| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biosciences and Nutrition (H.G., E.H., J.-Å.G., K.D.-W.), Karolinska Institutet, S-141 57 Huddinge, Sweden; and Department of Molecular Medicine and Surgery (G.B., A.K., S.E.), Karolinska Hospital, Karolinska Institutet, S-171 76 Stockholm, Sweden
Address all correspondence and requests for reprints to: Hui Gao, Department of Biosciences and Nutrition, Karolinska Institutet, Novum, S-14157 Huddinge, Sweden. E-mail: hui.gao{at}biosci.ki.se.
| ABSTRACT |
|---|
|
|
|---|
to the promoter of Stat3 in vivo, suggests that Stat3 is a direct target gene for estradiol. In conclusion, estradiol treatment improves glucose tolerance and insulin sensitivity in ob/ob mice. We propose that this may be mediated, at least partially, via estrogen stimulation of the hepatic expression of Stat3, leading to decreased expression of hepatic lipogenic genes, and thereby to antidiabetic effects. | INTRODUCTION |
|---|
|
|
|---|
Studies in humans and rodents link the endogenous estrogen hormone to the maintenance of glucose homeostasis (4). Thus, postmenopausal therapy with estrogen may reduce the incidence of type 2 diabetes (5). Treatment of healthy postmenopausal women with unopposed estradiol or conjugated equine estrogen has been shown to improve insulin sensitivity and to lower blood glucose (6, 7, 8). Furthermore, a randomized, double-blind, placebo-controlled trial has shown that hormone replacement therapy in postmenopausal women with coronary heart disease results in a 35% reduction in the incidence of diabetes at the 4-yr follow up (9). Estrogen also displays antidiabetic properties in several spontaneous rodent models of type 2 diabetes mellitus, such as db/db mice and Zucker diabetic fatty rats, in which male rodents develop hyperglycemia, whereas female rodents are protected (4). Aromatase-knockout mice that cannot synthesize endogenous estrogens develop insulin resistance (10). Studies of estrogen receptor (ER)
knockout (ERKO) mice and ERß knockout (BERKO) mice have demonstrated that ER
, but not ERß gene depletion, results in increased body weight, glucose intolerance, and insulin resistance (11).
The key role of the liver in controlling both carbohydrate and lipid homeostasis in vivo has been confirmed by transgenic and knockout models; see review (12). In healthy postmenopausal women, three short-term studies using the clamp technique have failed to demonstrate an effect of unopposed estradiol or conjugated equine estrogen on muscle insulin sensitivity (13, 14, 15), suggesting that the observed improvement in hyperinsulinemia in female results from an effect on the liver. The phenotype of the aromatase-knockout mouse has demonstrated the pivotal role of estrogen in supporting constitutive hepatic expression of genes involved in lipid-ß oxidation and in maintaining hepatic lipid homeostasis (10, 16). Many liver expressed genes have been found to play important roles in controlling carbohydrate and lipid homeostasis. These genes are mainly involved in insulin signaling pathways (17), lipid and fatty acid metabolism, and glucose metabolism (12, 18), as well as cytokine signaling pathways (19). Alterations in the expression of these genes could lead to development of hepatic insulin resistance or type 2 diabetes.
Diverse biological effects induced by estrogens are mediated via a direct interaction of estrogens with ERs that activate the expression of ER target genes. Besides binding to the classical estrogen response element (ERE) on DNA, the activated ERs can regulate gene expression through DNA sequences that are primary targets for other transcription factors such as cAMP-responsive elements (CREs) and signal transducers and activators of transcription (STATs) binding elements (SBEs). In this case, ERs are thought to bind to DNA bound activating protein-1 and STATs, respectively (20, 21).
We have previously shown that insulin resistance in ERKO mice is mainly localized to the liver and suggested that it results from up-regulation of lipogenic genes via suppression of leptin signaling, after down-regulation of leptin receptor (Lepr) expression in liver (22). To further explore this hypothesis, we treated ob/ob mice with estradiol and found markedly improved insulin sensitivity. Because the leptin gene is mutated in these mice (23) and they have low expression of the Lepr, it is likely that there are also additional mechanisms underlying the antidiabetic effect of estrogen. The present study suggests that one such mechanism could be via enhanced expression of Stat3. This transcription factor, which requires phosphorylation at a tyrosine at residue 705 for activity, has been suggested to play an important role in the regulation of lipid synthesis in liver and to integrate the pathways that are dysregulated in the metabolic syndrome, such as insulin resistance, dyslipidemia, and hepatic steatosis (19, 24).
| RESULTS |
|---|
|
|
|---|
|
Insulin Sensitivity Is Improved in ob/ob Mice in Response to Estrogen Administration
In estradiol-treated animals, the basal blood glucose concentration was, as expected, significantly lower compared with untreated mice (Fig. 1C
). After insulin and glucose challenge a peak in blood glucose level was attained at 15 min and then slowly decreased. However, blood glucose concentration remained higher in control mice compared with estradiol-treated mice throughout the experiment. Thus, estradiol treatment significantly improved insulin sensitivity in ob/ob mice.
Expression of Genes Involved in Lipid Synthesis Is Decreased in Livers of ob/ob Mice upon Estradiol Treatment
To identify estrogen-regulated signaling networks in mouse liver, we analyzed gene expression profiles from ob/ob mouse liver treated with estradiol and vehicle, respectively, for 4 wk using the Affymetrix (Santa Clara, CA) oligonucleotide microarrays. Changed genes were identified in ob/ob mouse livers after long-term estradiol treatment compared with control as described in Materials and Methods. The complete list of regulated genes is published as a supplemental table on The Endocrine Societys Journals Online web site at http://mend.endojournals.org.
To obtain a better understanding of overall changes in gene expression, we used an overrepresentation analysis procedure to detect coordinate changes in the expression of groups of functionally related genes or pathways in livers of ob/ob mice after long-term estradiol treatment. The ten pathways most significantly enriched for increased or decreased genes are displayed in Table 1
. This analysis revealed that gene ontology (GO) categories involved in lipid metabolism, such as lipid biosynthesis (GO 0008610), lipid metabolism (GO 0006629), and fatty acid metabolism (GO 0006631), were significantly enriched for decreased genes in ob/ob mice after long-term estradiol treatment. GO categories involved in steroid metabolism (GO 0008202) and acute-phase response (GO 0006953) were significantly enriched for increased genes in ob/ob mice treated with estradiol. GO categories involved in glucose metabolism such as gluconeogenesis (GO 0006094), glucose metabolism (GO 0006006), and glucose transport (GO 0015758) were not significantly enriched for changed genes in ob/ob mouse livers after estradiol treatment.
|
|
|
|
|
Real-time PCR confirmed estrogen stimulation of Stat3 expression in livers of ob/ob mice (Fig. 5A
). Figure 5
, B and C, demonstrates induction of Stat3 protein and phosphorylated Stat3 protein in livers from ob/ob mice treated with estradiol compared with vehicle alone.
|
(Cebpd) (25), serum amyloid P-component (Apcs), lipopolysaccharide binding protein (Lbp) (26), were also increased in ob/ob mouse livers after estradiol treatment (Table 3
|
Stat3 Is a Direct Estrogen Target Gene
We used a transient transfection assay to determine whether the mouse Stat3 promoter (positions 2166 to +60) mediates estradiol regulation of the Stat3 mRNA. Figure 6
shows that estrogen treatment of cells cotransfected with ER
increases reporter gene activity. Huh-7 cells, which have low levels of endogenous ERs, were used for these experiments. This allowed testing of the requirement of ER
for the observed effect.
|
to the region that contains the CRE and the SBE in vivo in the context of intact liver chromatin. Figure 8A
-specific recruitment to the region that contains the CRE and SBE sites. Recruitment of ER
was not observed to an upstream region that do not contain any known ER binding sites (Fig. 8A
with the fragment containing the CRE and SBE sites and the fragment that does not contain any known ER binding sites, respectively, is quantified by assaying bound DNA using real-time PCR.
|
|
| DISCUSSION |
|---|
|
|
|---|
Specifically, we have shown that 30 d treatment with estradiol in ob/ob mice increased Lepr expression level and decreased expression of genes involved in fatty acid synthesis in liver. Thus, mRNA level of several enzymes involved in lipid metabolism, such as Fasn, Scd1, were 3- to 8-fold down-regulated together with genes involved in lipid synthesis, particularly Gpam, which catalyzes the initial and committing step in glycerolipid biosynthesis. In our previous study using an overrepresentation analysis procedure to detect coordinate changes in the expression of groups of functionally related genes or pathways, we showed that genes involved in lipid synthesis were increased in livers from diabetic ERKO animals compared with wild-type animals. We used the same approach to analyze the effects of estradiol on overall changes in gene expression in livers of ob/ob mice. Interestingly, GO categories involved in lipid metabolism, such as lipid biosynthesis (GO 0008610), lipid metabolism (GO 0006629), and fatty acid metabolism (GO 0006631), were significantly enriched for decreased genes in ob/ob mice after long-term estradiol treatment. In contrast, these GO categories were significantly enriched for increased genes in ERKO compared with wild-type mice (22). GO categories significantly enriched for increased genes in ob/ob mice upon estradiol treatment include pathways involved in steroid metabolism (GO 0008202) and acute-phase response (GO 0006953). Again, these GO categories were enriched for decreased genes in ERKO mice. Consistent with our findings in ERKO mice, the GO categories involved in glucose homeostasis such as gluconeogenesis (GO 0006094), glucose metabolism (GO 0006006) and glucose transport (GO 0015758) were not significantly enriched for changed genes in ob/ob mouse livers after long-term estradiol treatment.
The above findings in ob/ob mice support our previous observation in ERKO mice that reciprocal expression of Lepr and lipogenic genes may be one of the possible mechanisms behind hepatic insulin resistance. However, increased leptin signaling is probably not the only mechanism mediating down-regulation of lipogenic genes by estradiol treatment in ob/ob mouse liver. Importantly, these mice carry a mutated leptin variant that could not activate the leptin receptor, and evidence is lacking for a ligand-independent activity of Lepr.
Cytokine signaling protein genes such as Stat3 have been implicated in regulation of lipid synthesis in liver and in integration of signaling pathways involved in the metabolic syndrome, such as insulin resistance, dyslipidemia, and hepatic steatosis (19, 24). Thus, liver-specific deficiency of Stat3 leads to insulin resistance in mice, whereas activation of Stat3 signaling by expression of a constitutively active form of Stat3 in the liver ameliorates glucose intolerance and insulin resistance in db/db mice (19). The same study demonstrated an effect of changed Stat3 expression on Fasn mRNA levels (19). Interestingly, the expression of Stat3 was increased in ob/ob mice liver after estradiol treatment. In contrast, the expression of this gene was decreased in ERKO mice compared with wild type (data not shown). Known Stat3-regulated genes, such as Cebpd, Apcs, and Lbp, were also increased in ob/ob mouse livers after estradiol treatment. Importantly, we show that levels of Tyr 705 phosphorylated active Stat3 is induced in ob/ob mice after long-term estrogen treatment. These findings indicate that the activity of the Stat3 signaling pathway was increased in the ob/ob liver after long term estradiol treatment.
Stat3 is rapidly induced in mouse livers by estradiol indicating a direct regulation of Stat3 by the hormone. Transient transfection assays showed that estradiol regulation of the Stat3 mRNA was mediated by the mouse Stat3 promoter (positions 2166 to +60). Using computational methods to search for transcription factor binding site, we identified an SBE (TGCCTGGAA) and a CRE (TGACGTCA) between positions 336 and 313 from the transcription start site in the mouse Stat3 promoter with a 5-bp spacing between the motifs. These two motifs have been shown to be the major determinants in the 2.2-kb Stat3 promoter for Stat3 basal transcription level in liver cells (28). These two sites are conserved in the promoter region of the human Stat3 gene. It has been clearly demonstrated that besides binding to the classical estrogen response element, the ERE, on DNA, the activated ERs can interact with other DNA-bound transcription factors, to regulate the transcription of genes. This mechanism of ER action could occur via CRE and SBE sites, respectively (21). Using mutations of these response elements, we show that both elements are required for maximal estradiol activation for the Stat3 promoter. ChIP assays demonstrate binding of ER
to the part of the promoter including these DNA elements.
In conclusion, we demonstrate that estradiol treatment improves insulin sensitivity in ob/ob mice. We propose that this effect may be accounted for by improved hepatic insulin sensitivity due to decreased expression of hepatic lipogenic genes. Specifically, estrogens via ER
may regulate the hepatic expression of important cellular signaling molecules such as Lepr and Stat3, thereby modulating lipid metabolism in liver and exerting antidiabetic effects.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To study effects of acute estradiol treatment on mRNA levels, 10-wk-old female C57BL/6 mice were ovariectomized. After recovery for 2 wk, the mice were injected sc with 100 µg/kg body weight of 17ß-estradiol or vehicle and euthanized 2 h or 4 h after injection. Livers were collected and stored at 80 C. The local ethical committees approved all animal experiments.
Intraperitoneal Glucose Tolerance Test (IPGTT) and Insulin Response
IPGTT and insulin response to glucose load was carried out in overnight fasted mice. Blood glucose and plasma insulin levels were measured at basal state (0 min) and then at 10, 30, 60, and 120 min after an ip injection of glucose (2 g/kg body weight) dissolved in saline. Blood glucose concentration was measured using MediSence glucose analyzer (Abbott Scandinavia AB, Solna, Sweden). Plasma insulin levels were measured by RIA with rat insulin as a standard.
Intraperitoneal Insulin Tolerance Test (IPITT)
IPITT was performed in overnight fasted mice by determining the rate of glucose disappearance from blood after an insulin challenge. For this purpose, the blood glucose concentration was measured at basal state and then the mice were injected with insulin (0.25 U/kg body weight, ip) diluted in saline. The blood glucose concentration was measured 10 min after insulin injection (0 min), which was followed by administration of glucose (1 g/kg body weight, ip). Blood glucose concentrations were determined at 15, 30, 60, 90, and 120 min after glucose injection.
RNA Preparation and Microarray Experiment
Frozen livers were homogenized and RNA purified using the TRIzol reagent (Invitrogen, Carlsbad, CA) followed by RNeasy Mini kits (QIAGEN, Valencia, CA). RNA quality was assayed using the Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA). Labeled cRNA was synthesized from total RNA according to the standard Affymetrix protocol, and 15 µg of cRNA were hybridized to Affymetrix Murine Genome 430 set A oligonucleotide microarrays (Affymetrix), washed and scanned. The gene expression technical manual can be downloaded from http://www.affymetrix.com/support/technical/manual/expression_manual.affx Total RNA from liver of individual mice, three in each group, was analyzed.
Bioinformatics
The scanned output files were analyzed with Microarray Suite version 5.0 software (MAS 5.0) (Affymetrix) and Bioconductor Package (www.bioconductor.org) for R. By using the statistical detection algorithm in Affymetrix MAS 5.0, the probe sets representing transcripts that are reliably detected (present call) were separated from the probe sets representing transcripts that could not be reliably detected (absent call). From the 22626 probe sets on the array, 9564 probe sets that give present call in all six chips for control and treatment mice were selected for the subsequent analysis.
To assess the change in gene expression between estradiol treatment and control treatment, the affyPLM package in Bioconductor was used to do a probe level test using information from all probe pairs for one probe set in the treatment group and control group. After fitting a probe level model to the data, the P value was calculated for each probe set for assessing the difference in expression level in treatment group and control group. The corrected P value for multiple tests was calculated using Benjamini and Hochberg method (29) in "multitest" package in Bioconductor.
Combining the analysis results from MAS 5.0 and Bioconductor, the genes giving present call in all chips and for which the P values for the probe level test were lower than 0.01, with a lower corrected P value (0.1), were selected as significant differently expressed genes. The cut off for the fold change was 2; the fold changes were transformed from the log ratio calculated by MAS 5.0. The fold changes presented in the tables are the average fold changes for each gene from all pair wise comparisons.
The overrepresentation analysis approach was used to test sets of related genes that might be systematically altered in ob/ob livers upon estradiol treatment. First, changed genes were selected according to the criteria above. High-Throughput GoMiner (30) was employed to find enrichment of changed genes involved in a particular function using all the priori defined GO categories (www.geneontology.org). Enrichment of changed genes, involved in a priori defined GO category, was determined by a one-sided Fishers exact test. Significantly changed GO categories with between 10 and 350 genes were reported to exclude very small and general pathways, respectively. The P value from one-sided Fishers exact test was reported, as well as the estimated false discovery rate (FDR) from multiple-comparison correction based on resampling technique.
Real-Time PCR Analysis
Total RNA were purified using the TRIzol reagent (Invitrogen) followed by RNeasy Mini kits (QIAGEN, Valencia, CA). Two micrograms of total RNA from each individual animal were reverse-transcribed into cDNA using superscript II (Invitrogen) with random hexamer primers. Expression levels of Fasn, Scd1, Gpam, Cebpd, Apcs, Lbp, Lepr, and Stat3 were quantified using the SYBR green real-time PCR reagent kit with normalization to Hprt (Applied Biosystems, Foster City, CA). Primers were designed with the Primer Express 3.0 software (Applied Biosystems), primer pairs reside in separate exons and have melting temperatures of 5860 C. The sequences of the primers employed are as follows:
Fasn (forward, GGGTTCTAGCCAGCAGAGTC; reverse, TCAGCCACTTGAGTGTCCTC). Scd1 (forward, TGACCTGAAAGCCGAGAAGC; reverse, ATGAAGCACATCAGCAGGAGG). Gpam (forward, CAATGGCGTACTTCATGTGTTCA; reverse, GCACCTCTTATTCAGGACTGCAT). Cebpd (forward, GCCCAAAGTGCAGGCTTGT; reverse, CACCTGTCAGAGACCCTGAAGAA). Apcs (forward, CATACCCTGGGCCAAGCAT; reverse, TCTTGAGGTCTGTCTGACAAAAGG). Lbp (forward, TTTCAACACACGCAAGGTTACC; reverse, ATGCCGACTTTGGATTCGAT), Lepr (forward, TGAGCAGGCGTGCCATC; reverse, GTACCCGTCAGTTTCACATGATATATTG). Stat3 (forward, TGCAGTTTGGAAATAACGGTGAA; reverse, AGGTCAGATCCATGTCAAACGT). Hprt (forward, GCAGTACAGCCCCAAAATGG; reverse, AACAAAGTCTGGCCTGTATCCAA).
Real-time PCR assays were conducted using the Applied Biosystems 7500 fast real-time PCR system. The two-step amplification protocol consisted of a 2-min incubation step at 50 C, 10 min at 95 C, followed by target amplification via 4050 cycles of 15 sec at 95 C and 1 min at 60 C. All real-time PCRs were performed in duplicate. Analysis of melting curves demonstrated amplification of one specific gene product for each primer pair. The real-time PCR data were analyzed by an assumption-free analysis method based on the absolute fluorescence as described by Ramakers et al. (31).
Measurement of Liver Triglycerides and Cholesterol
Hepatic lipids were extracted (32) and analyzed for cholesterol and triglycerides using CHOL kits and TG kits, respectively (Roche Applied Science, Indianapolis, IN).
Mass Spectrometry for Protein Identification
Analysis of in-gel digested proteins was carried out by MALDI-TOF/TOF mass spectrometry using an Ultraflex TOF/TOF mass spectrometer from Bruker Daltonik. In-gel digests were prepared essentially according to the method of Shevchenko (33) using sequencing grade modified trypsin (Promega, Madison, WI). The incubation with trypsin was carried out overnight at 37 C and at a protease concentration of 10 ng/µl. MALDI samples were prepared using the dried droplet technique according to reference (34) by using
-cyano-4-hydroxy-cinnamic acid (Agilent Technologies, Stockholm, Sweden) as a matrix. Data processing and database searches with the mass spectra were performed with the FlexAnalysis 2.2 software and the MS BioTools software version 2.3 from Bruker Daltonik. The acquired mass lists were further submitted to the mascot search engine (available on-line at http://www.matrixscience.com) that was used to search the NCBInr database (20051121). The search parameters allowed for oxidation of methionine, carbamidomethylation of cystein, one missed cleavage site with trypsin, and a mass accuracy of 10 ppm using the mammalian taxonomy filter. Mass spectra were internally calibrated using the autolysis products of trypsin with the monoisotopic masses (mass to charge ratio 842.51 and 2211.10).
Western Blot Analysis
Liver protein extracts were prepared by homogenizing and lysing tissue in RIPA buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate, 0.1 mg/ml phenylmethylsulfonyl fluoride] including 1x protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) and 1x Halt phosphatase inhibitor cocktail (Pierce Biotechnology, Rockford, IL). Total cell lysates were centrifuged at 12,000 x g for 10 min. Protein concentrations of extracts were determined using the protein assay dye reagent (Bio-Rad, Hercules, CA). Samples containing 20 µg or total protein were separated by electrophoresis through 6% or 8% polyacrylamide gels. Proteins were transferred to Hybond-C membranes (Amersham International, Buckinghamshire, UK). Membranes were probed using either phosphor-Stat3 (Tyr705), Stat3 (Cell Signaling Technology, Danvers, MA), Fasn (NB 400-114; Novus Biologicals, Littleton, CO) or ß-actin (AC-74; Sigma-Aldrich, Stockholm, Sweden) antibodies. Protein-antibody complexes were detected using an ECL chemiluminescence system (Amersham Biosciences, Buckinghamshire, UK). The bands were scanned and quantified by Scion image software (Scion Corp., Frederick, MD).
Site-Directed Mutagenesis
Mutations were introduced at the STAT-binding element (SBE) or the CRE of the mouse Stat3 promoter construct (p2166-Stat3-Luc, gift from Dr. Koichi Nakajima) using PCR mutagenesis according to the reference (28). The primers used for these mutations were as follows:
For mSTAT, just15'-ACGTCACGCACTGCCAGGTCCTCAGCTGAGTTTTCAGCAGG-3' and 5'-CCTGCTGAAAACTCAGCTGAGGACCTGGCAGTGCGTGACGT-3': for mCRE, 5'-GGCATTTAAAGTGTCTTGTCATCACGCACTGCCAGGAAC-3' and 5'-GTTCCTGGCAGTGCGTGATGACAAGACACTTTAAATGCC-3'. The underlined bases are targets for mutations. The DNA sequence of mutant constructs was determined by DNA sequencing.
Transient Transfection Assays
The Huh7 human hepatic carcinoma cells were cultured in DMEM (Invitrogen), supplemented with 10% fetal calf serum (FCS) (Invitrogen), 1 mM sodium pyruvate, and cells were maintained at 37 C containing 5% CO2. Hepa16 mouse hepatic carcinoma cells were cultured in DMEM, supplemented with 10% FCS, and cells were maintained at 37 C containing 5% CO2. For transient transfection experiments, cells were seeded in 12-well plates at a density of 1.5 x 105 cells per well in phenol red-free DMEM supplemented with 5% dextran-coated charcoal-treated FCS 24 h before transfection. The 2166/+61 mouse Stat3 promoter construct (p2166-Stat3-Luc) and empty pSP-Luc vector (both constructs are gifts from Dr. Koichi Nakajima) were transfected into Hepa16 cells or cotransfected into Huh7 cells with pSG5-mER
[described previously (35)] or empty pSG5 using Lipofectamine 2000 (Invitrogen) according to the manufacturers recommendations. All reactions included ß-gal to normalize for transfection efficiency. After transfection, cells were treated with ligands as indicated for 24 h before luciferase (Biothema, Dalarö, Sweden) and ß-galactosidase (Tropix, Bedford, MA) assays were performed.
ChIP
Liver tissues were fixed in 1% formaldehyde for 15 min at room temperature and quenched for 5 min by adding glycine to a final concentration of 0.125 M. The tissue blocks were washed twice with PBS and disaggregated by homogenizing. Cells were harvested by centrifugation at 2000 x g for 5 min.
The cell pellets were suspended in 600 µl cell lysis buffer [50 mM Tris (pH 8.0); 1 mM EDTA; 0.5 mM EGTA; 1% Triton X-100; 0.1% Na-deoxycholate; 150 mM NaCl; protease inhibitor]. ChIP assays were performed essentially following the protocol described in Ref. 36 . Samples were immunoprecipitated with 2 µg ER
antibody MC-20 (Santa Cruz Biotechnology, Santa Cruz, CA) at 4 C overnight. "Mock" samples using 2 µg normal rabbit IgG (Santa Cruz Biotechnology) were included as controls. Precipitated DNA was amplified by PCR with primers 5'-GAGCCGTATCAGGGCATTTA-3' and 5'-GGGGGAGGGAGGAGACATTA-3' for the part of the mStat3 promoter containing the CRE and the SBE sites and primers 5'-CCATTGGGGGATTATCTTTG-3' and 5'-TGGTGTTTGTATTGCTGGTGA-3' for the 1600 region included as negative control.
Statistics
The results are expressed as mean ± SD or mean ± SEM. An unpaired Students t test was used to assess differences between 17ß-estradiol or vehicle-treated ob/ob mice. All statistical tests were performed with Microsoft Excel for windows XP. A value of P value < 0.05 was considered to be significant.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Disclosure Statement: H.G., G.B., E.H., A.K., S.E., and K.D.-W. have nothing to declare. J.-Å.G. is a consultant for and has equity interests in KaroBio AB and received lecture fees from Eli Lilly.
First Published Online April 20, 2006
1 H.G. and G.B. have contributed equally to this study. ![]()
Abbreviations: Apcs, Serum amyloid P-component; BERKO, ERß knockout; Cebpd, CCAAT/enhancer binding protein
; ChIP, chromatin immunoprecipitation; CRE, cAMP-responsive element; ER, estrogen receptor; ERKO, ER
knockout; Fasn, fatty acid synthase; FCS, fetal calf serum; GO, gene ontology; Gpam, glycerol-3-phosphate acyltransferase; IPGTT, ip glucose tolerance test; IPITT, ip insulin tolerance test; Lbp, lipopolysaccharide binding protein; Lepr, leptin receptor; SBE, STAT binding element; Scd1, stearoyl-coenzyme A desaturase 1; STAT, signal transducer and activator of transcription.
Received for publication January 9, 2006. Accepted for publication April 13, 2006.
| REFERENCES |
|---|
|
|
|---|
knockout mice. Proc Natl Acad Sci USA 97:1272912734
function in muscle and liver. Nutr Rev 62:253255[CrossRef][Medline]
plays an important role in the regulation of glucose homeostasis in mice: insulin sensitivity in the liver. Diabetologia 49:588597[CrossRef][Medline]
/NF-IL6 ß, are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res 21:289294
to 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive promoters. Mol Cell Biol 25:53175328NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
V. Ribas, M. T. A. Nguyen, D. C. Henstridge, A.-K. Nguyen, S. W. Beaven, M. J. Watt, and A. L. Hevener Impaired oxidative metabolism and inflammation are associated with insulin resistance in ER{alpha}-deficient mice Am J Physiol Endocrinol Metab, February 1, 2010; 298(2): E304 - E319. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lkhagvadorj, L. Qu, W. Cai, O. P. Couture, C. R. Barb, G. J. Hausman, D. Nettleton, L. L. Anderson, J. C. M. Dekkers, and C. K. Tuggle Gene expression profiling of the short-term adaptive response to acute caloric restriction in liver and adipose tissues of pigs differing in feed efficiency Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2010; 298(2): R494 - R507. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wang, J. Tan, A. Coffey, J. Fehrenbacher, B. R. Weil, and D. R. Meldrum Signal transducer and activator of transcription 3-stimulated hypoxia inducible factor-1{alpha} mediates estrogen receptor-{alpha}-induced mesenchymal stem cell vascular endothelial growth factor production J. Thorac. Cardiovasc. Surg., July 1, 2009; 138(1): 163 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Singhal, K. Shankar, T. M Badger, and M. J Ronis Hepatic gene expression following consumption of soy protein isolate in female Sprague-Dawley rats differs from that produced by 17{beta}-estradiol treatment J. Endocrinol., July 1, 2009; 202(1): 141 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Riant, A. Waget, H. Cogo, J.-F. Arnal, R. Burcelin, and P. Gourdy Estrogens Protect against High-Fat Diet-Induced Insulin Resistance and Glucose Intolerance in Mice Endocrinology, May 1, 2009; 150(5): 2109 - 2117. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. H. Rogers, J. W. Perfield II, K. J. Strissel, M. S. Obin, and A. S. Greenberg Reduced Energy Expenditure and Increased Inflammation Are Early Events in the Development of Ovariectomy-Induced Obesity Endocrinology, May 1, 2009; 150(5): 2161 - 2168. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Lundholm, G Bryzgalova, H Gao, N Portwood, S Falt, K D Berndt, A Dicker, D Galuska, J R Zierath, J-A Gustafsson, et al. The estrogen receptor {alpha}-selective agonist propyl pyrazole triol improves glucose tolerance in ob/ob mice; potential molecular mechanisms J. Endocrinol., November 1, 2008; 199(2): 275 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bryzgalova, L. Lundholm, N. Portwood, J.-A. Gustafsson, A. Khan, S. Efendic, and K. Dahlman-Wright Mechanisms of antidiabetogenic and body weight-lowering effects of estrogen in high-fat diet-fed mice Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E904 - E912. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gao, S. Falt, A. Sandelin, J.-A. Gustafsson, and K. Dahlman-Wright Genome-Wide Identification of Estrogen Receptor {alpha}-Binding Sites in Mouse Liver Mol. Endocrinol., January 1, 2008; 22(1): 10 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wang, W. Zhang, P. Crisostomo, T. Markel, K. K. Meldrum, X. Y. Fu, and D. R. Meldrum Sex differences in endothelial STAT3 mediate sex differences in myocardial inflammation Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E872 - E877. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |