a typical VDRE structure (29). Importantly, the homologous region located in the human VDR gene also contained this VDRE sequence and was likewise capable of mediating induction by 1,25-(OH)2D3. Additional studies using ChIP analysis revealed that VDR localization, primarily in the S1 and S3 regions, was associated with RXR accumulation, potential CBP coactivator recruitment and increased histone 4 acetylation. Perhaps most interesting was the observation that VDR binding to this region was associated with the recruitment of RNA pol II. These results suggest that we have identified several enhancer regions within the VDR gene that are responsible for transcriptional autoregulation by 1,25-(OH)2D3 and its receptor and that in at least one region we have identified the VDRE itself. The binding properties of these regions within the VDR gene using ChIP analysis suggest that they may function as recruitment centers for factors such as RNA pol II that are necessary for direct transcriptional activity at the basal promoter (27).

We coupled ChIP-chip analysis, ChIP, and traditional cloning techniques to identify regions in the VDR gene with potential enhancer properties. These techniques resulted in the identification of three regions and at least one regulatory element that were located not only within introns in the VDR gene itself but also at significant distances from the gene’s TSS. It seems likely that these regions would not have been identified without the use of the ChIP-chip approach because more traditional work has focused upon regions relatively proximal to a gene’s active promoter. The ChIP-chip DNA tiling approach to identifying regulatory regions of multiple genes within the genome appears likely to revolutionize the way in which we search for regulatory regions of protein coding genes. Indeed, this approach is currently being used to identify not only regulatory regions on specific genes or small subsets of genes, as outlined here (26, 30, 31, 32) but also to explore the existence of binding sites for specific transcription factors at high resolution across the entire genome (33, 34, 35). Perhaps more spectacularly, genome-wide ChIP-chip analysis, now more generally termed genome-wide location analysis, is being used to establish physiologically relevant, transcription factor-based gene regulatory networks in yeast and other organisms (36, 37). Emerging evidence suggests that the existence of regulatory enhancers located at large apparent distances from gene promoters may be more common than once believed and is highlighting the potential role of chromatin looping and chromatin reorganization in transcriptional regulation (38, 39, 40, 41, 42).

While identifying regulatory regions at some distance from the TSS, our approach has also raised several issues. Accordingly, although ChIP assays have revealed the localization of VDR and its partner RXR at specific sites within the gene locus and have shown that this binding in response to 1,25-(OH)2D3 results in local chromatin modification, at least two of these regions were unable to confer 1,25-(OH)2D3 response either to their own promoter or to a heterologous promoter. Although it is always possible that the receptor binding observed in the ChIP assays at S2 and S3 reflects inappropriate cross-linking, we interpret our findings to suggest that the context in which the regulatory regions are placed within an artificial plasmid strongly influences regulatory capability. This lack of context could be related to orientation relative to the downstream promoter, the presence or absence of additional transactivators or repressors capable of binding to these enhancer regions, or to an inappropriate chromatin configuration due to plasmid peculiarities. It seems reasonable to conclude that the chromatinization of a transiently transfected plasmid, to the extent that it occurs, is unlikely to be identical with that seen in the native chromosomal state. In addition, it is also possible that regulatory regions might contribute in unique ways not measurable directly via a reporter gene approach. The complete isolation of a regulatory element does not solve this problem, again because context within surrounding DNA can aid an element’s activity. The weak transcriptional activity of a single isolated element seen in this study highlights this problem. Many of the above considerations already impact the examination of natural promoters with distant regulatory elements for which hormonal regulation in vivo has been well established. Future studies will be required to resolve the apparent differences that appear to exist between the two approaches.

Despite the inability of all the regions to direct transcriptional activity, we have learned much regarding how the VDR gene is autoregulated by its own product and 1,25-(OH)2D3. Aside from the demonstration that the VDR gene is autoregulated and that this autoregulation is mediated via distinct regions (and at least one VDRE) located significantly downstream of the TSS, we also discovered that the binding of VDR (and RXR) to these regions was rapid and resulted in an equally rapid acetylation of histone 4. Of interest is the fact that the gene exists in a broadly acetylated state in the absence of ligand, even at sites that do not appear to contain enhancers (the I and TSS regions) and that the changes in acetylation induced by 1,25-(OH)2D3 appear to be generally restricted to those regions that bind the VDR. Although we have not examined the acetylation state of the VDR gene at high resolution using ChIP-chip analysis, it seems likely that the enhancement of acetylation at these enhancer regions and likely other modification may be important to subsequent changes in the rate of VDR transcription (43, 44, 45). Perhaps more interesting is the finding that RNA pol II, although it is localized strongly at the TSS in the absence of ligand, is strikingly recruited to at least two of the enhancer regions in the presence of ligand. The ability of RNA pol II to localize at sites rather distant from gene promoters is currently emerging as a relatively common occurrence. Indeed, the presence of RNA pol II at many of these sites is now known to be associated with the production of both sense and antisense RNA transcripts, perhaps of a non-protein-coding nature (46, 47, 48). The appearance of these transcripts would also suggest that the general transcriptional apparatus might be recruited to these regions as well, and recent studies using ChIP analysis suggest that this can indeed occur (27). Although the precise function of these transcriptional complexes remains unclear, it has been speculated that enhancer regions could serve as recruitment centers to increase the local concentration of transcriptional components essential to enhanced gene expression (27). If so, this raises interesting questions as to the mechanism by which these elevated levels of the transcriptional machinery at enhancers are delivered to an active promoter and how enhancers and promoters actually differ in their properties. Our discovery of VDR regulatory elements located at significant distances from the VDR promoter region and their ability to localize RNA pol II provides valuable insight into the emerging concept that gene regulation is often controlled by enhancers located at unexpected sites along the chromosome.

In conclusion, we have identified several VDR-binding sites within two introns of the mouse VDR gene. One of these is highly active transcriptionally and contains a functional VDRE. That this region is highly conserved both structurally and functionally in the human VDR gene provides significant validity to this discovery. Our ongoing studies focus upon the specific functional roles of these enhancer regions in VDR gene expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
General biochemicals were obtained from Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St Louis, MO). 1,25-(OH)2D3 was obtained from Solvay (da Weesp, The Netherlands). {alpha}-MEM was purchased from Mediatech (Herndon, VA) and MEM-{alpha} was obtained from Invitrogen Corp. (Carlsbad, CA). Oligonucleotide primers were obtained from IDT (Coralville, IA). Anti-VDR (H-81), RXR ({Delta}N197), SRC-1 (M-341), and CBP antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-acetyl H4 antibody (06-866) was obtained from Upstate (Charlottesville, VA) and anti-RNA pol II antibody (8WG16) was obtained from Berkeley Antibody Co. (Richmond, CA). Lipofectamine Plus was obtained from Invitrogen. [32P]-deoxy (d) ATP was obtained from NEN Life Science Products, Inc. (Boston, MA).

Animal Studies
C57BL6 wild-type mice and research diets were obtained from Harlan (Indianapolis, IN). Eight-week-old mice were fed a vitamin D and calcium-deficient diet (0.8% Sr, 0.42% P) for 7 d before being dosed with 1,25-(OH)2D3 by ip injection. This dietary manipulation modestly reduced circulating 1,25-(OH)2D3 and serum calcium levels. After 6 h, the animals were killed and calvarial tissue was collected for RNA isolation (see RNA Isolation and Analysis). A preliminary study between 0 and 24 h had established peak induction at 6 h (data not shown). Experimental protocols were reviewed and approved by the Research Animal Resources Center (University of Wisconsin-Madison, Madison, WI).

Cell Culture
Mouse MC3T3-E1 and ST2 osteoblastic cells were cultured in {alpha}-MEM and MEM-{alpha}, respectively. Each medium was supplemented with 10% fetal bovine serum (FBS) obtained from Hyclone (Logan, UT). 1,25-(OH)2D3 was added in ethanol (0.1% maximum final concentration).

RNA Isolation and Analysis
Total RNA was isolated from homogenized animal tissue or cells using Triazol reagent obtained from MRC (Cincinnati, OH). The isolated RNA was reverse transcribed using the SuperScript III Ribonuclease H Reverse transcriptase kit from Invitrogen (Carlsbad, CA) and then subjected to PCR analysis using real-time (q) or standard PCR methods. The LightCycler FastStart DNA Master SYBR Green 1 kit used for qPCR was obtained from Roche (Indianapolis, IN). Primers used included those for mß-actin (forward, TGTTTGAGACCTTCAACACCC; reverse, CGTTGCCAATAGTGATGACCT); mCyp24a1 (forward, GTGCGGATTTCCTTTGTGATA; reverse, GGTAGCGTGTATTCACCCAGA); mVDR (real time) (forward, CCCATCATCCCTAGTGTGTCC; reverse, GGCTCCTTGGTTAGTGTGGTAG), and mVDR (standard PCR) (forward, TCACTGATGTCTCCAGAGCTGGGC; reverse, TGGATAGGCGGTCCTGAATGGC).

siRNA Studies
All siRNA duplexes were obtained from Dharmacon RNA Technologies (Lafayette, CO). ST2 cells were seeded into six-well plates at a concentration of 1.5 x 105 cells/well and transfected approximately 24 h later using Lipofectamine PLUS in serum and antibiotic-free medium. A total of 20 nM mVDR siRNA (D-058923-01), nontargeting siRNA pool (D-001206-13), or cyclophilin B siRNA (D-001136-01) was used for transfection. After transfection, the cells were cultured in medium supplemented with 10% FBS for 48 h before they were treated with a routine concentration of 10–7 M 1,25-(OH)2D3 for 6 h. RNA isolation and standard PCR analysis was carried out using the primers listed above and a primer set for mOPN (forward, CTAACTACGACCATGAGATTGGCAG; reverse, CTTTAGTTGACCTCAGAAGATGAAC).

ChIP Assay
ChIP assays were performed as previously described (7). Primer sets used for amplifying mouse VDR regions of interest included mVDR S1 (forward, CCCCTGGCACTTTATGTTTTT; reverse, AACCCTGTCATTCTCTAACTGG), mVDR S2 (forward, GACAAAAACCTTGTGGATTGGT; reverse, CTAGAAAGAACGGGCGATGTTC), mVDR S3 (forward, AGTAATAGCCCCAGGCAGAGC; reverse, AGTTCAGTCCAACAAGACGAGT), mVDR I (forward, CTGTGGAACATGGTGGCTCT; reverse, CCTGCTGTCTGGATGTAGTA), and mVDR TSS (–519 to –1) (forward, TGGGCTAATCCTAACCAGTA; reverse, CTTCCCGTGCTTAGGGCTCG). A primer set used for amplifying mouse Cyp24a1 (forward, GGTTATCTCCGGGGTGGAGT; reverse, AGTGGCCAATGAGCACGC) was included as a positive control.

Tiled Oligonucleotide Microarray Analysis
ChIP-chip analysis was carried out as described by others (26, 49, 50). In brief, DNA was isolated by specific immunoprecipitation using the ChIP methodology described above and then subjected to ligation-mediated PCR as described (51). ChIP purified DNA was blunt-ended using T4 polymerase, ligated to linkers with the sequence 5'-GCGGTGACCCGGGAGATCTGAATTC-3' and 5'-GAATTCAGATC-3' and subjected to repeated, low cycle PCR amplification. The resulting approximately 500-bp amplicons were then labeled with Cy3 or Cy5 dyes using an indirect labeling protocol. In this method, biotinylated deoxyuridine triphosphate is first incorporated into the individual amplicons by standard procedures and the conjugated DNA labeled subsequently with either Cy5- or Cy3-conjugated streptavidin (51). Cy3- and Cy5-labeled DNA samples are then mixed in the presence of CoT-1 DNA, denatured, and cohybridized to custom oligonucleotide microarray (Nimblegen Systems Inc., Madison, WI) as described (26). The microarrays are washed extensively and scanned using a Axon 4000B scanner at the appropriate wavelengths.

Custom oligonucleotide arrays were synthesized by Nimblegen Systems, Inc. (Madison, WI). The microarray probes consisted of maskless array, in situ-synthesized 50-oligomer oligonucleotides at 2-bp intervals representing an 84-kb screen of the mouse VDR gene from 20 kb upstream of the gene’s TSS to 10 kb downstream of the final 3' noncoding exon. The tiled arrays were synthesized in duplicate in both the forward as well as reverse directions, providing four independent measurements at each site within the gene. In addition, each analysis was carried out using two independently derived ChIP DNA samples. Both the Cyp24a1 and OPN genes as well as other candidate VDR target genes (not shown) were tiled in a similar fashion. A series of comparisons were made between 1) IgG in the presence or absence of hormone, 2) VDR in the presence or absence of hormone, 3) VDR in the presence of hormone vs. input DNA, 4) RXR in the presence or absence of hormone, and 5) RXR in the presence of hormone vs. input DNA. After sample cohybridization, the logarithmic enrichment ratio of Cy5 to Cy3 hybridization intensities (log2) were plotted as a function of chromosome nucleotide position. Although all of the peaks representative of enhanced VDR or RXR binding either in the presence of 1,25-(OH)2D3 or as compared with input DNA were evident visually, a peak finding algorithm was used to score the relative level of binding between the three regions identified (52).

Plasmids
Full-length hVDR and hRXR{alpha} were cloned into pET-29b vector obtained from Novagen (Darmstadt, Germany) and expressed with C-terminal 6xHis tags. The pCH110-ß-galactosidase reporter plasmid and the pcDNA-hVDR vector were previously described (53). ptk-mVDR S1-luc, ptk-mVDR S2-luc, and ptk-mVDR S3-luc were prepared by cloning the appropriate mouse VDR DNA fragments obtained through DNA amplification of MC3T3-E1 genomic DNA into the ptk-luc vector using the BamHI and SalI restriction sites. Mutagenesis of both VDREs located in the ptk-mVDR S1-luc reporter vector was performed using the QuikChange Mutagenesis Kit from Stratagene (San Diego, CA). pGL3 –100/+50 mVDR-luc vector was prepared by cloning the appropriate mouse VDR DNA fragment obtained through DNA amplification of MC3T3-E1 genomic DNA into the pGL3-basic vector using the HindIII and XhoI restriction sites. To prepare pGL3 –100/+50 mVDR S1-luc, the mVDR S1 region was amplified from the ptk-mVDR S1-luc vector and cloned into pGL3 –100/+50 mVDR-luc vector using the MluI and XhoI restriction sites. The same restriction sites were used for inserting phosphorylated oligonucleotide duplexes designed from VDRE 1 of the mVDR S1 region into pGL3 –100/+50 mVDR-luc vector to prepare pGL3 –100/+50 mVDR VDRE x1-luc and pGL3 –100/+50 mVDR VDRE x3-luc. ptk-hVDR S1-luc was prepared by cloning the appropriate VDR DNA fragment obtained through DNA amplification of human Caco2 genomic DNA into the ptk-luc vector using the BamHI and SalI restriction sites.

Transfection Assays
MC3T3-E1 and/or ST2 cells were seeded into 24-well plates at a concentration of 5.0 x 104 cells/well in {alpha}-MEM or MEM-{alpha} medium containing 10% FBS and were transfected 24 h later with Lipofectamine PLUS in serum and antibiotic-free medium. Individual wells were transfected with 250 ng of a luciferase reporter vector, 50 ng of pCH110-ßgal, and 50 ng of pcDNA-hVDR (unless otherwise indicated). A total of 50 nM nontargeting pool, cyclophilin B, or VDR siRNA was also transfected where indicated. After transfection, the cells were cultured in medium supplemented with 20% FBS with or without 1,25-(OH)2D3. Cells were harvested 24 h after stimulation and the lysates assayed for luciferase and ß-galactosidase activities as previously described (53). Luciferase activity was normalized to ß-galactosidase activity in all case.

DNA Bandshift Analysis
Duplex oligonucleotide probes comprised of the mouse osteopontin VDRE (54) (AACAAGGTTCACGAGGTTCACGTCT) and VDRE no. 1 of the mouse VDR S1 region (GGTCAG TGTCCTCTCTAACCCCTGGCT) (underline indicates specific VDRE sequence) were end-labeled using [32P]-dATP. Probes were incubated with 25 ng of hVDR and 12.5 ng of hRXR{alpha} in 10 mM HEPES (pH 7.4), 1 mM EDTA, 5 mM MgCl2, 10% glycerol, 0.5 mM dithiothreitol, 0.7 mM phenylmethylsulfonyl fluoride, and 50 mM (or 150 mM) KCl buffer at room temperature for 30 min. Incubations were performed in the presence or absence of 1,25-(OH)2D3. Protein amounts were doubled when indicated. 1, 10, or 100x molar excess unlabeled probe was added to the incubations for the competition bandshift assay. Complexes were resolved on 6% nondenaturing polyacrylamide gels, dried, and then visualized using autoradiography.

Protein Purification
Human VDR and RXR{alpha} proteins were produced using the bacterial expression vectors pET-hVDR and pET-hRXR{alpha} in BL21(DE3) codon Plus RIL cells obtained from Stratagene (San Diego, CA). Soluble full-length hVDR and hRXR{alpha} proteins were purified to homogeneity using sequential Ni-NTA and SP-Sepharose column chromatography (53). Two forms of RXR{alpha} were present.

Statistical Analyses
All values are expressed as mean ± SEM. We evaluated differences between experimental groups by using an unpaired t test or one-way ANOVA with Dunnett’s multiple comparison post test. For in vivo studies, EC50 calculations were performed using nonlinear regression analysis with a sigmoidal dose response curve. All statistical calculations were performed using the GraphPad PRISM version 4 statistical software package (GraphPad Software Inc., San Diego, CA).


    ACKNOWLEDGMENTS
 
We would like to thank Miwa Yamazaki for technical assistance and the members of the Pike laboratory for helpful discussions. We would also like to thank Adam Steinberg for preparing Fig. 4Go.


    FOOTNOTES
 
This work was supported by National Institutes of Health Grant AR-45173 (to J.W.P.).

First Published Online February 23, 2006

Abbreviations: bw, Body weight; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; ChIP-chip, chromatin immunoprecipitation-DNA microarray; Cyp24a1, 25 hydroxyvitamin D3-24 hydroxylase; FBS, fetal bovine serum; MOPN, mouse OPN; mVDR, mouse VDR; 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; OPN, osteopontin; qRT-PCR, quantitative real-time RT-PCR; RNA pol II, RNA polymerase II; RXR, retinoid X receptor; siRNA, small interfering RNAs; SRC-1, steroid receptor coactivator-1; TK, thymidine kinase; TSS, transcriptional start site; VDR, vitamin D receptor; VDRE, vitamin D3 response element.

Received for publication January 9, 2006. Accepted for publication February 13, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  2. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  3. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  4. Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, Dominguez CE, Jurutka PW 1998 The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13:325–349[CrossRef][Medline]
  5. Jurutka PW, Whitfield GK, Hsieh JC, Thompson PD, Haussler CA, Haussler MR 2001 Molecular nature of the vitamin D receptor and its role in regulation of gene expression. Rev Endocr Metab Disord 2:203–216[CrossRef][Medline]
  6. Sutton AL, MacDonald PN 2003 Vitamin D: more than a "bone-a-fide" hormone. Mol Endocrinol 17:777–791[Abstract/Free Full Text]
  7. Kim S, Shevde NK, Pike JW 2005 1,25-Dihydroxyvitamin D3 stimulates cyclic vitamin D receptor/retinoid X receptor DNA-binding, co-activator recruitment, and histone acetylation in intact osteoblasts. J Bone Miner Res 20:305–317[CrossRef][Medline]
  8. McDonnell DP, Mangelsdorf DJ, Pike JW, Haussler MR, O’Malley BW 1987 Molecular cloning of complementary DNA encoding the avian receptor for vitamin D. Science 235:1214–1217[Abstract/Free Full Text]
  9. Pan P, Reddy K, Lee S, Studzinski GP 1991 Differentiation-related regulation of 1,25-dihydroxyvitamin D3 receptor mRNA in human leukaemia cells HL-60. Cell Prolif 24:159–170[Medline]
  10. Mahonen A, Maenpaa PH 1994 Steroid hormone modulation of vitamin D receptor levels in human MG-63 osteosarcoma cells. Biochem Biophys Res Commun 205:1179–1186[CrossRef][Medline]
  11. Strom M, Sandgren ME, Brown TA, DeLuca HF 1989 1,25-Dihydroxyvitamin D3 up-regulates the 1,25-dihydroxyvitamin D3 receptor in vivo. Proc Natl Acad Sci USA 86:9770–9773[Abstract/Free Full Text]
  12. Naveh-Many T, Marx R, Keshet E, Pike JW, Silver J 1990 Regulation of 1,25-dihydroxyvitamin D3 receptor gene expression by 1,25-dihydroxyvitamin D3 in the parathyroid in vivo. J Clin Invest 86:1968–1975[Medline]
  13. Healy KD, Zella JB, Prahl JM, DeLuca HF 2003 Regulation of the murine renal vitamin D receptor by 1,25-dihydroxyvitamin D3 and calcium. Proc Natl Acad Sci USA 100:9733–9737[Abstract/Free Full Text]
  14. Healy KD, Frahm MA, DeLuca HF 2005 1,25-Dihydroxyvitamin D3 up-regulates the renal vitamin D receptor through indirect gene activation and receptor stabilization. Arch Biochem Biophys 433:466–473[CrossRef][Medline]
  15. Wiese RJ, Uhland-Smith A, Ross TK, Prahl JM, DeLuca HF 1992 Up-regulation of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from ligand-induced stabilization. J Biol Chem 267:20082–20086[Abstract/Free Full Text]
  16. Arbour NC, Prahl JM, DeLuca HF 1993 Stabilization of the vitamin D receptor in rat osteosarcoma cells through the action of 1,25-dihydroxyvitamin D3. Mol Endocrinol 7:1307–1312[Abstract/Free Full Text]
  17. Davoodi F, Brenner RV, Evans SR, Schumaker LM, Shabahang M, Nauta RJ, Buras RR 1995 Modulation of vitamin D receptor and estrogen receptor by 1,25(OH)2-vitamin D3 in T-47D human breast cancer cells. J Steroid Biochem Mol Biol 54:147–153[CrossRef][Medline]
  18. Zineb R, Zhor B, Odile W, Marthe RR 1998 Distinct, tissue-specific regulation of vitamin D receptor in the intestine, kidney, and skin by dietary calcium and vitamin D. Endocrinology 139:1844–1852[Abstract/Free Full Text]
  19. Jehan F, DeLuca HF 1997 Cloning and characterization of the mouse vitamin D receptor promoter. Proc Natl Acad Sci USA 94:10138–10143[Abstract/Free Full Text]
  20. Jehan F, DeLuca HF 2000 The mouse vitamin D receptor is mainly expressed through an Sp1-driven promoter in vivo. Arch Biochem Biophys 377:273–283[CrossRef][Medline]
  21. Miyamoto K, Kesterson RA, Yamamoto H, Taketani Y, Nishiwaki E, Tatsumi S, Inoue Y, Morita K, Takeda E, Pike JW 1997 Structural organization of the human vitamin D receptor chromosomal gene and its promoter. Mol Endocrinol 11:1165–1179[Abstract/Free Full Text]
  22. Crofts LA, Hancock MS, Morrison NA, Eisman JA 1998 Multiple promoters direct the tissue-specific expression of novel N-terminal variant human vitamin D receptor gene transcripts. Proc Natl Acad Sci USA 95:10529–10534[Abstract/Free Full Text]
  23. Byrne IM, Flanagan L, Tenniswood MP, Welsh J 2000 Identification of a hormone-responsive promoter immediately upstream of exon 1c in the human vitamin D receptor gene. Endocrinology 141:2829–2836[Abstract/Free Full Text]
  24. Huening M, Yehia G, Molina CA, Christakos S 2002 Evidence for a regulatory role of inducible cAMP early repressor in protein kinase a-mediated enhancement of vitamin D receptor expression and modulation of hormone action. Mol Endocrinol 16:2052–2064[Abstract]
  25. Esteban L, Eisman J, Gardiner E 2005 Vitamin D receptor promoter and regulation of receptor expression. In: Feldman D, Pike JW, Glorieux F, eds. Vitamin D. 2nd ed. New York: Elsevier/Academic Press; 193–217
  26. Kirmizis A, Bartley SM, Kuzmichev A, Margueron R, Reinberg D, Green R, Farnham PJ 2004 Silencing of human polycomb target genes is associated with methylation of histone H3 Lys 27. Genes Dev 18:1592–1605[Abstract/Free Full Text]
  27. Szutorisz H, Dillon N, Tora L 2005 The role of enhancers as centres for general transcription factor recruitment. Trends Biochem Sci 30:593–599[CrossRef][Medline]
  28. Gribnau J, Diderich K, Pruzina S, Calzolari R, Fraser P 2000 Intergenic transcription and developmental remodeling of chromatin subdomains in the human ß-globin locus. Mol Cell 5:377–386[CrossRef][Medline]
  29. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  30. Horak CE, Mahajan MC, Luscombe NM, Gerstein M, Weissman SM, Snyder M 2002 GATA-1 binding sites mapped in the ß-globin locus by using mammalian ChIP-chip analysis. Proc Natl Acad Sci USA 99:2924–2929[Abstract/Free Full Text]
  31. Martone R, Euskirchen G, Bertone P, Hartman S, Royce TE, Luscombe NM, Rinn JL, Nelson FK, Miller P, Gerstein M, Weissman S, Snyder M 2003 Distribution of NF-{kappa}B-binding sites across human chromosome 22. Proc Natl Acad Sci USA 100:12247–12252[Abstract/Free Full Text]
  32. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, Eeckhoute J, Shao W, Hestermann EV, Geistlinger TR, Fox EA, Silver PA, Brown M 2005 Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell 122:33–43[CrossRef][Medline]
  33. Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N, Kanin E, Volkert TL, Wilson CJ, Bell SP, Young RA 2000 Genome-wide location and function of DNA binding proteins. Science 290:2306–2309[Abstract/Free Full Text]
  34. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH 2004 Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell 119:1041–1054[Medline]
  35. Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, Best J, Chen H, Jenner R, Herbolsheimer E, Jacobsen E, Kadam S, Ecker JR, Emerson B, Hogenesch JB, Unterman T, Young RA, Montminy M 2005 Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci USA 102:4459–4464[Abstract/Free Full Text]
  36. Lee TI, Rinaldi NJ, Robert F, Odom DT, Bar-Joseph Z, Gerber GK, Hannett NM, Harbison CT, Thompson CM, Simon I, Zeitlinger J, Jennings EG, Murray HL, Gordon DB, Ren B, Wyrick JJ, Tagne JB, Volkert TL, Fraenkel E, Gifford DK, Young RA 2002 Transcriptional regulatory networks in Saccharomyces cerevisiae. Science 298:799–804[Abstract/Free Full Text]
  37. Cam H, Balciunaite E, Blais A, Spektor A, Scarpulla RC, Young R, Kluger Y, Dynlacht BD 2004 A common set of gene regulatory networks links metabolism and growth inhibition. Mol Cell 16:399–411[CrossRef][Medline]
  38. Tolhuis B, Palstra RJ, Splinter E, Grosveld F, de Laat W 2002 Looping and interaction between hypersensitive sites in the active ß-globin locus. Mol Cell 10:1453–1465[CrossRef][Medline]
  39. Dekker J, Rippe K, Dekker M, Kleckner N 2002 Capturing chromosome conformation. Science 295:1306–1311[Abstract/Free Full Text]
  40. Carter D, Chakalova L, Osborne CS, Dai YF, Fraser P 2002 Long-range chromatin regulatory interactions in vivo. Nat Genet 32:623–626[CrossRef][Medline]
  41. Drissen R, Palstra RJ, Gillemans N, Splinter E, Grosveld F, Philipsen S, de Laat W 2004 The active spatial organization of the ß-globin locus requires the transcription factor EKLF. Genes Dev 18:2485–2490[Abstract/Free Full Text]
  42. O’Sullivan JM, Tan-Wong SM, Morillon A, Lee B, Coles J, Mellor J, Proudfoot NJ 2004 Gene loops juxtapose promoters and terminators in yeast. Nat Genet 36:1014–1018[CrossRef][Medline]
  43. Spotswood HT, Turner BM 2002 An increasingly complex code. J Clin Invest 110:577–582[CrossRef][Medline]
  44. Schubeler D, MacAlpine DM, Scalzo D, Wirbelauer C, Kooperberg C, van Leeuwen F, Gottschling DE, O’Neill LP, Turner BM, Delrow J, Bell SP, Groudine M 2004 The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev 18:1263–1271[Abstract/Free Full Text]
  45. Bernstein BE, Kamal M, Lindblad-Toh K, Bekiranov S, Bailey DK, Huebert DJ, McMahon S, Karlsson EK, Kulbokas 3rd EJ, Gingeras TR, Schreiber SL, Lander ES 2005 Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120:169–181[CrossRef][Medline]
  46. Kampa D, Cheng J, Kapranov P, Yamanaka M, Brubaker S, Cawley S, Drenkow J, Piccolboni A, Bekiranov S, Helt G, Tammana H, Gingeras TR 2004 Novel RNAs identified from an in-depth analysis of the transcriptome of human chromosomes 21 and 22. Genome Res 14:331–342[Abstract/Free Full Text]
  47. Bolland DJ, Wood AL, Johnston CM, Bunting SF, Morgan G, Chakalova L, Fraser PJ, Corcoran AE 2004 Antisense intergenic transcription in V(D)J recombination. Nat Immunol 5:630–637[CrossRef][Medline]
  48. Cheng J, Kapranov P, Drenkow J, Dike S, Brubaker S, Patel S, Long J, Stern D, Tammana H, Helt G, Sementchenko V, Piccolboni A, Bekiranov S, Bailey DK, Ganesh M, Ghosh S, Bell I, Gerhard DS, Gingeras TR 2005 Transcriptional maps of 10 human chromosomes at 5-nucleotide resolution. Science 308:1149–1154[Abstract/Free Full Text]
  49. Kim TH, Barrera LO, Qu C, Van Calcar S, Trinklein ND, Cooper SJ, Luna RM, Glass CK, Rosenfeld MG, Myers RM, Ren B 2005 Direct isolation and identification of promoters in the human genome. Genome Res 15:830–839[Abstract/Free Full Text]
  50. Kim TH, Barrera LO, Zheng M, Qu C, Singer MA, Richmond TA, Wu Y, Green RD, Ren B 2005 A high-resolution map of active promoters in the human genome. Nature 436:876–880[CrossRef][Medline]
  51. Oberley MJ, Tsao J, Yau P, Farnham PJ 2004 High-throughput screening of chromatin immunoprecipitates using CpG-island microarrays. Methods Enzymol 376:315–334[Medline]
  52. Glynn EF, Megee PC, Yu HG, Mistrot C, Unal E, Koshland DE, DeRisi JL, Gerton JL 2004 Genome-wide mapping of the cohesin complex in the yeast Saccharomyces cerevisiae. PLoS Biol 2:E259
  53. Yamamoto H, Shevde NK, Warrier A, Plum LA, DeLuca HF, Pike JW 2003 2-Methylene-19-nor-(20S)-1,25-dihydroxyvitamin D3 potently stimulates gene-specific DNA binding of the vitamin D receptor in osteoblasts. J Biol Chem 278:31756–31765[Abstract/Free Full Text]
  54. Noda M, Vogel RL, Craig AM, Prahl J, DeLuca HF, Denhardt DT 1990 Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D3 receptor and 1,25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (SPP-1 or osteopontin) gene expression. Proc Natl Acad Sci USA 87:9995–9999[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   VDR  |  RXRα  |  RXRβ  |  RXRγ
Coregulators:   CBP  |  SRC-1
Ligands:   Calcitriol



This article has been cited by other articles:


Home page
Anticancer ResHome page
C. CARLBERG and S. SEUTER
A Genomic Perspective on Vitamin D Signaling
Anticancer Res, September 1, 2009; 29(9): 3485 - 3493.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Ishizawa, K.-i. Iwasaki, S. Kato, and M. Makishima
Hypergravity modulates vitamin D receptor target gene mRNA expression in mice
Am J Physiol Endocrinol Metab, September 1, 2009; 297(3): E728 - E734.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
J. W. Pike, M. B. Meyer, and M. L. Martowicz
New Techniques in Transcription Research Extend Our Understanding of the Molecular Actions of the Vitamin D Hormone
IBMS BoneKEy, May 1, 2009; 6(5): 169 - 180.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. F. Pan, K. D. S. A. Wansa, M. H. Liu, B. Zhao, S. Z. Hong, P. Y. Tan, K. S. Lim, G. Bourque, E. T. Liu, and E. Cheung
Regulation of Estrogen Receptor-mediated Long Range Transcription via Evolutionarily Conserved Distal Response Elements
J. Biol. Chem., November 21, 2008; 283(47): 32977 - 32988.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Deblois and V. Giguere
Nuclear Receptor Location Analyses in Mammalian Genomes: From Gene Regulation to Regulatory Networks
Mol. Endocrinol., September 1, 2008; 22(9): 1999 - 2011.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. D. Nerenz, M. L. Martowicz, and J. W. Pike
An Enhancer 20 Kilobases Upstream of the Human Receptor Activator of Nuclear Factor-{kappa}B Ligand Gene Mediates Dominant Activation by 1,25-Dihydroxyvitamin D3
Mol. Endocrinol., May 1, 2008; 22(5): 1044 - 1056.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. A. Fretz, N. K. Shevde, S. Singh, B. G. Darnay, and J. W. Pike
Receptor Activator of Nuclear Factor-{kappa}B Ligand-Induced Nuclear Factor of Activated T Cells (C1) Autoregulates Its Own Expression in Osteoclasts and Mediates the Up-Regulation of Tartrate-Resistant Acid Phosphatase
Mol. Endocrinol., March 1, 2008; 22(3): 737 - 750.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Galli, L. A. Zella, J. A. Fretz, Q. Fu, J. W. Pike, R. S. Weinstein, S. C. Manolagas, and C. A. O'Brien
Targeted Deletion of a Distant Transcriptional Enhancer of the Receptor Activator of Nuclear Factor-{kappa}B Ligand Gene Reduces Bone Remodeling and Increases Bone Mass
Endocrinology, January 1, 2008; 149(1): 146 - 153.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Seoane, I. Ben, V. Centeno, and R. Perez-Fernandez
Cellular Expression Levels of the Vitamin D Receptor Are Critical to Its Transcriptional Regulation by the Pituitary Transcription Factor Pit-1
Mol. Endocrinol., July 1, 2007; 21(7): 1513 - 1525.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. M. Turunen, T. W. Dunlop, C. Carlberg, and S. Vaisanen
Selective use of multiple vitamin D response elements underlies the 1 {alpha} ,25-dihydroxyvitamin D3-mediated negative regulation of the human CYP27B1 gene
Nucleic Acids Res., April 10, 2007; (2007) gkm179v1.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Kim, M. Yamazaki, L. A. Zella, N. K. Shevde, and J. W. Pike
Activation of Receptor Activator of NF-{kappa}B Ligand Gene Expression by 1,25-Dihydroxyvitamin D3 Is Mediated through Multiple Long-Range Enhancers.
Mol. Cell. Biol., September 1, 2006; 26(17): 6469 - 6486.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. A. Fretz, L. A. Zella, S. Kim, N. K. Shevde, and J. W. Pike
1,25-Dihydroxyvitamin D3 Regulates the Expression of Low-Density Lipoprotein Receptor-Related Protein 5 via Deoxyribonucleic Acid Sequence Elements Located Downstream of the Start Site of Transcription
Mol. Endocrinol., September 1, 2006; 20(9): 2215 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. B. Meyer, M. Watanuki, S. Kim, N. K. Shevde, and J. W. Pike
The Human Transient Receptor Potential Vanilloid Type 6 Distal Promoter Contains Multiple Vitamin D Receptor Binding Sites that Mediate Activation by 1,25-Dihydroxyvitamin D3 in Intestinal Cells
Mol. Endocrinol., June 1, 2006; 20(6): 1447 - 1461.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zella, L. A.
Right arrow Articles by Pike, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zella, L. A.
Right arrow Articles by Pike, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals