| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Recruits the Positive Transcription Elongation Factor b Complex to Activate Transcription and Promote Adipogenesis
Institut National de la Santé et de la Recherche Médicale (INSERM) (I.I., J.-S.A., C.C., D.S., L.F.), Unité 540, Equipe Avenir, Institut de Génetique Humaine (M.B.), and Centre Hospitalier Universitaire Arnaud de Villeneuve (L.F.), Montpellier F-34090, France; and Department of Biochemistry and Molecular Biology (R.K.P., J.B.H., I.K., K.K.), University of Southern Denmark, DK-5230 Odense M, Denmark
Address all correspondence and requests for reprints to: Lluis Fajas, Institut National de la Santé et de la Recherche Médicale, Equipe Avenir, Unité 540, 60 rue de Navacelles, Montpellier, France. E-mail: fajas{at}montp.inserm.fr.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(PPAR), which is the master regulator of this process, on the promoter of PPAR target genes. PPAR-cdk9 interaction results in increased transcriptional activity of PPAR and therefore increased adipogenesis. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B (NFB) (8), androgen receptor (AR) (9), and the aryl hydrocarbon receptor (10), implicating the cyclin T/cdk9 complex in the regulation of cellular processes such as heat-shock response, antigen presentation and processing, apoptosis, muscle cell differentiation, cell growth, or cell proliferation. Moreover, interaction of c-Myc with cyclin T1 and cdk9 results in efficient transcription of c-Myc target genes, and inhibition of cdk9 with DRB, at a concentration that does not inhibit the general transcription process, results in the block of c-Myc-induced proliferation and apoptosis (6). Of particular interest is the participation of P-TEFb in differentiation processes. Interaction of cdk9 with MyoD results in increased differentiation of muscle cells. Interestingly, MyoD interacted with, and was phosphorylated by, the cyclin T2/cdk9 complex, whereas c-Myc and NFB were shown to recruit the cdk9/cyclin T1 complex (5). Hence, the specificity of the interaction might be dictated by the cyclin T component of the P-TEFb complex (1). Cdk9 is also required for the monocyte differentiation program. In these cells, cyclin T1 is highly induced upon stimulation with phorbol 12-myristate 13-acetate (11). High levels of expression of cyclin T1 and T2, as well as cdk9, in differentiated tissues suggest the participation of P-TEFb in the activation or maintenance of specific differentiation processes (12, 13). Interestingly, white adipose tissue showed a very high level of expression of cyclin T1 (12). All these studies prompted us to investigate the role of P-TEFb in the adipocyte differentiation process.
Adipogenesis is a particular system, which involves two major events: preadipocyte proliferation and adipocyte differentiation. Upon reaching confluence, proliferative preadipocytes become growth arrested by contact inhibition. Those cells reenter cell cycle after hormonal induction, arrest proliferation again, and undergo terminal adipocyte differentiation. This last stage is characterized by the coordinated expression of specific genes that will finally determine the specific adipocyte phenotype of the cells. The major regulator of terminal adipocyte differentiation is the peroxisome proliferator-activated receptor (PPAR) (reviewed in Refs. 14 and 15), which is induced during the initial phases of these terminal stages of adipogenesis by CCAAT enhancer-binding protein-ß and -
, as well as by E2F1 (16). PPAR, upon activation by either fatty acid derivatives or antidiabetic thiazolidinediones, drives the expression of several adipocyte-specific genes, such as the fatty acid binding protein (aP2), thus transforming the cell into the characteristic lipid-rich adipocyte (17). Subsequent studies have demonstrated that ectopic expression of PPAR further induces adipocyte differentiation (18). This pivotal role of PPAR in adipocyte differentiation is also highlighted by the phenotype observed in humans with mutations in the PPAR gene and by PPAR-deficient mice, which are essentially devoid of white adipose tissue (19).
In this study we show that cyclin T1, T2, and cdk9 are expressed in adipocytes. Furthermore, cdk9 activity is increased during adipocyte differentiation. We show that inhibition of cdk9 activity impairs adipogenesis, whereas ectopically expressed cdk9 is highly adipogenic in 3T3-L1 cells. The adipogenic effects of cdk9 are mediated by the induction of PPAR transcriptional activity through direct phosphorylation. Finally, we show that PPAR is complexed with P-TEFb on promoters of PPAR target genes.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, A and B). Interestingly, Western blot analysis as well as RNA quantification showed that the expression of p55 cdk9 protein isoform was strongly increased during adipocyte differentiation, whereas p42 cdk9 expression was unchanged (Fig. 1, A and B). No differences in the expression of cyclin T1 or cyclin T2 were observed (data not shown). aP2 mRNA expression was quantified as a marker of differentiation (Fig. 1C). To further study the expression of P-TEFb during adipogenesis, immunofluorescence analyses were performed. During early stages of differentiation of 3T3-L1 cells, cdk9 was evenly distributed between the cytoplasm and the nucleus (Fig. 1D; d 0 and d 1). Starting at d 3, cdk9 expression became more prominent in the nuclear compartment (Fig. 1D). Strikingly, at this stage of differentiation, coexpression of cdk9 with PPAR in the nucleus of differentiating cells could be observed (Fig. 1D; d 3 and d 8). Similar results were observed when the expression of cyclins T1 and T2 were analyzed (supplemental Fig. 1 published on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). Furthermore, immunoprecipitated cdk9 from differentiated adipocytes was able to phosphorylate purified recombinant RNA pol II CTD, showing a gradual increase in cdk9 activity, as measured by the level of RNA pol II CTD phosphorylation, indicating that cdk9 was indeed active in adipocytes (Fig. 1E). This was consistent with the increase in nuclear localization of cdk9 at the same stages of adipocyte differentiation (Fig. 1D).
|
DRB Inhibition of cdk9 Results in Impaired Clonal Expansion and Terminal Adipocyte Differentiation
To further assess the role of cdk9 in the differentiation of 3T3-L1 cells, cdk9 activity was inhibited using DRB. 3T3-L1 cells treated with either vehicle or DRB were compared for their ability to differentiate into adipocytes. After 8 d in differentiation media, normal lipid accumulation was observed in control cells, whereas a dose-dependent decrease in lipid accumulation was observed in cells treated with DRB, as showed by oil red O staining (Fig. 2A). Quantitative RT-PCR performed on differentiated 3T3-L1 cells confirmed a DRB dose-dependent decrease in expression of the PPAR target gene aP2, which is a marker of adipocytes (Fig. 2B). 3T3-L1 preadipocytes reenter cell cycle after hormonal induction of differentiation (the clonal expansion phase). Because this is a required event of these cells before terminal differentiation into adipocytes, we next explored the hypothesis that cdk9 participates in adipogenesis through the control of cell cycle during the clonal expansion phase. A decrease in cell proliferation during the clonal expansion phase (d 1 and 2) was observed, as measured by bromodeoxyuridine incorporation assays, in cells treated with DRB compared with cells treated with vehicle (Fig. 2C). This indicated that inhibition of cdk9 by DRB suppressed, at least in part, the clonal expansion phase of adipogenesis. Furthermore, the decrease in cyclin B1 mRNA expression at d 1 of differentiation in cells treated with DRB suggested that cdk9 could participate in the control of the G2/M transition (Fig. 2D). No differences in the expression of cyclin D1 or dihydrofolate reductase were observed at this stage, whereas a significant reduction in the expression of these genes was observed at d 2 of differentiation (Fig. 2D). To further elucidate whether the role of cdk9 was limited to the regulation of the clonal expansion phase of adipocyte differentiation, cdk9 activity was inhibited starting at d 3 of differentiation. At this particular stage, 3T3-L1 cells are quiescent and have already gone through the clonal expansion phase (data not shown). Five days after treatment (d 8), oil red O staining indicated an inhibitory dose-dependent effect of DRB in lipid accumulation (Fig. 2E). A dose-dependent decrease in aP2 mRNA expression in DRB-treated cells further demonstrated inhibition of adipogenesis (Fig. 2F). These results suggested that cdk9 has a dual role in adipogenesis, i.e. a first role promoting the clonal expansion phase, and a second role promoting terminal differentiation.
|
). Overexpression of DNcdk9 was assessed by PCR assay (Fig. 3A, bottom panel). Inhibition of adipogenesis was further proved by decreased aP2 mRNA expression in DNcdk9 cells (Fig. 3B).
|
, bottom panel). After 4 d of differentiation only a small proportion of cells expressing a control vector were differentiated (Fig. 3, A and B), whereas a strong increase in lipid accumulation and up-regulation of adipogenic mRNA markers was observed in cells overexpressing cdk9 (Fig. 3, C and D), further demonstrating that cdk9 is an adipogenic factor.
Cdk9 Increases PPAR Activity
Because P-TEFb has an impact on adipogenesis, we tested whether these effects could be mediated by PPAR, which is the master regulator of adipocyte differentiation. To analyze the influence of cdk9 on PPAR activity, we performed cotransfection experiments using a PPAR-responsive, luciferase-based reporter construct [PPRE-thymidine kinase (TK)-Luc] and expression vectors for PPAR and cdk9. A cdk9 dose-dependent induction of luciferase activity was observed in the presence of PPAR both in the presence and absence of the PPAR agonist rosiglitazone (Fig. 4A). To further prove that the effects of cdk9 on the PPAR-responsive promoter were mediated by PPAR, a chimeric Gal4-PPAR construct containing the Gal4 DNA-binding domain fused to either the PPAR AB that contains the ligand-independent PPAR transactivating domain, or the PPAR ligand binding domain (LBD) that contains the ligand-dependent transactivating domain were used in combination with a Gal4-responsive, luciferase-based reporter construct [upstream activating sequence (UAS)-TK-Luc]. Consistent with the results using a PPRE-TK-Luc, a robust dose-dependent increase in luciferase activity was observed when cdk9 was cotransfected with the Gal4-PPAR AB construct (Fig. 4B). No effects of cdk9 were observed when the Gal4-PPAR LBD construct was used either in the presence or absence of rosiglitazone (Fig. 4B). These results demonstrated that cdk9 modulates PPAR activity. This was further proved by the observation that cdk9 inactivation by cotransfection of a DNcdk9 expression vector resulted in the attenuation of PPAR activation by rosiglitazone (Fig. 4C). Moreover, inactivation of cdk9 kinase activity by DRB resulted in a complete inhibition of PPAR activity (Fig. 4D). Finally, to ascertain that cdk9 activates PPAR-mediated transcription, chromatin immunoprecipitation (ChIP) studies on the aP2 promoter, which is a known PPAR target gene, were performed in both nondifferentiated and differentiated 3T3-L1 adipocytes. A 200-bp fragment of the mouse aP2 promoter, containing the binding site of PPAR, was amplified by PCR when anti-cdk9, anti-PPAR, or antiacetylated histone H4 antibodies were used to immunoprecipitate chromatin from differentiated 3T3-L1 cells (Fig. 4E, upper panel). No amplification product was observed when immunoprecipitated chromatin from confluent, nondifferentiated 3T3-L1 preadipocytes was used as template, or when chromatin was immunoprecipitated using an irrelevant antibody, or when a non-PPRE-containing region of the aP2 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter were used as template (Fig. 4E), demonstrating the specificity of the binding. The results of the ChIP assays demonstrate that the complex cdk9-PPAR is present on the promoter of a PPAR target gene. Furthermore, the presence of acetylated histone H4 on the PPAR-binding site of the aP2 promoter suggests that, in the presence of cdk9, this promoter is active. These results suggest that the stimulatory role of P-TEFb during adipogenesis is likely the result of its ability to modulate PPAR activity.
|
activity in the presence of P-TEFb is the consequence of a direct interaction between PPAR and cdk9, nuclear extracts from COS cells transfected with cdk9 and PPAR expression vectors were immunoprecipitated with cdk9 or irrelevant antibodies. PPAR protein could be detected in cdk9 immunoprecipitates as assessed by Western blot analysis (Fig. 5A), suggesting that a PPAR-cdk9 complex is present in these cells. To identify the PPAR domain responsible for the interaction, glutathione-S-transferase (GST)-PPAR fusion proteins containing different PPAR domains were incubated with in vitro translated 35S-radiolabeled cdk9 (Fig. 5B). Interestingly, we found that cdk9 binds to both the A/B and DE domains of PPAR (Fig. 5, C and D). In particular, cdk9 bound to a region from amino acids 1–72 and 292–399. The same results were observed when cyclin T1 or T2 was used instead of cdk9 (data not shown). These results further demonstrated a direct interaction between cdk9 and PPAR.
|
activity implicated its phosphorylation by cdk9. Overexpression of cdk9 and cyclin T in Saos cells resulted in the accumulation of the phosphorylated form of PPAR, as assessed by Western blot analysis (Fig. 6A), suggesting that PPAR could be a target for cdk9. Moreover, immunoprecipitated cdk9 from 293 cells was able to in vitro phosphorylate purified full-length GST-PPAR, whereas neither GST alone nor GST-PPAR LBD, which contains the PPAR LBD were phosphorylated by cdk9 (Fig. 6B). In contrast, GST-PPAR A/B, which contains the PPAR A/B domain was indeed phosphorylated by cdk9 (Fig. 6B). The PPAR A/B domain contains S112, which has been shown to be phosphorylated by other serine-threonine kinases, such as cdk7. To investigate whether this residue was the target for cdk9, S112 was replaced by an alanine (S112A). GST-PPAR A/B-S112 was not phosphorylated by cdk9 (Fig. 6B, right panel). These results demonstrate that cdk9 phosphorylates PPAR at S112. To further elucidate how PPAR phosphorylation could influence its transcriptional activity, we correlated the expression of the PPAR target gene aP2 with the phosphorylation status of PPAR. As expected, 3T3-L1 adipocytes treated with rosiglitazone increased the expression of aP2 (Fig. 6C). This effect was blunted by the addition of the PPAR antagonist GW9662 (Fig. 6C). Strikingly, maximal aP2 induction correlated with the accumulation of the PPAR phosphorylated forms (Fig. 6D). Similarly, the observed decrease in aP2 expression upon incubation with GW9662 correlated with a switch to nonphosphorylated PPAR (Fig. 6D). Furthermore, incubation of 3T3-L1 adipocytes with the cdk9 inhibitor DRB resulted in a decrease in aP2 mRNA expression to the levels observed in cells treated with the PPAR antagonist GW9662 (Fig. 6E). Interestingly, PPAR phosphorylation was inhibited when cells were incubated with DRB (Fig. 6F). Quantification of the relative intensity of the bands demonstrated that the observed reduction in PPAR phosphorylation levels was similar to that observed using the PPAR antagonist GW9662 (Fig. 6, D and F). Overall, these results suggested that phosphorylation by cdk9 increases PPAR activity. Further supporting this hypothesis was the observation that, in differentiated adipocytes, phosphorylated PPAR is complexed with the aP2 promoter as demonstrated by ChIP assays (Fig. 6G). Coincident with phospho-PPAR is the presence of cdk9 and acetylated histone H4 in the aP2 PPRE, indicating that, under these conditions, the promoter is active (Fig. 6G).
|
also plays a major role in adipocyte biology through regulation of genes implicated mainly in lipogenesis. Because cdk9 modulates PPAR activity, we asked whether cdk9 could also participate in these processes. First, we analyzed the mRNA expression of lipogenic genes such as aP2, lipoprotein lipase (LPL), stearoyl coenzyme A desaturase (SCD1), and fatty acid synthase (FAS). DRB treatment of 3T3-L1 adipocytes resulted in the inhibition of the expression of aP2, LPL, SCD1, and FAS (Fig. 7A), whereas no changes in the expression of genes implicated in lipolysis were observed (data not shown). These results suggested that similar to PPAR, cdk9 could also be implicated in lipogenesis. Interestingly, expression of cdk9 was strongly increased in adipose tissue of mice fed a high-fat diet (Fig. 7B). Furthermore, genetically obese db/db mice expressed high levels of cdk9 mRNA in adipose tissue compared with control nonobese mice (Fig. 7B). Similar results were observed for cyclin T1 and cyclin T2 expression (supplemental Fig. 2).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B (8), AR (9), and MyoD (5). As a result of the regulation of specific genes, P-TEFb coordinates cellular processes ranging from apoptosis, monocyte differentiation, or myogenesis (reviewed in Ref. 21). In this study, we analyzed the participation of cdk9 in adipocyte differentiation, and we found that cdk9 was required for adipogenesis. This is supported by several observations. First, expression of cdk9p55 is highly up-regulated during adipocyte differentiation (Fig. 1). Second, cdk9 activity is increased during adipogenesis (Fig. 1). Third, overexpression of cdk9 results in increased adipogenesis, whereas inhibition of cdk9 impairs the adipogenic potential of the cells (Figs. 2 and 3). Finally, cdk9 increases PPAR activity through direct interaction with PPAR on the promoters of PPAR target genes (Fig. 4). The central role of PPAR in adipose tissue differentiation and biology has been largely demonstrated. Consequently, any factor modulating PPAR activity, and such is the case for cdk9, will have a major impact on adipocyte differentiation.
A similar scenario has been observed for the transcription factor MyoD. In this case, cdk9 phosphorylates MyoD and increases its transcriptional activity (5). Similarly, PPAR is also phosphorylated by the P-TEFb complex, which may account for the observed effects of cdk9 on PPAR activity. Interestingly, PPAR is phosphorylated at S112, exactly the same residue previously reported to be phosphorylated by MAPK and cdk7 (22, 23, 24). The effects of PPAR phosphorylation on PPAR activity, so far, are inconsistent. MAPK phosphorylation of PPAR has been reported to inhibit its activity (22, 23), whereas phosphorylation by cdk7 has been shown to be required for PPAR-mediated transactivation (24). Our results are in agreement with this last study and show that PPAR phosphorylation by cdk9 results in PPAR activation. Three different observations support this hypothesis. First, cdk9 mediates PPAR activation in transient transfection assays (Fig. 4). Second, PPAR phosphorylation correlates with PPAR maximal activity in transactivation of target genes (Fig. 6). Finally, phosphorylated PPAR is complexed to the active promoters of target genes together with cdk9 (Fig. 6). How can phosphorylation of PPAR at the same residue by different kinases result in either activation or repression of this transcription factor? One possible explanation is cofactor recruitment. The interaction of PPAR with either kinase could modulate the interaction of PPAR with different cofactors. In the case of MAPK, the interaction could result in the recruitment of corepressors, whereas for cdk7 and cdk9, the interaction could result in the recruitment of coactivators and the general transcriptional machinery. Recruitment of coactivators is probably not the case, because we did not observe any difference in cofactor recruitment to PPAR in the absence or presence of cdk9 (data not shown). Alternatively, phosphorylation of PPAR might be required for optimal activation. The effects observed upon MAPK inactivation on PPAR could be indirect, such as replacement of PPAR by a more potent transcription factor. Unfortunately, no data demonstrating the presence of PPAR on the promoters of its target genes when MAPK inhibitors are used are available to date. Because phosphorylation of PPAR coincides with RNA pol II CTD phosphorylation, we believe that PPAR could tether the P-TEFb complex to the RNA pol II complex, facilitating phosphorylation and therefore elongation of the transcription of its target gene. This is the mechanism that has been suggested to explain the positive effects on the transcription of AR (9), AhR (10), or NFB (8), mediated by the interaction of cdk9 with these transcription factors. In contrast to this, another mechanism of regulation of P-TEFb activity was described recently for the glucocorticoid receptor. In this scenario glucocorticoid receptor inhibits P-TEFb activity by competing for binding to RelA and p50 complex on the promoter of the IL-8 gene, resulting in the repression of this gene (25).
The analysis of the expression of cdk9 during adipocyte differentiation showed that the recently identified cdk9 isoform, p55, which is transcribed from an alternative promoter (2), increases during differentiation. This pattern of expression of p55cdk9 suggests that it may be a PPAR target gene. Interestingly, we have identified a highly conserved PPAR-responsive element in the promoter of p55cdk9 (data not shown). Regulation of cdk9 expression by PPAR would result in a positive feed-back loop increasing the availability of cdk9 to activate PPAR-mediated transcription.
During adipocyte differentiation, which is a highly coordinated process, only a subset of genes are activated resulting in the specific adipocyte phenotype (reviewed in 15). This selective transcriptional activation supports the idea that the effects of cdk9 are rather gene specific than an effect on general transcription in the context of adipogenesis, and likely in other differentiation processes. Most interesting is the fact that cdk9 could participate in adipose tissue biology in addition to adipocyte differentiation. In differentiated adipocytes cdk9 inactivation results in the inhibition of the expression of genes implicated in lipogenesis, which is consistent with the increased expression of cdk9 that we found in mouse models of obesity. This may have important therapeutic implications, for instance in the context of obesity. Studies on the effects of specific cdk9 inhibitors in adiposity in mice are ongoing.
In summary, in this study we provide evidence that the nuclear receptor PPAR uses the P-TEFb complex to stimulate the transcription of its target genes to drive adipogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
E-8 antibody, anti-PPAR H-100 antibody, and antihistone H1 FL-219 antibody were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-cdk9 ab6544 antibody, anti-cyclin T1 ab2098 antibody, and the acetylated histone H4 (Lys 9) antibody were from Abcam Ltd. (Cambridge, UK). Anti-phospho-PPAR (Ser112) antibody was purchased from Euromedex (Mundolsheim, France), The RNA polymerase II CTD purified protein was purchased from ProteinOne (Bethesda, MD).
Plasmids and Oligonucleotides
PBSK and pcDNA3 vectors were purchased from Stratagene (La Jolla, CA). GST-PPAR AB, GST-PPAR DE, PPRE-TK-Luc, and the PPAR expression vector were described previously (26, 27). GST-PPAR deletion mutants were generated by PCR and inserted into pGEX-4T-1 vector. A pCMV ß-galactosidase vector was used as an internal control for transfection efficiency in mammalian cells. pCMV Sp6-cdk9, pCMV Sp6.1-cyclinT2, and pCMV Sp6-cyclin T1 expression vectors were purchased from Medical Research Council Geneservice (Cambridge, UK), a distributor for the Mammalian Gene Collection. The pCMV-DNcdk9 hemagglutinin-tagged vector was a kind gift from Monsef Benkirane. DNcdk9 contains a point mutation at nucleotide 563, which converts Asp to Asn. The following plasmids were kindly provided from Karsten Kristiansen: upstream activating sequence UAS-TK-luc reporter, pSG5-cdk9, pRc/CMV-cyclin T1, pcDNA3.1-PPAR2, Gal4-PPAR A/B, Gal4-PPAR LBD, pGEX-5X-2 GST-PPAR2 full-length, GST-PPAR2 LBD, GST-PPAR2 A/B, and GST-PPAR2 A/B S112A. Oligonucleotides used in ChIP assays to amplify the mouse aP2 promoter in PPRE region are 5'-GAGCCATGCGGATTCTTG-3' and 5'-CCAGGAGCGGCTTGATT GTTA-3'; for non-PPRE region of the aP2 promoter: 5'-CAGCCCCACATCCCCACAGC and 3'-GGATGCCCAACAACAGCCACAC; and for mouse GAPDH promoter amplification: 5'-AAGGCTGGTGCTGTGGAGAAACTG and 3'-GTCCCCTTGCAACATACATAACTG. Oligonucleotides used for real-time PCR experiments are the following in 5'- to 3'-orientation: cdk9p42 forward, GCCAAGATCGGCCAAGGCAC; cdk9p42 reverse, CAGCCCAGCAAGGTCATGCTC; cdk9p55 forward, CCTCTGCAGCTCCG GCTCCC; cdk9p55 reverse, CACTCCAGGCCCCTCCGCGG; T7 promoter GTAATACGACTCACTCACTATAGGG; aP2 forward, AACACCGAGATTTCCTTCAA; aP2 reverse, AGTCACGCCTTTCATAACACA; 18s forward, GTTCCGACCATAAACGATGCC; 18s reverse, TGGTGGTGCCCTTCCGTC AAT; LPL forward, GAGACCAAGAGAAGCAGCAAGATGT; LPL reverse, AGTCGGGCCAGCTGAAGTAGGAGT; SCD1 forward, TGGGTTGGCTGCTTGTG; SCD1 reverse, GCGCTGGGCAGGATGAAG; FAS forward, TGCTCCCAGCTGCAGGC; FAS reverse, GCCCGGTAGCTCTGGGTGTA.
RNA Isolation, Reverse Transcription, and Real-Time PCR
RNA was purified using an RNeasy Mini Kit of QIAGEN (Hilden, Germany). Reverse transcription of total RNA was performed at 37 C using the M-MLV reverse transcriptase (Invitrogen SARL, Cergy Pontoise, France) and random hexanucleotides primers (Promega Corp., Madison, WI), followed by a 15-min inactivation at 70 C. Quantitative PCR was carried out by real-time PCR using a LightCycler and the DNA double strand-specific SYBR Green I dye for detection (Roche, Basel, Switzerland). Results were then normalized to 18-sec levels.
Cell Culture, Cell Differentiation, and Transfections
NIH-3T3, COS, 293 and 3T3-L1 cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 µg/ml streptomycin in a humidified atmosphere of 5% CO2 at 37 C. 3T3-L1 cells were differentiated with DMEM, 10% serum, 0.5 mM 3-isobutyl-1methylxanthine, 10 µg/ml insulin, 1 µM dexamethasone, and 100 nM pioglitazone for 2 d. From d 3 on, cells were incubated with DMEM, 10% serum, 10 µg/ml insulin, and 100 nM pioglitazone. Oil red O staining was performed as described elsewhere (28). Transfections were performed using the Jet PEI reagent (Qbiogene, Irvine, CA). Rosiglitazone was used at the concentration of 1 µM. The luciferase and ß-galactosidase activities were measured as described previously (29). For stable transfections, Jet PEI was mixed with plasmid DNA, according to the manufacturer’s instructions, and the mixtures were allowed to remain on the cells in the incubator for 4 h. G418 or puromycin (Invitrogen SARL) was added, 24 h after transfections, at a final concentration of 1 mg/ml or 2.5 µg/ml, respectively. The medium plus G418 or puromycin was replaced three times/week until no surviving cells were observed.
Protein Expression Assays
For nuclear extracts, cells were homogenized in a lysis buffer containing 10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.1% Nonidet P-40 (MP Biomedicals, Aurora, OH), and 1 mM dithiothreitol. A protease inhibitor cocktail was added (Sigma). Lysates were centrifuged and resuspended in a buffer containing 20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM EGTA, 0.4 M NaCl, 1 mM dithiothreitol, and protease inhibitor cocktail. Protein concentrations were determined by the Bradford method (Bio-Rad, Hercules, CA). SDS-PAGE and electrotransfer were performed as described elsewhere (30). The membranes were blocked 1 h in blocking buffer (PBS, 0.5% Tween 20, 5% skimmed milk). Filters were first incubated overnight at 4 C with the indicated primary antibodies, and then for 1 h at room temperature with a peroxidase conjugate secondary antibody. The complex was visualized with enhanced chemiluminescence (Interchim, Montluçon, France).
Immunofluorescence in 3T3-L1 Cells
For all immunofluorescence experiments, cells were grown on coverslips. After fixation and permeabilization with 100% methanol, cells were incubated with antibodies directed against cdk9 (Abcam Ltd.), cyclin T1 (Abcam Ltd.), and PPAR (Santa Cruz Biotechnology, Inc.). For cyclin T2 detection, cells were fixed with 4% formaldehyde and then permeabilized with 0.1% Triton X-100 (Sigma) and incubated with cyclin T2 antibody (Santa Cruz Biotechnology). Preparations were then incubated with a combination of Texas Red-conjugated antimouse IgG and fluorescein isothiocyanate-conjugated antirabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), or fluorescein isothiocyanate-conjugated antigoat IgG (Santa Cruz Biotechnology).
Coimmunoprecipitation and ChIP Assays
For coimmunoprecipitation assays, whole-cell extracts were precleared with protein A-agarose beads (Roche) during 30 min at room temperature, and an aliquot of the precleared lysates was saved as input. Extracts were then centrifuged (5 min at 3000 rpm), and supernatants were immunoprecipitated with the indicated specific antibodies overnight at 4 C, and rabbit IgGs (Sigma) were used as negative control (mock). Immunoprecipitates were then washed twice with IP buffer [150 mM NaCl, 1% Nonidet P-40, 50 mM Tris/HCl (pH 8), and protease inhibitor cocktail] and three times with washing buffer (0.25 M KCl in PBS) and subjected to SDS-PAGE electrophoresis. ChIP assays were performed as described previously (31). Briefly, proteins were formaldehyde cross-linked to DNA in confluent 3T3-L1 preadipocytes before induction of differentiation or in cells induced with differentiation medium for 7 d. Proteins were then immunoprecipitated using the indicated antibodies, rabbit IgGs or beads were used as mock, DNA was extracted from the immunoprecipitates, and PCR amplification was performed using promoter-specific oligonucleotide primers.
Pull-Down Assays
In vitro translation of pCMV-cdk9 was performed with [35S]methionine (PerkinElmer, Boston, MA) in a TNT-coupled transcription-translation system, as described by the manufacturer (Promega Corp.). GST fusion or GST alone were expressed in Escherichia coli, and purified on glutathione-sepharose-4B beads (Amersham Biosciences, Uppsala, Sweden). For in vitro binding GST, GST-PPAR AB, GST-PPAR DE, and GST-PPAR deletion mutants were incubated with the labeled protein in 1 ml binding buffer containing 300 mM NaCl, 0.5% Triton-X-100, 50 mM Tris (pH 8), and 2 mM EDTA at room temperature for 1 h. Beads were washed five times with the same buffer. The proteins were visualized by autoradiography after SDS-PAGE.
Kinase Assays
Immunoprecipitated cdk9 from 3T3-L1 cells at different stages of differentiation was used as kinase. Immunoprecipitates were washed once with kinase buffer [25 mM Tris/HCl (pH 7.5), 150 mM NaCl, 10 mM MgCl2, 1 mM DTT, and protease inhibitor cocktail] in the presence of a protease inhibitor cocktail (Sigma) and phosphatase inhibitors (5 mM Na4P2O7, 50 mM NaF, 1 mM vanadate). Kinase assay was performed during 30 min at 37 C in the presence of 40 µM ATP and 8 µCi 33P-ATP; purified RNA polymerase CTD or GST, GST-PPAR2 A/B, GST-PPAR A/B S112A, GST-PPAR LBD, or GST-PPAR2 full length was used as substrate. Reaction was stopped by boiling the samples at 95 C for 5 min in the presence of denaturing sample buffer. Samples were then subjected to SDS-PAGE; gels were then dried in a gel dryer for 1 h at 80 C and exposed to an x-ray film.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
First Published Online February 16, 2006
Abbreviations: AR, Androgen receptor; cdk, cyclin-dependent kinase; ChIP, chromatin immunoprecipitation; CTD, carboxyl-terminal domain; DN, dominant negative; DRB, dichloro-1-ß-ribofuranosyl-benzimidazole; FAS, fatty acid synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GST, glutathione-S-transferase; LBD, ligand binding domain; LPL, lipoprotein lipase; PPAR, peroxisome proliferator-activated receptor-; PPRE, PPAR response element; P-TEFb, positive transcription elongation factor b; RNA pol II, RNA polymerase II; SCD1, stearoyl coenzyme A desaturase; TK, thymidine kinase; UAS, upstream activating sequence.
Received for publication June 6, 2005. Accepted for publication February 8, 2006.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
B binds P-TEFb to stimulate transcriptional elongation by RNA polymerase II. Mol Cell 8:327–337[CrossRef][Medline]2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–12342, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]: from adipogenesis to carcinogenesis. J Mol Endocrinol 27:1–9[Abstract]. Science 274:2100–2103 is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 272:5128–5132B to effect promoter-specific transcriptional repression. Genes Dev 19:1116–1127 and adipocyte differentiation. Dev Cell 3:903–910[CrossRef][Medline] gene. J Biol Chem 272:18779–18789 ligand with potent insulin-sensitizing yet weak adipogenic activity. Mol Cell 8:737–747[CrossRef][Medline]NURSA Molecule Pages Link:
This article has been cited by other articles:
 |
|
 |
|
  A. Bugge, L. Grontved, M. M. Aagaard, R. Borup, and S. Mandrup The PPAR{gamma}2 A/B-Domain Plays a Gene-Specific Role in Transactivation and Cofactor Recruitment Mol. Endocrinol., June 1, 2009; 23(6): 794 - 808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Ogba, L. J. Chaplin, Y. Q. Doughman, K. Fujinaga, and M. M. Montano HEXIM1 Regulates 17{beta}-Estradiol/Estrogen Receptor-{alpha}-Mediated Expression of Cyclin D1 in Mammary Cells via Modulation of P-TEFb Cancer Res., September 1, 2008; 68(17): 7015 - 7024. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Are, L. Aronsson, S. Wang, G. Greicius, Y. K. Lee, J.-A. Gustafsson, S. Pettersson, and V. Arulampalam Enterococcus faecalis from newborn babies regulate endogenous PPAR{gamma} activity and IL-10 levels in colonic epithelial cells PNAS, February 12, 2008; 105(6): 1943 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. N. Johnstone, P. S. Mongroo, A. S. Rich, M. Schupp, M. J. Bowser, A. S. deLemos, J. W. Tobias, Y. Liu, G. E. Hannigan, and A. K. Rustgi Parvin- Inhibits Breast Cancer Tumorigenicity and Promotes CDK9-Mediated Peroxisome Proliferator-Activated Receptor Gamma 1 Phosphorylation Mol. Cell. Biol., January 15, 2008; 28(2): 687 - 704. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Hou, S. Ray, and A. R. Brasier The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression J. Biol. Chem., December 21, 2007; 282(51): 37091 - 37102. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
