help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2006-0012
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, H.
Right arrow Articles by Dahlman-Wright, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, H.
Right arrow Articles by Dahlman-Wright, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Molecular Endocrinology 20 (6): 1287-1299
Copyright © 2006 by The Endocrine Society

Long-Term Administration of Estradiol Decreases Expression of Hepatic Lipogenic Genes and Improves Insulin Sensitivity in ob/ob Mice: A Possible Mechanism Is through Direct Regulation of Signal Transducer and Activator of Transcription 3

Hui Gao1, Galina Bryzgalova1, Erik Hedman, Akhtar Khan, Suad Efendic, Jan-Åke Gustafsson and Karin Dahlman-Wright

Department of Biosciences and Nutrition (H.G., E.H., J.-Å.G., K.D.-W.), Karolinska Institutet, S-141 57 Huddinge, Sweden; and Department of Molecular Medicine and Surgery (G.B., A.K., S.E.), Karolinska Hospital, Karolinska Institutet, S-171 76 Stockholm, Sweden

Address all correspondence and requests for reprints to: Hui Gao, Department of Biosciences and Nutrition, Karolinska Institutet, Novum, S-14157 Huddinge, Sweden. E-mail: hui.gao{at}biosci.ki.se.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we used ob/ob mice as a model to investigate the effects of long-term estradiol administration on insulin sensitivity and to explore the mechanisms that underlie the antidiabetic effects of estrogen on mouse liver. Female ob/ob mice were randomly divided into two groups and given estradiol (100 µg/kg·d) or vehicle alone for 4 wk. Estrogen administration improved glucose tolerance and insulin response to glucose in ob/ob mice. Moreover, insulin resistance and liver triglyceride levels were decreased in response to estrogen administration. Microarray analysis revealed that expression of genes involved in hepatic lipid biosynthesis was decreased in ob/ob mouse livers after estradiol treatment. Further searches for direct estrogen target genes revealed increased hepatic mRNA expression of signal transducer and activator of transcription 3 (Stat3) and several known Stat3 target genes in ob/ob livers after long-term estradiol treatment. Furthermore, Stat3 and phosphorylated Stat3 protein is induced in ob/ob mouse liver after long-term estrogen treatment. We also present data showing that Stat3 is rapidly induced by estradiol in mouse livers. This, together with data showing recruitment of ER{alpha} to the promoter of Stat3 in vivo, suggests that Stat3 is a direct target gene for estradiol. In conclusion, estradiol treatment improves glucose tolerance and insulin sensitivity in ob/ob mice. We propose that this may be mediated, at least partially, via estrogen stimulation of the hepatic expression of Stat3, leading to decreased expression of hepatic lipogenic genes, and thereby to antidiabetic effects.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TYPE 2 DIABETES mellitus is now considered as a major threat to world health (1, 2). Although the pathophysiologic basis of type 2 diabetes mellitus is largely unknown, accumulating evidence suggests that modern diets and sedentary lifestyles progressively lead to accumulation of saturated fatty acids in nonadipose tissue (3). The subsequent metabolism of this ectopic fatty acid pool may lead to decreased insulin-stimulated glucose uptake in skeletal muscle and increased hepatic glucose production (3).

Studies in humans and rodents link the endogenous estrogen hormone to the maintenance of glucose homeostasis (4). Thus, postmenopausal therapy with estrogen may reduce the incidence of type 2 diabetes (5). Treatment of healthy postmenopausal women with unopposed estradiol or conjugated equine estrogen has been shown to improve insulin sensitivity and to lower blood glucose (6, 7, 8). Furthermore, a randomized, double-blind, placebo-controlled trial has shown that hormone replacement therapy in postmenopausal women with coronary heart disease results in a 35% reduction in the incidence of diabetes at the 4-yr follow up (9). Estrogen also displays antidiabetic properties in several spontaneous rodent models of type 2 diabetes mellitus, such as db/db mice and Zucker diabetic fatty rats, in which male rodents develop hyperglycemia, whereas female rodents are protected (4). Aromatase-knockout mice that cannot synthesize endogenous estrogens develop insulin resistance (10). Studies of estrogen receptor (ER) {alpha} knockout (ERKO) mice and ERß knockout (BERKO) mice have demonstrated that ER{alpha}, but not ERß gene depletion, results in increased body weight, glucose intolerance, and insulin resistance (11).

The key role of the liver in controlling both carbohydrate and lipid homeostasis in vivo has been confirmed by transgenic and knockout models; see review (12). In healthy postmenopausal women, three short-term studies using the clamp technique have failed to demonstrate an effect of unopposed estradiol or conjugated equine estrogen on muscle insulin sensitivity (13, 14, 15), suggesting that the observed improvement in hyperinsulinemia in female results from an effect on the liver. The phenotype of the aromatase-knockout mouse has demonstrated the pivotal role of estrogen in supporting constitutive hepatic expression of genes involved in lipid-ß oxidation and in maintaining hepatic lipid homeostasis (10, 16). Many liver expressed genes have been found to play important roles in controlling carbohydrate and lipid homeostasis. These genes are mainly involved in insulin signaling pathways (17), lipid and fatty acid metabolism, and glucose metabolism (12, 18), as well as cytokine signaling pathways (19). Alterations in the expression of these genes could lead to development of hepatic insulin resistance or type 2 diabetes.

Diverse biological effects induced by estrogens are mediated via a direct interaction of estrogens with ERs that activate the expression of ER target genes. Besides binding to the classical estrogen response element (ERE) on DNA, the activated ERs can regulate gene expression through DNA sequences that are primary targets for other transcription factors such as cAMP-responsive elements (CREs) and signal transducers and activators of transcription (STATs) binding elements (SBEs). In this case, ERs are thought to bind to DNA bound activating protein-1 and STATs, respectively (20, 21).

We have previously shown that insulin resistance in ERKO mice is mainly localized to the liver and suggested that it results from up-regulation of lipogenic genes via suppression of leptin signaling, after down-regulation of leptin receptor (Lepr) expression in liver (22). To further explore this hypothesis, we treated ob/ob mice with estradiol and found markedly improved insulin sensitivity. Because the leptin gene is mutated in these mice (23) and they have low expression of the Lepr, it is likely that there are also additional mechanisms underlying the antidiabetic effect of estrogen. The present study suggests that one such mechanism could be via enhanced expression of Stat3. This transcription factor, which requires phosphorylation at a tyrosine at residue 705 for activity, has been suggested to play an important role in the regulation of lipid synthesis in liver and to integrate the pathways that are dysregulated in the metabolic syndrome, such as insulin resistance, dyslipidemia, and hepatic steatosis (19, 24).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Glucose Tolerance and Insulin Response to Glucose Are Improved in ob/ob Mice upon Estrogen Administration
Thirty days of treatment with estradiol significantly decreased fasting blood glucose levels in ob/ob mice (Fig. 1AGo). Ten minutes after the ip glucose load, blood glucose concentrations increased in both treated and control mice, but glucose levels remained significantly lower in estradiol-treated mice throughout the experiment (120 min). Hence, estradiol treatment markedly improved glucose tolerance in ob/ob mice.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Glucose Tolerance and Insulin Sensitivity Are Improved in ob/ob Mice upon Estrogen Administration

A, IPGTT in overnight fasted ob/ob mice treated with 17ß-estradiol (open circle) or control (black circle) for 30 d. Blood glucose concentrations were measured before and after glucose challenge (2 g/kg, ip) at the indicated time points. Data are presented as mean ± SEM, n = 8 for the control group and n = 7 for the treated animals. B, Insulin concentration during the IPGTT test. Data are presented as mean ± SEM, n = 6 for the control group and n = 6 for the treated mice. C, IPITT in overnight fasted ob/ob mice treated with 17ß-estradiol or vehicle for 30 d. Animals were injected first with insulin at a dose of 0.25 U/kg, ip and 10 min later with glucose at a dose of 1.0 mg/kg ip. Blood glucose levels were measured at basal conditions and at different time points after glucose load. Data are presented as mean ± SEM, n = 7 for the control group and n = 8 for the treated animals. *, P value < 0.05; **, P value < 0.01; ***, P value < 0.001.

 
At the basal state, the plasma insulin level was significantly lower in estradiol-treated animals (Fig. 1BGo). After glucose injection, insulin levels increased slowly and continuously in control mice, whereas estradiol-treated animals showed a sharp peak of insulin response at 10 min. Subsequently, the insulin level dropped to basal levels.

Insulin Sensitivity Is Improved in ob/ob Mice in Response to Estrogen Administration
In estradiol-treated animals, the basal blood glucose concentration was, as expected, significantly lower compared with untreated mice (Fig. 1CGo). After insulin and glucose challenge a peak in blood glucose level was attained at 15 min and then slowly decreased. However, blood glucose concentration remained higher in control mice compared with estradiol-treated mice throughout the experiment. Thus, estradiol treatment significantly improved insulin sensitivity in ob/ob mice.

Expression of Genes Involved in Lipid Synthesis Is Decreased in Livers of ob/ob Mice upon Estradiol Treatment
To identify estrogen-regulated signaling networks in mouse liver, we analyzed gene expression profiles from ob/ob mouse liver treated with estradiol and vehicle, respectively, for 4 wk using the Affymetrix (Santa Clara, CA) oligonucleotide microarrays. Changed genes were identified in ob/ob mouse livers after long-term estradiol treatment compared with control as described in Materials and Methods. The complete list of regulated genes is published as a supplemental table on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org.

To obtain a better understanding of overall changes in gene expression, we used an overrepresentation analysis procedure to detect coordinate changes in the expression of groups of functionally related genes or pathways in livers of ob/ob mice after long-term estradiol treatment. The ten pathways most significantly enriched for increased or decreased genes are displayed in Table 1Go. This analysis revealed that gene ontology (GO) categories involved in lipid metabolism, such as lipid biosynthesis (GO 0008610), lipid metabolism (GO 0006629), and fatty acid metabolism (GO 0006631), were significantly enriched for decreased genes in ob/ob mice after long-term estradiol treatment. GO categories involved in steroid metabolism (GO 0008202) and acute-phase response (GO 0006953) were significantly enriched for increased genes in ob/ob mice treated with estradiol. GO categories involved in glucose metabolism such as gluconeogenesis (GO 0006094), glucose metabolism (GO 0006006), and glucose transport (GO 0015758) were not significantly enriched for changed genes in ob/ob mouse livers after estradiol treatment.


View this table:
[in this window]
[in a new window]
 
Table 1. Significantly Changed GO Categories Identified by High-Throughput GoMiner

 
A closer examination of changed genes involved in the lipid metabolism pathway shows that genes participating in fatty acid synthesis, fatty acid synthase (Fasn), stearoyl-coenzyme A desaturase 1 (Scd1), and lipid synthesis, particularly glycerol-3-phosphate acyltransferase (Gpam), were decreased in ob/ob mouse livers after estradiol treatment (Table 2Go). Fasn, Scd1, and Gpam were decreased 2-, 4-, and 2.3-fold in ob/ob mouse livers upon estradiol treatment, respectively, as assayed using microarray. The fold decreases for these genes detected by quantitative RT-PCR were 3.7-, 6.7-, and 2.5-fold for Fasn, Scd1, and Gpam, respectively, suggesting a high reliability of the microarray data concerning direction and extent of regulation (Fig. 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Genes with Decreased Expression in ob/ob after Long-Term Estradiol in the Lipid Metabolism Category

 

Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Confirmation of Gene Expression Profiling Data by Quantitative Real-Time PCR

ob/ob mice were given sc injections of sesame oil/ethanol vehicle or 100 µg/kg 17ß-estradiol once daily for 30 d. RNA samples from individual mice prepared for gene profiling experiments were analyzed by quantitative real-time PCR for expression. Values are expressed as the mean ± SD and relative to the mean values in vehicle-treated ob/ob mouse livers. *, P value < 0.05; n = 3.

 
Triglyceride Levels Are Decreased in Livers of ob/ob Mice upon Estradiol Treatment
Figure 3AGo shows that liver triglyceride levels were significantly reduced in ob/ob mice in response to estrogen treatment, whereas there were no significant changes in liver cholesterol levels. Furthermore, SDS-PAGE analysis of total liver protein identified a protein, the level of which was markedly reduced after estrogen treatment of ob/ob mice (Fig. 3BGo). This protein was later identified by MALDI-TOF/TOF mass spectrometry. Thirty-seven masses of in-gel tryptic digestion fragments (not shown) specifically matched the amino acid sequence of the mouse Fasn (NCBInr accession no: AAH46513; Mowse score: 137; sequence coverage: 19%). Western blot analysis confirmed reduction of Fasn protein expression in livers of ob/ob mice after long-term estradiol treatment (Fig. 3CGo).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Estrogen Long-Term Treatment Decreases the Lipid Content in ob/ob Mouse Liver

A, The ob/ob mice were given sc injections of sesame oil/ethanol vehicle or 100 µg/kg 17ß-estradiol once daily for 30 d. Hepatic lipids were extracted from individual animals and analyzed for cholesterol (CHOL) and triglycerides (TG). Values represent the mean ± SD with n = 5 animals per group. B, SDS-PAGE analysis of total protein prepared from individual livers of ob/ob mice treated with estradiol or vehicle alone for 4 wk. The gel was stained with Coomassie blue. Shown is a representative analysis of one treated and one control liver of three analyzed in each group. C, Western blot analysis of Fasn and ß-actin expression using total protein extracts (20 µg per lane) prepared from individual livers of ob/ob mice treated with estradiol or vehicle alone for 4 wk. Shown is a representative analysis of one treated and one control liver of three analyzed in each group (upper panel). The bands were quantified by densitometric scanning. The lower panel shows Fasn expression normalized to ß-actin with levels. Values are expressed as the mean ± SD and relative to the mean value in vehicle-treated ob/ob mouse livers that is arbitrarily set to 1. **, P value < 0.01; n = 3.

 
The Leptin Receptor Is Induced by Estradiol in Livers of ob/ob Mice
Expression of Lepr in livers of ob/ob mice was too low to allow accurate detection using the Affymetrix platform. However, real-time PCR showed that the mRNA for Lepr is increased approximately 8-fold after estradiol treatment (Fig. 4Go).


Figure 4
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Leptin Receptor mRNA Is Induced by Estradiol in Livers of ob/ob Mice

The ob/ob mice were given sc injections of sesame oil/ethanol vehicle or 100 µg/kg 17ß-estradiol once daily for 30 d. RNA samples from individual mice prepared for gene profiling experiments were analyzed by quantitative real-time PCR for expression. Values are expressed as the mean ± SD and relative to the mean values in vehicle-treated ob/ob mouse livers. **, P value < 0.01; n = 3. Analysis of melting curves demonstrated amplification of one specific gene product for each primer pair.

 
Identification of Stat3 as an Estrogen-Induced Gene in Livers of ob/ob Mice
Neither Fasn or Scd1 nor Gpam was regulated by short-term (2, 4, and 6 h, respectively), of estrogen treatment (100 µg/kg) in vivo (data not shown). We therefore examined the list of regulated genes for potential direct target genes that have been associated with lipid biosynthesis and insulin sensitivity. This analysis revealed increased expression of Stat3.

Real-time PCR confirmed estrogen stimulation of Stat3 expression in livers of ob/ob mice (Fig. 5AGo). Figure 5Go, B and C, demonstrates induction of Stat3 protein and phosphorylated Stat3 protein in livers from ob/ob mice treated with estradiol compared with vehicle alone.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. Estradiol Induces Expression of Stat3 in Mouse Liver

A, RNA samples from individual mice prepared for gene profiling experiments were analyzed by quantitative real-time PCR for expression. Values are expressed as the mean ± SD and relative to the mean values in vehicle-treated ob/ob mice liver. *, P value < 0.05; n = 3. Analysis of melting curves demonstrated amplification of one specific gene product for each primer pair. B, Total protein extracts (20 µg) prepared from individual livers of ob/ob mice treated with estradiol or vehicle alone for 4 wk were analyzed by Western blot analysis using Stat3 antibodies, antibodies specific to Stat3 phosphorylated at tyrosine 705 (P-Tyr) or b-actin. Shown is a representative analysis of one treated and one control liver of three analyzed in each group. C, Data from Western blot analysis was quantified by densitometric scanning and the amount of phosphorylated Stat3 (P-Tyr) and total Stat3 was normalized to ß-actin. Values are expressed as the mean ± SD and relative to the mean values in vehicle-treated ob/ob mouse livers that are arbitrarily set to 1. **, P value < 0.01; n = 3. D, Confirmation of gene expression profiling data for known Stat3 target genes by quantitative real-time PCR. Values are expressed as the mean ± SD and relative to the mean values in vehicle-treated ob/ob mouse livers which are arbitrarily set to one. *, P value < 0.05; n = 3. E, Time course for estradiol induction of Stat3 in vivo in C57BL/6 mice assayed by real-time PCR. All expression values are normalized for expression of Hprt and are presented as the mean ± SD with n = 5 per group. The mean expression of Stat3 in animals receiving vehicle treatment was defined as 1.0 with all other expression values reported relative to this value. *, P value < 0.05 for comparison to vehicle-treated animals.

 
Importantly, known Stat3-regulated genes, such as CCAAT/enhancer binding protein {delta} (Cebpd) (25), serum amyloid P-component (Apcs), lipopolysaccharide binding protein (Lbp) (26), were also increased in ob/ob mouse livers after estradiol treatment (Table 3Go and Fig. 5DGo). These findings indicate that the Stat3 signaling pathway is increased in ob/ob livers after long-term estradiol treatment.


View this table:
[in this window]
[in a new window]
 
Table 3. Genes with Increased Expression in ob/ob after Long-Term Estradiol Related to Stat3 Signaling

 
Stat3 Is Rapidly Induced in Mouse Livers
The time course for hepatic Stat3 induction was determined in vivo in mouse livers. Stat3 mRNA was induced already 2 h (earliest assayed time point) after estrogen treatment in mouse liver in vivo (Fig. 5EGo). These data suggest that Stat3 is a primary estrogen target gene.

Stat3 Is a Direct Estrogen Target Gene
We used a transient transfection assay to determine whether the mouse Stat3 promoter (positions –2166 to +60) mediates estradiol regulation of the Stat3 mRNA. Figure 6Go shows that estrogen treatment of cells cotransfected with ER{alpha} increases reporter gene activity. Huh-7 cells, which have low levels of endogenous ERs, were used for these experiments. This allowed testing of the requirement of ER{alpha} for the observed effect.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. Estrogens Induce Activation of the 2.2-kb Stat3 Promoter Region

A, Schematic representation of the Stat3 promoter luciferase reporter construct containing the mouse Stat3 promoter region (–2166/+60). B, Huh7 cells were transfected with 200 ng p2166-Stat3-Luc or empty pSP-Luc vector, 20 ng of pSG5-mouse-ER{alpha} expression vector or empty pSG5 vector, and 50 ng ß-galactosidase control vector in 12-well plates. After treatment with ethanol or 10 nM 17ß-estradiol for 24 h, cell extracts were prepared and assayed for luciferase and ß-galactosidase activities. Luciferase values were normalized for ß-galactosidase expression. Luciferase activity in cells transfected with pSG5 and treated with vehicle is set to 1. Shown is a representative experiment of three independent experiments. Values represent the mean ± SD of triplicate for this experiments. **, P value < 0.01.

 
Using computational methods to search for transcription factor binding sites, we identified an SBE (TGCCTGGAA) and a CRE (TGACGTCA) between positions –336 and –313 from the transcription start site in the mouse Stat3 promoter with a 5-bp spacing between the motifs. Mutations were introduced at these sites to investigate whether the SBE and/or the CRE were responsible for estradiol responsiveness of the Stat3 promoter. Hepa1–6 cells, containing endogenous ERs, were used for these experiments. Hepa1–6 cells are mouse cells, in contrast to the human Huh-7 cells, and were therefore considered appropriate for a more detailed characterization of the mouse Stat3 promoter. Figure 7Go shows that both mutant promoter constructs, CRE (p2166-Stat3-luc-mCRE) and SBE (p2166-Stat3-luc-mSTAT), respectively, show reduced basal activity. However, importantly, mutations of either the putative SBE or the putative CRE eliminated estradiol responsiveness of the respective constructs. Finally, we used a chromatin immunoprecipitation (ChIP) assay to demonstrate direct recruitment of ER{alpha} to the region that contains the CRE and the SBE in vivo in the context of intact liver chromatin. Figure 8AGo, right panel, shows ER{alpha}-specific recruitment to the region that contains the CRE and SBE sites. Recruitment of ER{alpha} was not observed to an upstream region that do not contain any known ER binding sites (Fig. 8AGo, left panel). In Fig. 8BGo, the interaction of ER{alpha} with the fragment containing the CRE and SBE sites and the fragment that does not contain any known ER binding sites, respectively, is quantified by assaying bound DNA using real-time PCR.


Figure 7
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7. Both the CRE and the SBE Are Required for Estradiol Induction of the Stat3 Promoter Activity

Introduced mutations are shown in gray. Hepa1–6 cells were transfected with 200 ng of the respective reporter vector together with 50 ng ß-galactosidase control vector. After treatment with ethanol or 1 nM 17ß-estradiol for 24 h, cell extracts were prepared and assayed for luciferase and ß-galactosidase activities. All luciferase values were normalized for ß-galactosidase expression. The luciferase activity in cells transfected with pSP-Luc vector and treated with ethanol was defined as 1. Shown is a representative experiment of three independent experiments. Values represent the mean ± SD of triplicate for this experiments. **, P value < 0.01. WT, Wild type.

 

Figure 8
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 8. Recruitment of ER{alpha} to the Mouse Stat3 Promoter

Livers from ovariectomized C57BL/6 mice, treated with a single sc injection 100 µg/kg 17ß-estradiol or vehicle alone and euthanized 2 h after injection, were assayed by ChIP. A, Upper panel, Schematic representation of the Stat3 promoter structure and the position of the PCR primers for detecting recruitment of ER{alpha}. A, Lower panel, The Stat3 promoter occupancy was analyzed for three individual animals in each group. Shown is one representative analysis from each group. B, Real-time PCR analysis of the promoter occupancy of ER{alpha} at the mouse Stat3 promoter. Data are presented relative to promoter occupancy in mock precipitated samples. Values represent the mean ± SD with three animals in each group. *, P value < 0.05; **, P value < 0.01, n = 3.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Treatment of ob/ob mice with estradiol during 30 d resulted in significantly decreased basal glucose and insulin levels, and improved insulin response to glucose. Moreover, glucose tolerance and insulin sensitivity were markedly improved. We previously demonstrated that ERKO mice exhibited hyperglycemia, hyperinsulinemia, and insulin resistance, primarily resulting from hepatic dysfunction (22). Therefore, it is likely that improvement of insulin sensitivity in estradiol-treated ob/ob mice was mainly caused by increased hepatic insulin responsiveness. Furthermore, we have found that long-term treatment of ob/ob mice with estradiol decreased hepatic storage of triglycerides more than 2-fold compared with untreated animals. Notably, causal relationship between hepatic fat accumulation and hepatic insulin resistance has also been shown in rats after feeding with a high-fat diet (27). These rats had significantly impaired insulin-mediated suppression of hepatic glucose production, without any changes in peripheral glucose uptake.

Specifically, we have shown that 30 d treatment with estradiol in ob/ob mice increased Lepr expression level and decreased expression of genes involved in fatty acid synthesis in liver. Thus, mRNA level of several enzymes involved in lipid metabolism, such as Fasn, Scd1, were 3- to 8-fold down-regulated together with genes involved in lipid synthesis, particularly Gpam, which catalyzes the initial and committing step in glycerolipid biosynthesis. In our previous study using an overrepresentation analysis procedure to detect coordinate changes in the expression of groups of functionally related genes or pathways, we showed that genes involved in lipid synthesis were increased in livers from diabetic ERKO animals compared with wild-type animals. We used the same approach to analyze the effects of estradiol on overall changes in gene expression in livers of ob/ob mice. Interestingly, GO categories involved in lipid metabolism, such as lipid biosynthesis (GO 0008610), lipid metabolism (GO 0006629), and fatty acid metabolism (GO 0006631), were significantly enriched for decreased genes in ob/ob mice after long-term estradiol treatment. In contrast, these GO categories were significantly enriched for increased genes in ERKO compared with wild-type mice (22). GO categories significantly enriched for increased genes in ob/ob mice upon estradiol treatment include pathways involved in steroid metabolism (GO 0008202) and acute-phase response (GO 0006953). Again, these GO categories were enriched for decreased genes in ERKO mice. Consistent with our findings in ERKO mice, the GO categories involved in glucose homeostasis such as gluconeogenesis (GO 0006094), glucose metabolism (GO 0006006) and glucose transport (GO 0015758) were not significantly enriched for changed genes in ob/ob mouse livers after long-term estradiol treatment.

The above findings in ob/ob mice support our previous observation in ERKO mice that reciprocal expression of Lepr and lipogenic genes may be one of the possible mechanisms behind hepatic insulin resistance. However, increased leptin signaling is probably not the only mechanism mediating down-regulation of lipogenic genes by estradiol treatment in ob/ob mouse liver. Importantly, these mice carry a mutated leptin variant that could not activate the leptin receptor, and evidence is lacking for a ligand-independent activity of Lepr.

Cytokine signaling protein genes such as Stat3 have been implicated in regulation of lipid synthesis in liver and in integration of signaling pathways involved in the metabolic syndrome, such as insulin resistance, dyslipidemia, and hepatic steatosis (19, 24). Thus, liver-specific deficiency of Stat3 leads to insulin resistance in mice, whereas activation of Stat3 signaling by expression of a constitutively active form of Stat3 in the liver ameliorates glucose intolerance and insulin resistance in db/db mice (19). The same study demonstrated an effect of changed Stat3 expression on Fasn mRNA levels (19). Interestingly, the expression of Stat3 was increased in ob/ob mice liver after estradiol treatment. In contrast, the expression of this gene was decreased in ERKO mice compared with wild type (data not shown). Known Stat3-regulated genes, such as Cebpd, Apcs, and Lbp, were also increased in ob/ob mouse livers after estradiol treatment. Importantly, we show that levels of Tyr 705 phosphorylated active Stat3 is induced in ob/ob mice after long-term estrogen treatment. These findings indicate that the activity of the Stat3 signaling pathway was increased in the ob/ob liver after long term estradiol treatment.

Stat3 is rapidly induced in mouse livers by estradiol indicating a direct regulation of Stat3 by the hormone. Transient transfection assays showed that estradiol regulation of the Stat3 mRNA was mediated by the mouse Stat3 promoter (positions –2166 to +60). Using computational methods to search for transcription factor binding site, we identified an SBE (TGCCTGGAA) and a CRE (TGACGTCA) between positions –336 and –313 from the transcription start site in the mouse Stat3 promoter with a 5-bp spacing between the motifs. These two motifs have been shown to be the major determinants in the 2.2-kb Stat3 promoter for Stat3 basal transcription level in liver cells (28). These two sites are conserved in the promoter region of the human Stat3 gene. It has been clearly demonstrated that besides binding to the classical estrogen response element, the ERE, on DNA, the activated ERs can interact with other DNA-bound transcription factors, to regulate the transcription of genes. This mechanism of ER action could occur via CRE and SBE sites, respectively (21). Using mutations of these response elements, we show that both elements are required for maximal estradiol activation for the Stat3 promoter. ChIP assays demonstrate binding of ER{alpha} to the part of the promoter including these DNA elements.

In conclusion, we demonstrate that estradiol treatment improves insulin sensitivity in ob/ob mice. We propose that this effect may be accounted for by improved hepatic insulin sensitivity due to decreased expression of hepatic lipogenic genes. Specifically, estrogens via ER{alpha} may regulate the hepatic expression of important cellular signaling molecules such as Lepr and Stat3, thereby modulating lipid metabolism in liver and exerting antidiabetic effects.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
To study effects of long-term estradiol treatment, 12-wk-old female ob/ob mice were obtained from the animal colony of the Karolinska Institute. All animals were fed standard rodent chow diet (Lactamin AB, Kimstad, Sweden) ad libitum and had free access to water. 17ß-Estradiol (100 µg/kg body weight) dissolved in 90% sesame oil/10% ethanol was administered by sc injection to ob/ob mice once daily for 30 d. Control animals received equal volume of solvent. The body weight of ob/ob-treated mice had a tendency to decrease with estradiol treatment vs. control. However, this decrease did not reach statistical significance. After treatment the mice were decapitated, blood was collected in heparinized tubes, centrifuged at 12,000 x g for 2 min, and plasma was stored at –20 C. Livers were removed and stored at –80 C.

To study effects of acute estradiol treatment on mRNA levels, 10-wk-old female C57BL/6 mice were ovariectomized. After recovery for 2 wk, the mice were injected sc with 100 µg/kg body weight of 17ß-estradiol or vehicle and euthanized 2 h or 4 h after injection. Livers were collected and stored at –80 C. The local ethical committees approved all animal experiments.

Intraperitoneal Glucose Tolerance Test (IPGTT) and Insulin Response
IPGTT and insulin response to glucose load was carried out in overnight fasted mice. Blood glucose and plasma insulin levels were measured at basal state (0 min) and then at 10, 30, 60, and 120 min after an ip injection of glucose (2 g/kg body weight) dissolved in saline. Blood glucose concentration was measured using MediSence glucose analyzer (Abbott Scandinavia AB, Solna, Sweden). Plasma insulin levels were measured by RIA with rat insulin as a standard.

Intraperitoneal Insulin Tolerance Test (IPITT)
IPITT was performed in overnight fasted mice by determining the rate of glucose disappearance from blood after an insulin challenge. For this purpose, the blood glucose concentration was measured at basal state and then the mice were injected with insulin (0.25 U/kg body weight, ip) diluted in saline. The blood glucose concentration was measured 10 min after insulin injection (0 min), which was followed by administration of glucose (1 g/kg body weight, ip). Blood glucose concentrations were determined at 15, 30, 60, 90, and 120 min after glucose injection.

RNA Preparation and Microarray Experiment
Frozen livers were homogenized and RNA purified using the TRIzol reagent (Invitrogen, Carlsbad, CA) followed by RNeasy Mini kits (QIAGEN, Valencia, CA). RNA quality was assayed using the Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA). Labeled cRNA was synthesized from total RNA according to the standard Affymetrix protocol, and 15 µg of cRNA were hybridized to Affymetrix Murine Genome 430 set A oligonucleotide microarrays (Affymetrix), washed and scanned. The gene expression technical manual can be downloaded from http://www.affymetrix.com/support/technical/manual/expression_manual.affx Total RNA from liver of individual mice, three in each group, was analyzed.

Bioinformatics
The scanned output files were analyzed with Microarray Suite version 5.0 software (MAS 5.0) (Affymetrix) and Bioconductor Package (www.bioconductor.org) for R. By using the statistical detection algorithm in Affymetrix MAS 5.0, the probe sets representing transcripts that are reliably detected (present call) were separated from the probe sets representing transcripts that could not be reliably detected (absent call). From the 22626 probe sets on the array, 9564 probe sets that give present call in all six chips for control and treatment mice were selected for the subsequent analysis.

To assess the change in gene expression between estradiol treatment and control treatment, the affyPLM package in Bioconductor was used to do a probe level test using information from all probe pairs for one probe set in the treatment group and control group. After fitting a probe level model to the data, the P value was calculated for each probe set for assessing the difference in expression level in treatment group and control group. The corrected P value for multiple tests was calculated using Benjamini and Hochberg method (29) in "multitest" package in Bioconductor.

Combining the analysis results from MAS 5.0 and Bioconductor, the genes giving present call in all chips and for which the P values for the probe level test were lower than 0.01, with a lower corrected P value (0.1), were selected as significant differently expressed genes. The cut off for the fold change was 2; the fold changes were transformed from the log ratio calculated by MAS 5.0. The fold changes presented in the tables are the average fold changes for each gene from all pair wise comparisons.

The overrepresentation analysis approach was used to test sets of related genes that might be systematically altered in ob/ob livers upon estradiol treatment. First, changed genes were selected according to the criteria above. High-Throughput GoMiner (30) was employed to find enrichment of changed genes involved in a particular function using all the priori defined GO categories (www.geneontology.org). Enrichment of changed genes, involved in a priori defined GO category, was determined by a one-sided Fisher’s exact test. Significantly changed GO categories with between 10 and 350 genes were reported to exclude very small and general pathways, respectively. The P value from one-sided Fisher’s exact test was reported, as well as the estimated false discovery rate (FDR) from multiple-comparison correction based on resampling technique.

Real-Time PCR Analysis
Total RNA were purified using the TRIzol reagent (Invitrogen) followed by RNeasy Mini kits (QIAGEN, Valencia, CA). Two micrograms of total RNA from each individual animal were reverse-transcribed into cDNA using superscript II (Invitrogen) with random hexamer primers. Expression levels of Fasn, Scd1, Gpam, Cebpd, Apcs, Lbp, Lepr, and Stat3 were quantified using the SYBR green real-time PCR reagent kit with normalization to Hprt (Applied Biosystems, Foster City, CA). Primers were designed with the Primer Express 3.0 software (Applied Biosystems), primer pairs reside in separate exons and have melting temperatures of 58–60 C. The sequences of the primers employed are as follows:

Fasn (forward, GGGTTCTAGCCAGCAGAGTC; reverse, TCAGCCACTTGAGTGTCCTC). Scd1 (forward, TGACCTGAAAGCCGAGAAGC; reverse, ATGAAGCACATCAGCAGGAGG). Gpam (forward, CAATGGCGTACTTCATGTGTTCA; reverse, GCACCTCTTATTCAGGACTGCAT). Cebpd (forward, GCCCAAAGTGCAGGCTTGT; reverse, CACCTGTCAGAGACCCTGAAGAA). Apcs (forward, CATACCCTGGGCCAAGCAT; reverse, TCTTGAGGTCTGTCTGACAAAAGG). Lbp (forward, TTTCAACACACGCAAGGTTACC; reverse, ATGCCGACTTTGGATTCGAT), Lepr (forward, TGAGCAGGCGTGCCATC; reverse, GTACCCGTCAGTTTCACATGATATATTG). Stat3 (forward, TGCAGTTTGGAAATAACGGTGAA; reverse, AGGTCAGATCCATGTCAAACGT). Hprt (forward, GCAGTACAGCCCCAAAATGG; reverse, AACAAAGTCTGGCCTGTATCCAA).

Real-time PCR assays were conducted using the Applied Biosystems 7500 fast real-time PCR system. The two-step amplification protocol consisted of a 2-min incubation step at 50 C, 10 min at 95 C, followed by target amplification via 40–50 cycles of 15 sec at 95 C and 1 min at 60 C. All real-time PCRs were performed in duplicate. Analysis of melting curves demonstrated amplification of one specific gene product for each primer pair. The real-time PCR data were analyzed by an assumption-free analysis method based on the absolute fluorescence as described by Ramakers et al. (31).

Measurement of Liver Triglycerides and Cholesterol
Hepatic lipids were extracted (32) and analyzed for cholesterol and triglycerides using CHOL kits and TG kits, respectively (Roche Applied Science, Indianapolis, IN).

Mass Spectrometry for Protein Identification
Analysis of in-gel digested proteins was carried out by MALDI-TOF/TOF mass spectrometry using an Ultraflex TOF/TOF mass spectrometer from Bruker Daltonik. In-gel digests were prepared essentially according to the method of Shevchenko (33) using sequencing grade modified trypsin (Promega, Madison, WI). The incubation with trypsin was carried out overnight at 37 C and at a protease concentration of 10 ng/µl. MALDI samples were prepared using the dried droplet technique according to reference (34) by using {alpha}-cyano-4-hydroxy-cinnamic acid (Agilent Technologies, Stockholm, Sweden) as a matrix. Data processing and database searches with the mass spectra were performed with the FlexAnalysis 2.2 software and the MS BioTools software version 2.3 from Bruker Daltonik. The acquired mass lists were further submitted to the mascot search engine (available on-line at http://www.matrixscience.com) that was used to search the NCBInr database (20051121). The search parameters allowed for oxidation of methionine, carbamidomethylation of cystein, one missed cleavage site with trypsin, and a mass accuracy of 10 ppm using the mammalian taxonomy filter. Mass spectra were internally calibrated using the autolysis products of trypsin with the monoisotopic masses (mass to charge ratio 842.51 and 2211.10).

Western Blot Analysis
Liver protein extracts were prepared by homogenizing and lysing tissue in RIPA buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate, 0.1 mg/ml phenylmethylsulfonyl fluoride] including 1x protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) and 1x Halt phosphatase inhibitor cocktail (Pierce Biotechnology, Rockford, IL). Total cell lysates were centrifuged at 12,000 x g for 10 min. Protein concentrations of extracts were determined using the protein assay dye reagent (Bio-Rad, Hercules, CA). Samples containing 20 µg or total protein were separated by electrophoresis through 6% or 8% polyacrylamide gels. Proteins were transferred to Hybond-C membranes (Amersham International, Buckinghamshire, UK). Membranes were probed using either phosphor-Stat3 (Tyr705), Stat3 (Cell Signaling Technology, Danvers, MA), Fasn (NB 400-114; Novus Biologicals, Littleton, CO) or ß-actin (AC-74; Sigma-Aldrich, Stockholm, Sweden) antibodies. Protein-antibody complexes were detected using an ECL chemiluminescence system (Amersham Biosciences, Buckinghamshire, UK). The bands were scanned and quantified by Scion image software (Scion Corp., Frederick, MD).

Site-Directed Mutagenesis
Mutations were introduced at the STAT-binding element (SBE) or the CRE of the mouse Stat3 promoter construct (p2166-Stat3-Luc, gift from Dr. Koichi Nakajima) using PCR mutagenesis according to the reference (28). The primers used for these mutations were as follows:

For mSTAT, just15'-ACGTCACGCACTGCCAGGTCCTCAGCTGAGTTTTCAGCAGG-3' and 5'-CCTGCTGAAAACTCAGCTGAGGACCTGGCAGTGCGTGACGT-3': for mCRE, 5'-GGCATTTAAAGTGTCTTGTCATCACGCACTGCCAGGAAC-3' and 5'-GTTCCTGGCAGTGCGTGATGACAAGACACTTTAAATGCC-3'. The underlined bases are targets for mutations. The DNA sequence of mutant constructs was determined by DNA sequencing.

Transient Transfection Assays
The Huh7 human hepatic carcinoma cells were cultured in DMEM (Invitrogen), supplemented with 10% fetal calf serum (FCS) (Invitrogen), 1 mM sodium pyruvate, and cells were maintained at 37 C containing 5% CO2. Hepa1–6 mouse hepatic carcinoma cells were cultured in DMEM, supplemented with 10% FCS, and cells were maintained at 37 C containing 5% CO2. For transient transfection experiments, cells were seeded in 12-well plates at a density of 1.5 x 105 cells per well in phenol red-free DMEM supplemented with 5% dextran-coated charcoal-treated FCS 24 h before transfection. The –2166/+61 mouse Stat3 promoter construct (p2166-Stat3-Luc) and empty pSP-Luc vector (both constructs are gifts from Dr. Koichi Nakajima) were transfected into Hepa1–6 cells or cotransfected into Huh7 cells with pSG5-mER{alpha} [described previously (35)] or empty pSG5 using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations. All reactions included ß-gal to normalize for transfection efficiency. After transfection, cells were treated with ligands as indicated for 24 h before luciferase (Biothema, Dalarö, Sweden) and ß-galactosidase (Tropix, Bedford, MA) assays were performed.

ChIP
Liver tissues were fixed in 1% formaldehyde for 15 min at room temperature and quenched for 5 min by adding glycine to a final concentration of 0.125 M. The tissue blocks were washed twice with PBS and disaggregated by homogenizing. Cells were harvested by centrifugation at 2000 x g for 5 min.

The cell pellets were suspended in 600 µl cell lysis buffer [50 mM Tris (pH 8.0); 1 mM EDTA; 0.5 mM EGTA; 1% Triton X-100; 0.1% Na-deoxycholate; 150 mM NaCl; protease inhibitor]. ChIP assays were performed essentially following the protocol described in Ref. 36 . Samples were immunoprecipitated with 2 µg ER{alpha} antibody MC-20 (Santa Cruz Biotechnology, Santa Cruz, CA) at 4 C overnight. "Mock" samples using 2 µg normal rabbit IgG (Santa Cruz Biotechnology) were included as controls. Precipitated DNA was amplified by PCR with primers 5'-GAGCCGTATCAGGGCATTTA-3' and 5'-GGGGGAGGGAGGAGACATTA-3' for the part of the mStat3 promoter containing the CRE and the SBE sites and primers 5'-CCATTGGGGGATTATCTTTG-3' and 5'-TGGTGTTTGTATTGCTGGTGA-3' for the –1600 region included as negative control.

Statistics
The results are expressed as mean ± SD or mean ± SEM. An unpaired Student’s t test was used to assess differences between 17ß-estradiol or vehicle-treated ob/ob mice. All statistical tests were performed with Microsoft Excel for windows XP. A value of P value < 0.05 was considered to be significant.


    ACKNOWLEDGMENTS
 
Mark Reimers and Jason Matthews are gratefully acknowledged for advice on Microarray data analysis and ChIP assays, respectively. We also would like to thank the Wallenberg Consortium North for supporting the Affymetrix core facility, Novum.


    FOOTNOTES
 
This work was supported by grants from the Protein Analysis Unit at the Center for Structural Biochemistry at the Karolinska Institutet, European Union Network of Excellence CASCADE, the Swedish Cancer Fund, KaroBio AB and Swedish Research Council (K2005-31X-00034-41A).

Disclosure Statement: H.G., G.B., E.H., A.K., S.E., and K.D.-W. have nothing to declare. J.-Å.G. is a consultant for and has equity interests in KaroBio AB and received lecture fees from Eli Lilly.

First Published Online April 20, 2006

1 H.G. and G.B. have contributed equally to this study. Back

Abbreviations: Apcs, Serum amyloid P-component; BERKO, ERß knockout; Cebpd, CCAAT/enhancer binding protein {delta}; ChIP, chromatin immunoprecipitation; CRE, cAMP-responsive element; ER, estrogen receptor; ERKO, ER{alpha} knockout; Fasn, fatty acid synthase; FCS, fetal calf serum; GO, gene ontology; Gpam, glycerol-3-phosphate acyltransferase; IPGTT, ip glucose tolerance test; IPITT, ip insulin tolerance test; Lbp, lipopolysaccharide binding protein; Lepr, leptin receptor; SBE, STAT binding element; Scd1, stearoyl-coenzyme A desaturase 1; STAT, signal transducer and activator of transcription.

Received for publication January 9, 2006. Accepted for publication April 13, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. King H, Aubert RE, Herman WH 1998 Global burden of diabetes, 1995–2025: prevalence, numerical estimates, and projections. Diabetes Care 21:1414–1431[Abstract]
  2. Gibson F, Froguel P 21 April 2005 Diabetes susceptibility genes, part 1: The search for genes. http://genome.wellcome.ac.uk/doc_wtd020840.html
  3. McGarry JD 2002 Banting Lecture 2001: Dysregulation of fatty acid metabolism in the etiology of type 2 diabetes. Diabetes 51:7–18[Free Full Text]
  4. Louet JF, LeMay C, Mauvais-Jarvis F 2004 Antidiabetic actions of estrogen: insight from human and genetic mouse models. Curr Atheroscler Rep 6:180–185[Medline]
  5. Bonds DE, Lasser N, Qi L, Brzyski R, Caan B, Heiss G, Limacher MC, Liu JH, Mason E, Oberman A, O’Sullivan MJ, Phillips LS, Prineas RJ, Tinker L 2006 The effect of conjugated equine oestrogen on diabetes incidence: the Women’s Health Initiative randomised trial. Diabetologia 49:459–468[CrossRef][Medline]
  6. Espeland MA, Hogan PE, Fineberg SE, Howard G, Schrott H, Waclawiw MA, Bush TL 1998 Effect of postmenopausal hormone therapy on glucose and insulin concentrations. PEPI Investigators. Postmenopausal estrogen/progestin interventions. Diabetes Care 21:1589–1595[Abstract]
  7. Crespo CJ, Smit E, Snelling A, Sempos CT, Andersen RE 2002 Hormone replacement therapy and its relationship to lipid and glucose metabolism in diabetic and nondiabetic postmenopausal women: results from the Third National Health and Nutrition Examination Survey (NHANES III). Diabetes Care 25:1675–1680[Abstract/Free Full Text]
  8. Saglam K, Polat Z, Yilmaz MI, Gulec M, Akinci SB 2002 Effects of postmenopausal hormone replacement therapy on insulin resistance. Endocrine 18:211–214[CrossRef][Medline]
  9. Kanaya AM, Herrington D, Vittinghoff E, Lin F, Grady D, Bittner V, Cauley JA, Barrett-Connor E; Heart and Estrogen/Progestin Replacement Study 2003 Glycemic effects of postmenopausal hormone therapy: the Heart and Estrogen/Progestin Replacement Study. A randomized, double-blind, placebo-controlled trial. Ann Intern Med 138:1–9[Abstract/Free Full Text]
  10. Jones ME, Thorburn AW, Britt KL, Hewitt KN, Wreford NG, Proietto J, Oz OK, Leury BJ, Robertson KM, Yao S, Simpson ER 2000 Aromatase-deficient (ArKO) mice have a phenotype of increased adiposity. Proc Natl Acad Sci USA 97:12735–12740[Abstract/Free Full Text]
  11. Heine PA, Taylor JA, Iwamoto GA, Lubahn DB, Cooke PS 2000 Increased adipose tissue in male and female estrogen receptor-{alpha} knockout mice. Proc Natl Acad Sci USA 97:12729–12734[Abstract/Free Full Text]
  12. Postic C, Dentin R, Girard J 2004 Role of the liver in the control of carbohydrate and lipid homeostasis. Diabetes Metab 30:398–408[Medline]
  13. Duncan AC, Lyall H, Roberts RN, Petrie JR, Perera MJ, Monaghan S, Hart DM, Connell JM, Lumsden MA 1999 The effect of estradiol and a combined estradiol/progestagen preparation on insulin sensitivity in healthy postmenopausal women. J Clin Endocrinol Metab 84:2402–2407[Abstract/Free Full Text]
  14. O’Sullivan AJ, Ho KK 1995 A comparison of the effects of oral and transdermal estrogen replacement on insulin sensitivity in postmenopausal women. J Clin Endocrinol Metab 80:1783–1788[Abstract]
  15. Vehkavaara S, Westerbacka J, Hakala-Ala-Pietila T, Virkamaki A, Hovatta O, Yki-Jarvinen H 2000 Effect of estrogen replacement therapy on insulin sensitivity of glucose metabolism and preresistance and resistance vessel function in healthy postmenopausal women. J Clin Endocrinol Metab 85:4663–4670[Abstract/Free Full Text]
  16. Nemoto Y, Toda K, Ono M, Fujikawa-Adachi K, Saibara T, Onishi S, Enzan H, Okada T, Shizuta Y 2000 Altered expression of fatty acid-metabolizing enzymes in aromatase-deficient mice. J Clin Invest 105:1819–1825[Medline]
  17. Schinner S, Scherbaum WA, Bornstein SR, Barthel 2005 A Molecular mechanisms of insulin resistance. Diabet Med 22:674–682[Medline]
  18. Wolf G 2004 Tissue-specific knockout defines peroxisome proliferator-activated receptor {gamma} function in muscle and liver. Nutr Rev 62:253–255[CrossRef][Medline]
  19. Inoue H, Ogawa W, Ozaki M, Haga S, Matsumoto M, Furukawa K, Hashimoto N, Kido Y, Mori T, Sakaue H, Teshigawara K, Jin S, Iguchi H, Hiramatsu R, LeRoith D, Takeda K, Akira S, Kasuga M 2004 Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nat Med 10:168–174[CrossRef][Medline]
  20. Nelson LR, Bulun SE 2001 Estrogen production and action. J Am Acad Dermatol 45:S116–S124
  21. Bjornstrom L, Sjoberg M 2005 Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19:833–842[Abstract/Free Full Text]
  22. Bryzgalova G, Gao H, Ahren B, Zierath JR, Galuska D, Steiler TL, Dahlman-Wright K, Nilsson S, Gustafsson JA, Efendic S, Khan A 2006 Evidence that estrogen receptor {alpha} plays an important role in the regulation of glucose homeostasis in mice: insulin sensitivity in the liver. Diabetologia 49:588–597[CrossRef][Medline]
  23. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–332[CrossRef][Medline]
  24. Ueki K, Kondo T, Tseng YH, Kahn CR 2004 Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad Sci USA 101:10422–10427[Abstract/Free Full Text]
  25. Ramji DP, Vitelli A, Tronche F, Cortese R, Ciliberto G 1993 The two C/EBP isoforms, IL-6DBP/NF-IL6 and C/EBP {delta}/NF-IL6 ß, are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res 21:289–294[Abstract/Free Full Text]
  26. Kirschning C, Unbehaun A, Lamping N, Pfeil D, Herrmann F, Schumann RR 1997 Control of transcriptional activation of the lipopolysaccharide binding protein (LBP) gene by proinflammatory cytokines. Cytokines Cell Mol Ther 3:59–62[Medline]
  27. Samuel VT, Liu ZX, Qu X, Elder BD, Bilz S, Befroy D, Romanelli AJ, Shulman GI 2004 Mechanism of hepatic insulin resistance in non-alcoholic fatty liver disease. J Biol Chem 279:32345–32353[Abstract/Free Full Text]
  28. Ichiba M, Nakajima K, Yamanaka Y, Kiuchi N, Hirano T 1998 Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element-binding protein. J Biol Chem 273:6132–6138[Abstract/Free Full Text]
  29. Benjamini Y, Hochberg Y 1995 Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B 57:289–300
  30. Zeeberg BR, Qin H, Narasimhan S, Sunshine M, Cao H, Kane DW, Reimers M, Stephens RM, Bryant D, Burt SK, Elnekave E, Hari DM, Wynn TA, Cunningham-Rundles C, Stewart DM, Nelson D, Weinstein JN 2005 High-Throughput GoMiner, an ‘industrial-strength’ integrative gene ontology tool for interpretation of multiple-microarray experiments, with application to studies of common variable immune deficiency (CVID). BMC Bioinformatics 6:168[CrossRef][Medline]
  31. Ramakers C, Ruijter JM, Deprez RH, Moorman AF 2003 Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339:62–66[CrossRef][Medline]
  32. Folch J, Lees M, Sloane Stanley GH 1957 A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509[Free Full Text]
  33. Shevchenko A, Wilm M, Vorm O, Mann M 1996 Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68:850–858[Medline]
  34. Kussmann M, Roepstorff P 2000 Sample preparation techniques for peptides and proteins analyzed by MALDI-MS. Methods Mol Biol 146:405–424[Medline]
  35. Otsuki M, Gao H, Dahlman-Wright K, Ohlsson C, Eguchi N, Urade Y, Gustafsson JA 2003 Specific regulation of lipocalin-type prostaglandin D synthase in mouse heart by estrogen receptor ß. Mol Endocrinol 17:1844–1855[Abstract/Free Full Text]
  36. Matthews J, Wihlen B, Thomsen J, Gustafsson JA 2005 Aryl hydrocarbon receptor-mediated transcription: ligand-dependent recruitment of estrogen receptor {alpha} to 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive promoters. Mol Cell Biol 25:5317–5328[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα
Ligands:   17β-Estradiol



This article has been cited by other articles:


Home page
J EndocrinolHome page
R. Singhal, K. Shankar, T. M Badger, and M. J Ronis
Hepatic gene expression following consumption of soy protein isolate in female Sprague-Dawley rats differs from that produced by 17{beta}-estradiol treatment
J. Endocrinol., July 1, 2009; 202(1): 141 - 152.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Riant, A. Waget, H. Cogo, J.-F. Arnal, R. Burcelin, and P. Gourdy
Estrogens Protect against High-Fat Diet-Induced Insulin Resistance and Glucose Intolerance in Mice
Endocrinology, May 1, 2009; 150(5): 2109 - 2117.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. H. Rogers, J. W. Perfield II, K. J. Strissel, M. S. Obin, and A. S. Greenberg
Reduced Energy Expenditure and Increased Inflammation Are Early Events in the Development of Ovariectomy-Induced Obesity
Endocrinology, May 1, 2009; 150(5): 2161 - 2168.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L Lundholm, G Bryzgalova, H Gao, N Portwood, S Falt, K D Berndt, A Dicker, D Galuska, J R Zierath, J-A Gustafsson, et al.
The estrogen receptor {alpha}-selective agonist propyl pyrazole triol improves glucose tolerance in ob/ob mice; potential molecular mechanisms
J. Endocrinol., November 1, 2008; 199(2): 275 - 286.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. Bryzgalova, L. Lundholm, N. Portwood, J.-A. Gustafsson, A. Khan, S. Efendic, and K. Dahlman-Wright
Mechanisms of antidiabetogenic and body weight-lowering effects of estrogen in high-fat diet-fed mice
Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E904 - E912.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Gao, S. Falt, A. Sandelin, J.-A. Gustafsson, and K. Dahlman-Wright
Genome-Wide Identification of Estrogen Receptor {alpha}-Binding Sites in Mouse Liver
Mol. Endocrinol., January 1, 2008; 22(1): 10 - 22.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Wang, W. Zhang, P. Crisostomo, T. Markel, K. K. Meldrum, X. Y. Fu, and D. R. Meldrum
Sex differences in endothelial STAT3 mediate sex differences in myocardial inflammation
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E872 - E877.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Table
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, H.
Right arrow Articles by Dahlman-Wright, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, H.
Right arrow Articles by Dahlman-Wright, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals