help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2005-0469
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Molecular Endocrinology 20 (7): 1574-1586
Copyright © 2006 by The Endocrine Society

A Polymorphism in a Conserved Posttranscriptional Regulatory Motif Alters Bone Morphogenetic Protein 2 (BMP2) RNA:Protein Interactions

David T. Fritz1, Shan Jiang1, Junwang Xu and Melissa B. Rogers

Biochemistry and Molecular Biology, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, Newark, New Jersey 07101

Address all correspondence and requests for reprints to: Melissa B. Rogers, Biochemistry and Molecular Biology (MSB E627), University of Medicine and Dentistry of New Jersey-New Jersey Medical School, 185 South Orange Avenue, P.O. Box 1709, Newark, New Jersey 07101-1709. E-mail: rogersmb{at}umdnj.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The bone morphogenetic protein (BMP)2 gene has been genetically linked to osteoporosis and osteoarthritis. We have shown that the 3'-untranslated regions (UTR) of BMP2 genes from mammals to fishes are extraordinarily conserved. This indicates that the BMP2 3'-UTR is under stringent selective pressure. We present evidence that the conserved region is a strong posttranscriptional regulator of BMP2 expression. Polymorphisms in cis-regulatory elements have been proven to influence susceptibility to a growing number of diseases. A common single nucleotide polymorphism (SNP) disrupts a putative posttranscriptional regulatory motif, an AU-rich element, within the BMP2 3'-UTR. The affinity of specific proteins for the rs15705 SNP sequence differs from their affinity for the normal human sequence. More importantly, the in vitro decay rate of RNAs with the SNP is higher than that of RNAs with the normal sequence. Such changes in mRNA:protein interactions may influence the posttranscriptional mechanisms that control BMP2 gene expression. The consequent alterations in BMP2 protein levels may influence the development or physiology of bone or other BMP2-influenced tissues.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FIRST IDENTIFIED AS osteogenic factors, bone morphogenetic proteins (BMPs) are essential morphogens expressed in complex patterns in vertebrate embryos (1, 2, 3, 4). BMP2 and BMP4 signaling mediates key events such as epithelio-mesenchymal interactions (5), apoptosis (6, 7, 8, 9), and dorso-ventral axis specification (10). Mice having null mutations in Bmp2 or Bmp4 (11, 12), BMP receptor genes (13, 14, 15, 16), or the BMP signal transducing SMADs (17, 18, 19, 20, 21) die during early embryogenesis. Such embryonic lethality proves that BMP signaling controls vital developmental processes.


    BMP2 and Osteoporosis
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Osteoporosis, a reduction in bone density leading to dangerously fragile bones, has been linked to the human BMP2 gene (22, 23). Systemic application of recombinant human BMP2 abrogated bone loss in two mouse models of osteoporosis (24), suggesting that BMP2 levels can influence bone quality. The BMP2 gene also is linked to osteoarthritis, which has a complex genetic relationship with osteoporosis (25). The phenotypes of genetically manipulated transgenic mice and human disorders highlight the importance of controlling BMP signaling during bone and cartilage formation and adult bone homeostasis (26, 27, 28, 29, 30, 31, 32, 33, 34). The biology of BMP2 suggests that polymorphisms that reduce BMP2 function or gene expression promote osteoporosis. A polymorphism in an osteoporosis-linked haplotype (22) disrupts a putative cis-regulatory motif that is surprisingly conserved in the 3'-untranslated regions (UTRs) of mammalian, avian, amphibian, and fish BMP2 mRNAs (35). Our results suggest that this single nucleotide change alters the binding of proteins to the BMP2 mRNA in this region. Inherited polymorphisms in conserved cis-acting regulatory elements may cause subtle alterations in BMP2 protein levels that promote osteoporosis.


    Numerous Mechanisms Modulate BMP Signaling
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Like other potent growth and differentiation factors, both positive and negative regulation at many levels controls BMP expression (35, 36, 37, 38, 39, 40, 41, 42). The extensive network of BMP inhibitors and the bone and embryonic phenotypes caused by overexpressing or inactivating them indicates that down-regulating BMPs is as essential as up-regulating them (e.g. Refs. 30, 31, 32, 33, 34 and 43, 44, 45). An important way to limit signaling by potent factors is to alter mRNA function and half-life via motifs in the 3'-UTR. Small changes in mRNA half-life can modulate gene expression by over 100-fold (46). Our initial analysis has identified posttranscriptional regulatory elements in the 3'-UTR that may play major roles in regulating BMP2 gene expression in embryos (35, 37). Polymorphisms within this sequence potentially influence BMP2 gene expression in embryonic and adult tissues.


    BMP2 Single Nucleotide Polymorphisms (SNPs) Disrupt an Unusually Conserved Regulatory Region
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A SNP that defines the end of a haplotype associated with osteoporosis is in the BMP2 3'-UTR (22). The BMP2 3'-UTR is unusually long and, unlike most genes, is more conserved than the coding region (35, 37). The ultra-conserved region ranks among the most evolutionarily conserved sequences described to date. For example, the percent identity and length of alignment of 370 nucleotides (nt) of the BMP2 3'-UTRs from all mammals is more conserved than the most highly conserved blocks in 33.5 megabases of syntenic mouse and human DNA on human chromosome 21 (47, 48). The region is also 73% identical over 265 nt between mammals and fishes. The striking conservation of the BMP2 3'-UTR between diverse vertebrates implies vital regulatory functions. Our data suggest that polymorphisms in this region alter BMP2 expression and thus may influence morphogenesis in general and the mechanical properties of human bone, in particular.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mammalian BMP2 3'-UTRs Strongly Activate Gene Expression
BMP2 expression in embryos and in bones is highly dynamic and occurs in tissues that are difficult to analyze biochemically. Therefore, we studied BMP2 gene regulation in F9 embryonal carcinoma cells (49, 50), which express BMP2 in response to retinoic acid (RA) or RA with drugs that elevate cAMP levels (e.g. dibutyryl cAMP and theophylline). BMP2 is differentially regulated to three distinct levels in F9 cells (off, induced, further induced) (51, 52). Although this differential gene regulation captures only part of the complexity of BMP2 expression in tissues, it is the best available tool for biochemical analysis of the mechanisms controlling embryonic BMP2 expression (35, 36, 37).

We showed previously that the effect of the ultra-conserved region on BMP2 reporter gene activity in RA-treated F9 cells is significantly greater than any upstream or 5'-UTR region (35, 36, 37). Unlike the upstream elements, the 3'-UTR stimulatory effect is specific to RA-induced expression of BMP2 (37). We have now tested subclones containing the most highly conserved sequence from the 3'-UTRs of mouse, human, and dog. The homologous region from all three species strongly activates mouse promoter-driven reporter genes in the mouse model (Fig. 1Go). Interchangeable 3'-UTR function between these mammals suggests that regulatory mechanisms are conserved. Therefore, mechanisms identified using mouse systems are highly relevant to how the human BMP2 gene is regulated.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Conserved Regulatory Sequences that Drive Expression in Bone May Act Posttranscriptionally

A, Reporter genes with the murine BMP2 promoter (->, nt –1237 to 471 relative to the promoter) upstream of the luciferase (LUC) gene alone or with the ultra-conserved region (nt 9574–9938) of the murine 3'-UTR (M) or the homologous human (H) or dog (D) sequence downstream of the pGL2-Basic luciferase gene. F9 cells were treated with RA, dibutyryl cAMP, and theophylline for 4 d, and cotransfected with a plasmid constitutively expressing ßgal to normalize transfection efficiency. These conditions induce maximal BMP2 expression. Average reporter activity is shown ± SEM, n ≥ 4. B, Reporter transgenes with the murine BMP2 promoter region (nt –1237 to 471) and the 3'-UTR and downstream sequences (nt 9,392–11,604) flanking the lacZ gene were injected into oocytes. Toes removed to mark individual pups were whole-mount stained for ßgal activity. The dark staining indicates ßgal activity in the claw bed and phalanges (Ph) of transgenic mice, but not in the adjacent soft tissues or in the dense claw bed and phalanges of nontransgenic mice. C, Reporter genes with the murine Bmp2 promoter (nt –1237 to 471) upstream of the luciferase (LUC) gene alone (BmpLuc) or with nt 9,392–11,604 of mouse BMP2 3'-UTR and downstream sequence between the pGL2-Basic luciferase gene and the SV40 pA signal (SV) of pGL2-Basic (BmpLucBmp). "M" and "A A" mark the ultra-conserved region and the two BMP2 poly(A) sites, respectively. In BmpLucSVBmp, the 3'-UTR and downstream sequence was inserted after the SV40 pA signal. Average reporter activity (gray bars) at 4 d of differentiation is shown ± SEM, n ≥ 4. The hatched bars show the relative steady-state luciferase RNA levels for cells transfected with BmpLucBmp or BmpLucSVBmp as determined by RNase protection assays using a luciferase probe. D, After transfection with BmpLuc or BmpLucBmp and induction of differentiation, F9 cells were exposed to the adenosine analog 5,6-dichloro-1-ß-ribofuranosyl benzimidazole (DRB) for up to 6 h. Average luciferase activities and ranges (n = 2) were plotted as a percentage of luciferase activity in non-inhibitor-treated cells (time 0).

 
Transgenic Reporter Genes Are Expressed in Neonatal Bone
Because the F9 cells model only three embryonic cell types, we generated a transgenic mouse (53) to test whether reporter genes including the 3'-UTR were expressed in bone. Many publications have described expression patterns of the endogenous BMP2 mRNA (4, 54, 55, 56, 57, 58, 59, 60, 61). As in these reports, BMP2 reporter transgenes with the natural 3'-UTR are expressed in heart, trigeminal nerves, eye, interdigital cells undergoing apoptosis, hair follicles (data not shown), and bones (Fig. 1BGo). Thus, as observed previously with a promoter-only reporter transgene (62), reporter genes with the BMP2 3'-UTR are expressed in bone.

Activating Elements Act Posttranscriptionally
We made two constructs to distinguish between reporter gene activation due to cis-regulatory elements within the mRNA or transcriptional enhancers in the plasmid DNA. BmpLucBmp (Fig. 1CGo) contains the entire 3'-UTR and downstream sequences. The transcribed reporter mRNAs may end at the natural BMP2 poly(A) signals (37) or the simian virus 40 (SV40) poly(A) signal from pGL2-Basic. To distinguish between elements that act posttranscriptionally within the RNA molecule or as enhancers of transcription within the DNA, we placed the 2.2-kb fragment downstream of the SV40 poly(A) signal (BmpLucSVBmp; Fig. 1CGo). Because the SV40 sequence is a strong polyadenylation and cleavage signal, most mRNAs should end before the BMP2 sequence. The luciferase activity of BmpLucSVBmp-transfected cells was less than half that of BmpLucBmp. More importantly, relative RNA levels correlated with luciferase activities.

We also found that luciferase levels in cells transfected with a promoter-only construct, BmpLuc, declined faster after treatment of cells with the transcriptional inhibitor 5,6-dichloro-1-ß-ribofuranosyl benzimidazole (DRB) than in cells transfected with the 3'-UTR-containing BmpLucBmp (Fig. 1DGo). This may reflect a relatively less stable mRNA in the absence of the BMP2 3'-UTR. We previously showed that RNAs with the ultra-conserved region decayed more rapidly in vitro in extracts from F9 cells that do not express BMP2 relative to cells that express BMP2 (35). These data are consistent with two hypotheses: 1) the BMP2 3'-UTR contains elements that stabilize an mRNA in cells that do express BMP2 and/or 2) the BMP2 3'-UTR contains elements that destabilize an mRNA in cells that do not express BMP2.

Trans-Acting Factors Interacting with the Osteoporosis-Associated Polymorphic Region Influence BMP2 RNA Decay in Vitro
The nearly 400-nt ultra-conserved region probably contains multiple posttranscriptional regulatory motifs. One such well-characterized motif is the AU-rich element (ARE) which marks mRNAs whose half-life is regulated (63, 64, 65, 66). The ultra-conserved region in mammalian BMP2 genes contains 10 widely spaced AREs (AUUUA or AUUUUA) (35, 37). Interestingly, a conserved AUUUA element in the BMP2 RNA is altered to AUUUC in an osteoporosis-associated SNP (rs15705) (22).

It is not known whether the 10 AREs function equivalently in any particular cell type. Because each ARE is embedded in highly distinct flanking sequence, binding affinity for proteins that regulate mRNA decay may vary. Additionally, the AREs may function additively, antagonistically, or synergistically. However, for all possibilities, the ARE/protein interactions may contribute to the sophisticated level of control required to fine-tune BMP2 expression in animals. ARE-interacting factors may promote or inhibit mRNA decay. A simple hypothesis is that more AREs recruit more decay proteins leading to more rapid decay. To begin to test this, we used a quantitative in vitro assay to measure the regulated decay of a synthetic, capped RNA in extracts (35, 67, 68, 69). Because these RNAs were not polyadenylated, this assay specifically measures the effect of ARE motifs on degradation rate, but not on deadenylation. Furthermore, we showed previously that RNAs with the well-characterized ARE from the short-lived TNF{alpha} mRNA, but not RNAs with a mutated TNF{alpha} (Fig. 2BGo) (35, 70), decay rapidly. This indicates that F9 cells contain the factors required to regulate the stability of ARE-containing RNAs.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. The Number of AREs May Influence BMP2 RNA Decay

A, Decay of labeled RNAs containing BMP2 sequences in extracts from undifferentiated F9 cells (in which the BMP2 mRNA would be expected to be actively degraded) after adding excess poly(A) competitor to activate decay. Intact RNA was plotted as a percentage of RNA in unincubated extracts at time 0. An average of three experiments was plotted for RNAs containing nt 9574–9938 and nt 9574–9735. n = 4 for RNAs with nt 9574–9782, n =1 for 9736–9938, and n =2 for 9713–9747. B, Bars show the relative lengths and positions of BMP2 sequence in the RNAs. An asterisk (*) marks the approximate positions of AREs within the BMP2 and TNF{alpha} RNAs. An arrow ({blacktriangledown}) shows the position of the AUUUA that is converted to AUUUC in the rs15705 SNP. The number of AREs (AUUUA or AUUUUA) and in vitro half-lives (t1/2 ± SEM) of the RNAs in extracts from F9 cells are shown to the right of each bar. The t1/2 value for the longest BMP2 RNA (9455–9938) (n = 4) and RNAs containing the wild-type ARE from TNF{alpha} (WT, AAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUAA) or a mutated RNA (MT, AAUGAUGUACUACUUGUUCAUGAUGUUCUUCUUGAA) are from data shown in Ref. 35 . Wild-type and mutated TNF{alpha} RNAs are positive and negative controls for ARE-regulated decay, respectively.

 
Our previous measurements of the amount of BMP2 RNA remaining after a 30-min incubation in F9 cell extracts were consistent with the hypothesis that the separated motifs recruit decay factors independently (35). We have now determined the half-lives of RNAs containing the entire ultra-conserved region or shorter RNAs with fewer AREs. The half-lives of RNAs containing the entire ultra-conserved region (10 or 11 AREs) are less than 10 min in extracts from undifferentiated F9 cells (Fig. 2Go, A and B). This is shorter than the 15-min half-life of RNAs with the potent ARE from the short-lived TNF{alpha} mRNA, which has six densely packed AUUUA motifs (Fig. 2BGo) (35, 70). Similar to that of TNF{alpha}, the half-lives of three different BMP2 RNAs with five or six AREs are greater than 10 min (Fig. 2Go, A and B). A 35-nt RNA with three isolated AREs was relatively stable. This suggests that the number of AREs may influence decay rate in these RNAs.

Tissue-Specific ARE Binding Proteins Interact with the BMP2 RNA
Proteins that bind the 3'-UTR regulate many important regulatory processes; e.g. polyadenylation efficiency, nuclear mRNA export, cytoplasmic localization, and mRNA translation efficiency and decay. As a first step toward understanding the role of the ultra-conserved region, we used UV cross-linking to characterize the cytoplasmic proteins that interact with this RNA (Fig. 3Go, lanes 1, 4, 7, and 10). 32P-labeled RNAs containing the mouse BMP2 ultra-conserved region or the homologous human region UV cross-linked discrete proteins in cytoplasmic extracts from mouse cells (F9) or human cells (BEAS-2B immortalized human bronchial epithelial, A549 lung adenocarcinoma, or HeLa). Whereas the BMP2 RNA UV cross-links some proteins from all cells that migrate in similar positions (for example, p63), others are cell-type specific; for example, several proteins migrating in the 90- to 130-kDa range (Fig. 3AGo). We have also performed UV cross-linking assays using the mouse RNA with the three extracts from human cells and the human RNA with extracts from F9 cells and detected no differences in protein profiles (data not shown). Therefore, as might be expected from the sequence identity, the differences between the mouse and human cell protein profiles are cell-type specific rather than species specific.


Figure 3
View larger version (87K):
[in this window]
[in a new window]
 
Fig. 3. Distinct ARE Binding Proteins Interact with the BMP2 RNA in Diverse Cell Types

A, RNAs containing the mouse BMP2 ultra-conserved region (mB, nt 9574–9938), the human BMP2 ultra-conserved region (hB), the wild-type TNF{alpha} ARE (W), or the mutated TNF{alpha} ARE (M) (TNF{alpha} sequences in legend to Fig. 2Go) were UV cross-linked in extracts from undifferentiated F9 cells, BEAS-2B immortalized human bronchial epithelial cells, A549 lung adenocarcinoma cells, or HeLa cells with excess poly(A) competitor. Selected proteins discussed in the text are marked. B, RNAs containing the wild-type TNF{alpha} ARE (lanes 2–8) were UV cross-linked in extracts from HeLa cells with 0.6, 1.2, or 2.4 pmol of TNF{alpha} ARE competitor oligo (sequence in legend to Fig. 2Go) or nonspecific (NS) oligo (GUCACTUTUCACC). Lanes 9–19, RNAs with the human BMP2 ultra-conserved region were UV cross-linked with 0.15, 0.3, 0.6, 1.2, or 2.4 pmol of TNF{alpha} ARE or nonspecific competitor oligo. Lane 1 shows the proteins UV cross-linked to the mutated TNF{alpha} ARE. C, Quantification of the relative cross-linking of the 32- and 33-kDa proteins in the presence of the TNF{alpha} ARE (bullet) or nonspecific (NS, {blacksquare}) competitor oligos. D, RNAs with the human BMP2 ultra-conserved region were UV cross-linked in HeLa extracts with 5, 10, or 25 pmol of TNF{alpha} ARE (lanes 4–6) or 1, 5, 10, or 25 pmol of normal (lanes 7–10) or SNP (lanes 11–14) oligo, or 1, 10, or 25 pmol of nonspecific (NS) (lanes 15–17) competitor oligo. Lanes 1 and 2 show the proteins UV cross-linked to the mutated and wild-type TNF{alpha} AREs, respectively. The graph in D combines the competition data in Fig. 3Go, B and D. The sequence of the normal competitor RNA oligo is AGAUUUAAAAUGUAUUUAGUUGUACAUUUUAUAUG (nt 9713–9747). The AREs are boldfaced. The position of the C in the rs15705 SNP is underlined.

 
To our knowledge, we are the first to examine the proteins that bind the BMP2 3'-UTR. However, the proteins that bind the classical ARE in the TNF{alpha} mRNA are well characterized and can be used to make initial comparisons and tentative identifications. So, to begin to identify the proteins that bind the ultra-conserved region, we first examined proteins UV cross-linked to the TNF{alpha} ARE (Fig. 3AGo, lanes 2, 5, 8, and 11). Although some proteins are unique to BMP2 in each cell type, several proteins of similar apparent molecular weights were UV cross-linked by both BMP2 and TNF{alpha}. The apparent molecular weight of some of the proteins interacting with both RNAs suggests that several are previously identified proteins. For example, the set of 32- to 37-kDa proteins fall within the molecular weight ranges of known stability regulators including HuR (32 kDa) (71), the four AUF-1/hnRNP D isoforms (37–45 kDa) (72, 73, 74, 75), and tristetraproline (TTP) (35–55 kDa) (76, 77, 78). To test whether these proteins were indeed ARE-binding proteins, we attempted to UV cross-link them using an RNA containing a mutated TNF{alpha} ARE (Fig. 3AGo, lanes 3, 6, 9, and 12) (79). The inability of this RNA to label the low-molecular-weight set of proteins suggests that they are bona fide ARE-binding proteins.

We also observed that the intensity of UV cross-linking between the TNF{alpha} and the BMP2 RNAs and proteins that appear to be the same size varies significantly. For example, in HeLa cells (lane 11), the 32-kDa protein that is strongly labeled by the TNF{alpha} RNA with its multiple overlapping AUUUA motifs (see Fig. 2Go) is HuR (71). Although HuR is abundant in HeLa cells, the BMP2 RNA with its widely separated AUUUA or AUUUUA motifs (35, 37) cross-linked HuR poorly in the same extracts.

RNA oligonucleotide (oligo) competition can interfere with protein:RNA interactions at defined motifs such as AREs (80). The only sequence in common to the BMP2 and TNF{alpha} RNAs is AUUUA. If the proteins UV cross-linked by both the BMP2 and the TNF{alpha} RNAs that migrate similarly are indeed the same proteins, then an RNA oligo with the TNF{alpha} ARE should compete for binding and decrease cross-linking. Figure 3Go, B and C, shows that the TNF{alpha} ARE oligo (lanes 3–5, 10–14), but not a nonspecific oligo (lanes 6–8, 15–19), inhibited cross-linking of the 32- to 33-kDa proteins that are labeled by both the BMP2 and the TNF{alpha} RNAs in HeLa cells. Thus, a common subset of proteins interacts with the classical ARE found in TNF{alpha} and the BMP2 ultra-conserved region.

Different Proteins Bind the Normal RNA Sequence Relative to RNA with the rs15705 SNP in an ARE
Unlike the concatenated AREs in the TNF{alpha} RNA, all but two of the BMP2 AREs in the ultra-conserved sequence are isolated. The conserved sequence flanking each ARE may alter the presentation of each ARE to stabilizing or destabilizing RNA binding proteins. We have begun to analyze the influence of each conserved ARE in the BMP2 RNA, beginning with an ARE that is altered in individuals with the rs15705 SNP. To test whether this SNP could alter the affinity of specific proteins for the BMP2 mRNA, we synthesized 35-nt RNA oligos that span three isolated AREs in a region that is identical between rodents and primates (37). The central ARE of this set is changed by the rs15705 SNP from AUUUA to AUUUC. These oligos were used to compete for UV cross-linking to 32P-labeled RNAs containing the full-length ultra-conserved sequences from mouse or human. The polymorphism could decrease the affinity of the RNA oligo for specific proteins and cause a loss of function. Alternatively, the polymorphism could increase the affinity of the RNA oligo for specific proteins and cause a gain of function.

First, the normal and the SNP oligos both inhibited the UV cross-linking of specific proteins. For example, 1 pmol of either oligo competed efficiently for the interaction between p63 present in five different cell types and the BMP2 RNAs (Fig. 4Go, A and B, and data not shown). UV cross-linking of other proteins (for example, several migrating above the 37-kDa marker) were never significantly affected by either oligo (n = 2–3 for each cell type). This suggests that the SNP has no effect on the affinity of the oligo for these proteins. However, in contrast to the wild-type oligo, the mutated oligo less efficiently inhibited UV cross-linking to proteins migrating between 32 and 37 kDa in F9, HeLa, A549 lung adenocarcinoma, BEAS-2B immortalized human bronchial epithelial, and ROS17/2.8 rodent osteosarcoma cells (compare lanes 1–5 with lanes 6–10 in each set; Fig. 4Go, A–C).


Figure 4
View larger version (107K):
[in this window]
[in a new window]
 
Fig. 4. RNA Oligos with the Normal Sequence Compete More Efficiently Than Those with the SNP Sequence for UV Cross-Linking to Low-Molecular-Weight Proteins

A, An RNA containing the mouse ultra-conserved sequence (9574–9938) was UV cross-linked in extracts from undifferentiated F9 cells, or an RNA with the homologous human ultra-conserved sequence was UV cross-linked in extracts from HeLa cells. A total of 1, 5, 10, or 25 pmol of oligo with normal or SNP sequence (shown in legend to Fig. 3Go) were added. B, Average cross-linking to p63 or proteins migrating between 32 and 37 kDa in F9 (n = 3) or HeLa (n = 2) extracts relative to samples without oligo. The set of proteins in the 32- to 37-kDa range were quantified both as groups shown here and individually (data not shown). The ability of each oligo to inhibit UV cross-linking of each individual protein is similar to that of the group. C, Similarly, the low-molecular-weight proteins from A549 lung adenocarcinoma (n = 2), BEAS-2B immortalized human bronchial epithelial (n = 2), or ROS17/2.8 rodent osteosarcoma (n = 1) cells that UV cross-linked to an RNA containing the mouse ultra-conserved sequence are shown with quantification relative to samples without oligo (% no oligo) below each autoradiograph.

 
Side-by-side competition (Fig. 3DGo) using the TNF{alpha} ARE oligo (lanes 4–6), the normal (lanes 7–10) or SNP (lanes 11–14) BMP2 oligos or the nonspecific oligo (lanes 15–17) confirmed that the proteins migrating at this position are ARE binding proteins. As might be expected from the concatenated nature of the AUUUA motifs in the TNF{alpha} ARE, the TNF{alpha} ARE competed more effectively than the BMP2 oligo at lower concentrations (Fig. 3DGo).

We also noted that cross-linking to a protein migrating at approximately 100 kDa (p100) was competed more effectively by the SNP oligo in HeLa cells (Fig. 5AGo, lanes 3–11) and A549 cells (data not shown). This suggests that this protein may bind the SNP RNA with higher affinity. Because competition is an indirect, albeit quantitative, method of measuring RNA:protein affinity, we transcribed two capped and 32P-labeled RNAs containing the 35 nt of BMP2 sequence identical with the normal and rs15705 SNP-containing competitor RNA oligos. As expected, these two small transcribed RNAs UV cross-linked a subset of HeLa proteins relative to RNAs containing the entire ultra-conserved region (364 nt). Consistent with the increased ability of the SNP RNA oligo to compete for UV cross-linking by the full-length ultra-conserved region, the SNP RNA cross-linked the 100-kDa protein more than twice as well as the normal RNA (2.4 ± 0.2-fold; n = 6; Fig. 5AGo, lanes 1 and 2). Increased HeLa cell protein binding to the SNP RNA was also observed under the conditions of EMSAs (Fig. 5BGo, lanes 1 and 2). The BMP2 RNAs do not cross-link F9 cell proteins migrating at 100 kDa; however, EMSAs revealed that the SNP RNA bound proteins in both undifferentiated and differentiated cells more efficiently than the normal RNA (Fig. 5BGo, lanes 3–6). Taken together, the competitions, direct UV cross-linking, and EMSAs suggest that the SNP mRNA binds several proteins differently than normal mRNAs.


Figure 5
View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5. Relative to the Normal RNA, the SNP RNA Interacts More Strongly with Other Proteins

A, Lanes 1 and 2, Capped and 32P-labeled RNAs containing nt 9713–9747 of the mouse BMP2 RNA with the normal sequence or the A to C rs15705 SNP were UV cross-linked with proteins from HeLa cells. These RNAs contain only the BMP2 sequence identical with the competitor RNA oligos as shown in the legend to Fig. 3DGo. Lanes 3–11, Capped and 32P-labeled RNAs containing the human ultra-conserved sequence were UV cross-linked in extracts from HeLa cells. A total of 1, 5, 10 or 25 pmol of RNA oligo with normal or SNP sequence (nt 9713–9747; Fig. 3DGo) was added. This titration was performed in three independent experiments. In each experiment, as shown in Fig. 4AGo, the normal oligo, but not the SNP oligo, inhibited the cross-linking of the 32- to 33-kDa proteins. In contrast, the SNP oligo, but not the normal oligo, inhibited the cross-linking of the 100-kDa protein. The average cross-linking to p100 relative to samples without oligo (% no oligo) is graphed below the gel. B, Proteins in extracts from HeLa cells and undifferentiated (Un) and differentiated (Diff) F9 cells differentially shift the mobility of the capped and 32P-labeled RNAs containing nt 9713–9747 of the mouse BMP2 RNA with the normal sequence or the A to C rs15705 SNP.

 
The Polymorphism Alters BMP2 RNA Decay in Vitro
The assays of RNA:protein interactions suggest differences in protein binding that may lead to differences in normal and SNP RNA stability. Although AREs are commonly described as instability elements, it is more accurate to say that they mark mRNAs whose half-life is regulated (81, 82, 83, 84, 85, 86). Because it is impossible to predict whether these proteins will stabilize or destabilize the BMP2 mRNA in the context of shorter subclones relative to the full-length mRNA RNA, we hypothesized that the proteins will change the stability of the subclones in vitro. We tested the effect of the 35-nt competitor RNA oligos on the decay of the entire ultra-conserved BMP2 sequence in extracts from undifferentiated F9 cells that do not express BMP2. As shown previously (Fig. 2AGo) (35), approximately 20% of this RNA remains after 30-min incubation. In contrast, nearly 40% remained when 5 or more pmol of competitor RNA oligo was added (Fig. 6Go, A and B). Similarly, this RNA oligo stabilized the human BMP2 RNA in HeLa cells (Fig. 6BGo). Thus, interfering with the proteins that bind this 35-nt region stabilized the 364-nt full-length BMP2 RNA in extracts from two cell types. Finally, we have directly compared the decay rate of the in vitro capped and transcribed small RNAs containing the BMP2 sequence of the normal or rs15705 SNP-containing RNA mimicking that of the competitor RNA oligos. The 35-nt SNP RNA decayed considerably more rapidly than the normal RNA in both undifferentiated F9 cells and HeLa cells (Fig. 6CGo).


Figure 6
View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6. A 35-nt RNA Oligo Spanning the rs15705 SNP Inhibits Mouse or Human BMP2 RNA Decay in Vitro

A, RNA with the entire ultra-conserved element from mouse (nt 9574–9938) was incubated in extracts from undifferentiated F9 cells with excess poly(A) competitor and with the indicated picomoles of normal competitor oligo (nt 9713–9747; Fig. 3DGo) for 30 min; n = 2–3. B, Decay curves were generated using RNAs with mouse nt 9574–9782 or the entire human ultra-conserved element incubated in extracts from F9 or HeLa cells, respectively, for up to 30 min with excess poly(A) competitor and with or without 10 pmol of normal competitor oligo. C, Capped and 32P-labeled RNAs containing nt 9713–9747 of the mouse BMP2 RNA with the normal sequence or rs15705 SNP (Fig. 3DGo) were incubated in extracts from F9 or HeLa cells with excess poly(A) competitor. Intact RNA was plotted as a percentage of RNA in unincubated extracts at time 0. n = 2.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interplay between the many genes and environmental factors that control bone structure and turnover influences susceptibility to osteoporosis (87, 88). One haplotype linked to osteoporosis includes the ultra-conserved region of the BMP2 3'-UTR (22). Our finding of unusually high downstream sequence conservation and alternate polyadenylation and cleavage are consistent with vital functions in the BMP2 3'-UTR (35, 37). Elements in 3'-UTRs can modulate mRNA levels over two orders of magnitude while retaining tissue-specific expression patterns (46). Subtle variation in BMP2 mRNA level might be tolerated during embryogenesis, but may alter bone and tissue physiology over the course of a human lifetime. Indeed, one polymorphism found in the osteoporosis-linked haplotype disrupts an ARE, a putative regulatory motif in an extraordinarily conserved region of the BMP2 3'-UTR.

The most significant aspect of our observations is that the single nucleotide change found in the rs15705 SNP markedly changes the affinity of several proteins for the BMP2 ultra-conserved region (Figs. 4Go and 5Go). Specifically, an RNA with the polymorphism loses affinity for a 32- to 37-kDa set of proteins in five different extracts from human or mouse cells and gains affinity for a 100-kDa protein in human cells. More importantly, the stability of RNAs with the normal or the SNP sequence differs in both mouse and human cells (Fig. 6CGo). Thus, multiple and distinct assays showed that the normal and SNP RNAs function differently in vitro. We do not know how these proteins interact with the intact BMP2 mRNA in a living cell. However, it is reasonable to suppose that changes in BMP2 mRNA:protein interactions with the SNP mRNA would alter the posttranscriptional mechanisms controlling BMP2 expression in vivo.

We have not yet identified the 100-kDa protein that binds the SNP RNA better. However, based on the ability of the mutated TNF{alpha} RNA to UV cross-link it (Fig. 3AGo) and the inability of the ARE RNA oligo to inhibit this cross-linking (Fig. 3BGo), it does not appear to be a classical ARE-binding protein. In contrast, the low-molecular-weight set of proteins with higher affinity for the normal RNA relative to the SNP RNA may be known RNA binding proteins such as HuR and various isoforms of hnRNPD/AUF1 and TTP. Previous studies (71) have shown that a protein that interacts with AREs and that migrates at 32 kDa in HeLa cell extracts is HuR, a known RNA stabilizer. Although one cannot predict the precise effect of a particular combination of ARE binding proteins in cells, the ability of these proteins to influence mRNA degradation in vitro and in cells is well established (71, 76, 81, 82, 89, 90, 91, 92, 93, 94, 95). Indeed, an increased affinity of the normal RNA for HuR would explain the increased stability of the normal RNA relative to the SNP RNA in F9 and HeLa cells (Fig. 6CGo). If the SNP also changes the molar ratio of proteins binding to the BMP2 mRNA in osteoblasts and chondrocytes, this might alter BMP2 protein levels at key stages of bone and cartilage differentiation and may explain the association of this SNP with osteoporosis and osteoarthritis (22, 25). Indeed, BMP2 is known to be aberrantly expressed in osteoarthritis (96, 97).

Abnormal BMP2 expression also is specifically associated with lung, breast, colon, pancreatic, and prostate cancers (98, 99, 100, 101, 102). Loss of normal BMP2 expression occurs in prostate and breast cancers and in the microadenomas of familial adenomatous polyposis patients (99, 101, 103). Recombinant BMP2 can inhibit cell proliferation and induce apoptosis in diverse cell types (e.g. Refs. 6, 7, 51, 101 , and 104, 105, 106, 107, 108). Thus, normal BMP2 protein levels may suppress tumors in some tissues, and altering BMP2 expression may promote the transition from normality to malignancy. Mutations in potent regulatory elements like the AREs in the ultra-conserved region of the BMP2 3'-UTR, may alter the physiology of any BMP2-sensitive tissue and influence the onset or progression of diverse human pathologies.

According to the Single Nucleotide Polymorphism database (dbSNP; http://www.ncbi.nlm.nih.gov/SNP/), about one third of Caucasian and Asian populations carry the rs15705 SNP. This suggests that 9% of the population may be homozygous for this alteration in the ultra-conserved region. If this polymorphism changes the affinity of proteins for the BMP2 3'-UTR in vivo, the stoichiometry of mRNA binding proteins and the delicate balance of stabilizing and destabilizing factors controlling RNA half-life would be altered. Thus, the rs15705 or other 3'-UTR SNPs could alter BMP2 protein levels in bone and influence susceptibility to osteoporosis and diseases in other BMP2-expressing tissues.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Luciferase Reporter Constructs
All positions are indicated according to the distal start site of the mouse BMP2 gene (36). Constructs BmpLuc (nt –1,237 to 471), BmpLucSVBmp (nt –1,237 to 471 and nt 9,392–11,604) and BmpLucBmp (nt –1,237 to 471 and nt 9,392–11,604), and pGL2Basic{Delta}Bam+Sac were described previously (35, 37).

BmpLucM (nt –1237 to 471 and nt 9585–9999)
The SacI site in pGL1.7XX was removed by digestion, blunting with T4 DNA polymerase in the presence of dNTPs, and religation to create pGL1.7XX{Delta}SacI. A DraIII and XbaI fragment containing the 1702-bp BMP2 promoter excised from pGL1.7XX{Delta}SacI was inserted in place of the DraIII and XbaI fragment in pGL2Basic{Delta}Bam+Sac, creating pGLB25'{Delta}SacI+SacI. Finally, a 395-bp fragment was removed from pGEM4MouseKA (35) with PvuII and SacI, blunted, then inserted into the SacI site of pGLB25'{Delta}SacI+SacI.

BmpLucH (nt –1237 to 471 and Human Sequence Homologous to Mouse nt 9604–9999)
A 385-bp fragment was removed from pGEM4HumanKA (35) with HincII, blunted, digested with SacI, and then ligated into SacI site of pGLB25'{Delta}SacI+SacI. The ligation mixture was then blunted again and religated.

BmpLucD (nt –1237 to 471 and Dog Sequence Homologous to Mouse nt 9392–9999)
A 533-bp fragment was removed from pGEM4DogKA (35) with EcoRI, blunted, and inserted into the blunted SacI site of pGLB25'{Delta}SacI+SacI.

In Vitro Transcription Plasmids
pGemB2-KA (nt 9455–9938) and plasmids containing the homologous regions from human and zebrafish (35) were linearized with BamHI. pGBmp2-SacPst (nt 9,397–10,202) and pGBmp2-PvuIIPst (9,574–10,202) were linearized with AccI to make sense probe spanning nt 9,397–9,938 or 9,574–9,938, respectively (35). pGBmp2-PvuIIRsa (nt 9574–9735), pGBmp2-RsaAcc (nt 9735–9938), or wild-type or mutated TNF{alpha} plasmids (79) were linearized with HindIII.

For a ribonuclease (RNase) protection probe specific to luciferase, a fragment was PCR amplified using the pGL2-basic plasmid as template and primers specific to the luciferase gene (5'-ATGGAAGACGCCAAAAACATAAAG-3' and 5'-ATAGCTTCTGCCAACCGAAC-3'). This fragment was cloned into the pCRII-TOPO cloning vector (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. This plasmid (pCRII-Luc) and the M13 forward and reverse primers were used for PCR to generate T7 polymerase template for probe.

Transgene Construct (pGLB25'3'LacZloxpCNS)
This plasmid contains in order, the BMP2 distal promoter region (nt –1,237 to 471), the lacZ gene, a loxP site, BMP2 3'-UTR with the most highly conserved region (nt 9,392–10,200), another loxP site, BMP2 3'-UTR with poly(A) sites and downstream sequence (nt 10,200–11,444). Plasmid pBSB2–3'-UTR (35) was digested with PstI to remove nt 10,200–11,444, and then religated to create pBSB2–3'-UTR{Delta}Pst. Nucleotides 9,392–10,200 of BMP2 were removed by digesting this plasmid with SacI, and then blunted and then digested with EcoRI. pLoxp3'-UTR was created by inserting this 817-bp fragment into pGKLoxp, which had been digested with HindIII, blunted, and then digested with EcoRI. pGL1.7XX{Delta}SacI was digested with KpnI and XhoI to release a 1712-bp BMP2 promoter-containing fragment. This was used to replace the promoter-containing KpnI and XhoI fragment in pGLB25'3'. This created pGLB25'3'{Delta}SacI, which is identical with pGLB25'3' except the SacI site in the polylinker was deleted. pLoxp3'-UTR was digested with PacI and blunted. This 885-bp fragment containing nt 9,392–10,200 flanked by LoxP sites was inserted into pGLB25'3'{Delta}SacI digested with PstI and SacI (blunted) to create pGLB25'3'{Delta}Sac loxpCNS. The lacZ-containing plasmid, pBI-3 (109) was digested with XbaI, partially filled in with Klenow in presence of dTTP and dCTP, and then digested with XmnI, yielding a 3155-bp fragment containing the lacZ gene fused in-frame with a nuclear localization signal. pGLB25'3'{Delta}Sac loxpCNS was digested with HindIII, partially filled in with Klenow in presence of dATP and dGTP, and EcoNI (blunted), and the 7949-bp fragment containing the BMP2 promoter and 3'-UTR regions without luciferase was isolated. The lacZ fragment was inserted to create pGLB25'3'LacZloxpCNS in which the HindIII, XbaI, XmnI, and EcoNI sites were destroyed.

Transgenic Mice
All animals were handled in accordance with the Guidelines for Care and Use of Experimental Animals and approved by the New Jersey Medical School Institutional Animal Care and Use Committee (protocol nos. 04086 and 00100). The transgene construct pGLB25'3'LacZloxpCNS was digested with SalI and KpnI to remove all but 24 bp of vector sequence. Linearized DNA fragment was microinjected into oocytes in University of Medicine and Dentistry of New Jersey-New Jersey Medical School transgenic/knockout facility (Dr. Carlos Molina, director). The ß-gal expression pattern of the reporter gene in transgenic mice was detected by X-Gal staining (110).

F9 cell culture, differentiation, and transfection have been described in Refs. 37 and 111 .

In Vitro Stability Measurements
After linearization, plasmids were transcribed with SP6 RNA polymerase with 7meGpppG and {alpha}32P-UTP (70, 79, 112). Capped and labeled RNAs were incubated in S18 cytoplasmic extracts as described in Refs. 67, 68, 70 , and 79 . RNAs and degradation products were visualized and quantified on an 8 M urea-containing 5% polyacrylamide (37.5:1, acrylamide:bis-acrylamide) gel (67, 68) using a Molecular Dynamics (Sunnyvale, CA) PhosphorImager and ImageQuant software.

UV Cross-Linking Reactions
UV cross-linking analysis was performed essentially as described (113). Briefly, 20–50 fmol of radiolabeled RNA was incubated in the cell extract under in vitro decay assay conditions for 10 min at 37 C. EDTA was added to a concentration of 1 mM to prevent RNA decay while proteins bound to the RNA. The reaction mixtures were irradiated with UV light for 10 min using a 15-W germicidal lamp at 2 µJ/sec at room temperature. A total of 100 ng of RNase A was added and incubated for 15 min at 37 C to degrade the labeled RNA. Labeled proteins were solubilized by heating at 95 C for 5 min in 8% glycerol, 1.0% SDS, 75 mM dithiothreitol, 0.05% Bromophenol Blue, 62.5 mM Tris (pH 6.8), analyzed on a 10% polyacrylamide gel (37.5:1, acrylamide:bis-acrylamide) in running buffer (192 mM glycine, 25 mM Tris-HCl, 0.1% SDS), and quantified as above.

EMSAs
Binding reactions contained 1 mM spermidine, 2 µg of poly(A), 50 fmol of capped and 32P-labeled RNA probe, 8 µl of cell extract, and 1 mM EDTA (to prevent RNA decay) in a final volume of 10 µl. All components were incubated at room temperature for 10 min. After adding glycerol to a final concentration of 30%, reactions were loaded on 4.5% nondenaturing polyacrylamide gels containing 1x Tris-borate EDTA, and electrophoresed at 200 V, constant voltage.


    ACKNOWLEDGMENTS
 
We thank Drs. Carol Lutz from University of Medicine and Dentistry of New Jersey-New Jersey Medical School (Newark, NJ) and Jeff Wilusz from Colorado State University (Fort Collins, CO) for critical discussions and advice. We appreciate the technical assistance of Dr. Minzhen He.


    FOOTNOTES
 
This work was supported in part by the Molecular Resource Facility at the University of Medicine and Dentistry of New Jersey-New Jersey Medical School, by National Institute of Child Health and Human Development Grant HD31117, and by grants from the Foundation of the University of Medicine and Dentistry of New Jersey.

D.T.F., S.J., J.X., and M.B.R. have nothing to declare.

First Published Online February 23, 2006

1 D.T.F. and S.J. contributed equally to this work. Back

Abbreviations: ARE, AU-rich element; BMP, bone morphogenetic protein; nt, nucleotide; oligo, oligonucleotide; RA, retinoic acid; RNase, ribonuclease; SNP, single nucleotide polymorphism; SV40, simian virus 40; TTP, tristetraproline; UTR, untranslated region.

Received for publication November 23, 2005. Accepted for publication February 14, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 BMP2 and Osteoporosis
 Numerous Mechanisms Modulate BMP...
 BMP2 Single Nucleotide...
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Reddi AH 2001 Bone morphogenetic proteins: from basic science to clinical applications. J Bone Joint Surg Am 83-A:S1–S6
  2. Urist M 1965 Bone: formation by autoinduction. Science 150:893–899[Abstract/Free Full Text]
  3. Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM, Wang EA. 1988 Novel regulators of bone formation: molecular clones and activities. Science 242:1528–1534[Abstract/Free Full Text]
  4. Hogan B 1996 Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10:1580–1594[Free Full Text]
  5. Vainio S, Karavanova I, Jowett A, Thesleff I 1993 Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development. Cell 75:45–58[CrossRef][Medline]
  6. Glozak MA, Rogers MB 1996 Specific induction of apoptosis in P19 embryonal carcinoma cells by retinoic acid and BMP2 or BMP4. Dev Biol 179:458–470[CrossRef][Medline]
  7. Graham A, Francis-West P, Brickell P, Lumsden A 1994 The signalling molecule BMP4 mediates apoptosis in the rhombencephalic neural crest. Nature 372:684–686[CrossRef][Medline]
  8. Vaahtokari A, Aberg T, Thesleff I 1996 Apoptosis in the developing tooth: association with an embryonic signaling center and suppression by EGF and FGF-4. Development 122:121–129[Abstract]
  9. Zou H, Niswander L 1996 Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272:738–741[Abstract]
  10. Graff J 1997 Embryonic patterning: to BMP or not to BMP, that is the question. Cell 89:171–174[CrossRef][Medline]
  11. Winnier G, Blessing M, Labosky PA, Hogan BL 1995 Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev 9:2105–2116[Abstract/Free Full Text]
  12. Zhang H, Bradley A 1996 Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development. Development 122:2977–2986[Abstract]
  13. Yi SE, Daluiski A, Pederson R, Rosen V, Lyons KM 2000 The type I BMP receptor BMPRIB is required for chondrogenesis in the mouse limb. Development 127:621–630[Abstract]
  14. Mishina Y, Suzuki A, Ueno N, Behringer RR 1995 Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev 9:3027–3037[Abstract/Free Full Text]
  15. Beppu H, Kawabata M, Hamamoto T, Chytil A, Minowa O, Noda T, Miyazono K 2000 BMP type II receptor is required for gastrulation and early development of mouse embryos. Dev Biol 221:249–258[CrossRef][Medline]
  16. Baur ST, Mai JJ, Dymecki SM 2000 Combinatorial signaling through BMP receptor IB and GDF5: shaping of the distal mouse limb and the genetics of distal limb diversity. Development 127:605–619[Abstract]
  17. Chang H, Huylebroeck D, Verschueren K, Guo Q, Matzuk MM, Zwijsen A 1999 Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 126:1631–1642[Abstract]
  18. Sirard C, de la Pompa JL, Elia A, Itie A, Mirtsos C, Cheung A, Hahn S, Wakeham A, Schwartz L, Kern SE, Rossant J, Mak TW 1998 The tumor suppressor gene Smad4/Dpc4 is required for gastrulation and later for anterior development of the mouse embryo. Genes Dev 12:107–119[Abstract/Free Full Text]
  19. Tremblay KD, Dunn NR, Robertson EJ 2001 Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development 128:3609–3621[Medline]
  20. Yang X, Li C, Xu X, Deng C 1998 The tumor suppressor SMAD4/DPC4 is essential for epiblast proliferation and mesoderm induction in mice. Proc Natl Acad Sci USA 95:3667–3672[Abstract/Free Full Text]
  21. Yang X, Castilla LH, Xu X, Li C, Gotay J, Weinstein M, Liu PP, Deng CX 1999 Angiogenesis defects and mesenchymal apoptosis in mice lacking SMAD5. Development 126:1571–1580[Abstract]
  22. Styrkarsdottir U, Cazier JB, Kong A, Rolfsson O, Larsen H, Bjarnadottir E, Johannsdottir VD, Sigurdardottir MS, Bagger Y, Christiansen C, Reynisdottir I, Grant SF, Jonasson K, Frigge ML, Gulcher JR, Sigurdsson G, Stefansson K 2003 Linkage of osteoporosis to chromosome 20p12 and association to BMP2. PLoS Biol 1:E69
  23. Reneland RH, Mah S, Kammerer S, Hoyal CR, Marnellos G, Wilson SG, Sambrook PN, Spector TD, Nelson MR, Braun A 2005 Association between a variation in the phosphodiesterase 4D gene and bone mineral density. BMC Med Genet 6:9[CrossRef][Medline]
  24. Turgeman G, Zilberman Y, Zhou S, Kelly P, Moutsatsos IK, Kharode YP, Borella LE, Bex FJ, Komm BS, Bodine PV, Gazit D 2002 Systemically administered rhBMP-2 promotes MSC activity and reverses bone and cartilage loss in osteopenic mice. J Cell Biochem 86:461–474[CrossRef][Medline]
  25. Valdes AM, Hart DJ, Jones KA, Surdulescu G, Swarbrick P, Doyle DV, Schafer AJ, Spector TD 2004 Association study of candidate genes for the prevalence and progression of knee osteoarthritis. Arthritis Rheum 50:2497–2507[CrossRef][Medline]
  26. Marcelino J, Sciortino CM, Romero MF, Ulatowski LM, Ballock RT, Economides AN, Eimon PM, Harland RM, Warman ML 2001 Human disease-causing NOG missense mutations: effects on noggin secretion, dimer formation, and bone morphogenetic protein binding. Proc Natl Acad Sci USA 98:11353–11358[Abstract/Free Full Text]
  27. Gong Y, Krakow D, Marcelino J, Wilkin D, Chitayat D, Babul-Hirji R, Hudgins L, Cremers CW, Cremers FP, Brunner HG, Reinker K, Rimoin DL, Cohn DH, Goodman FR, Reardon W, Patton M, Francomano CA, Warman ML 1999 Heterozygous mutations in the gene encoding noggin affect human joint morphogenesis. Nat Genet 21:302–304[CrossRef][Medline]
  28. Shafritz AB, Shore EM, Gannon FH, Zasloff MA, Taub R, Muenke M, Kaplan FS 1996 Overexpression of an osteogeneic morphogen in fibrodysplasia ossificans progressiva. N Engl J Med 335:555–561[Abstract/Free Full Text]
  29. Mishina Y, Starbuck MW, Gentile MA, Mishina Y, Starbuck MW, Gentile MA, Fukuda T, Kasparcova V, Seedor JG, Hanks MC, Amling M, Pinero GJ, Harada S, Behringer RR 2004 Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem 279:27560–27566[Abstract/Free Full Text]
  30. Devlin RD, Du Z, Pereira RC, Kimble RB, Economides AN, Jorgetti V, Canalis E 2003 Skeletal overexpression of noggin results in osteopenia and reduced bone formation. Endocrinology 144:1972–1978[Abstract/Free Full Text]
  31. Wu XB, Li Y, Schneider A, Yu W, Rajendren G, Iqbal J, Yamamoto M, Alam M, Brunet LJ, Blair HC, Zaidi M, Abe E 2003 Impaired osteoblastic differentiation, reduced bone formation, and severe osteoporosis in noggin-overexpressing mice. J Clin Invest 112:924–934[CrossRef][Medline]
  32. Zhao M, Harris SE, Horn D, Geng Z, Nishimura R, Mundy GR, Chen D 2002 Bone morphogenetic protein receptor signaling is necessary for normal murine postnatal bone formation. J Cell Biol 157:1049–1060[Abstract/Free Full Text]
  33. Chen D, Zhao M, Mundy GR 2004 Bone morphogenetic proteins. Growth Factors 22:233–241[CrossRef][Medline]
  34. Usui M, Yoshida Y, Tsuji K, Oikawa K, Miyazono K, Ishikawa I, Yamamoto T, Nifuji A, Noda M 2004 Tob deficiency superenhances osteoblastic activity after ovariectomy to block estrogen deficiency-induced osteoporosis. Proc Natl Acad Sci USA 101:6653–6658[Abstract/Free Full Text]
  35. Fritz DT, Liu D, Xu J, Jiang S, Rogers MB 2004 Conservation of Bmp2 post-transcriptional regulatory mechanisms. J Biol Chem 279:48950–48958[Abstract/Free Full Text]
  36. Heller LC, Li Y, Abrams KA, Rogers MB 1999 Transcriptional regulation of the Bmp2 gene: retinoic acid induction in F9 embryonal carcinoma cells and Saccharomyces cerevisiae. J Biol Chem 274:1394–1400[Abstract/Free Full Text]
  37. Abrams KL, Xu J, Nativelle-Serpentini C, Dabirshahsahebi S, Rogers MB 2004 An evolutionary and molecular analysis of Bmp2 expression. J Biol Chem 279:15916–15928[Abstract/Free Full Text]
  38. Feng J, Harris M, Ghosh-Choudhury N, Feng M, Mundy G, Harris S 1994 Structure and sequence of mouse bone morphogenetic protein-2 gene (BMP-2): comparison of the structures and promoter regions of BMP2- and BMP-4 genes. Biochim Biophys Acta 1218:221–224[Medline]
  39. Feng JQ, Chen D, Ghosh-Choudhury N, Esparza J, Mundy GR, Harris SE 1997 Bone morphogenetic protein 2 transcripts in rapidly developing deer antler tissue contain an extended 5' non-coding region arising from a distal promoter. Biochim Biophys Acta 1350:47–52[Medline]
  40. Helvering LM, Sharp RL, Ou X, Geiser AG 2000 Regulation of the promoters for the human bone morphogenetic protein 2 and 4 genes. Gene 256:123–138[CrossRef][Medline]
  41. Ghosh-Choudhury N, Abboud SL, Mahimainathan L, Chandrasekar B, Choudhury GG 2003 Phosphatidylinositol 3-kinase regulates bone morphogenetic protein-2 (BMP-2)-induced myocyte enhancer factor 2A-dependent transcription of BMP-2 gene in cardiomyocyte precursor cells. J Biol Chem 278:21998–22005[Abstract/Free Full Text]
  42. Ghosh-Choudhury N, Choudhury GG, Harris MA, Wozney J, Mundy GR, Abboud SL, Harris SE 2001 Autoregulation of mouse BMP-2 gene transcription is directed by the proximal promoter element. Biochem Biophys Res Commun 286:101–108[CrossRef][Medline]
  43. Canalis E, Economides AN, Gazzerro E 2003 Bone morphogenetic proteins, their antagonists, and the skeleton. Endocr Rev 24:218–235[Abstract/Free Full Text]
  44. Miyazono K 2000 Positive and negative regulation of TGF-ß signaling. J Cell Sci 113:1101–1109[Abstract]
  45. Merino R, Rodriguez-Leon J, Macias D, Ganan Y, Economides AN, Hurle JM 1999 The BMP antagonist gremlin regulates outgrowth, chondrogenesis and programmed cell death in the developing limb. Development 126:5515–5522[Abstract]
  46. Kakoki M, Tsai YS, Kim HS, Hatada S, Ciavatta DJ, Takahashi N, Arnold LW, Maeda N, Smithies O 2004 Altering the expression in mice of genes by modifying their 3' regions. Dev Cell 6:597–606[CrossRef][Medline]
  47. Dermitzakis ET, Kirkness E, Schwarz S, Birney E, Reymond A, Antonarakis SE 2004 Comparison of human chromosome 21 conserved nongenic sequences (CNGs) with the mouse and dog genomes shows that their selective constraint is independent of their genic environment. Genome Res 14:852–859[Abstract/Free Full Text]
  48. Dermitzakis ET, Reymond A, Lyle R, Scamuffa N, Ucla C, Deutsch S, Stevenson BJ, Flegel V, Bucher P, Jongeneel CV, Antonarakis SE 2002 Numerous potentially functional but non-genic conserved sequences on human chromosome 21. Nature 420:578–582[CrossRef][Medline]
  49. Strickland S, Mahdavi V 1978 The induction of differentiation in teratocarcinoma stem cells by retinoic acid. Cell 15:393–403[CrossRef][Medline]
  50. Strickland S, Smith KK, Marotti KR 1980 Hormonal induction of differentiation in teratocarcinoma stem cells: generation of parietal endoderm by retinoic acid and dibutyryl cAMP. Cell 21:347–355[CrossRef][Medline]
  51. Rogers MB, Rosen V, Wozney JM, Gudas LJ 1992 Bone morphogenetic proteins-2 and 4 are involved in the retinoic acid-induced differentiation of embryonal carcinoma cells. Mol Biol Cell 3:189–196[Abstract]
  52. Rogers M 1996 Receptor-selective retinoids implicate RAR {alpha} and {gamma} in the regulation of bmp-2 and bmp-4 in F9 embryonal carcinoma cells. Cell Growth Differ 7:115–122[Abstract]
  53. Hogan B, Beddington R, Constantini F, Lacy E 1994 Manipulating the mouse embryo, a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
  54. Lyons K, Pelton R, Hogan B 1989 Patterns of expression of murine Vgr-1 and BMP-2a RNA suggest that transforming growth factor-ß-like genes coordinately regulate aspects of embryonic development. Genes Dev 3:1657–1668[Abstract/Free Full Text]
  55. Lyons KM, Pelton RW, Hogan BLM 1990 Organogenesis and pattern formation in the mouse: RNA distribution patterns suggest a role for Bone Morphogenetic Protein-2A (BMP-2A). Development 109:833–844[Abstract/Free Full Text]
  56. Jones CM, Lyons KM, Hogan BLM 1991 Involvement of Bone Morphogenetic Protein-4 (BMP-4) and Vgr-1 in morphogenesis and neurogenesis in the mouse. Development 111:531–542[Abstract]
  57. Bitgood MJ, McMahon AP 1995 Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol 172:126–138[CrossRef][Medline]
  58. Furuta Y, Piston DW, Hogan BL 1997 Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development 124:2203–2212[Abstract]
  59. Dudley AT, Robertson EJ 1997 Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev Dyn 208:349–362[CrossRef][Medline]
  60. Jin Y, Lu HB, Liong E, Lau TY, Tipoe GL 2001 Transcriptional mRNA of BMP-2, 3, 4, and 5 in trigeminal nerve, benign and malignant peripheral nerve sheath tumors. Histol Histopathol 16:1013–1019[Medline]
  61. Belecky-Adams T, Adler R 2001 Developmental expression patterns of bone morphogenetic proteins, receptors, and binding proteins in the chick retina. J Comp Neurol 430:562–572[CrossRef][Medline]
  62. Feng JQ, Xing L, Zhang JH, Zhao M, Horn D, Chan J, Boyce BF, Harris SE, Mundy GR, Chen D 2003 NF-{kappa}B specifically activates BMP-2 gene expression in growth plate chondrocytes in vivo and in a chondrocyte cell line in vitro. J Biol Chem 278:29130–29135[Abstract/Free Full Text]
  63. Wilusz CJ, Wormington M, Peltz SW 2001 The cap-to-tail guide to mRNA turnover. Nat Rev Mol Cell Biol 2:237–246[CrossRef][Medline]
  64. Wilusz CJ, Wilusz J 2004 Bringing the role of mRNA decay in the control of gene expression into focus. Trends Genet 20:491–497[CrossRef][Medline]
  65. Bakheet T, Williams BR, Khabar KS 2003 ARED 2.0: an update of AU-rich element mRNA database. Nucleic Acids Res 31:421–423[Abstract/Free Full Text]
  66. Khabar KS, Dhalla M, Al-Haj L, Bakheet T, Sy C, Naemmuddin M 2004 Selection of AU-rich transiently expressed sequences: reversal of cDNA abundance. RNA 10:747–753[Abstract/Free Full Text]
  67. Fritz DT, Ford LP, Wilusz J 2000 An in vitro assay to study regulated mRNA stability. Sci STKE 2000:PL1
  68. Mukherjee D, Fritz DT, Kilpatrick WJ, Gao M, Wilusz J 2004 Analysis of RNA exonucleolytic activities in cellular extracts. Methods Mol Biol 257:193–212[Medline]
  69. Fritz DT, Bergman N, Kilpatrick WJ, Wilusz CJ, Wilusz J 2004 Messenger RNA decay in mammalian cells: the exonuclease perspective. Cell Biochem Biophys 41:265–278[CrossRef][Medline]
  70. Ford LP, Wilusz J 1999 An in vitro system using HeLa cytoplasmic extracts that reproduces regulated mRNA stability. Methods 17:21–27[CrossRef][Medline]
  71. Ford LP, Watson J, Keene JD, Wilusz J 1999 ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system. Genes Dev 13:188–201[Abstract/Free Full Text]
  72. Laroia G, Cuesta R, Brewer G, Schneider RJ 1999 Control of mRNA decay by heat shock-ubiquitin-proteasome pathway. Science 284:499–502[Abstract/Free Full Text]
  73. Sarkar B, Xi Q, He C, Schneider RJ 2003 Selective degradation of AU-rich mRNAs promoted by the p37 AUF1 protein isoform. Mol Cell Biol 23:6685–6693[Abstract/Free Full Text]
  74. Wagner BJ, DeMaria CT, Sun Y, Wilson GM, Brewer G 1998 Structure and genomic organization of the human AUF1 gene: alternative pre-mRNA splicing generates four protein isoforms. Genomics 48:195–202[CrossRef][Medline]
  75. Raineri I, Wegmueller D, Gross B, Certa U, Moroni C 2004 Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference. Nucleic Acids Res 32:1279–1288[Abstract/Free Full Text]
  76. Lai WS, Carballo E, Strum JR, Kennington EA, Phillips RS, Blackshear PJ 1999 Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor {alpha} mRNA. Mol Cell Biol 19:4311–4323[Abstract/Free Full Text]
  77. Blackshear PJ 2002 Tristetraprolin and other CCCH tandem zinc-finger proteins in the regulation of mRNA turnover. Biochem Soc Trans 30:945–952[CrossRef][Medline]
  78. Carballo E, Lai WS, Blackshear PJ 1998 Feedback inhibition of macrophage tumor necrosis factor-{alpha} production by tristetraprolin. Science 281:1001–1005[Abstract/Free Full Text]
  79. Mukherjee D, Gao M, O’Connor JP, Raijmakers R, Pruijn G, Lutz CS, Wilusz J 2002 The mammalian exosome mediates the efficient degradation of mRNAs that contain AU-rich elements. EMBO J 21:165–174[CrossRef][Medline]
  80. Lutz CS, Alwine JC 1994 Direct interaction of the U1 snRNP-A protein with the upstream efficiency element of the SV40 late polyadenylation signal. Genes Dev 8:576–586[Abstract/Free Full Text]
  81. Adams DJ, Beveridge DJ, van der Weyden L, Mangs H, Leedman PJ, Morris BJ 2003 HADHB, HuR, and CP1 bind to the distal 3'-untranslated region of human renin mRNA and differentially modulate renin expression. J Biol Chem 278:44894–44903[Abstract/Free Full Text]
  82. Tran H, Maurer F, Nagamine Y 2003 Stabilization of urokinase and urokinase receptor mRNAs by HuR is linked to its cytoplasmic accumulation induced by activated mitogen-activated protein kinase-activated protein kinase 2. Mol Cell Biol 23:7177–7188[Abstract/Free Full Text]
  83. Tran H, Schilling M, Wirbelauer C, Hess D, Nagamine Y 2004 Facilitation of mRNA deadenylation and decay by the exosome-bound, DExH protein RHAU. Mol Cell 13:101–111[CrossRef][Medline]
  84. Raghavan A, Robison RL, McNabb J, Miller CR, Williams DA, Bohjanen PR 2001 HuA and tristetraprolin are induced following T cell activation and display distinct but overlapping RNA binding specificities. J Biol Chem 276:47958–47965[Abstract/Free Full Text]
  85. Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL, Gorospe M 2004 Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J 23:3092–3102[CrossRef][Medline]
  86. Linker K, Pautz A, Fechir M, Hubrich T, Greeve J, Kleinert H 2005 Involvement of KSRP in the post-transcriptional regulation of human iNOS expression-complex interplay of KSRP with TTP and HuR. Nucleic Acids Res 33:4813–4827[Abstract/Free Full Text]
  87. Ralston SH 2003 Genetic determinants of susceptibility to osteoporosis. Curr Opin Pharmacol 3:286–290[CrossRef][Medline]
  88. Ralston SH 2002 Genetic control of susceptibility to osteoporosis. J Clin Endocrinol Metab 87:2460–2466[Abstract/Free Full Text]
  89. Fan XC, Steitz JA 1998 Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J 17:3448–3460[CrossRef][Medline]
  90. Keene JD 1999 Why is Hu where? Shuttling of early-response-gene messenger RNA subsets. Proc Natl Acad Sci USA 96:5–7[Free Full Text]
  91. Keene JD 2001 Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc Natl Acad Sci USA 98:7018–7024[Abstract/Free Full Text]
  92. Peng SS, Chen CY, Xu N, Shyu AB 1998 RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J 17:3461–3470[CrossRef][Medline]
  93. van der Giessen K, Di-Marco S, Clair E, Gallouzi IE 2003 RNAi-mediated HuR depletion leads to the inhibition of muscle cell differentiation. J Biol Chem 278:47119–47128[Abstract/Free Full Text]
  94. McMullen MR, Cocuzzi E, Hatzoglou M, Nagy LE 2003 Chronic ethanol exposure increases the binding of HuR to the TNF{alpha} 3'-untranslated region in macrophages. J Biol Chem 278:38333–38341[Abstract/Free Full Text]
  95. Loflin P, Chen CY, Shyu AB 1999 Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element. Genes Dev 13:1884–1897[Abstract/Free Full Text]
  96. Fukui N, Zhu Y, Maloney WJ, Clohisy J, Sandell LJ 2003 Stimulation of BMP-2 expression by pro-inflammatory cytokines IL-1 and TNF-{alpha} in normal and osteoarthritic chondrocytes. J Bone Joint Surg Am 85-A(Suppl 3):59–66
  97. Lories RJ, Derese I, Ceuppens JL, Luyten FP 2003 Bone morphogenetic proteins 2 and 6, expressed in arthritic synovium, are regulated by proinflammatory cytokines and differentially modulate fibroblast-like synoviocyte apoptosis. Arthritis Rheum 48:2807–2818[CrossRef][Medline]
  98. Langenfeld EM, Calvano SE, Abou-Nukta F, Lowry SF, Amenta P, Langenfeld J 2003 The mature bone morphogenetic protein-2 is aberrantly expressed in non-small cell lung carcinomas and stimulates tumor growth of A549 cells. Carcinogenesis 24:1445–1454[Abstract/Free Full Text]
  99. Horvath LG, Henshall SM, Kench JG, Turner JJ, Golovsky D, Brenner PC, O’Neill GF, Kooner R, Stricker PD, Grygiel JJ, Sutherland RL 2004 Loss of BMP2, Smad8, and Smad4 expression in prostate cancer progression. Prostate 59:234–242[CrossRef][Medline]
  100. Kleeff J, Maruyama H, Ishiwata T, Sawhney H, Friess H, Buchler MW, Korc M 1999 Bone morphogenetic protein 2 exerts diverse effects on cell growth in vitro and is expressed in human pancreatic cancer in vivo. Gastroenterology 116:1202–1216[CrossRef][Medline]
  101. Hardwick JC, Van Den Brink GR, Bleuming SA, Ballester I, Van Den Brande JM, Keller JJ, Offerhaus GJ, Van Deventer SJ, Peppelenbosch MP 2004 Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. Gastroenterology 126:111–121[CrossRef]
  102. Reinholz MM, Iturria SJ, Ingle JN, Roche PC 2002 Differential gene expression of TGF-ß family members and osteopontin in breast tumor tissue: analysis by real-time quantitative PCR. Breast Cancer Res Treat 74:255–269[CrossRef][Medline]
  103. Harris SE, Harris MA, Mahy P, Wozney J, Feng JQ, Mundy GR 1994 Expression of bone morphogenetic protein messenger RNAs by normal rat and human prostate and prostate cancer cells. Prostate 24:204–211[Medline]
  104. Coucouvanis E, Martin GR 1999 BMP signaling plays a role in visceral endoderm differentiation and cavitation in the early mouse embryo. Development 126:535–546[Abstract]
  105. Rodriguez-Leon J, Merino R, Macias D, Ganan Y, Santesteban E, Hurle JM 1999 Retinoic acid regulates programmed cell death through BMP signalling. Nat Cell Biol 1:125–126[CrossRef][Medline]
  106. Zhang S, Fantozzi I, Tigno DD, Yi ES, Platoshyn O, Thistlethwaite PA, Kriett JM, Yung G, Rubin LJ, Yuan JX 2003 Bone morphogenetic proteins induce apoptosis in human pulmonary vascular smooth muscle cells. Am J Physiol 285:L740–L754
  107. Hallahan AR, Pritchard JI, Chandraratna RA, Ellenbogen RG, Geyer JR, Overland RP, Strand AD, Tapscott SJ, Olson JM 2003 BMP-2 mediates retinoid-induced apoptosis in medulloblastoma cells through a paracrine effect. Nat Med 9:1033–1038[CrossRef][Medline]
  108. Kawamura C, Kizaki M, Yamato K, Uchida H, Fukuchi Y, Hattori Y, Koseki T, Nishihara T, Ikeda Y 2000 Bone morphogenetic protein-2 induces apoptosis in human myeloma cells with modulation of STAT3. Blood 96:2005–2011[Abstract/Free Full Text]
  109. Baron U, Freundlieb S, Gossen M, Bujard H 1995 Co-regulation of two gene activities by tetracycline via a bidirectional promoter. Nucleic Acids Res 23:3605–3606[Free Full Text]
  110. Agah R, Frenkel PA, French BA, Michael LH, Overbeek PA, Schneider MD 1997 Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. J Clin Invest 100:169–179[Medline]
  111. Vasios GW, Gold JD, Petkovich M, Chambon P, Gudas LJ 1989 A retinoic acid-responsive element is present in the 5' flanking region of the laminin B1 gene. Proc Natl Acad Sci USA 86:9099–9103[Abstract/Free Full Text]
  112. Natalizio BJ, Muniz LC, Arhin GK, Wilusz J, Lutz CS 2002 Upstream elements present in the 3'-untranslated region of collagen genes influence the processing efficiency of overlapping polyadenylation signals. J Biol Chem 277:42733–42740[Abstract/Free Full Text]
  113. Wilusz J, Shenk T 1988 A 64 kd nuclear protein binds to RNA segments that include the AAUAAA polyadenylation motif. Cell 52:221–228[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. Liu, D. T. Fritz, M. B. Rogers, and A. J. Shatkin
Species-specific cis-Regulatory Elements in the 3'-Untranslated Region Direct Alternative Polyadenylation of Bone Morphogenetic Protein 2 mRNA
J. Biol. Chem., October 17, 2008; 283(42): 28010 - 28019.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals