help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0286
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carascossa, S.
Right arrow Articles by Jalaguier, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carascossa, S.
Right arrow Articles by Jalaguier, S.
Molecular Endocrinology 20 (7): 1506-1518
Copyright © 2006 by The Endocrine Society

Receptor-Interacting Protein 140 Is a Repressor of the Androgen Receptor Activity

Sophie Carascossa, Jérôme Gobinet, Virginie Georget, Annick Lucas, Eric Badia, Audrey Castet, Roger White, Jean-Claude Nicolas, Vincent Cavaillès and Stéphan Jalaguier

Institut National de la Santé et de la Recherche Médicale (S.C., J.G., V.G., A.L., E.B., A.C., J.-C.N., V.C., S.J.), Unité 540, Montpellier F-34090, France; and Institute of Reproductive and Developmental Biology (R.W.), Imperial College London, London W12 0NN, United Kingdom

Address all correspondence and requests for reprints to: Stéphan Jalaguier, Institut National de la Santé et de la Recherche Médicale, Unité 540, 60 rue de Navacelles, F-34090 Montpellier, France. E-mail: jalaguie{at}montp.inserm.fr.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 
The androgen receptor (AR) is a ligand-activated transcription factor that controls growth and survival of prostate cancer cells. In the present study, we investigated the regulation of AR activity by the receptor-interacting protein 140 (RIP140). We first showed that RIP140 could be coimmunoprecipitated with the receptor when coexpressed in 293T cells. This interaction appeared physiologically relevant because chromatin immunoprecipitation assays revealed that, under R1881 treatment, RIP140 could be recruited to the prostate-specific antigen encoding gene in LNCaP cells. In vitro glutathione S-transferase pull-down assays provided evidence that the carboxy-terminal domain of AR could interact with different regions of RIP140. By means of fluorescent proteins, we demonstrated that ligand-activated AR was not only able to translocate to the nucleus but also to relocate RIP140 from very structured nuclear foci to a diffuse pattern. Overexpression of RIP140 strongly repressed AR-dependent transactivation by preferentially targeting the ligand binding domain-dependent activity. Moreover, disruption of RIP140 expression induced AR overactivation, thus revealing RIP140 as a strong AR repressor. We analyzed its mechanism of transrepression and first demonstrated that different regions of RIP140 could mediate AR-dependent repression. We then showed that the carboxy-terminal end of RIP140 could reverse transcriptional intermediary factor 2-dependent overactivation of AR. The use of mutants of RIP140 allowed us to suggest that C-terminal binding protein played no role in RIP140-dependent inhibition of AR activity, whereas histone deacetylases partly regulated that transrepression. Finally, we provided evidence for a stimulation of RIP140 mRNA expression in LNCaP cells under androgen treatment, further emphasizing the role of RIP140 in androgen signaling.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 
DEFECTS IN ANDROGEN signaling result in a large panel of clinical phenotypes ranging from perturbation in male sexual development to prostate cancer etiology (1, 2). Because androgen stimulation regulates prostate epithelial cell growth, treatment for advanced prostate cancer, the major malignancy in men in Western countries, can be achieved by eradication of androgen action through androgen withdrawal using chemical or surgical castration (3). However, the disease invariably progresses to an androgen-independent state. Therefore, elucidation of mechanisms that regulate androgen actions is of critical importance.

The effects of androgens are mediated by the androgen receptor (AR), a transcription factor member of the nuclear receptor superfamily. Unliganded AR is a cytoplasmic protein associated in an inactive state with heat shock proteins (4). Under hormone binding, the receptor undergoes conformational changes that induce its translocation from the cytoplasm to the nucleus. To regulate transcription of target genes, AR binds to specific DNA sequences called androgen response elements (ARE) (1). The receptor harbors three main functional domains: the amino-terminal domain where the primary ligand-independent transactivation domain, activating function (AF) 1 (amino acids 142–337) supports the major transactivation function of the receptor (5), the central DNA binding domain, and the carboxy-terminal domain also called ligand binding domain (LBD) (1). The AR LBD is highly conserved among the steroid receptor family of proteins and contains the weak transcriptional activation domain AF2 (6).

AR-mediated transactivation requires the concerted action of AF1 and AF2 (6). To date, a great number of AR cofactors have been described to mediate androgens action (7). Gene activation by the AR is thought to require the general initiation factors that form preinitiation complexes on common core promoter element (8) and different general and specific coactivators that either modulate chromatin structure (9) or serve as direct adapters between the receptor and general initiation factors (10). The interest in AR corepression rapidly developed in the recent years and subsequently the number of AR corepressors drastically increased (see Ref. 11 for a review). The mechanism of action for many corepressors remains to be discovered. However, recruitment of histone deacetylases (HDACs) is a common way to repress AR activity. In that category are found different proteins (12, 13, 14) including the short heterodimer partner (SHP) (15), which can be all recruited by the agonist-activated AR.

RIP140 (receptor-interacting protein of 140 kDa) is a protein of 1158 amino acids that is recruited by a large number of agonist-activated receptors, including estrogen receptor (ER) {alpha}, thyroid hormone receptor, retinoic acid receptor, and retinoid X receptor (16), AR (17), vitamin D receptor (18), peroxisome proliferator-activated receptor {alpha}/ligand X receptor {alpha} (19), or glucocorticoid receptor (20). It was also shown to interact with other nuclear receptors such as steroidogenic factor 1 or dosage-sensitive sex reversal-adrenal hypoplasia congenita gene on the X chromosome (DAX-1) (21) or other transcription factors including the aryl hydrocarbon receptor (22), 14-3-3 (23) or c-jun (24). Its mechanism of action not only involves a competition with coactivators such as those belonging to the p160 family (25), but it also implies active repression. We and others recently provided evidence of four repressive domains in the molecule involving complex mechanisms relying on multiple partners, including HDACs and C-terminal binding proteins (CtBPs) (26, 27).

Surprisingly, although widely depicted as a corepressor, a study by Ikonen et al. (17) described RIP140 as a strong coactivator for AR. To decipher RIP140 mechanism of action, we investigated further its role in the androgen signaling pathway. In the present paper, we first characterized the interaction between RIP140 and AR and provided evidence for a nuclear relocalization of RIP140 upon activation of the receptor. We showed that RIP140 is a strong AR repressor and to shed light on the mechanism of RIP140-dependent inhibition, we investigated the role of CtBPs and HDAC as well as a competition with a p160 coactivator. Finally, we demonstrated that RIP140 mRNA expression in LNCaP cells was significantly increased by a treatment with R1881, further emphasizing the role of RIP140 in AR activity.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 
RIP140 Interacts with AR
To determine whether AR could interact with the coregulator RIP140, we first performed immunoprecipitations between full-length proteins (Fig. 1AGo). 293T cells were either nontransfected (lanes 1 and 2) or transfected with pCMV-AR alone (lanes 3 and 4), pCMV-AR and pEF-c-mycRIP140 (lanes 5 and 6) or pEF-c-mycRIP140 alone (lanes 7 and 8), and treated with 10–8 M R1881. As shown in the figure, when AR is expressed alone the use of an anti-AR antibody immunoprecipitated the receptor (lane 4, upper panel). When AR and c-mycRIP140 were coexpressed, the same antibody not only pulled-down AR (lane 6, upper panel) but also c-mycRIP140 (lane 6, lower panel). We noted the band corresponding to c-mycRIP140 was slightly retarded as compared with the input which could be due to differences in salt concentrations. It has to be noticed that, as a control for the immunoprecipitation, when pEF-c-mycRIP140 was transfected alone (lanes 7 and 8), the use of an anti-AR antibody could not pull down c-mycRIP140, thus strengthening the specificity of the interaction.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. RIP140 Interacts with AR

A, Immunoprecipitations. 293T cells were either nontransfected (lanes 1 and 2), transfected with pCMV-AR alone (lanes 3 and 4), with pCMV-AR and pEF-c-mycRIP140 (lanes 5 and 6) or with pEF-c-mycRIP140 alone (lanes 7 and 8) and treated with R1881 (10–8 M). The immunoprecipitations were undertaken using an anti-AR monoclonal antibody and the Western blots were performed with either an anti-AR polyclonal antibody (upper panel) or an anti-c-myc monoclonal antibody (lower panel). B, GST pull-downs assays. The assays were performed as described in the Materials and Methods using 35S-labeled AR, AR (1–501) or AR (618–919), and purified GST, GST-RIP (27–439), GST-RIP (428–739) or GST-RIP(683–1158) in the presence of R1881 (10–6 M). GST alone was used as a control for the interaction. The inputs represent 10% of the in vitro translated AR used in each assay. C, Interaction of RIP140 with PSA promoter and enhancer. LNCaP cells (2 x 106) were grown for 7 d in DMEM 3% DCC before hormone treatment. They were then treated with R1881 10–8 M or vehicle (ethanol) for 1 or 6 h. ChIP assays were performed as described in Materials and Methods. Each experiment was repeated twice and quantitative PCR analyses were performed in duplicates (mean ± SD).

 
To investigate further the interaction and determine which domains of the proteins were involved, we performed in vitro glutathione S-transferase (GST) pull-downs. In this series of experiments, three fragments of RIP140 spanning the whole protein were expressed as GST fusion proteins and either full-length or truncated domains of AR were in vitro translated. As indicated in Fig. 1BGo, upper panel, in the presence of R1881, full-length AR interacted with the three regions of RIP140. However, the binding appeared stronger with GST-RIP140 (27–439). As observed in Fig. 1BGo, middle panel, only a very faint band corresponding to the binding between GST-RIP (27–439) and AR (1–501) could be detected, whereas none was observed with either the central or the carboxy-terminal part of RIP140. In the lower panel, we analyzed the interaction with the carboxy-terminal part of the receptor in the presence of R1881. As observed, both GST-RIP (27–439) and GST-RIP(683–1118) appeared to have a strong affinity for AR (618–919), whereas GST-RIP (428–739) displayed a lower but still significant binding. Only a faint band was observed when GST was incubated with either full-length AR or AR (618–919), whereas none appeared with AR (1–501). It must be stated that the experiments with either full-length AR or AR (618–919) were also performed in the absence of R1881 and gave the same degree of interaction (data not shown). Coomassie staining of the gels indicated that the amount of GST fusion proteins was kept constant in all experiments (data not shown).

To give further credit to the interaction, we wondered whether RIP140 could be recruited to an androgen-dependent gene. To this end, we performed chromatin immunoprecipitation (ChIP) assay with an anti-RIP140 antibody on LNCaP cells previously treated or not with 10–8 M R1881. Because a recent work (28) provided evidence that transcription factors could differentially recruit the promoter and the enhancer of the prostate-specific antigen (PSA) gene, these different regions of the gene were then amplified (Fig. 1CGo). As observed on the figure either a 1- or 6-h treatment with the AR agonist induced a clear amplification of both the PSA promoter and the enhancer as quantified by quantitative PCR demonstrating that an AR-responsive gene could be a target of RIP140.

We conclude from these experiments that RIP140 interacts with AR both in vitro and in intact cells. Furthermore, the interaction is mediated on one hand by several regions covering the entire cofactor and on another hand by the LBD of AR.

AR Relocalizes RIP140
Subcellular localization of transcription factors is tightly regulated. Therefore, we questioned whether overexpression of one partner could affect the localization of the other. We first transfected COS7 cells with pYFP-RIP140 (see Fig. 2AGo). As observed in the left panel, whatever the treatment of the cells yellow fluorescent protein (YFP)-RIP140 always formed foci in the nucleus, a structure already described (26). In Fig. 2AGo, right panel, the cells were cotransfected with vectors expressing cyan fluorescent protein (CFP)-AR and YFP-RIP140. When the cells were incubated with ethanol, AR was localized to the cytoplasmic compartment, whereas RIP140 was nuclear and formed regular foci (upper panel). When treated with the agonist R1881, AR was entirely translocated to the nucleus (Fig. 2AGo, middle panel). Remarkably, in the same cell, RIP140 presented a more evenly spread nuclear localization with only rare foci. Interestingly, when the cells were treated with the complete antagonist bicalutamide, AR was translocated to the nucleus as previously described (29), but there RIP140 formed the same foci as observed in the presence of ethanol. Interestingly, when merged the two signals did not show a colocalization of the two proteins. From these observations, we can conclude that translocation of the activated AR relocalized RIP140. Moreover, the relocalization was specific to the activated receptor because the bicalutamide-liganded AR was not able to trigger it.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2. Intranuclear Distribution of CFP-AR and YFP-RIP140

COS7 cells were transiently transfected with vectors expressing either the fusion protein YFP-RIP140 alone or together with CFP-AR (A), CFP-AR (1–501) (B, left panel) or CFP-AR (507–919) (B, right panel). Cells were incubated overnight in the presence of either vehicle or ligands (10–8 M R1881 or 10–6 M bicalutamide), fixed with 4% paraformaldehyde and then observed using a Leica SP2 Confocal microscope. Pseudocolors were used (blue for CFP and yellow for YFP).

 
Then, we wondered whether AR amino- or carboxy-terminal domains would induce differential localizations of RIP140. Therefore, we cotransfected COS7 cells with YFP-RIP140 together with either CFP-AR (1–501) (Fig. 2BGo, left panel) or CFP-AR (507–919) (Fig. 2BGo, right panel). As observed in the left panel, whatever the treatment, CFP-AR (1–501) stayed in the cytoplasm, whereas YFP-RIP140 was organized in nuclear foci. In Fig. 2BGo, right panel, it is interesting to observe that CFP-AR (507–919) in the absence of agonist ligand was nuclear but evenly spread, whereas YFP-RIP140 still formed foci. Remarkably, under R1881 treatment CFP-AR (507–919) was organized in large foci. In the same conditions, YFP-RIP140 was organized in structures of the same size as CFP-AR (507–919). As observed on the overlay picture, the two proteins were perfectly colocalized. These data strengthen the evidence of a ligand-dependent intracellular interaction between RIP140 and AR mediated by the carboxy-terminal domain of the receptor.

RIP140 Inhibits AR-Dependent Transactivation
We then investigated the role of RIP140 on AR-dependent transactivation. In a first series of experiments, CV1 cells were transfected with pCMV-AR and increasing amounts of pcRIP140 (Fig. 3AGo). As shown in the figure, RIP140 dose-dependently inhibited AR-mediated transactivation with a maximal repression obtained with 2 µg of transfected pcRIP140.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. RIP140 Inhibits AR-Dependent Transactivation

A, RIP140 represses AR-dependent transactivation. CV1 cells were transfected using the calcium phosphate method with 10 ng of pCMV-AR and increasing amounts of pcRIP140. The pcDNA empty vector was used to keep the amount of DNA transfected constant. B, AR is overactivated in cells devoid of RIP140. Wild-type (wt) or RIPKO (–/–) MEF cells were cotransfected with either 10 or 50 ng of pCMV-AR using the calcium phosphate method. C, Different domains of RIP140 participate in AR-dependent transactivation. Ten nanograms of pCMV-AR, as well as 800 ng of each mutant, were transfected in CV1 cells using the calcium phosphate method. D, RIP140 reverses TIF2-induced AR activity. CV1 cells were transfected with 10 ng of pCMV-AR, 200 ng of psg5-TIF2 and increasing amounts of pcRIP(917–1158). The luciferase activity was expressed taking AR in the presence of R1881 as 100% of the activity. The mean ± SD values from at least three independent experiments are shown. {blacksquare}, Ethanol; Figure 3, R1881 (10–9 M).

 
We then asked whether an extinction of RIP140 could affect AR transactivation. To this end, we used mouse embryo fibroblasts lacking the RIP140 gene (termed RIPKO-1) (30) as well as the wild-type counterpart cells. As observed in Fig. 3BGo, whatever the dose of vector transfected, AR was repeatedly overactivated in RIPKO-1 cells treated with R1881 as compared with the wild type. It has to be noticed that no difference in AR expression could be observed in either cell type (data not shown). This experiment allowed us to propose that endogenous RIP140 exerts a significant repressive effect on AR-dependent transactivation, further emphasizing results described above.

RIP140 possesses nine nuclear receptor boxes (31) and results from Fig. 1Go showed that several regions of RIP140 were able to mediate its interaction with AR. Therefore, we investigated in CV1 cells the repressive potential of RIP140 constructs spanning different domains of the cofactor on AR-dependent transcription. As shown in Fig. 3CGo, all the constructs tested displayed a high degree of repression. However, the two fragments encompassing the amino-terminal part of RIP140, i.e. RIP140 (1–282) and RIP140 (1–480) did not exhibit a repressive potential as strong as the wild type. By sharp contrast, the carboxy-terminal fragment of RIP140 and more precisely RIP140(917–1158) exhibited an even stronger repression than full-length RIP140. We concluded that different domains of RIP140 can mediate AR-dependent repression.

It has already been shown that RIP140 can compete away coactivators to bind nuclear receptors (25). Moreover, results presented above provided evidence of the carboxy-terminal domain of RIP140 as a strong inhibitor. Therefore, we investigated whether RIP140(917–1158) could compete with an AR coactivator, transcriptional intermediary factor 2 (TIF2), for repression of the receptor. As shown in Fig. 3DGo, when CV1 cells were cotransfected with pSG5-TIF2, AR-dependent transcription was augmented. Remarkably, cotransfections with increasing amounts of pcRIP140(917–1158) not only reversed AR overactivation, but also completely down-regulated AR activity. Noticeably, the same experiment was performed with full-length RIP140, and the same results were obtained (data not shown). These data allowed us to propose that the carboxy-terminal part of RIP140 can act as a strong competitor for p160-mediated activation of AR.

AR exhibiting two transactivation domains, lying in the amino- and the carboxy-terminal parts of the receptor, we asked whether results from protein-protein interactions would be corroborated by transactivation assays. We first studied the effect of RIP140 on the constitutively active AR (1–660). CV1 cells were transfected with a constant dose of pCMV-AR (1–660) and increasing amounts of pcRIP140. As shown in Fig. 4AGo, whatever the quantity of pcRIP140 transfected, AR (1–660)-dependent activity could not be modulated, indicating that the main activation domain of AR, when isolated, was not a target for RIP140.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. RIP140 Exerts Its Repression via the Carboxy-Terminal Domain of AR

A, RIP140 has no effect on AR (1–660)-dependent transactivation. CV1 cells were transfected as above with 100 ng of pCMV-AR (1–660) and increasing amounts of pcRIP140. The luciferase value given by pCMV-AR (1–660) in the absence of pcRIP140 was determined as 100%. B, RIP140 inhibits AR (507–919)-dependent activity. CHO cells were transfected using the FUGENE-6 according to the manufacturer’s instructions with 100 ng of pCMV-AR (507–919), with or without psg5-TIF2 and pEF-RIP140. The luciferase activity was expressed taking AR (507–919) + TIF2 as 100% of the activity. The mean ± SD values from at least three independent experiments are shown.

 
We then asked whether RIP140 could inhibit AR LBD-dependent transactivation. We thus used the deletion mutant AR (507–919) that lacks the amino-terminal domain and displays no transcriptional activity per se. To restore its transcriptional ability in a strictly ligand-dependent manner, CHO cells were cotransfected with an AR coactivator, TIF2 (Fig. 4BGo). In those conditions, as shown in the figure, a dose as low as 50 ng of pcRIP140 was sufficient to completely reverse TIF2-induced activity of AR (507–919).

This series of data supports the conclusion that RIP140 represses AR-dependent activity by targeting its LBD.

HDACs But Not CtBPs Participate in RIP140-Dependent Repression
In a previous study, we precisely defined the role of the two C-terminal binding proteins (CtBPs) on RIP140 activity (26). In that work, the use of RIP140 proteins harboring mutations preventing the interaction with CtBPs significantly affected RIP140 repressive potential. Therefore, to further enlighten the mechanism of action of RIP140-mediated inhibition of AR we questioned the role of CtBPs.

RIP140 possesses two CtBP-interacting sites corresponding to the sequences PIDLS and PINLS (26). We used vectors coding for RIP140 with single or double mutations for the two interaction motifs.

As observed in Fig. 5Go, it appeared that transfections of 293T cells with either RIP140-mutPIDLS, RIP140-mutPINLS or RIP140-mutPID/NLS did not result in any change in RIP140-mediated AR repression.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. CtBPs Do Not Participate in RIP140-Dependent AR Transactivation

293T cells were transfected with 10 ng of pCMV-AR, increasing amounts of pEF-c-mycRIP140(wt), pEF-c-mycRIP140(PIDLS), pEF-c-mycRIP140(PINLS) or pEF-c-mycRIP140(PID/NLS). The luciferase activity was expressed taking AR in the presence of R1881 as 100% of the activity. The mean ± SD values from at least three independent experiments are shown.

 
We concluded that in our experimental conditions, CtBP could not account for RIP140-dependent inhibition of AR.

In the same above-mentioned study, we showed that RIP140 could interact with class I and class II HDACs (26). Therefore, we asked whether such enzymes would participate in the repression of AR on two different promoters.

We first studied the routinely used mouse mammary tumor virus (MMTV) promoter (Fig. 6AGo). When CV1 cells, first transfected with increasing amounts of RIP140 expressing vectors were then treated with 50 nM trichostatin A (TSA), a specific inhibitor of HDAC activity, we still observed a strong repressive effect of RIP140 on AR transactivation. However, as compared with RIP140-dependent activity without TSA, the same degree of repression was never reached. This first series of data indicated that HDAC activity could partly account for RIP140-dependent AR transcription.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. TSA Reverses the Repressive Effect of RIP140 on AR Transactivation

CV1 cells were transfected with 10 ng of pCMV-AR, increasing amounts of pEF-RIP140, and either 1 µg of MMTV (A) or 1 µg of tyrosine aminotransferase (TAT) (B) promoters. The experiments were done both in the absence and in the presence of 50 nM TSA. The luciferase activity was expressed taking AR in the presence of R1881 as 100% of the activity. The mean ± SD values from at least three independent experiments are shown.

 
To complete this investigation, we then studied the effect of the drug on another AR-responsive promoter, i.e. the tyrosine aminotransferase promoter. As shown in Fig. 6BGo, RIP140 displayed a repressive effect, although not as strong as observed on the MMTV promoter. Indeed, the maximal effect, obtained with 2 µg RIP140 transfected resulted in 60% decrease of AR activity, whereas a 90% decrease was observed with the MMTV promoter. In the same conditions, under 50 nM TSA, the basal activity of AR was significantly augmented (Fig. 6BGo, right panel). Nevertheless, as observed in the figure, TSA had a striking effect on RIP140-dependent inhibition. Indeed, it appeared that, under TSA treatment, RIP140 only induced between 20 and 30% decrease of AR transactivation potential as compared with the 70% decrease observed on a MMTV promoter.

We concluded from this study that TSA had an effect on RIP140-mediated repression of AR, which is dependent on the nature of the promoter.

R1881 Induces RIP140 mRNA Expression in LNCaP Cells
RIP140 mRNA expression was already shown to be under the control of different hormones/nuclear receptor ligands, including estradiol (32) and all-trans retinoic acid (33). We therefore asked whether androgens could as well stimulate RIP140 mRNA expression. To this end, we treated LNCaP cells with 10 nM R1881 and then performed a Northern blot analysis (Fig. 7Go). As shown in the figure, nontreated cells displayed barely detectable amounts of RIP140 mRNA. Remarkably, under stimulation with R1881, the amount of mRNA rapidly augmented after a 1-h treatment to reach a peak at 6-h induction. This experiment allowed us to propose that, in prostate cells, RIP140 expression is under the control of androgens, thus revealing a potential feed-back loop.


Figure 7
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7. R1881 Stimulates RIP140 mRNA Expression in LNCaP Cells

Northern blot analysis of RIP140 mRNA induction in LNCaP cells treated with 10 nM R1881. Upper panel, Time course expression of RIP140 mRNA expression. The same membrane was also hybridized with a 36B4 probe to control for RNA loading and transfer. Lower panel, Relative ratio of RIP140 to 36B4 signals as determined by phosphor imaging analysis. The figure shown is representative of three independent experiments. Ctl refers to control for which cells were incubated with vehicle for 12 h.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 
This study, aimed at investigating the role of RIP140 on AR-dependent transactivation clearly provides evidence that RIP140 acts as a strong AR repressor. A controversy raised a few years ago when RIP140 was first described as a coactivator for AR (17). At that time, RIP140 was believed to have modulating effects that could vary with the amount of DNA transfected. Indeed, as first shown with ER, low doses of RIP140 were described to slightly increase ER-dependent transactivation, whereas higher amounts had the opposite effect (34). In the study by Ikonen et al. (17), the authors observed a paradoxical effect of RIP140: when cotransfected with AR it behaved as a strong coactivator, whereas it strongly inhibited the interactions between amino- and carboxy-terminal domains. Since then, the need for ligand-dependent intramolecular interactions between the carboxy- and amino-terminal interactions was extensively described for a full AR transactivation (35, 36). Therefore, it appears puzzling to envisage that a protein that exerts a repression of the intramolecular interactions would act as a strong AR coactivator.

In the present study, we first provided clear evidence of the interaction between the two full-length proteins and further delineated the interaction between the LBD of AR and several domains of RIP140. It is noticeable that RIP140 displays nine so-called nuclear receptor boxes, i.e. the LXXLL motifs. These motifs are randomly distributed along the protein sequence, which would explain why the three domains interacted with the carboxy-terminal domain of AR. Although it is not yet explained which motifs in RIP140 would be specifically recruited by AR, a previous study investigated the relative affinity of RIP140 LXXLL motifs for nuclear receptors, evidencing some selectivity (31). Along with this study, fluorescence anisotropy analysis showed that the RIP140 LXXLL motifs presented differential affinities for ER{alpha} and ERß (our unpublished results).

RIP140 is a nuclear protein that was described to form small nuclear foci (37). Tazawa et al. (37) described that when RIP140 was coexpressed with glucocorticoid receptor, stimulation of the cells with a glucocorticoid ligand induced a relocalization of the cofactor to a more diffuse pattern. In our experiments, we described that RIP140 formed previously described nuclear foci. But, when coexpressed with AR previously liganded with R1881, RIP140 was completely relocalized to a diffuse pattern. This relocalization was very specific to the agonist because the antagonist-bound AR was not able to induce such a change. Our results concerning the intracellular localization of AR subdomains may appear contradictory of the study by Saitoh et al. (38) because they described AR-AF1-YFP to form foci, whereas the AR amino-terminal domain had a diffuse pattern in our hands. It must be underlined that their construct includes the constitutively active receptor, which induces a nuclear localization of the fluorescent protein. Very interestingly, when CFP-AR (507–919) was coexpressed with YFP-RIP140 and treated with R1881, the cofactor was completely relocalized with AR LBD, further supporting the fact that AR carboxy-terminal domain of AR is the target for RIP140. It can be hypothesized that a relocalization of RIP140 concomitant to that of the interacting receptor could be a way to activate and render RIP140 available for its targets.

Both the in vitro interaction data and the cotransfection experiments showed that the LBD of AR was the target of RIP140 action. Many corepressors of AR were shown to target the carboxy-terminal part of the receptor, including amino-terminal enhancer of split (AES) (39), DAX-1 (40), hRAD9 (41), nuclear receptor corepressor, and silencing mediator of retinoid and thyroid receptors (SMRT) (42), histone acetyltransferase binding to ORC (HBO1) (43), HDAC1 (44), and SHP (45). These corepressors are recruited by the agonist-activated receptor but their mechanisms of action, when elucidated are very different from one protein to another. Only a few can be recruited by the AR DNA binding domain. Among them can be found ARR19 (13), DJ-1 binding protein (DJBP) (14), or sex-determining region (SRY) (39). By sharp contrast, the corepressors able to be recruited by the amino-terminal domain of AR are rare: SHP (45), Daxx (46), Cyclin D1 (47), and Hey1 (48).

Based on our work, it is tempting to postulate that RIP140 first interacts with AR LBD, hence preventing the interaction between the amino- and carboxy-terminal ends of the receptor as shown by Ikonen et al. (17). In a previous study by Treuter et al. (25), the authors demonstrated that RIP140 was capable of competing with steroid receptor coactivator-1 for binding to nuclear receptors. Herein, we showed that RIP140 was able to reverse the overactivation of AR triggered by TIF2. In a similar way, we can propose that a second level of repression could be achieved by the competition between coactivators members of the p160 family of proteins and RIP140. Then, RIP140 could develop its repression activity by recruiting other proteins able to mediate AR inhibition.

Recently, CtBP was shown to be recruited by RIP140 and could partly account for the cofactor-dependent intrinsic repression (26, 49). However, in the present paper, the use of RIP140 mutants unable to bind to CtBPs allowed us to show that this negative modulator had no effect on RIP140-mediated AR activity.

The use of a specific inhibitor of HDAC activity, TSA, significantly affected RIP140 repression. As previously reported, the intrinsic repressive potential of RIP140 was shown to be sensitive to TSA (50). However, this evidence was then contradicted by the report of Castet et al. (26) where the effect of TSA was efficient on subdomains of RIP140 fused to a heterologous protein, whereas the drug had no effect on the full-length protein. Still, in the same study, we described an interaction between a class II HDAC, precisely HDAC5, and RIP140. Along with this study, in our investigations, TSA had different effects according to the promoter context further supporting this hypothesis. We therefore hypothesize that, depending on RIP140 targets and cellular context, HDAC proteins may be differentially recruited and therefore have very different effects on the nuclear receptor activity.

We and others (26, 27) showed that the carboxy-terminal domain of RIP140 displayed a strong intrinsic repression. Still, to date no protein was isolated and shown to mediate that repression. Moreover, results obtained with TSA suggest that non-HDAC proteins also participate in RIP140-dependent transrepression of AR. Therefore, we are currently investigating that issue to decipher the complete mechanism of action of the cofactor.

RIP140-dependent repression of AR is reminiscent of that found for other AR corepressors including SHP (15). Indeed, we described SHP as a cofactor able to exert its transcriptional repression through both a competition with AR coactivators and also by recruitment of HDAC activities. According to the cellular context, RIP140 could exert its repressive functions via various proteins. This large potential could well be a way to make sure the protein can exert a strong repressive action.

The present work also revealed that RIP140 mRNA was under the control of R1881 in LNCaP cells. The induction of mRNA expression was rapid and reached a maximum effect after 6 h. At this point, it is impossible to conclude whether this induction requires de novo protein synthesis or whether it is directly mediated by AR-stimulation of the gene. However, isolation of the gene coding for RIP140 revealed that the promoter region contained at least three consensus androgen receptor elements (our unpublished results), suggesting that the mRNA expression could be directly stimulated by the receptor. It must be underlined that such an induction is reminiscent of the previously described estradiol and retinoic acid-mediated RIP140 mRNA expression (33, 51).

Very interestingly, our data from ChIP assays clearly indicated that, under AR agonist treatment, RIP140 was recruited to both the promoter and the enhancer regions of the PSA gene with a better recruitment to the promoter than to the enhancer. Recent studies were undertaken to investigate the dynamics of different transcription factors onto the PSA gene in response to androgens. Two different studies described AR as preferentially recruited to the enhancer but differed with description of either a receptor’s residence time being more transient on the enhancer (52) or a long-term recruitment of the receptor to that region (28). The two papers also differed in describing the recruitment of different receptor cofactors with either a loading of the p160 family members to both the enhancer and promoter of the PSA gene (52) or a preferential recruitment of the enhancer region of the gene (28). However, very little is known about loading of AR corepressors to androgen-responsive genes. In that context, it would be of interest to undertake a kinetics study of RIP140 association to a specific AR-responsive gene such as PSA. That work would tell us when that recruitment to the promoter occurs with regards to other transcription factors (52) and would permit us to give substantial insight into the androgen-induced expression of RIP140 mRNA we showed. Overall, we believe that the potential physiological loop we observed in prostate cells is of importance because it would allow a precise control of the androgen activity in many physiopathological issues including cancer.


    Materials and Methods
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 
Plasmids
Mammalian Expression Plasmids
pCMV-AR and pSG5-TIF2 were generous gifts from, respectively, Drs. Terry Brown (Johns Hopkins Bloomberg School of Public Health, Baltimore, MD) and Hinrich Gronemeyer (IGBMC, Illkirch, France). pCMV-AR (1–660), pCMV-AR (507–919) (45) and pFC31-Luc (53) were already described. pEYFP-RIP140, pcRIP140, pcRIP (1–282), pcRIP (1–480), pcRIP(479–1158), pcRIP(917–1158), pcRIPmutPIDLS, pcRIPmutPINLS and pcRIPmutPID/NLS were described elsewhere (26). pEF-c-mycRIP140 was created by inserting the PCR-amplified cDNA encoding c-myc fused to RIP140 amino-acids 1–479 into pEF-RIP140 previously digested with BclI and EcoRV. pEF-RIPmutPIDLS was created by digestion of pcRIPmutPIDLS with BclI and EcoRV and insertion of the resulting fragment into pEF-RIP140. pEF-RIPmutPINLS was created by digestion of pcRIPmutPINLS with EcoRV and BlpI and insertion of the resulting fragment into pEF-RIP140. pEF-RIPmutPID/NLS was created by digestion of pcRIPmutPID/NLS with BclI and BlpI and insertion of the resulting fragment into pEF-RIP140.

pECFP-AR (507–919) was created by inserting the PCR-amplified cDNA encoding AR (507–919) into pECFP-C2 previously digested with BamHI. pGFP-AR (1–501) was digested with XhoI and XbaI and the resulting fragment was inserted into pECFP-AR previously digested with the same enzymes to create pECFP-AR (1–501). pECFP-AR was obtained by insertion of AR excised by NheI and BglII restriction sites from the previously described pGFP-AR (29) into pECFP-C1 (CLONTECH, Palo Alto, CA).

Bacterial Expression Plasmids
pGEX-RIP (27–439), pGEX-RIP (428–739), and pGEX-RIP(683–1158) were described elsewhere (16).

Plasmids for in Vitro Expression
pGBK-AR, pGBK-AR (1–501), and pGBK-AR (627–919) were previously described (45).

Transient Transfection
CV1, COS7, and 293T cells were maintained in DMEM supplemented with 10% fetal calf serum (FCS). For transient transfection experiments, cells were plated in 12-well dishes and transfected using the calcium phosphate method. CHO and MEF cells were cultured in DMEM-F12 supplemented with 10% FCS and transfected using FuGENE 6 according to the manufacturer’s instructions (Roche, Meylan, France) and calcium phosphate respectively. Whenever different amounts of an expressing vector were transfected, the quantity of DNA was kept constant by the use of the empty vector. Twelve hours after transfection, and 24–30 h before lysis, R1881 was added to a final concentration of 10–9 M. When indicated, TSA was added 17 h before lysis. Cells were then harvested in a lysis buffer [25 mM Tris-H3PO4 (pH 7.8), 2 mM dithiothreitol (DTT), 2 mM EDTA, 1% Triton X-100, and 10% glycerol], and the luciferase activity was measured by the reaction of lysate with the luciferin solution (270 µM coenzyme A, 470 µM luciferin, 530 µM ATP, 20 mM Tris-H3PO4, 1.05 mM MgCl2, 2.7 mM MgSO4, 0.1 mM EDTA, and 33 mM DTT) on a luminometer. In all experiments pCMV-ßgal was used to normalize the transfection efficiency.

Fluorescence Microscopy and Imaging Analysis
COS7 cells were cultured on coverslips and then transfected with 1 µg of each plasmid using 3 µl of FuGENE 6 reagent (Roche) per dish. Twenty-four hours after transfection, the culture medium was replaced with serum-free DMEM for overnight starvation. Cells were incubated with R1881 (10–8 M) or antihormones (10–6 M) for 8 h, fixed with 4% paraformaldehyde for 15 min, washed three times with PBS and mounted on slides with Dako (Carpinteria, CA) mounting medium. The cells were imaged using confocal laser scanning microscopy (Leica SP2 UV system; Leica Microsystems, Heidelberg, Germany). CFP was excited with a 457-nm argon laser line and CFP emission was sampled between 460 and 490 nm. The cells were imaged for yellow fluorescence by excitation with the 514-nm argon laser line and emission was sampled between 520 and 550 nm. The images were analyzed with LCS (Leica Confocal Software) and merged images were generated by Adobe Photoshop software.

In Vitro Transcription and Translation
Expression plasmids pGBK-ARwt, pGBK-AR (1–501) and pGBK-AR (618–628) were transcribed and translated using the TNTT7-coupled reticulocyte lysate system (Promega, Charbonnieres, France) in the presence of 35S-labeled methionin for 1 h 30 min at 30 C according to the manufacturer’s instructions.

GST Pull-Down
GST, GST-RIP (27–439), GST-RIP (428–739), and GST-RIP(683–1158) were produced and purified as previously described (26). Each aliquot of 500 µl containing 30 µl of Glutathione Sepharose (Pharmacia, Uppsala, Sweden) was mixed with either 35S-labeled ARwt, AR (1–501) or AR (618–928). After incubation for 3 h at 4 C, beads were washed four times with PDB [PBS containing 20 mM HEPES-KOH (pH 7.9), 10% glycerol, 100 mM KCl, 5 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, 0.2 mM phenylmethylsulfonyl fluoride], and boiled for 5 min in the presence of sodium dodecyl sulfate (SDS) buffer. Proteins were then separated on a 10% SDS-PAGE. Gels were colored with coomassie blue, dried, and autoradiographies were performed with Kodak (Rochester, NY) Biomax films. The figures are representative of at least three independent experiments.

Immunoprecipitations
293T cells were transfected and treated with 10 nM R1881 as described above except that 100-mm dishes were used and 10 mg of pCMV-AR and pEF-c-mycRIP140 were transfected. The cells were resuspended in 500 µl of lysis buffer [50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 5 mM CaCl2, 5 mM MgCl2, 1% Nonidet P-40, 1% Triton] supplemented with protease inhibitors. Four hundred microliters of each extract were first incubated with the anti-AR (AR-441; Santa Cruz) monoclonal antibody for 2 h at 4 C, and then with Protein G Sepharose for an additional 16 h at 4 C. Protein G-Sepharose containing the immune complex was then washed three times with the washing buffer [50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 5 mM CaCl2, 5 mM MgCl2, 0.1% Nonidet P-40] and resuspended in SDS-containing sample buffer. The proteins were resolved through a 6% SDS-PAGE and immunoblotted with either an anti-c-myc monoclonal antibody or an anti-AR polyclonal antibody (N20; Santa Cruz). Signals were detected with the ECL method (Amersham Biosciences) using Kodak Biomax films.

ChIP Analysis
ChIP assays were performed as described in Metivier et al. (54) with minor modifications. In brief, at the end of hormone treatment, medium was removed and replaced by PBS containing hormone or ethanol. Chromatin was cross-linked using 1% formaldehyde at 25 C for 10 min followed by a 15-min incubation with 250 mM glycine. Cells were then rinsed twice with cold PBS and centrifuged. PBS was removed and cells were quickly frozen, using liquid nitrogen, until sonication process of all samples. Cells were then washed sequentially with buffer A [10 mM EDTA, 0.5 mM EGTA, 10 mM HEPES (pH 6.5) and 0.25% Triton X-100] and buffer B [1 mM EDTA, 0.5 mM EGTA, 10 mM HEPES (pH 6.5), and 200 mM NaCl], containing antiproteases. They were then resuspended in Lysis buffer [10 mM EDTA, 50 mM Tris-HCl (pH 8.0), 1% SDS, 0.5% Empigen BB]. Samples were sonicated eight times for 4 sec at 60% settings (Bioblock Vibra cell, Model 7205) and centrifuged at 14,000 rpm at 4 C. Immunoprecipitations [using 2 µg of H300 anti-RIP140 (Santa Cruz, le Penay, France)], and washes were performed as described in Ref. 54 (except that samples were diluted 10 times with immunoprecipitation dilution buffer containing antiproteases). DNA was purified with QIAquick columns (QIAGEN, Courtaboeuf, France). Real-time PCRs were performed using 3 µl of sample DNA, and 3 µl of diluted inputs. The primers were: PSA promoter, forward primer, TCTGCCTTTGTCCCCTAGAT; reverse primer, GGGAGGGAGAGCTAGCACTTG. PSA enhancer, forward primer, GCCTGGATCTGAGAGAGATATCATC; reverse primer, ACACCTTTTTTTTTCTGGATTGTTG.

RNA Extraction and Northern Blot Analysis
LNCaP cells were cultured in RPMI 1640 medium supplemented with 10% charcoal-stripped FCS, 0.1% glucose and puromycin, before incubation with or without 10 nM R1881 as indicated. Total RNA was isolated with TRI REAGENT (Molecular Research Center, Cincinnati, OH) as described by the manufacturer. RNA quantity was determined photometrically by absorption at 260 nm, stored in ribonuclease-free H2O at –80 C until analysis. For Northern blot assays, 30 µg RNA were electrophoresed and then hybridized with [32P]ATP-labeled probes: RIP140 cDNA (51) and 36B4 cDNA (encoding the human acidic ribosomal phosphoprotein PO), used to correct variations in the amount of RNA loaded on each track (55). Hybridization was quantified by phosphorimager analysis using a Fujix-Bas 1000 Phosphorimager (RAYTEST, Courbevoie, France).


    ACKNOWLEDGMENTS
 
We thank Dr. Jacky Marie (CBS, Montpellier, France) for the kind gift of anti-c-myc antibodies. This paper is dedicated to the memory of Françoise Vignon.


    FOOTNOTES
 
S.C. received grants from Association pour la Recherche sur les Tumeurs de la Prostate and Ligue Nationale contre le Cancer, J.G. and V.G. from Association pour la Recherche contre le Cancer, and A.C. was a recipient of Poste d’accueil, Institut National de la Santé et de la Recherche Médicale (INSERM). This work was funded by INSERM, Faculté de Médecine de Montpellier, Association pour la Recherche contre le Cancer (Grant No. 3494), Ligue Nationale contre le Cancer (Grant No. RAB05002FFA), and Fondation Jérôme Lejeune.

Present address for V.G.: Institut Biologie Intégrative, 7, quai Saint-Bernard, 75252 Paris cedex 05, France.

First Published Online March 9, 2006

Abbreviations: AF, Activating function; AR, androgen receptor; ARE, androgen receptor response element; CFP, cyan fluorescent protein; ChIP, chromatin immunoprecipitation; CtBP, C-terminal binding protein; DTT, dithiothreitol; ER, estrogen receptor; FCS, fetal calf serum; GST, glutathione S-transferase; HDAC, histone deacetylase; LBD, ligand binding domain; MMTV, mouse mammary tumor virus; PSA, prostate-specific antigen; RIP140, receptor-interacting protein of 140 kDa; SDS, sodium dodecyl sulfate; SHP, short heterodimer partner; TIF2, transcriptional intermediary factor 2; TSA, trichostatin A; YFP, yellow fluorescent protein.

Received for publication July 13, 2005. Accepted for publication February 28, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 Materials and Methods
 REFERENCES
 

  1. Gelmann EP 2002 Molecular biology of the androgen receptor. J Clin Oncol 20:3001–3015[Abstract/Free Full Text]
  2. McPhaul MJ 1999 Molecular defects of the androgen receptor. J Steroid Biochem Mol Biol 69:315–322[CrossRef][Medline]
  3. Culig Z, Klocker H, Bartsch G, Hobisch A 2002 Androgen receptors in prostate cancer. Endocr Relat Cancer 9:155–170[Abstract]
  4. Pratt WB, Toft DO 1997 Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr Rev 18:306–360[Abstract/Free Full Text]
  5. Jenster G, van der Korput HA, Trapman J, Brinkmann AO 1995 Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J Biol Chem 270:7341–7346[Abstract/Free Full Text]
  6. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J 1999 Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69:307–313[CrossRef][Medline]
  7. Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocr Rev 23:175–200[Abstract/Free Full Text]
  8. Roeder RG 1996 The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem Sci 21:327–335[CrossRef][Medline]
  9. Neely KE, Workman JL 2002 The complexity of chromatin remodeling and its links to cancer. Biochim Biophys Acta 1603:19–29[Medline]
  10. Roeder RG 1998 Role of general and gene-specific cofactors in the regulation of eukaryotic transcription. Cold Spring Harb Symp Quant Biol 63:201–218[CrossRef][Medline]
  11. Wang L, Hsu CL, Chang C 2005 Androgen receptor corepressors: an overview. Prostate 63:117–130[CrossRef][Medline]
  12. Cheng S, Brzostek S, Lee SR, Hollenberg AN, Balk SP 2002 Inhibition of the dihydrotestosterone-activated androgen receptor by nuclear receptor corepressor. Mol Endocrinol 16:1492–1501[Abstract/Free Full Text]
  13. Jeong BC, Hong CY, Chattopadhyay S, Park JH, Gong EY, Kim HJ, Chun SY, Lee K 2004 Androgen receptor corepressor-19 kDa (ARR19), a leucine-rich protein that represses the transcriptional activity of androgen receptor through recruitment of histone deacetylase. Mol Endocrinol 18:13–25[Abstract/Free Full Text]
  14. Niki T, Takahashi-Niki K, Taira T, Iguchi-Ariga SM, Ariga H 2003 DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol Cancer Res 1:247–261[Abstract/Free Full Text]
  15. Gobinet J, Carascossa S, Cavaillès V, Vignon F, Nicolas JC, Jalaguier S 2005 SHP represses transcriptional activity via recruitment of histone deacetylases. Biochemistry 44:6312–6320[CrossRef][Medline]
  16. L’Horset F, Dauvois S, Heery DM, Cavaillès V, Parker MG 1996 RIP-140 interacts with multiple nuclear receptors by means of two distinct sites. Mol Cell Biol 16:6029–6036[Abstract]
  17. Ikonen T, Palvimo JJ, Jänne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  18. Masuyama H, Brownfield CM, St-Arnaud R, MacDonald PN 1997 Evidence for ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol Endocrinol 11:1507–1517[Abstract/Free Full Text]
  19. Miyata KS, McCaw SE, Meertens LM, Patel HV, Rachubinski RA, Capone JP 1998 Receptor-interacting protein 140 interacts with and inhibits transactivation by, peroxisome proliferator-activated receptor {alpha} and liver-X-receptor {alpha}. Mol Cell Endocrinol 146:69–76[CrossRef][Medline]
  20. Subramaniam N, Treuter E, Okret S 1999 Receptor interacting protein RIP140 inhibits both positive and negative gene regulation by glucocorticoids. J Biol Chem 274:18121–18127[Abstract/Free Full Text]
  21. Sugawara T, Abe S, Sakuragi N, Fujimoto Y, Nomura E, Fujieda K, Saito M, Fujimoto S 2001 RIP 140 modulates transcription of the steroidogenic acute regulatory protein gene through interactions with both SF-1 and DAX-1. Endocrinology 142:3570–3577[Abstract/Free Full Text]
  22. Kumar MB, Tarpey RW, Perdew GH 1999 Differential recruitment of coactivator RIP140 by Ah and estrogen receptors. Absence of a role for LXXLL motifs. J Biol Chem 274:22155–22164[Abstract/Free Full Text]
  23. Zilliacus J, Holter E, Wakui H, Tazawa H, Treuter E, Gustafsson JÅ 2001 Regulation of glucocorticoid receptor activity by 14-3-3-dependent intracellular relocalization of the corepressor rip140. Mol Endocrinol 15:501–511[Abstract/Free Full Text]
  24. Teyssier C, Belguise K, Galtier F, Cavaillès V, Chalbos D 2003 Receptor-interacting protein 140 binds c-Jun and inhibits estradiol-induced activator protein-1 activity by reversing glucocorticoid receptor-interacting protein 1 effect. Mol Endocrinol 17:287–299[Abstract/Free Full Text]
  25. Treuter E, Albrektsen T, Johansson L, Leers J, Gustafsson JÅ 1998 A regulatory role for RIP140 in nuclear receptor activation. Mol Endocrinol 12:864–881[Abstract/Free Full Text]
  26. Castet A, Boulahtouf A, Versini G, Bonnet S, Augereau P, Vignon F, Khochbin S, Jalaguier S, Cavaillès V 2004 Multiple domains of the receptor-interacting protein 140 contribute to transcription inhibition. Nucleic Acids Res 32:1957–1966[Abstract/Free Full Text]
  27. Christian M, Tullet JM, Parker MG 2004 Characterization of four autonomous repression domains in the corepressor receptor interacting protein 140. J Biol Chem 279:15645–15651[Abstract/Free Full Text]
  28. Wang Q, Carroll JS, Brown M 2005 Spatial and temporal recruitment of androgen receptor and its coactivators involves chromosomal looping and polymerase tracking. Mol Cell 19:631–642[CrossRef][Medline]
  29. Georget V, Terouanne B, Nicolas JC, Sultan C 2002 Mechanism of antiandrogen action: key role of hsp90 in conformational change and transcriptional activity of the androgen receptor. Biochemistry 41:11824–11831[CrossRef][Medline]
  30. Christian M, Kiskinis E, Debevec D, Leonardsson G, White R, Parker MG 2005 RIP140-targeted repression of gene expression in adipocytes. Mol Cell Biol 25:9383–9391[Abstract/Free Full Text]
  31. Heery DM, Hoare S, Hussain S, Parker MG, Sheppard H 2001 Core LXXLL motif sequences in CREB-binding protein, SRC1, and RIP140 define affinity and selectivity for steroid and retinoid receptors. J Biol Chem 276:6695–6702[Abstract/Free Full Text]
  32. Thénot S, Bonnet S, Boulahtouf A, Margeat E, Royer CA, Borgna JL, Cavaillès V 1999 Effect of ligand and DNA binding on the interaction between human transcription intermediary factor 1{alpha} and estrogen receptors. Mol Endocrinol 13:2137–2150[Abstract/Free Full Text]
  33. Kerley JS, Olsen SL, Freemantle SJ, Spinella MJ 2001 Transcriptional activation of the nuclear receptor corepressor RIP140 by retinoic acid: a potential negative-feedback regulatory mechanism. Biochem Biophys Res Commun 285:969–975[CrossRef][Medline]
  34. Cavaillès V, Dauvois S, L’Horset F, Lopez G, Hoare S, Kushner PJ, Parker MG 1995 Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J 14:3741–3751[Medline]
  35. He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. J Biol Chem 274:37219–37225[Abstract/Free Full Text]
  36. He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986–22994[Abstract/Free Full Text]
  37. Tazawa H, Osman W, Shoji Y, Treuter E, Gustafsson JÅ, Zilliacus J 2003 Regulation of subnuclear localization is associated with a mechanism for nuclear receptor corepression by RIP140. Mol Cell Biol 23:4187–4198[Abstract/Free Full Text]
  38. Saitoh M, Takayanagi R, Goto K, Fukamizu A, Tomura A, Yanase T, Nawata H 2002 The presence of both the amino- and carboxyl-terminal domains in the AR is essential for the completion of a transcriptionally active form with coactivators and intranuclear compartmentalization common to the steroid hormone receptors: a three-dimensional imaging study. Mol Endocrinol 16:694–706[Abstract/Free Full Text]
  39. Yu X, Li P, Roeder RG, Wang Z 2001 Inhibition of androgen receptor-mediated transcription by amino-terminal enhancer of split. Mol Cell Biol 21:4614–4625[Abstract/Free Full Text]
  40. Holter E, Kotaja N, Mäkela S, Strauss L, Kietz S, Janne OA, Gustafsson JÅ, Palvimo JJ, Treuter E 2002 Inhibition of androgen receptor (AR) function by the reproductive orphan nuclear receptor DAX-1. Mol Endocrinol 16:515–528[Abstract/Free Full Text]
  41. Wang L, Hsu CL, Ni J, Wang PH, Yeh S, Keng P, Chang C 2004 Human checkpoint protein hRad9 functions as a negative coregulator to repress androgen receptor transactivation in prostate cancer cells. Mol Cell Biol 24:2202–2213[Abstract/Free Full Text]
  42. Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz KB 1997 The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693–705[Abstract/Free Full Text]
  43. Sharma M, Zarnegar M, Li X, Lim B, Sun Z 2000 Androgen receptor interacts with a novel MYST protein, HBO1. J Biol Chem 275:35200–35208[Abstract/Free Full Text]
  44. Gaughan L, Logan IR, Cook S, Neal DE, Robson CN 2002 Tip60 and histone deacetylase 1 regulate androgen receptor activity through changes to the acetylation status of the receptor. J Biol Chem 277:25904–25913[Abstract/Free Full Text]
  45. Gobinet J, Auzou G, Nicolas JC, Sultan C, Jalaguier S 2001 Characterization of the interaction between androgen receptor and a new transcriptional inhibitor, SHP. Biochemistry 40:15369–15377[CrossRef][Medline]
  46. Lin DY, Fang HI, Ma AH, Huang YS, Pu YS, Jenster G, Kung HJ, Shih HM 2004 Negative modulation of androgen receptor transcriptional activity by Daxx. Mol Cell Biol 24:10529–10541[Abstract/Free Full Text]
  47. Burd CJ, Petre CE, Moghadam H, Wilson EM, Knudsen KE 2005 Cyclin D1 binding to the androgen receptor (AR) NH2-terminal domain inhibits activation function 2 association and reveals dual roles for AR corepression. Mol Endocrinol 19:607–620[Abstract/Free Full Text]
  48. Belandia B, Powell SM, Garcia-Pedrero JM, Walker MM, Bevan CL, Parker MG 2005 Hey1, a mediator of notch signaling, is an androgen receptor corepressor. Mol Cell Biol 25:1425–1436[Abstract/Free Full Text]
  49. Vo N, Fjeld C, Goodman RH 2001 Acetylation of nuclear hormone receptor-interacting protein RIP140 regulates binding of the transcriptional corepressor CtBP. Mol Cell Biol 21:6181–6188[Abstract/Free Full Text]
  50. Wei LN, Hu X, Chandra D, Seto E, Farooqui M 2000 Receptor-interacting protein 140 directly recruits histone deacetylases for gene silencing. J Biol Chem 275:40782–40787[Abstract/Free Full Text]
  51. Thénot S, Charpin M, Bonnet S, Cavaillès V 1999 Estrogen receptor cofactors expression in breast and endometrial human cancer cells. Mol Cell Endocrinol 156:85–93[CrossRef][Medline]
  52. Kang Z, Janne OA, Palvimo JJ 2004 Coregulator recruitment and histone modifications in transcriptional regulation by the androgen receptor. Mol Endocrinol 18:2633–2648[Abstract/Free Full Text]
  53. Gouilleux F, Sola B, Couette B, Richard-Foy H 1991 Cooperation between structural elements in hormono-regulated transcription from the mouse mammary tumor virus promoter. Nucleic Acids Res 19:1563–1569[Abstract/Free Full Text]
  54. Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  55. Cavaillès V, Augereau P, Garcia M, Rochefort H 1988 Estrogens and growth factors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells. Nucleic Acids Res 16:1903–1919[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   AR
Coregulators:   RIP140  |  GRIP1
Ligands:   Bicalutamide  |  R1881



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
H. V. Heemers and D. J. Tindall
Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex
Endocr. Rev., December 1, 2007; 28(7): 778 - 808.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carascossa, S.
Right arrow Articles by Jalaguier, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carascossa, S.
Right arrow Articles by Jalaguier, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals